Downregulation of ENPP4 Is Associated with Poor Prognosis and Enhanced Malignant Phenotypes in Clear Cell Renal Cell Carcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Downregulation of ENPP4 Is Associated with Poor Prognosis and Enhanced Malignant Phenotypes in Clear Cell Renal Cell Carcinoma Wenjie Yang, Chenxi Li, Yuheng Niu, Xin Jiang, Zhifang Ma This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8769917/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Background: Clear cell renal cell carcinoma (ccRCC) is the most prevalent and aggressive subtype of renal cell carcinoma, characterized by high recurrence rates and unfavorable prognosis. Identification of novel molecular biomarkers is crucial for improving prognostic stratification and therapeutic decision-making. Ectonucleotide pyrophosphatase/phosphodiesterase 4 (ENPP4), a member of the ENPP family, has been implicated in immune regulation and tumor biology; however, its role in ccRCC remains largely unexplored. Methods: Transcriptomic data and corresponding clinical information of ccRCC patients were obtained from The Cancer Genome Atlas (TCGA). Differential expression analyses, survival analyses, and univariate and multivariate Cox regression models were performed to evaluate the prognostic significance of ENPP4. An ENPP4-associated risk stratification model was constructed to visualize survival differences. ENPP4 expression was further validated in clinical ccRCC tissues and matched adjacent normal tissues using quantitative real-time PCR and Western blot analysis. Functional assays were conducted in ccRCC cell lines (786-O, A498, and ACHN) following shRNA-mediated ENPP4 knockdown to assess cell proliferation, migration, and invasion. Results: ENPP4 expression was significantly downregulated in ccRCC tissues compared with normal renal tissues at both the mRNA and protein levels. Low ENPP4 expression was associated with advanced tumor stage and significantly poorer overall survival. Multivariate Cox regression analysis identified ENPP4 as an independent prognostic factor in ccRCC. Risk stratification analyses further demonstrated a close association between reduced ENPP4 expression, elevated risk scores, and unfavorable survival outcomes. Functional experiments revealed that ENPP4 knockdown markedly enhanced ccRCC cell proliferation, migration, and invasion. Conclusion: Our findings indicate that ENPP4 is frequently downregulated in ccRCC and that its low expression is associated with aggressive tumor behavior and poor prognosis. ENPP4 may function as a tumor suppressor and serve as a potential prognostic biomarker, providing new insights into molecular stratification and personalized management of ccRCC. Health sciences/Biomarkers Biological sciences/Cancer Biological sciences/Computational biology and bioinformatics Health sciences/Oncology clear cell renal cell carcinoma ENPP4 prognostic biomarker tumor progression The Cancer Genome Atlas Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Renal cell carcinoma (RCC) is one of the most common malignant tumors of the urinary system worldwide, and its incidence has shown a continuous upward trend over the past several decades. It is estimated that more than 430,000 new cases of kidney cancer are diagnosed globally each year, with nearly 18 0,000 associated deaths ( 1 ). Epidemiological evidence shows that the incidence of renal cancer has steadily increased worldwide over the past decades ( 2 ), posing a substantial challenge to public health systems and cancer prevention and control strategies. From a pathological perspective, RCC can be classified into several histological subtypes, including clear cell carcinoma, papillary carcinoma, chromophobe carcinoma, and collecting duct carcinoma. Among these, clear cell renal cell carcinoma (ccRCC) accounts for approximately 70%–80% of all renal cancers and represents the most prevalent subtype with the most aggressive biological behavior ( 3 ). ccRCC exhibits poor sensitivity to conventional radiotherapy and chemotherapy, and surgical resection remains the primary treatment option for patients with early-stage disease ( 4 ). Nevertheless, approximately 20%–30% of patients experience local recurrence or distant metastasis after surgery, and the risk of recurrence remains substantial even following radical nephrectomy ( 5 ). Recurrence most frequently involves vital organs such as the lungs, bones, liver, and brain, and is often indicative of rapid disease progression and an unfavorable prognosis ( 6 ). For patients with advanced or recurrent ccRCC, systemic therapy constitutes the mainstay of treatment. Over the past decade, molecular targeted therapies, including vascular endothelial growth factor (VEGF) inhibitors and mammalian target of rapamycin (mTOR) inhibitors, have significantly prolonged progression-free survival. However, due to pronounced tumor heterogeneity and the emergence of drug resistance mechanisms, the durability of therapeutic responses remains limited ( 7 ). In recent years, immune checkpoint inhibitors (ICIs) have introduced new therapeutic prospects for ccRCC ( 8 ). Given the challenges associated with early diagnosis, high postoperative recurrence rates, and complex resistance mechanisms in ccRCC, in-depth investigation of its molecular mechanisms and tumor immune microenvironment is of critical importance for the identification of novel therapeutic targets and the optimization of personalized treatment strategies. Such studies may not only contribute to improvements in overall survival but also provide new insights into the management of disease recurrence and metastasis. Ectonucleotide pyrophosphatase/phosphodiesterase 4 (ENPP4) is a transmembrane glycoprotein encoded by the ENPP4 gene and is a member of the ENPP family. Members of this family play crucial roles in the hydrolysis of extracellular nucleotides, signal transduction, immune regulation, and cell proliferation ( 9 ). Accumulating evidence has demonstrated that multiple ENPP family members are closely associated with tumor initiation and progression. For instance, ENPP1 has been implicated in the development and progression of various malignancies, including pancreatic cancer, breast cancer, gallbladder cancer, and colorectal cancer ( 10 ); ENPP2, also known as autotaxin, contributes to tumor cell migration and angiogenesis by promoting the production of lysophosphatidic acid (LPA) ( 11 ). In contrast to these well-studied members, ENPP4 has received relatively limited attention in oncology, and its biological functions have not yet been fully elucidated. Experimental evidence indicates that recombinant ENPP4 protein dose-dependently inhibits the proliferation of MCA207 cells in vitro, while blockade of ENPP4 on the surface of BCG-activated macrophages markedly attenuates their cytotoxic activity against MCA207 cells, suggesting a critical role of ENPP4 in macrophage-mediated antitumor immunity ( 12 ). Emerging data further suggest that aberrant ENPP4 expression is associated with the development of several malignancies, including esophageal precancerous lesions and acute myeloid leukemia ( 13 , 14 ). However, studies investigating ENPP4 in the context of ccRCC remain scarce. Given the potential biological relevance of ENPP4 observed in other tumor types, we hypothesize that ENPP4 may participate in and influence the initiation and progression of ccRCC. A comprehensive investigation of ENPP4 expression patterns and underlying molecular mechanisms in ccRCC may provide a theoretical basis for the identification of novel molecular targets and the development of potential therapeutic strategies for this disease. To address this knowledge gap, we first obtained clinicopathological information and gene expression profiles of patients with ccRCC from The Cancer Genome Atlas (TCGA) database. Bioinformatic analyses were performed to evaluate the differential expression of ENPP4 between tumor tissues and adjacent normal tissues, and to explore its associations with clinicopathological characteristics (including tumor stage and grade) as well as patient prognosis. To further validate the biological role of ENPP4, tumor tissues and paired adjacent non-tumorous tissues were collected from patients with ccRCC. The mRNA and protein expression levels of ENPP4 were assessed using quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot (WB) analysis, respectively. In addition, cell proliferation and migration assays were conducted to preliminarily investigate the effects of ENPP4 expression on the proliferative and migratory capacities of ccRCC cells. Methods Data acquisition Gene expression profiles quantified as fragments per kilobase per million mapped reads (FPKM), together with corresponding clinicopathological information of patients with ccRCC, were retrieved from TCGA database ( https://portal.gdc.cancer.gov/ ). The dataset comprised a total of 614 samples, including 542 ccRCC tumor tissues and 72 matched adjacent non-tumorous tissues. Bioinformatic and statistical analyses All computational and statistical analyses were conducted using R software (version 4.4.2) in conjunction with RStudio (version 2024.04.2). To systematically evaluate the prognostic relevance of differentially expressed genes in ccRCC, TCGA-derived datasets were subjected to an integrated analytical workflow. This workflow included differential expression analysis using the Wilcoxon rank-sum test, paired differential analysis, survival analysis, correlation analyses with clinicopathological parameters, risk score construction, as well as univariate and multivariate Cox proportional hazards regression analyses. Through this stepwise screening strategy, prognostically informative biomarkers with the highest predictive value for ccRCC outcomes were identified. Clinical specimens Tumor tissues and paired adjacent non-tumorous tissues were collected from patients with ccRCC who underwent laparoscopic radical nephrectomy at the First Hospital of Shanxi Medical University. Inclusion criteria consisted of histopathologically confirmed ccRCC, absence of distant metastasis as verified by preoperative imaging and intraoperative exploration, and no prior exposure to radiotherapy, chemotherapy, or other anticancer treatments that could potentially influence gene expression or cellular function. Patients were excluded if they had concomitant malignancies, severe organ dysfunctions that might confound the results, or insufficient RNA quantity or quality due to suboptimal tissue preservation. Based on these criteria, tumor specimens from 40 ccRCC patients were ultimately included, and all samples were snap-frozen and stored under liquid nitrogen conditions. The study protocol was approved by the Ethics Committee of the First Hospital of Shanxi Medical University (Approval No. KYLL-2025-105). All procedures involving human specimens were conducted in strict accordance with the Declaration of Helsinki and relevant clinical research guidelines, ensuring full ethical compliance. Quantification of gene expression in patient samples Total RNA was isolated from freshly frozen tissue specimens using a total RNA extraction kit (Omega Bio-Tek) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Japan). Quantitative real-time PCR was performed with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus; Takara, Japan) on an Applied Biosystems 7500 Fast Real-Time PCR System. The primer sequences specific for ENPP4 were as follows: forward, 5′-GCCATCGCGATTGTTATCGG-3′; reverse, 5′-AAGCCCTAGCACATGTCACC-3′. Western blot analysis Total protein was extracted from tumor tissues and matched adjacent normal tissues and quantified prior to analysis. Equal amounts of protein (50 µg per sample) were separated by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) using 4%–12% gradient gels, followed by transfer onto nitrocellulose membranes. After blocking, membranes were incubated with a primary antibody against ENPP4, followed by incubation with corresponding secondary antibodies supplied by LI-COR Biosciences (Lincoln, NE, USA). Protein bands were visualized and quantified using the Odyssey® CLx Imaging System (LI-COR Biosciences). GAPDH was used as the internal loading control for Western blot analysis. Western blot analyses were independently repeated three times for both tumor and adjacent normal tissues. Cell culture Human ccRCC cell lines 786-O, A498, and ACHN were obtained from Genechem (Guangdong, China). 786-O and ACHN cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM), whereas A498 cells were cultured in Minimum Essential Medium (MEM). All culture media were supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin, and cells were maintained in a humidified incubator at 37°C with 5% CO₂. Establishment of stable ENPP4 knockdown cell lines Short hairpin RNA (shRNA)-expressing lentiviral vectors targeting ENPP4 were obtained from Shanghai Genechem Co., Ltd. Lentiviral transduction was performed in 786-O, A498, and ACHN cells, followed by antibiotic selection to generate stable ENPP4 knockdown cell lines. The shRNA sequences targeting ENPP4 were as follows: shENPP4-#1, GCCTGGAAGATGACATTGATT; shENPP4-#2, CCAGGTGTTCAAGATCAAGAA. Cell proliferation, migration, and invasion assays For cell proliferation assays, stable ENPP4 knockdown cells and corresponding control cells were cultured under standard conditions. Cells in the logarithmic growth phase were collected, resuspended in serum-free medium supplemented with bovine serum albumin (BSA), and adjusted to a density of approximately 5 × 10⁴ cells/mL. Cell suspensions were seeded into 6-well plates and incubated at 37°C with 5% CO₂. Cell growth was monitored and recorded at 12, 24, 36, 48, and 60 hours using an optical microscope. For migration assays, cells were serum-starved for 12–24 hours prior to experimentation. Cells were then resuspended in serum-free BSA-containing medium at a density of 2 × 10⁴ cells and seeded into the upper chambers of Transwell inserts with 8-µm pore size (24-well format; BD Biosciences). The lower chambers were filled with medium containing 10% FBS as a chemoattractant. After 24 hours of incubation, migrated cells on the lower surface of the membrane were fixed, stained, and counted under a microscope. For invasion assays, Transwell inserts were pre-coated with Matrigel (BD Biosciences, USA). A total of 2 × 10⁴ cells suspended in serum-free medium were added to the upper chamber, while medium supplemented with 10% FBS was placed in the lower chamber. After 24 hours, invaded cells were fixed, stained, and quantified. Results Tumor-suppressive role of ENPP4 in ccRCC Based on the ccRCC cohort from TCGA, this study systematically investigated the expression profile of ENPP4 in ccRCC tissues and its potential association with clinical outcomes. To determine whether ENPP4 expression differed between tumor and normal renal tissues, Wilcoxon rank-sum tests were initially performed. The results demonstrated that ENPP4 expression was significantly reduced in ccRCC tumor tissues compared with normal renal tissues (P < 0.05, Fig. 1 A). To further verify the robustness of this finding, paired analyses of tumor tissues and matched adjacent normal tissues from the same patients were conducted, which consistently confirmed a pronounced downregulation of ENPP4 in ccRCC tumors (Fig. 1 B). To elucidate the relationship between ENPP4 expression and patient survival, ccRCC patients were stratified into high- and low-expression groups using the median ENPP4 expression level as the cutoff value. Kaplan–Meier survival analysis combined with the log-rank test revealed that patients in the high ENPP4 expression group exhibited significantly longer overall survival (OS) than those in the low-expression group (P < 0.01, Fig. 1 C). Subsequently, the association between ENPP4 expression and clinicopathological characteristics, particularly tumor stage, was further explored. ENPP4 expression levels differed significantly across tumor stages, with statistically significant reductions observed between stage I and stage III, as well as stage I and stage IV disease (P < 0.05, Fig. 1 D–E). Using stage I as the reference category, odds ratio (OR) analyses were performed to evaluate the strength of the association between tumor stage and low ENPP4 expression. The results showed that ENPP4 expression was significantly lower in stage III and stage IV tumors compared with stage I tumors (both P 0.05, Table 1 ). These findings suggest that reduced ENPP4 expression may be closely associated with tumor progression, invasiveness, and metastatic potential in ccRCC. Finally, to determine whether ENPP4 expression could serve as a predictive biomarker for patient prognosis, univariate and multivariate Cox proportional hazards regression analyses were performed. Univariate Cox analysis identified ENPP4 expression status as a significant prognostic factor in ccRCC (P < 0.05, Table 2 ). Importantly, after adjusting for conventional clinicopathological variables, including age, sex, and TNM stage (T, N, and M classifications), ENPP4 expression remained independently associated with overall survival in multivariate analysis (P < 0.05, Table 3 ). These results indicate that ENPP4 may function as an independent prognostic indicator for patients with ccRCC (Fig. 1 F) (A) Differential expression of ENPP4 between tumor tissues and normal renal tissues assessed using the Wilcoxon rank-sum test; (B) Paired comparison of ENPP4 expression between tumor tissues and matched adjacent normal tissues analyzed by paired t -test; (C) Kaplan–Meier survival analysis illustrating the association between ENPP4 expression levels and overall survival in patients with ccRCC; (D, E) Correlations between ENPP4 expression and clinicopathological parameters, showing significant associations with tumor stage; (F) Multivariate Cox proportional hazards regression analysis demonstrating the independent prognostic value of ENPP4 expression, presented as a forest plot. Table 1 Odds Ratios for ENPP4 Expression by Tumor Stage Clinical characteristics Total(N) Odds ration in HAMP expression p-Value Stage(II vs. I) 320 0.86 (0.49–1.55) 0.621 Stage(III vs. I) 391 0.46 (0.30–0.71) < 0.001 Stage(IV vs. I) 343 0.27 (0.16–0.46) < 0.001 Table 2 Univariate Cox Analysis of Prognostic Factors id HR HR.95L HR.95H pvalue age 1.033765 1.020011 1.047703 1.18E-06 gender 0.943879 0.686104 1.298501 0.722661 stage 1.897654 1.657193 2.173007 1.92E-20 T 2.005603 1.691393 2.378183 1.19E-15 N 3.430654 1.804545 6.522079 0.000169 M 4.305491 3.131988 5.918685 2.44E-19 ENPP4 0.753176 0.67598 0.839188 2.78E-07 Table 3 Multivariate Cox Analysis of Prognostic Factors id HR HR.95L HR.95H pvalue age 1.038704 1.023457 1.054178 4.83E-07 gender 0.990075 0.711041 1.378611 0.952911 stage 1.544695 1.004989 2.374238 0.047406 T 1.013048 0.682102 1.504563 0.948783 N 1.888124 0.964113 3.697714 0.063826 M 1.66422 0.89159 3.106395 0.109687 ENPP4 0.79342 0.694946 0.905848 0.000621 To further illustrate the prognostic relevance of ENPP4-associated risk stratification, a Cox proportional hazards regression model incorporating ENPP4 expression and clinicopathological variables was constructed to calculate an individualized risk score for each patient. As shown in Fig. 2 , the three subpanels were aligned horizontally according to patient indices ordered by increasing risk score, ensuring that each vertical position corresponded to the same patient across all panels. Figure 2 A shows the distribution of patient risk scores, which exhibits a progressive increase along the patient index, indicating successful stratification of patients from low- to high-risk categories. Figure 2 B presents the distribution of survival time and survival status, in which death events become increasingly concentrated as risk scores increase, and patients in the high-risk region display shorter survival times compared with those in the low-risk region. Figure 2 C displays a heatmap of ENPP4 expression levels, demonstrating a gradual decrease in ENPP4 expression with increasing risk scores. Collectively, the coordinated trends across Fig. 2 A–C illustrate consistent relationships among risk scores, patient survival outcomes, and ENPP4 expression. (A) Distribution of patient risk scores; (B) Distribution of survival time and survival status (death, deceased; alive, surviving); (C) Heatmap of ENPP4 gene expression levels. Aberrant expression of ENPP4 in clinical ccRCC and adjacent normal tissues To validate the findings derived from TCGA analysis, tumor tissues and matched adjacent normal tissues were collected from patients with ccRCC. The differential expression of ENPP4 at both the mRNA and protein levels was examined using qRT-PCR and Western blot analysis, respectively. The qRT-PCR results demonstrated that the relative mRNA expression level of ENPP4 was significantly higher in adjacent normal tissues than in ccRCC tumor tissues, with strong statistical significance between the two groups (****P < 0.0001, Fig. 3 A). Consistent expression trends were observed at both the mRNA and protein levels, indicating reduced ENPP4 expression in ccRCC tissues. Western blot analysis further confirmed this observation, as analysis of three pairs of matched tissue samples revealed a marked decrease in band intensity and narrowing of band width corresponding to ENPP4 protein in ccRCC tumor tissues compared with adjacent normal tissues (Fig. 3 B), confirming lower ENPP4 protein expression in tumor samples. (A) Relative mRNA expression levels of ENPP4 in normal tissues (Normal) and tumor tissues (Tumor) as determined by quantitative real-time PCR (qRT-PCR). **** indicates an extremely significant difference between groups; (B) Western blot analysis of ENPP4 protein expression in adjacent normal tissues (ANT) and ccRCC tissues (T), with GAPDH used as the internal loading control (Samples were obtained from different regions of the same gel, and the original images are provided in Supplementary File1 Raw WB). Low ENPP4 expression promotes cell proliferation, migration, and invasion To investigate the functional role of ENPP4 at the cellular level, ENPP4 expression was silenced using shRNA-mediated knockdown in the 786-O, A498, and ACHN cell lines. Western blot analysis confirmed that ENPP4 expression was markedly reduced following shRNA transfection in all three cell lines (Fig. 4 A). Cell proliferation assays further showed that, compared with the sh-NC group, cells in both the sh-ENPP4#1 and sh-ENPP4#2 groups exhibited significantly accelerated growth across all three cell lines (Fig. 4 B), with the differences reaching a high level of statistical significance (***P < 0.001), indicating that ENPP4 knockdown markedly promotes cell proliferation in 786-O, A498, and ACHN cells. In addition, Transwell migration and invasion assays demonstrated that silencing ENPP4 led to a significant increase in the number of migrated and invaded cells in the sh-ENPP4#1 and sh-ENPP4#2 groups compared with their respective control groups (Fig. 4 C–E). Collectively, these results indicate that low ENPP4 expression enhances the proliferative, migratory, and invasive abilities of ccRCC cells, suggesting that ENPP4 may act as a tumor suppressor in ccRCC. (A) Western blot analysis confirming efficient knockdown of ENPP4 expression (Samples were obtained from different regions of the same gel, and the original images are provided in Supplementary File1 Raw WB); (B) Cell proliferation assays showing a significant increase in tumor cell proliferation following ENPP4 knockdown; (C–E) Transwell assays demonstrating that knockdown of ENPP4 significantly enhances tumor cell migration and invasion. (*P < 0.05; **P < 0.01; ***P < 0.001). Discussion In this study, we systematically analyzed the expression profile of ENPP4 in ccRCC at the transcriptomic level using data derived from TCGA, and further explored its association with clinical outcomes. Our results demonstrated that ENPP4 expression was significantly downregulated in ccRCC tissues compared with normal renal tissues, and that reduced ENPP4 expression was closely associated with poor overall survival, advanced tumor stage, and increased tumor aggressiveness. Importantly, multivariate Cox regression analysis confirmed that low ENPP4 expression represents an independent risk factor for unfavorable prognosis in patients with ccRCC. When integrated with bioinformatic analyses and functional experiments, these findings suggest that ENPP4 may exert tumor-suppressive effects during ccRCC initiation and progression and holds potential value as a prognostic biomarker. First, our study identified a marked downregulation of ENPP4 in ccRCC tissues, indicating that loss or reduction of ENPP4 expression may be closely linked to renal tumorigenesis. Previous studies have shown that the development and progression of ccRCC involve aberrant activation of multiple signaling pathways, including VHL/HIF-mediated hypoxia signaling, the PI3K/AKT/mTOR pathway, and immune–metabolic reprogramming ( 15 – 17 ). However, the biological role of ENPP4 in ccRCC has remained largely unexplored. Our findings therefore provide novel insights into the potential involvement of ENPP4 in renal cancer biology and lay a foundation for future investigations into the molecular mechanisms underlying its dysregulation. Second, survival analyses revealed that patients with high ENPP4 expression exhibited significantly prolonged overall survival compared with those with low expression, underscoring the clinical relevance of ENPP4 expression levels. Further analyses demonstrated a significant inverse correlation between ENPP4 expression and tumor stage, with ENPP4 expression progressively decreasing as tumor stage advanced. This pattern suggests that ENPP4 downregulation may contribute to tumor progression from early to advanced stages, potentially through mechanisms associated with enhanced cell proliferation, migration, and invasion. Consistent with this notion, previous studies have reported that molecular subtypes of ccRCC are closely linked to dysregulated signaling pathways and aggressive tumor behavior ( 18 ). Collectively, these findings support the potential utility of ENPP4 as a novel molecular marker for prognostic stratification, which may aid in clinical risk assessment and individualized treatment planning. Moreover, multivariate Cox regression analysis demonstrated that ENPP4 expression remained significantly associated with overall survival after adjustment for established clinicopathological variables, including age, sex, and TNM stage. This indicates that ENPP4 may serve as an independent prognostic factor, providing predictive information beyond traditional clinical parameters. In line with these observations, our functional assays showed that ENPP4 knockdown significantly enhanced ccRCC cell proliferation, migration, and invasion, further supporting the hypothesis that ENPP4 functions as a tumor suppressor in ccRCC. Previous functional genomic screening studies have similarly reported that aberrant expression of specific key genes can markedly promote malignant phenotypes in ccRCC cells ( 19 , 20 ). Although the precise mechanisms remain to be elucidated, ENPP4 may influence tumor behavior through regulation of intracellular signaling pathways, extracellular matrix remodeling, or cellular energy metabolism. These hypotheses warrant further investigation in future mechanistic studies. Despite the strengths of this study, several limitations should be acknowledged. First, this work was primarily based on a retrospective analysis of publicly available TCGA datasets, and potential biases may arise from data sources and inter-sample heterogeneity. Second, although bioinformatic analyses revealed significant alterations in ENPP4 expression and its clinical relevance, causal relationships have not been directly established. Further validation through in vitro and in vivo functional experiments is required to confirm the biological role of ENPP4. Finally, the present study mainly focused on transcriptional-level analyses. Future investigations integrating protein expression, DNA methylation status, upstream regulatory factors, and other multi-omics data are warranted to provide a more comprehensive understanding of the biological mechanisms of ENPP4 in ccRCC. Conclusion In conclusion, this study demonstrates that ENPP4 is significantly downregulated in ccRCC, and that low ENPP4 expression is closely associated with unfavorable prognosis. Reduced ENPP4 expression may contribute to disease progression by enhancing tumor cell proliferation, migration, and invasion. These findings suggest that ENPP4 may function as a tumor suppressor and an independent prognostic indicator, providing new theoretical insights for molecular stratification and personalized treatment of ccRCC. Future studies involving larger clinical cohorts and in-depth mechanistic investigations are required to further elucidate the precise role of ENPP4 in the initiation and progression of ccRCC. Abbreviations Clear cell renal cell carcinoma (ccRCC) renal cell carcinoma (RCC) ectonucleotide pyrophosphatase/phosphodiesterase 4 (ENPP4) The Cancer Genome Atlas (TCGA) fragments per kilobase of exon model per million mapped reads (FPKM) overall survival (OS) odds ratio (OR) hazard ratio (HR) confidence interval (CI) quantitative real time polymerase chain reaction (qRT–PCR) Western blot (WB) Dulbecco’s Modified Eagle Medium (DMEM) Minimum Essential Medium (MEM) fetal bovine serum (FBS) short hairpin RNA (shRNA) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) bovine serum albumin (BSA) vascular endothelial growth factor (VEGF) mammalian target of rapamycin (mTOR) immune checkpoint inhibitors (ICIs) tumor node–metastasis (TNM). Declarations Ethics approval and consent to participate This study was approved by the Ethics Committee of the First Hospital of Shanxi Medical University (Approval No. KYLL-2025-105). Written informed consent was waived because the study used postoperative pathological tissues from routine clinical care, involved no additional patient intervention, and included no identifiable personal information. Consent for publication Not applicable Competing interests The authors have no relevant financial or non-financial interests to disclose. Funding The authors did not receive support from any organization for the submitted work. Author Contribution Conceptualization: Wenjie Yang, Xin Jiang, Zhifang Ma; Methodology: Chenxi Li, Yuheng Niu; Formal analysis and investigation: Wenjie Yang, Chenxi Li, Yuheng Niu; Writing – original draft preparation: Wenjie Yang, Chenxi Li, Yuheng Niu; Writing – review and editing: Xin Jiang, Zhifang Ma; Resources: Xin Jiang, Zhifang Ma; Supervision: Zhifang Ma. All authors read and approved the final manuscript. Acknowledgements We sincerely thank the Department of Urology, the First Hospital of Shanxi Medical University, for providing the tissue samples used in this study. We also acknowledge the Genomic Data Commons (GDC) Public Data Portal for access to the datasets supporting this research. Data Availability The data analyzed in this study were obtained from the Genomic Data Commons (GDC) Data Portal (https://portal.gdc.cancer.gov/). Additional data supporting the findings of this study are available from the corresponding author upon reasonable request. References Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 71 (3), 209–249 (2021). Capitanio, U. & Montorsi, F. Renal cancer. Lancet 387 (10021), 894–906 (2016). Moch, H., Cubilla, A. L., Humphrey, P. A., Reuter, V. E. & Ulbright, T. M. The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs-Part A: Renal, Penile, and Testicular Tumours. Eur. Urol. 70 (1), 93–105 (2016). Motzer, R. J. et al. NCCN Guidelines Insights: Kidney Cancer, Version 2.2020. J. Natl. Compr. Canc Netw. 17 (11), 1278–1285 (2019). Ljungberg, B. et al. EAU guidelines on renal cell carcinoma: 2014 update. Eur. Urol. 67 (5), 913–924 (2015). Rini, B. I., Campbell, S. C. & Escudier, B. Renal cell carcinoma. Lancet 373 (9669), 1119–1132 (2009). Choueiri, T. K. & Motzer, R. J. Systemic Therapy for Metastatic Renal-Cell Carcinoma. N Engl. J. Med. 376 (4), 354–366 (2017). Motzer, R. J. et al. Nivolumab plus Ipilimumab versus Sunitinib in Advanced Renal-Cell Carcinoma. N Engl. J. Med. 378 (14), 1277–1290 (2018). Goding, J. W., Grobben, B. & Slegers, H. Physiological and pathophysiological functions of the ecto-nucleotide pyrophosphatase/phosphodiesterase family. Biochim. Biophys. Acta . 1638 (1), 1–19 (2003). Zhao, L. et al. Role of ENPP1 in cancer pathogenesis: Mechanisms and clinical implications (Review). Oncol. Lett. 28 (6), 590 (2024). Benesch, M. G. et al. Insights into autotaxin- and lysophosphatidate-mediated signaling in the pancreatic ductal adenocarcinoma tumor microenvironment: a survey of pathway gene expression. Am. J. Cancer Res. 14 (8), 4004–4027 (2024). Yan, D. et al. Homology modeling and docking studies of ENPP4: a BCG activated tumoricidal macrophage protein. Lipids Health Dis. 15 , 19 (2016). Mohd Amin, A. et al. ENPP4 and HOXA3 as potential leukaemia stem cell markers in acute myeloid leukaemia. Malays J. Pathol. 45 (1), 65–76 (2023). Wang, J., Di, J. & Wang, G. ENPP4 overexpression is associated with no recovery from Barrett's esophagus. Int. J. Clin. Exp. Pathol. 13 (12), 2927–2936 (2020). Shen, C. & Kaelin, W. G. Jr. The VHL/HIF axis in clear cell renal carcinoma. Semin Cancer Biol. 23 (1), 18–25 (2013). Guo, H. et al. The PI3K/AKT Pathway and Renal Cell Carcinoma. J. Genet. Genomics . 42 (7), 343–353 (2015). Wettersten, H. I., Aboud, O. A., Lara, P. N. Jr. & Weiss, R. H. Metabolic reprogramming in clear cell renal cell carcinoma. Nat. Rev. Nephrol. 13 (7), 410–419 (2017). Ricketts, C. J. et al. The Cancer Genome Atlas Comprehensive Molecular Characterization of Renal Cell Carcinoma. Cell. Rep. 23 (1), 313–26e5 (2018). Yao, X. et al. VHL Deficiency Drives Enhancer Activation of Oncogenes in Clear Cell Renal Cell Carcinoma. Cancer Discov . 7 (11), 1284–1305 (2017). Lv, Z. et al. FOXM1-regulated ZIC2 promotes the malignant phenotype of renal clear cell carcinoma by activating UBE2C/mTOR signaling pathway. Int. J. Biol. Sci. 19 (11), 3293–3306 (2023). Additional Declarations No competing interests reported. Supplementary Files EthicsApprovalEnglishTranslation.pdf EthicsApprovalChinese.pdf SupplementaryFile1RawWB.tif SupplementaryFile1Legends.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 06 May, 2026 Reviews received at journal 26 Apr, 2026 Reviewers agreed at journal 22 Apr, 2026 Reviewers invited by journal 10 Apr, 2026 Editor assigned by journal 12 Mar, 2026 Editor invited by journal 05 Mar, 2026 Submission checks completed at journal 28 Feb, 2026 First submitted to journal 28 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8769917","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":623969782,"identity":"5de124ec-9bdc-490a-8755-11c34689cdff","order_by":0,"name":"Wenjie Yang","email":"","orcid":"","institution":"First Hospital of Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenjie","middleName":"","lastName":"Yang","suffix":""},{"id":623969783,"identity":"bdc17365-df38-4ede-a743-69bd319f7f9a","order_by":1,"name":"Chenxi Li","email":"","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chenxi","middleName":"","lastName":"Li","suffix":""},{"id":623969784,"identity":"5a522784-dad0-4014-a610-689178b86293","order_by":2,"name":"Yuheng Niu","email":"","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuheng","middleName":"","lastName":"Niu","suffix":""},{"id":623969785,"identity":"a6342ddc-9cd4-49ae-bbc7-bb5b34e8fa59","order_by":3,"name":"Xin Jiang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYBACNvnznx//4PkvJ8/ekPggoaKGsBY+CQYzYwYZZmPDngOPDR6cOUZYi5wEg4E0gw1zYsONxGeSD1uYiXCYdEOCcUEOW2Jjz+G0isQGNgb+9u4E/FpkDhx4POMMj3E7e1vajcQdMgwSZ85uwK+FIbHBgLdHQrax5wxQyxk2BgOJXEJakhkkeP8ZMDbcyP9WkNjGTIQWiTQGaR6eBMWGGwlpDMRp4TnDZjiD5wAokJMlEs4c4yHoF/n2HuYHH3gOgKPy44+KGjn+9l78WjAAD2nKR8EoGAWjYBRgBQDsQkwt2/f8vwAAAABJRU5ErkJggg==","orcid":"","institution":"Shanxi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Jiang","suffix":""},{"id":623969787,"identity":"861dd0bb-9350-4af1-8674-42937d27ab2b","order_by":4,"name":"Zhifang Ma","email":"","orcid":"","institution":"First Hospital of Shanxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhifang","middleName":"","lastName":"Ma","suffix":""}],"badges":[],"createdAt":"2026-02-03 02:08:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8769917/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8769917/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107376876,"identity":"2c4cb993-a3b5-458b-a09a-e2b89651a5a0","added_by":"auto","created_at":"2026-04-21 01:22:50","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":517348,"visible":true,"origin":"","legend":"\u003cp\u003eDownregulation of ENPP4 and its tumor-suppressive relevance and prognostic value in ccRCC.\u003cbr\u003e\n(A) Differential expression of ENPP4 between tumor tissues and normal renal tissues assessed using the Wilcoxon rank-sum test; (B) Paired comparison of ENPP4 expression between tumor tissues and matched adjacent normal tissues analyzed by paired \u003cem\u003et\u003c/em\u003e-test; (C) Kaplan–Meier survival analysis illustrating the association between ENPP4 expression levels and overall survival in patients with ccRCC; (D, E) Correlations between ENPP4 expression and clinicopathological parameters, showing significant associations with tumor stage; (F) Multivariate Cox proportional hazards regression analysis demonstrating the independent prognostic value of ENPP4 expression, presented as a forest plot.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/941da2c6d10caf912d4eb0ce.jpg"},{"id":107489688,"identity":"0dc30e04-c4f8-40e3-9b0a-0664d071530c","added_by":"auto","created_at":"2026-04-22 02:48:36","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":374179,"visible":true,"origin":"","legend":"\u003cp\u003eIntegrated analysis of ENPP4-associated risk scores, survival outcomes, and expression levels.\u003c/p\u003e\n\u003cp\u003e(A) Distribution of patient risk scores; (B) Distribution of survival time and survival status (death, deceased; alive, surviving); (C) Heatmap of ENPP4 gene expression levels.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/c0d2782957d1be13e4d32120.jpg"},{"id":107487256,"identity":"c1d8d508-27ce-4078-bbcd-a7ebe4a34ddc","added_by":"auto","created_at":"2026-04-22 02:40:14","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":147252,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential expression of ENPP4 in ccRCC and adjacent normal tissues.\u003c/p\u003e\n\u003cp\u003e(A) Relative mRNA expression levels of ENPP4 in normal tissues (Normal) and tumor tissues (Tumor) as determined by quantitative real-time PCR (qRT-PCR). **** indicates an extremely significant difference between groups; (B) Western blot analysis of ENPP4 protein expression in adjacent normal tissues (ANT) and ccRCC tissues (T), with GAPDH used as the internal loading control (Samples were obtained from different regions of the same gel, and the original images are provided in Supplementary File1 Raw WB).\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/f04d0dbe01d42f0a3ff7a11d.jpg"},{"id":107376882,"identity":"50b7b847-f536-4ece-9582-82658131d83e","added_by":"auto","created_at":"2026-04-21 01:22:50","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1882574,"visible":true,"origin":"","legend":"\u003cp\u003eLow ENPP4 expression promotes cell proliferation, migration, and invasion.\u003c/p\u003e\n\u003cp\u003e(A) Western blot analysis confirming efficient knockdown of ENPP4 expression (Samples were obtained from different regions of the same gel, and the original images are provided in Supplementary File1 Raw WB); (B) Cell proliferation assays showing a significant increase in tumor cell proliferation following ENPP4 knockdown; (C–E) Transwell assays demonstrating that knockdown of ENPP4 significantly enhances tumor cell migration and invasion.\u003c/p\u003e\n\u003cp\u003e(*P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/be64d3c173388744b19bac84.jpg"},{"id":107705763,"identity":"0e0f5268-0798-4b8b-93eb-4c12ade95a67","added_by":"auto","created_at":"2026-04-24 09:15:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3215662,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/1cfda1ff-1b83-4635-8014-c4a5aadbb9d6.pdf"},{"id":107489619,"identity":"985ea1bd-ee41-456d-b622-d2297e3b1ba1","added_by":"auto","created_at":"2026-04-22 02:48:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":170438,"visible":true,"origin":"","legend":"","description":"","filename":"EthicsApprovalEnglishTranslation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/7889271ad9ad780ab09fd57c.pdf"},{"id":107488265,"identity":"3ffea280-691f-4ca7-a583-e4f16caafbb1","added_by":"auto","created_at":"2026-04-22 02:44:02","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2534475,"visible":true,"origin":"","legend":"","description":"","filename":"EthicsApprovalChinese.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/e03ac24aeceb4043a34e9bec.pdf"},{"id":107487954,"identity":"148a825c-e537-4cf1-b6ac-b565b8b43f4b","added_by":"auto","created_at":"2026-04-22 02:43:09","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":8160312,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile1RawWB.tif","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/80fad9d69f03a557ab1a80b7.tif"},{"id":107376881,"identity":"e5bd283d-9169-41f9-ae79-966139b5aa7d","added_by":"auto","created_at":"2026-04-21 01:22:50","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":15635,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile1Legends.docx","url":"https://assets-eu.researchsquare.com/files/rs-8769917/v1/9b36d6d0021e3a80b6bc2ec3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Downregulation of ENPP4 Is Associated with Poor Prognosis and Enhanced Malignant Phenotypes in Clear Cell Renal Cell Carcinoma","fulltext":[{"header":"Background","content":"\u003cp\u003eRenal cell carcinoma (RCC) is one of the most common malignant tumors of the urinary system worldwide, and its incidence has shown a continuous upward trend over the past several decades. It is estimated that more than 430,000 new cases of kidney cancer are diagnosed globally each year, with nearly 18 0,000 associated deaths (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Epidemiological evidence shows that the incidence of renal cancer has steadily increased worldwide over the past decades (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e), posing a substantial challenge to public health systems and cancer prevention and control strategies.\u003c/p\u003e \u003cp\u003eFrom a pathological perspective, RCC can be classified into several histological subtypes, including clear cell carcinoma, papillary carcinoma, chromophobe carcinoma, and collecting duct carcinoma. Among these, clear cell renal cell carcinoma (ccRCC) accounts for approximately 70%\u0026ndash;80% of all renal cancers and represents the most prevalent subtype with the most aggressive biological behavior (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). ccRCC exhibits poor sensitivity to conventional radiotherapy and chemotherapy, and surgical resection remains the primary treatment option for patients with early-stage disease (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Nevertheless, approximately 20%\u0026ndash;30% of patients experience local recurrence or distant metastasis after surgery, and the risk of recurrence remains substantial even following radical nephrectomy (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Recurrence most frequently involves vital organs such as the lungs, bones, liver, and brain, and is often indicative of rapid disease progression and an unfavorable prognosis (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor patients with advanced or recurrent ccRCC, systemic therapy constitutes the mainstay of treatment. Over the past decade, molecular targeted therapies, including vascular endothelial growth factor (VEGF) inhibitors and mammalian target of rapamycin (mTOR) inhibitors, have significantly prolonged progression-free survival. However, due to pronounced tumor heterogeneity and the emergence of drug resistance mechanisms, the durability of therapeutic responses remains limited (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). In recent years, immune checkpoint inhibitors (ICIs) have introduced new therapeutic prospects for ccRCC (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGiven the challenges associated with early diagnosis, high postoperative recurrence rates, and complex resistance mechanisms in ccRCC, in-depth investigation of its molecular mechanisms and tumor immune microenvironment is of critical importance for the identification of novel therapeutic targets and the optimization of personalized treatment strategies. Such studies may not only contribute to improvements in overall survival but also provide new insights into the management of disease recurrence and metastasis.\u003c/p\u003e \u003cp\u003eEctonucleotide pyrophosphatase/phosphodiesterase 4 (ENPP4) is a transmembrane glycoprotein encoded by the \u003cem\u003eENPP4\u003c/em\u003e gene and is a member of the ENPP family. Members of this family play crucial roles in the hydrolysis of extracellular nucleotides, signal transduction, immune regulation, and cell proliferation (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Accumulating evidence has demonstrated that multiple ENPP family members are closely associated with tumor initiation and progression. For instance, ENPP1 has been implicated in the development and progression of various malignancies, including pancreatic cancer, breast cancer, gallbladder cancer, and colorectal cancer (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e); ENPP2, also known as autotaxin, contributes to tumor cell migration and angiogenesis by promoting the production of lysophosphatidic acid (LPA) (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). In contrast to these well-studied members, ENPP4 has received relatively limited attention in oncology, and its biological functions have not yet been fully elucidated. Experimental evidence indicates that recombinant ENPP4 protein dose-dependently inhibits the proliferation of MCA207 cells in vitro, while blockade of ENPP4 on the surface of BCG-activated macrophages markedly attenuates their cytotoxic activity against MCA207 cells, suggesting a critical role of ENPP4 in macrophage-mediated antitumor immunity (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Emerging data further suggest that aberrant ENPP4 expression is associated with the development of several malignancies, including esophageal precancerous lesions and acute myeloid leukemia (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). However, studies investigating ENPP4 in the context of ccRCC remain scarce. Given the potential biological relevance of ENPP4 observed in other tumor types, we hypothesize that ENPP4 may participate in and influence the initiation and progression of ccRCC. A comprehensive investigation of ENPP4 expression patterns and underlying molecular mechanisms in ccRCC may provide a theoretical basis for the identification of novel molecular targets and the development of potential therapeutic strategies for this disease.\u003c/p\u003e \u003cp\u003eTo address this knowledge gap, we first obtained clinicopathological information and gene expression profiles of patients with ccRCC from The Cancer Genome Atlas (TCGA) database. Bioinformatic analyses were performed to evaluate the differential expression of ENPP4 between tumor tissues and adjacent normal tissues, and to explore its associations with clinicopathological characteristics (including tumor stage and grade) as well as patient prognosis. To further validate the biological role of ENPP4, tumor tissues and paired adjacent non-tumorous tissues were collected from patients with ccRCC. The mRNA and protein expression levels of ENPP4 were assessed using quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot (WB) analysis, respectively. In addition, cell proliferation and migration assays were conducted to preliminarily investigate the effects of ENPP4 expression on the proliferative and migratory capacities of ccRCC cells.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eData acquisition\u003c/h2\u003e \u003cp\u003eGene expression profiles quantified as fragments per kilobase per million mapped reads (FPKM), together with corresponding clinicopathological information of patients with ccRCC, were retrieved from TCGA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov/\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The dataset comprised a total of 614 samples, including 542 ccRCC tumor tissues and 72 matched adjacent non-tumorous tissues.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBioinformatic and statistical analyses\u003c/h3\u003e\n\u003cp\u003eAll computational and statistical analyses were conducted using R software (version 4.4.2) in conjunction with RStudio (version 2024.04.2). To systematically evaluate the prognostic relevance of differentially expressed genes in ccRCC, TCGA-derived datasets were subjected to an integrated analytical workflow. This workflow included differential expression analysis using the Wilcoxon rank-sum test, paired differential analysis, survival analysis, correlation analyses with clinicopathological parameters, risk score construction, as well as univariate and multivariate Cox proportional hazards regression analyses. Through this stepwise screening strategy, prognostically informative biomarkers with the highest predictive value for ccRCC outcomes were identified.\u003c/p\u003e\n\u003ch3\u003eClinical specimens\u003c/h3\u003e\n\u003cp\u003eTumor tissues and paired adjacent non-tumorous tissues were collected from patients with ccRCC who underwent laparoscopic radical nephrectomy at the First Hospital of Shanxi Medical University. Inclusion criteria consisted of histopathologically confirmed ccRCC, absence of distant metastasis as verified by preoperative imaging and intraoperative exploration, and no prior exposure to radiotherapy, chemotherapy, or other anticancer treatments that could potentially influence gene expression or cellular function. Patients were excluded if they had concomitant malignancies, severe organ dysfunctions that might confound the results, or insufficient RNA quantity or quality due to suboptimal tissue preservation. Based on these criteria, tumor specimens from 40 ccRCC patients were ultimately included, and all samples were snap-frozen and stored under liquid nitrogen conditions. The study protocol was approved by the Ethics Committee of the First Hospital of Shanxi Medical University (Approval No. KYLL-2025-105). All procedures involving human specimens were conducted in strict accordance with the Declaration of Helsinki and relevant clinical research guidelines, ensuring full ethical compliance.\u003c/p\u003e\n\u003ch3\u003eQuantification of gene expression in patient samples\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from freshly frozen tissue specimens using a total RNA extraction kit (Omega Bio-Tek) according to the manufacturer\u0026rsquo;s instructions. Complementary DNA (cDNA) was synthesized using the PrimeScript\u0026trade; RT reagent kit with gDNA Eraser (Takara, Japan). Quantitative real-time PCR was performed with TB Green\u0026reg; Premix Ex Taq\u0026trade; II (Tli RNaseH Plus; Takara, Japan) on an Applied Biosystems 7500 Fast Real-Time PCR System. The primer sequences specific for ENPP4 were as follows: forward, 5\u0026prime;-GCCATCGCGATTGTTATCGG-3\u0026prime;; reverse, 5\u0026prime;-AAGCCCTAGCACATGTCACC-3\u0026prime;.\u003c/p\u003e\n\u003ch3\u003eWestern blot analysis\u003c/h3\u003e\n\u003cp\u003eTotal protein was extracted from tumor tissues and matched adjacent normal tissues and quantified prior to analysis. Equal amounts of protein (50 \u0026micro;g per sample) were separated by SDS\u0026ndash;polyacrylamide gel electrophoresis (SDS\u0026ndash;PAGE) using 4%\u0026ndash;12% gradient gels, followed by transfer onto nitrocellulose membranes. After blocking, membranes were incubated with a primary antibody against ENPP4, followed by incubation with corresponding secondary antibodies supplied by LI-COR Biosciences (Lincoln, NE, USA). Protein bands were visualized and quantified using the Odyssey\u0026reg; CLx Imaging System (LI-COR Biosciences). GAPDH was used as the internal loading control for Western blot analysis. Western blot analyses were independently repeated three times for both tumor and adjacent normal tissues.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman ccRCC cell lines 786-O, A498, and ACHN were obtained from Genechem (Guangdong, China). 786-O and ACHN cells were maintained in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM), whereas A498 cells were cultured in Minimum Essential Medium (MEM). All culture media were supplemented with 10% fetal bovine serum (FBS) and 1% penicillin\u0026ndash;streptomycin, and cells were maintained in a humidified incubator at 37\u0026deg;C with 5% CO₂.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEstablishment of stable ENPP4 knockdown cell lines\u003c/h3\u003e\n\u003cp\u003e Short hairpin RNA (shRNA)-expressing lentiviral vectors targeting ENPP4 were obtained from Shanghai Genechem Co., Ltd. Lentiviral transduction was performed in 786-O, A498, and ACHN cells, followed by antibiotic selection to generate stable ENPP4 knockdown cell lines. The shRNA sequences targeting ENPP4 were as follows: shENPP4-#1, GCCTGGAAGATGACATTGATT; shENPP4-#2, CCAGGTGTTCAAGATCAAGAA.\u003c/p\u003e\n\u003ch3\u003eCell proliferation, migration, and invasion assays\u003c/h3\u003e\n\u003cp\u003eFor cell proliferation assays, stable ENPP4 knockdown cells and corresponding control cells were cultured under standard conditions. Cells in the logarithmic growth phase were collected, resuspended in serum-free medium supplemented with bovine serum albumin (BSA), and adjusted to a density of approximately 5 \u0026times; 10⁴ cells/mL. Cell suspensions were seeded into 6-well plates and incubated at 37\u0026deg;C with 5% CO₂. Cell growth was monitored and recorded at 12, 24, 36, 48, and 60 hours using an optical microscope.\u003c/p\u003e \u003cp\u003eFor migration assays, cells were serum-starved for 12\u0026ndash;24 hours prior to experimentation. Cells were then resuspended in serum-free BSA-containing medium at a density of 2 \u0026times; 10⁴ cells and seeded into the upper chambers of Transwell inserts with 8-\u0026micro;m pore size (24-well format; BD Biosciences). The lower chambers were filled with medium containing 10% FBS as a chemoattractant. After 24 hours of incubation, migrated cells on the lower surface of the membrane were fixed, stained, and counted under a microscope.\u003c/p\u003e \u003cp\u003eFor invasion assays, Transwell inserts were pre-coated with Matrigel (BD Biosciences, USA). A total of 2 \u0026times; 10⁴ cells suspended in serum-free medium were added to the upper chamber, while medium supplemented with 10% FBS was placed in the lower chamber. After 24 hours, invaded cells were fixed, stained, and quantified.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTumor-suppressive role of ENPP4 in ccRCC\u003c/h2\u003e \u003cp\u003eBased on the ccRCC cohort from TCGA, this study systematically investigated the expression profile of ENPP4 in ccRCC tissues and its potential association with clinical outcomes. To determine whether ENPP4 expression differed between tumor and normal renal tissues, Wilcoxon rank-sum tests were initially performed. The results demonstrated that ENPP4 expression was significantly reduced in ccRCC tumor tissues compared with normal renal tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To further verify the robustness of this finding, paired analyses of tumor tissues and matched adjacent normal tissues from the same patients were conducted, which consistently confirmed a pronounced downregulation of ENPP4 in ccRCC tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTo elucidate the relationship between ENPP4 expression and patient survival, ccRCC patients were stratified into high- and low-expression groups using the median ENPP4 expression level as the cutoff value. Kaplan\u0026ndash;Meier survival analysis combined with the log-rank test revealed that patients in the high ENPP4 expression group exhibited significantly longer overall survival (OS) than those in the low-expression group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eSubsequently, the association between ENPP4 expression and clinicopathological characteristics, particularly tumor stage, was further explored. ENPP4 expression levels differed significantly across tumor stages, with statistically significant reductions observed between stage I and stage III, as well as stage I and stage IV disease (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u0026ndash;E). Using stage I as the reference category, odds ratio (OR) analyses were performed to evaluate the strength of the association between tumor stage and low ENPP4 expression. The results showed that ENPP4 expression was significantly lower in stage III and stage IV tumors compared with stage I tumors (both P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas no significant difference was observed between stage II and stage I tumors (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These findings suggest that reduced ENPP4 expression may be closely associated with tumor progression, invasiveness, and metastatic potential in ccRCC.\u003c/p\u003e \u003cp\u003eFinally, to determine whether ENPP4 expression could serve as a predictive biomarker for patient prognosis, univariate and multivariate Cox proportional hazards regression analyses were performed. Univariate Cox analysis identified ENPP4 expression status as a significant prognostic factor in ccRCC (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Importantly, after adjusting for conventional clinicopathological variables, including age, sex, and TNM stage (T, N, and M classifications), ENPP4 expression remained independently associated with overall survival in multivariate analysis (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These results indicate that ENPP4 may function as an independent prognostic indicator for patients with ccRCC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) Differential expression of ENPP4 between tumor tissues and normal renal tissues assessed using the Wilcoxon rank-sum test; (B) Paired comparison of ENPP4 expression between tumor tissues and matched adjacent normal tissues analyzed by paired \u003cem\u003et\u003c/em\u003e-test; (C) Kaplan\u0026ndash;Meier survival analysis illustrating the association between ENPP4 expression levels and overall survival in patients with ccRCC; (D, E) Correlations between ENPP4 expression and clinicopathological parameters, showing significant associations with tumor stage; (F) Multivariate Cox proportional hazards regression analysis demonstrating the independent prognostic value of ENPP4 expression, presented as a forest plot.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOdds Ratios for ENPP4 Expression by Tumor Stage\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClinical characteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal(N)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOdds ration in HAMP expression\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ep-Value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage(II vs. I)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e320\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.86 (0.49\u0026ndash;1.55)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.621\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage(III vs. I)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e391\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.46 (0.30\u0026ndash;0.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage(IV vs. I)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e343\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.27 (0.16\u0026ndash;0.46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eUnivariate Cox Analysis of Prognostic Factors\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eid\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHR.95L\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHR.95H\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003epvalue\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.033765\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.020011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.047703\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.18E-06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003egender\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.943879\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.686104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.298501\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.722661\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003estage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.897654\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.657193\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.173007\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.92E-20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2.005603\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.691393\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.378183\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.19E-15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eN\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.430654\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.804545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6.522079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.000169\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eM\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4.305491\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3.131988\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.918685\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.44E-19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eENPP4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.753176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.67598\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.839188\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.78E-07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMultivariate Cox Analysis of Prognostic Factors\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eid\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHR.95L\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHR.95H\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003epvalue\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.038704\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.023457\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.054178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.83E-07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003egender\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.990075\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.711041\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.378611\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.952911\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003estage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.544695\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.004989\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.374238\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.047406\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.013048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.682102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.504563\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.948783\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eN\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.888124\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.964113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.697714\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.063826\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eM\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.66422\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.89159\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.106395\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.109687\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eENPP4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.79342\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.694946\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.905848\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.000621\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTo further illustrate the prognostic relevance of ENPP4-associated risk stratification, a Cox proportional hazards regression model incorporating ENPP4 expression and clinicopathological variables was constructed to calculate an individualized risk score for each patient. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the three subpanels were aligned horizontally according to patient indices ordered by increasing risk score, ensuring that each vertical position corresponded to the same patient across all panels. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA shows the distribution of patient risk scores, which exhibits a progressive increase along the patient index, indicating successful stratification of patients from low- to high-risk categories. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB presents the distribution of survival time and survival status, in which death events become increasingly concentrated as risk scores increase, and patients in the high-risk region display shorter survival times compared with those in the low-risk region. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC displays a heatmap of ENPP4 expression levels, demonstrating a gradual decrease in ENPP4 expression with increasing risk scores. Collectively, the coordinated trends across Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026ndash;C illustrate consistent relationships among risk scores, patient survival outcomes, and ENPP4 expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) Distribution of patient risk scores; (B) Distribution of survival time and survival status (death, deceased; alive, surviving); (C) Heatmap of ENPP4 gene expression levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eAberrant expression of ENPP4 in clinical ccRCC and adjacent normal tissues\u003c/h2\u003e \u003cp\u003eTo validate the findings derived from TCGA analysis, tumor tissues and matched adjacent normal tissues were collected from patients with ccRCC. The differential expression of ENPP4 at both the mRNA and protein levels was examined using qRT-PCR and Western blot analysis, respectively. The qRT-PCR results demonstrated that the relative mRNA expression level of ENPP4 was significantly higher in adjacent normal tissues than in ccRCC tumor tissues, with strong statistical significance between the two groups (****P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Consistent expression trends were observed at both the mRNA and protein levels, indicating reduced ENPP4 expression in ccRCC tissues. Western blot analysis further confirmed this observation, as analysis of three pairs of matched tissue samples revealed a marked decrease in band intensity and narrowing of band width corresponding to ENPP4 protein in ccRCC tumor tissues compared with adjacent normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), confirming lower ENPP4 protein expression in tumor samples.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) Relative mRNA expression levels of ENPP4 in normal tissues (Normal) and tumor tissues (Tumor) as determined by quantitative real-time PCR (qRT-PCR). **** indicates an extremely significant difference between groups; (B) Western blot analysis of ENPP4 protein expression in adjacent normal tissues (ANT) and ccRCC tissues (T), with GAPDH used as the internal loading control (Samples were obtained from different regions of the same gel, and the original images are provided in Supplementary File1 Raw WB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eLow ENPP4 expression promotes cell proliferation, migration, and invasion\u003c/h2\u003e \u003cp\u003eTo investigate the functional role of ENPP4 at the cellular level, ENPP4 expression was silenced using shRNA-mediated knockdown in the 786-O, A498, and ACHN cell lines. Western blot analysis confirmed that ENPP4 expression was markedly reduced following shRNA transfection in all three cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Cell proliferation assays further showed that, compared with the sh-NC group, cells in both the sh-ENPP4#1 and sh-ENPP4#2 groups exhibited significantly accelerated growth across all three cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), with the differences reaching a high level of statistical significance (***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), indicating that ENPP4 knockdown markedly promotes cell proliferation in 786-O, A498, and ACHN cells. In addition, Transwell migration and invasion assays demonstrated that silencing ENPP4 led to a significant increase in the number of migrated and invaded cells in the sh-ENPP4#1 and sh-ENPP4#2 groups compared with their respective control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC\u0026ndash;E). Collectively, these results indicate that low ENPP4 expression enhances the proliferative, migratory, and invasive abilities of ccRCC cells, suggesting that ENPP4 may act as a tumor suppressor in ccRCC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e (A) Western blot analysis confirming efficient knockdown of ENPP4 expression (Samples were obtained from different regions of the same gel, and the original images are provided in Supplementary File1 Raw WB); (B) Cell proliferation assays showing a significant increase in tumor cell proliferation following ENPP4 knockdown; (C\u0026ndash;E) Transwell assays demonstrating that knockdown of ENPP4 significantly enhances tumor cell migration and invasion.\u003c/p\u003e \u003cp\u003e(*P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we systematically analyzed the expression profile of ENPP4 in ccRCC at the transcriptomic level using data derived from TCGA, and further explored its association with clinical outcomes. Our results demonstrated that ENPP4 expression was significantly downregulated in ccRCC tissues compared with normal renal tissues, and that reduced ENPP4 expression was closely associated with poor overall survival, advanced tumor stage, and increased tumor aggressiveness. Importantly, multivariate Cox regression analysis confirmed that low ENPP4 expression represents an independent risk factor for unfavorable prognosis in patients with ccRCC. When integrated with bioinformatic analyses and functional experiments, these findings suggest that ENPP4 may exert tumor-suppressive effects during ccRCC initiation and progression and holds potential value as a prognostic biomarker.\u003c/p\u003e \u003cp\u003eFirst, our study identified a marked downregulation of ENPP4 in ccRCC tissues, indicating that loss or reduction of ENPP4 expression may be closely linked to renal tumorigenesis. Previous studies have shown that the development and progression of ccRCC involve aberrant activation of multiple signaling pathways, including VHL/HIF-mediated hypoxia signaling, the PI3K/AKT/mTOR pathway, and immune\u0026ndash;metabolic reprogramming (\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). However, the biological role of ENPP4 in ccRCC has remained largely unexplored. Our findings therefore provide novel insights into the potential involvement of ENPP4 in renal cancer biology and lay a foundation for future investigations into the molecular mechanisms underlying its dysregulation.\u003c/p\u003e \u003cp\u003eSecond, survival analyses revealed that patients with high ENPP4 expression exhibited significantly prolonged overall survival compared with those with low expression, underscoring the clinical relevance of ENPP4 expression levels. Further analyses demonstrated a significant inverse correlation between ENPP4 expression and tumor stage, with ENPP4 expression progressively decreasing as tumor stage advanced. This pattern suggests that ENPP4 downregulation may contribute to tumor progression from early to advanced stages, potentially through mechanisms associated with enhanced cell proliferation, migration, and invasion. Consistent with this notion, previous studies have reported that molecular subtypes of ccRCC are closely linked to dysregulated signaling pathways and aggressive tumor behavior (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Collectively, these findings support the potential utility of ENPP4 as a novel molecular marker for prognostic stratification, which may aid in clinical risk assessment and individualized treatment planning.\u003c/p\u003e \u003cp\u003eMoreover, multivariate Cox regression analysis demonstrated that ENPP4 expression remained significantly associated with overall survival after adjustment for established clinicopathological variables, including age, sex, and TNM stage. This indicates that ENPP4 may serve as an independent prognostic factor, providing predictive information beyond traditional clinical parameters. In line with these observations, our functional assays showed that ENPP4 knockdown significantly enhanced ccRCC cell proliferation, migration, and invasion, further supporting the hypothesis that ENPP4 functions as a tumor suppressor in ccRCC. Previous functional genomic screening studies have similarly reported that aberrant expression of specific key genes can markedly promote malignant phenotypes in ccRCC cells (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Although the precise mechanisms remain to be elucidated, ENPP4 may influence tumor behavior through regulation of intracellular signaling pathways, extracellular matrix remodeling, or cellular energy metabolism. These hypotheses warrant further investigation in future mechanistic studies.\u003c/p\u003e \u003cp\u003eDespite the strengths of this study, several limitations should be acknowledged. First, this work was primarily based on a retrospective analysis of publicly available TCGA datasets, and potential biases may arise from data sources and inter-sample heterogeneity. Second, although bioinformatic analyses revealed significant alterations in ENPP4 expression and its clinical relevance, causal relationships have not been directly established. Further validation through in vitro and in vivo functional experiments is required to confirm the biological role of ENPP4. Finally, the present study mainly focused on transcriptional-level analyses. Future investigations integrating protein expression, DNA methylation status, upstream regulatory factors, and other multi-omics data are warranted to provide a more comprehensive understanding of the biological mechanisms of ENPP4 in ccRCC.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, this study demonstrates that ENPP4 is significantly downregulated in ccRCC, and that low ENPP4 expression is closely associated with unfavorable prognosis. Reduced ENPP4 expression may contribute to disease progression by enhancing tumor cell proliferation, migration, and invasion. These findings suggest that ENPP4 may function as a tumor suppressor and an independent prognostic indicator, providing new theoretical insights for molecular stratification and personalized treatment of ccRCC. Future studies involving larger clinical cohorts and in-depth mechanistic investigations are required to further elucidate the precise role of ENPP4 in the initiation and progression of ccRCC.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eClear cell renal cell carcinoma (ccRCC)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003erenal cell carcinoma (RCC)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eectonucleotide pyrophosphatase/phosphodiesterase 4 (ENPP4)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eThe Cancer Genome Atlas (TCGA)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003efragments per kilobase of exon model per million mapped reads (FPKM)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eoverall survival (OS)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eodds ratio (OR)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ehazard ratio (HR)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003econfidence interval (CI)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003equantitative real\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etime polymerase chain reaction (qRT\u0026ndash;PCR)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWestern blot (WB)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDulbecco\u0026rsquo;s Modified Eagle Medium (DMEM)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMinimum Essential Medium (MEM)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003efetal bovine serum (FBS)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eshort hairpin RNA (shRNA)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003esodium dodecyl sulfate\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epolyacrylamide gel electrophoresis (SDS\u0026ndash;PAGE)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ebovine serum albumin (BSA)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003evascular endothelial growth factor (VEGF)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003emammalian target of rapamycin (mTOR)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eimmune checkpoint inhibitors (ICIs)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003etumor\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enode\u0026ndash;metastasis (TNM).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003e This study was approved by the Ethics Committee of the First Hospital of Shanxi Medical University (Approval No. KYLL-2025-105). Written informed consent was waived because the study used postoperative pathological tissues from routine clinical care, involved no additional patient intervention, and included no identifiable personal information.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThe authors did not receive support from any organization for the submitted work.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization: Wenjie Yang, Xin Jiang, Zhifang Ma; Methodology: Chenxi Li, Yuheng Niu; Formal analysis and investigation: Wenjie Yang, Chenxi Li, Yuheng Niu; Writing \u0026ndash; original draft preparation: Wenjie Yang, Chenxi Li, Yuheng Niu; Writing \u0026ndash; review and editing: Xin Jiang, Zhifang Ma; Resources: Xin Jiang, Zhifang Ma; Supervision: Zhifang Ma. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe sincerely thank the Department of Urology, the First Hospital of Shanxi Medical University, for providing the tissue samples used in this study. We also acknowledge the Genomic Data Commons (GDC) Public Data Portal for access to the datasets supporting this research.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data analyzed in this study were obtained from the Genomic Data Commons (GDC) Data Portal (https://portal.gdc.cancer.gov/). Additional data supporting the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. \u003cem\u003eCA Cancer J. Clin.\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e (3), 209\u0026ndash;249 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCapitanio, U. \u0026amp; Montorsi, F. Renal cancer. \u003cem\u003eLancet\u003c/em\u003e \u003cb\u003e387\u003c/b\u003e (10021), 894\u0026ndash;906 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoch, H., Cubilla, A. L., Humphrey, P. A., Reuter, V. E. \u0026amp; Ulbright, T. M. The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs-Part A: Renal, Penile, and Testicular Tumours. \u003cem\u003eEur. Urol.\u003c/em\u003e \u003cb\u003e70\u003c/b\u003e (1), 93\u0026ndash;105 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMotzer, R. J. et al. NCCN Guidelines Insights: Kidney Cancer, Version 2.2020. \u003cem\u003eJ. Natl. Compr. Canc Netw.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e (11), 1278\u0026ndash;1285 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLjungberg, B. et al. EAU guidelines on renal cell carcinoma: 2014 update. \u003cem\u003eEur. Urol.\u003c/em\u003e \u003cb\u003e67\u003c/b\u003e (5), 913\u0026ndash;924 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRini, B. I., Campbell, S. C. \u0026amp; Escudier, B. Renal cell carcinoma. \u003cem\u003eLancet\u003c/em\u003e \u003cb\u003e373\u003c/b\u003e (9669), 1119\u0026ndash;1132 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoueiri, T. K. \u0026amp; Motzer, R. J. Systemic Therapy for Metastatic Renal-Cell Carcinoma. \u003cem\u003eN Engl. J. Med.\u003c/em\u003e \u003cb\u003e376\u003c/b\u003e (4), 354\u0026ndash;366 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMotzer, R. J. et al. Nivolumab plus Ipilimumab versus Sunitinib in Advanced Renal-Cell Carcinoma. \u003cem\u003eN Engl. J. Med.\u003c/em\u003e \u003cb\u003e378\u003c/b\u003e (14), 1277\u0026ndash;1290 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoding, J. W., Grobben, B. \u0026amp; Slegers, H. Physiological and pathophysiological functions of the ecto-nucleotide pyrophosphatase/phosphodiesterase family. \u003cem\u003eBiochim. Biophys. Acta\u003c/em\u003e. \u003cb\u003e1638\u003c/b\u003e (1), 1\u0026ndash;19 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, L. et al. Role of ENPP1 in cancer pathogenesis: Mechanisms and clinical implications (Review). \u003cem\u003eOncol. Lett.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e (6), 590 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenesch, M. G. et al. Insights into autotaxin- and lysophosphatidate-mediated signaling in the pancreatic ductal adenocarcinoma tumor microenvironment: a survey of pathway gene expression. \u003cem\u003eAm. J. Cancer Res.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e (8), 4004\u0026ndash;4027 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan, D. et al. Homology modeling and docking studies of ENPP4: a BCG activated tumoricidal macrophage protein. \u003cem\u003eLipids Health Dis.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 19 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohd Amin, A. et al. ENPP4 and HOXA3 as potential leukaemia stem cell markers in acute myeloid leukaemia. \u003cem\u003eMalays J. Pathol.\u003c/em\u003e \u003cb\u003e45\u003c/b\u003e (1), 65\u0026ndash;76 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J., Di, J. \u0026amp; Wang, G. ENPP4 overexpression is associated with no recovery from Barrett's esophagus. \u003cem\u003eInt. J. Clin. Exp. Pathol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (12), 2927\u0026ndash;2936 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen, C. \u0026amp; Kaelin, W. G. Jr. The VHL/HIF axis in clear cell renal carcinoma. \u003cem\u003eSemin Cancer Biol.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (1), 18\u0026ndash;25 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, H. et al. The PI3K/AKT Pathway and Renal Cell Carcinoma. \u003cem\u003eJ. Genet. Genomics\u003c/em\u003e. \u003cb\u003e42\u003c/b\u003e (7), 343\u0026ndash;353 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWettersten, H. I., Aboud, O. A., Lara, P. N. Jr. \u0026amp; Weiss, R. H. Metabolic reprogramming in clear cell renal cell carcinoma. \u003cem\u003eNat. Rev. Nephrol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (7), 410\u0026ndash;419 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRicketts, C. J. et al. The Cancer Genome Atlas Comprehensive Molecular Characterization of Renal Cell Carcinoma. \u003cem\u003eCell. Rep.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (1), 313\u0026ndash;26e5 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao, X. et al. VHL Deficiency Drives Enhancer Activation of Oncogenes in Clear Cell Renal Cell Carcinoma. \u003cem\u003eCancer Discov\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e (11), 1284\u0026ndash;1305 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv, Z. et al. FOXM1-regulated ZIC2 promotes the malignant phenotype of renal clear cell carcinoma by activating UBE2C/mTOR signaling pathway. \u003cem\u003eInt. J. Biol. Sci.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e (11), 3293\u0026ndash;3306 (2023).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"clear cell renal cell carcinoma, ENPP4, prognostic biomarker, tumor progression, The Cancer Genome Atlas","lastPublishedDoi":"10.21203/rs.3.rs-8769917/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8769917/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground:\u003c/h2\u003e \u003cp\u003eClear cell renal cell carcinoma (ccRCC) is the most prevalent and aggressive subtype of renal cell carcinoma, characterized by high recurrence rates and unfavorable prognosis. Identification of novel molecular biomarkers is crucial for improving prognostic stratification and therapeutic decision-making. Ectonucleotide pyrophosphatase/phosphodiesterase 4 (ENPP4), a member of the ENPP family, has been implicated in immune regulation and tumor biology; however, its role in ccRCC remains largely unexplored.\u003c/p\u003e\u003ch2\u003eMethods:\u003c/h2\u003e \u003cp\u003eTranscriptomic data and corresponding clinical information of ccRCC patients were obtained from The Cancer Genome Atlas (TCGA). Differential expression analyses, survival analyses, and univariate and multivariate Cox regression models were performed to evaluate the prognostic significance of ENPP4. An ENPP4-associated risk stratification model was constructed to visualize survival differences. ENPP4 expression was further validated in clinical ccRCC tissues and matched adjacent normal tissues using quantitative real-time PCR and Western blot analysis. Functional assays were conducted in ccRCC cell lines (786-O, A498, and ACHN) following shRNA-mediated ENPP4 knockdown to assess cell proliferation, migration, and invasion.\u003c/p\u003e\u003ch2\u003eResults:\u003c/h2\u003e \u003cp\u003eENPP4 expression was significantly downregulated in ccRCC tissues compared with normal renal tissues at both the mRNA and protein levels. Low ENPP4 expression was associated with advanced tumor stage and significantly poorer overall survival. Multivariate Cox regression analysis identified ENPP4 as an independent prognostic factor in ccRCC. Risk stratification analyses further demonstrated a close association between reduced ENPP4 expression, elevated risk scores, and unfavorable survival outcomes. Functional experiments revealed that ENPP4 knockdown markedly enhanced ccRCC cell proliferation, migration, and invasion.\u003c/p\u003e\u003ch2\u003eConclusion:\u003c/h2\u003e \u003cp\u003eOur findings indicate that ENPP4 is frequently downregulated in ccRCC and that its low expression is associated with aggressive tumor behavior and poor prognosis. ENPP4 may function as a tumor suppressor and serve as a potential prognostic biomarker, providing new insights into molecular stratification and personalized management of ccRCC.\u003c/p\u003e","manuscriptTitle":"Downregulation of ENPP4 Is Associated with Poor Prognosis and Enhanced Malignant Phenotypes in Clear Cell Renal Cell Carcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-21 01:22:41","doi":"10.21203/rs.3.rs-8769917/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"204833403432476750060890428865024604154","date":"2026-05-06T08:49:26+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-26T04:13:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"262656547652463310311017280579084830771","date":"2026-04-22T12:03:15+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-10T07:25:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-12T13:37:09+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-05T10:57:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-28T14:35:29+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-02-28T14:03:50+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"419e9975-fe88-4407-b9bd-14ff40917e3e","owner":[],"postedDate":"April 21st, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"204833403432476750060890428865024604154","date":"2026-05-06T08:49:26+00:00","index":99,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":66407202,"name":"Health sciences/Biomarkers"},{"id":66407203,"name":"Biological sciences/Cancer"},{"id":66407204,"name":"Biological sciences/Computational biology and bioinformatics"},{"id":66407205,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2026-04-21T01:22:42+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-21 01:22:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8769917","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8769917","identity":"rs-8769917","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.