Functions of violaxanthin de­epoxidase-related (VDR) in the photoprotective response to high-light stress

Functions of violaxanthin de­epoxidase-related (VDR) in the photoprotective response to high-light stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Functions of violaxanthin de­epoxidase-related (VDR) in the photoprotective response to high-light stress Jingwei Wei, Hongyu Huang, Shi Zhang, Jing Zhang, Weike Sun, Yichao Huang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3731188/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract The xanthophyll cycle is crucial for protecting plants and algae from photodamage. While the resistance of the violaxanthin de-epoxidase enzyme (VDE) to high-light stress in the xanthophyll cycle has been extensively studied, there is limited knowledge about VDE-related (VDR) proteins, which share a close homologous relationship with VDEs. In this study, we conducted a preliminary investigation of VDR protein from the aspects of basic bioinformatics, spatiotemporal gene expression patterns, and strong light stress treatment. Through subcellular localization experiments, we observed that the CsVDR-GFP protein was predominantly located in chloroplasts. CsVDR was expressed in all tissues of Arabidopsis and cucumber, with the highest expression level observed in mature leaves cultivated for 20 days in cucumber. Interestingly, both CsVDR and AtVDR were identified as high-light response genes. However, when subjected to high-light stress, all CRISPR/Cas9 mediated gene-edited Arabidopsis mutants ( Atvdr ) exhibited a decreasing trend in the de-epoxidation ratio of (A+Z)/(A+Z+V) and non-photochemical quenching (NPQ) compared to the wild-type (WT) lines. This suggests that the xanthophyll cycle in Atvdr was less effective and more susceptible to photoinhibition of PSII under high-light stress. Our findings provide evidence that VDR proteins play a role in regulating the high-light response in plants, thereby offering a theoretical basis for further investigation into plant photoprotective pathways. Xanthophyll cycle High-light VDE VDR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Light is a crucial energy source for plants, and a lack of sufficient light can hinder photosynthesis. However, excessive light absorption by plants can lead to photoinhibition, particularly in the presence of stress factors like drought and salt stress (Lin et al. 2022 ; He et al. 2021). Over time, plants have developed sophisticated mechanisms to protect themselves from potential damage caused by excess light (Renata et al. 2015). These mechanisms include leaf and chloroplast movement for light protection, NPQ processes that convert absorbed light energy into thermal energy, cyclic electron transport around PSI, and ROS-scavenging systems (Horton and Hague 1998; Jin et al. 2014 ; Cazzaniga et al. 2013 ). However, severe damage and photo-oxidation can irreversibly deactivate the photosynthetic system, resulting in high-light stress, which ultimately impacts plant growth, crop yield, and quality (Paxton et al. 2001). The xanthophyll cycle plays a crucial role in regulating the heat dissipation capacity of plants by affecting the qE (Quantum efficiency) component of NPQ (Kong et al. 2015 ). In high-light conditions, violaxanthin de-epoxidase enzymes (VDEs) can catalyze the conversion of violaxanthin (V) to zeaxanthin (Z) through an intermediate called antheraxanthin (A) (Saga et al. 2010 ). Zeaxanthin and antheraxanthin are involved in dissipating excess light energy as heat in plants, thereby protecting photosynthetic organs from light damage (Xu et al. 2016 ). Previous studies have demonstrated that VDE exhibits significant sequence similarity in the middle and C-terminal regions, which contain the lipocalin superfamily domain (Arnoux et al. 2009 ). This domain comprises conserved cysteine residues that facilitate VDE's attachment to the thylakoid membrane under acidic pH conditions, allowing it to bind to its violaxanthin substrate (Arnoux et al. 2009 ). Genome sequencing has revealed that the VDRs (violaxanthin de-epoxidase-related genes) and VDLs (violaxanthin de-epoxidase-like genes) possess the lipocalin superfamily domain and belong to the VDE superfamily (Coesel et al. 2008 ; Girolomoni et al. 2020 ). According to phylogenetic tree analysis, VDEs, VDLs, and VDRs exhibit external homology to the original VDEs, with the VDL and VDR proteins arising from two replication events (Coesel et al. 2008 ; Girolomoni et al. 2020 ). While VDEs and VDRs are found in plants, the absence of VDL proteins could be attributed to their loss during evolution or their occurrence exclusively in secondary endosymbiotic photoautotrophs (Coesel et al. 2008 ; Girolomoni et al. 2020 ). Currently, there are numerous studies investigating the role of VDEs in resistance to high-light stress. For instance, Arabidopsis VDE mutants ( Atnpq1 ) have demonstrated significant suppression of NPQ and leaf development-dependent photosynthetic defects damage (Havaux et al. 2000 ; Niyogi et al. 1998 ). In tobacco, the overexpression of LeVDE has been found to reduce its sensitivity to high-light inhibition (Guan et al. 2014). Similarly, AhVDE has shown the ability to alleviate PSII photoinhibition under high temperature and light stress in peanuts by enhancing xanthophyll cycle-dependent energy consumption (Yang et al. 2015 ). A recent study has revealed that overexpressing AtVDE , AtPsbS , or AtZEP in soybeans can accelerate NPQ relaxation, thereby improving photosynthetic efficiency under fluctuating light conditions and increasing seed yield (Souzal et al. 2022). While the function of VDEs in the high-light response of plants has been extensively studied, there is a lack of research on the function of VDRs, which are homologous to VDEs in plants. Here, we preliminarily investigated the biological function of CsVDR and AtVDR . Subcellular localization experiments revealed that CsVDR-GFP protein was predominantly located in chloroplasts. GUS histochemical staining and qRT-PCR analysis demonstrated that CsVDR was widely expressed in all tissues of Arabidopsis and cucumber, while the highest expression level of CsVDR was presented in mature leaves cultivated for 20 days in cucumber. Additionally, it was remarkable that both CsVDR and AtVDR were high-light response genes. Whereas, under high-light stress, the de-epoxidation ratio of (A + Z)/(A + Z + V) and non-photochemical quenching (NPQ) were decreased within all CRISPR/Cas9 mediated gene-edited Arabidopsis mutants ( Atvdr ), compared to wild-type (WT) lines. The xanthophyll cycle in Atvdr was less effective and more susceptible to photoinhibition of PSII under high-light stress. Our study indicated that VDRs are functionally redundant with VDEs and played a crucial role in plant responses to high-light conditions, providing a theoretical basis for studying plant photoprotection pathways. Materials and methods Plant material and sample collection Cucumber ( Cucumis sativus L., Xintaimici) plants were grown in 30×30 cm seedlings basin in a growth chamber with 25°C/18°C (day/night), and photoperiod of 12 h/12 h (light/dark), and under a light intensity of 500 mmol m − 2 s − 1 . High-light response analysis was initiated when the plants grew to 4–5 true leaves; the leaves were irradiated under high-light (1200 mmolžm − 2 s − 1 ) or control light (500 mmolžm- 2 s −1 ) for 0 h, 2 h, 4 h, 8 h, and 12 h. For tissue expression analysis, plants were grown in the greenhouses at China Agricultural University until fruit development, and samples were extracted from different tissues for gene expression analysis. The leaf development expression analysis of CsVDR , day 0 was defined as the first unexpanded leaf counted from the tip and recorded every five days. All the leaves were collected on the 40th day (marked as 0 d, 5 d, 15 d, 20 d, 25 d, 30 d, 35 d, and 40 d, respectively) for analysis. The Arabidopsis Col-0 (ecotype Columbia) and mutants ( Atvdr ) were grown in a growth chamber with the temperature (22°C/16°C) and light (200 µmolžm − 2 s − 1 ) for 10 h/14 h day/night cycle. High-light treatment was performed when the plant had grown 10–15 rosette leaves. After the plants were exposed to 1000 mmolžm − 2 s − 1 of high-light or 200 mmol m-2 s-1 of control light for 0, 1, 2, 4, 6, 8, and 10 hours, the leaves were quickly sampled in liquid nitrogen and used for subsequent qRT-PCR experiments. Sequence analyses and phylogenetic tree analysis A phylogenetic tree was generated using MEGA X and a maximum likelihood tree method (Tamura et al. 2011 ). The protein sequence of VDEs, VDLs and VDRs within Cucurbitaceae, Arabidopsis , Solanaceae, Gramineae, and Cyanobacteria were retrieved from NCBI ( https://www.ncbi.nlm.nih.gov/ ), CuGenDB ( http://www.cucurbitgenomics.org/ ), TAIR ( https://www.arabidopsis.org/ ), Sol Genomics Network ( https://solgenomics.net/ ), Ensembl Plants ( https://plants.ensembl.org/ ) and JGI ( https://img-dev.jgi.doe.gov/ ), respectively. The sequence information of proteins used for the phylogenetic development analysis within algae and terrestrial plants is compiled in supplementary table S1 . The protein domain analysis, secondary structures analysis, and the tertiary structural analysis of VDE/VDR proteins were predicted based on the websites of NCBI ( https://www.ncbi.nlm.nih.gov/ ), PSIPRED ( http://bioinf.cs.ucl.ac.uk/psipred/ ) and SWISS-MODEL ( http://swissmodel.expasy.org/ ), respectively. The whole proteins of VDE/VDR were analyzed for domain analysis and secondary structures analysis in this study, and the tertiary structure analysis was predicted using the central lipocalin domain, based on the research of Arnoux et al. ( 2009 ). Cloning of CsVDR and AtVDR The sequences of CsVDR and AtVDR were initially identified from CuGenDB ( http://www.cucurbitgenomics.org/ ) and TAIR ( https://www.arabidopsis.org/ ). The CsVDR was cloned from cucumber using the forward primer (5’-ATGAAAGTGGAGTTGAATTTCAATT-3’) and the reverse primer (5’-TTATTTAACCTCAATCACATTATGC-3’). The AtVDR was cloned from Arabidopsis using the forward primer (5’-ATGGCGGCGATTCCTCTCAAAGCTC-3’) and the reverse primer (5’-TTAGTTGAATTTTTCTTCCGAGTCT-3’). Subcellular localization analysis of CsVDR and AtVDR To investigate the subcellular localization of CsVDR, the full-length CDS sequences of CsVDR was cloned into the expression vector pBI121-GFP to obtain the recombinant vectors of CsVDR-GFP driven by a CMV35S promoter. Cucumber protoplasts were isolated from mesophyll tissues originating from cucumber young leaves. The protoplast extraction and plasmid transformation were conducted according to the procedure described by Huang et al. ( 2013 ). In short, cucumber leaves were cut into thin strips, placed in an enzymolysis solution for cell dissociation, incubated in darkness with rotation (40–50 r/min), and then filtered and combined with the plasmid and PEG4000-Ca 2+ solution. Transfection was stopped after the W5 (2M NaCl, 1M CaCl 2 , 2M KCl, 0.2M MES, ddH 2 O) solution was added and the GFP fluorescence signals were observed. The identification of CsVDR protein localization in tobacco leaf cells was performed via the Agrobacterium -mediated transient transformation. The GFP fluorescent signals of CsVDR-GFP was detected with a confocal laser scanning microscope (Zeiss LSM510 META) with an excitation wavelength of 488 nm. Histochemical analysis of GUS activity The 710 bp upstream promoter of CsVDR was cloned into the pCAMBIA1391 vector using a forward primer (5’-TATCCTTGTGAACCTCAATTTGATT-3’) and reverse primer (5’-TTCTGTTTTCTGAAAGCAAGGACGA-3’). The recombinant vector prom CsVDR -GUS was transformed into Arabidopsis thaliana mediated by Agrobacterium to obtain T 3 homozygous transgenic plants for GUS staining. Immersing different plant tissues in the staining solution containing 2 mM X-gluc (5-Bromo-4-chloro-3-indolyl-β-D-glucuronide), 50 mM sodium phosphate (pH 7.2), 10 mM EDTA (pH 8.0), 2 mM K ferrous cyanide, 2 mM K ferrous cyanide, and 0.1% (v/v) Triton X-100 (Liu et al. 2021 ). After vacuum infiltration, the samples were dyed overnight at 37°C; then, the tissues were bleached with different concentrations of ethanol (50%, 70%, 95%, and 100%) to remove chlorophyll and photographed with a digital camera (Liu et al. 2021 ). Quantitative real-time PCR Quantitative real-time PCR was carried out using FastFire qPCR PreMix (SYBR Green) (TIANGEN, https://www.tiangen.com/ ). The AtVDR qPCR primers were as follows: 5’-GGGAAAGGGAAGTCGTCGTT-3’; 5’-ACGAAACGTTGCAGGGATCT-3’. The CsVDR qPCR primers were as follows: 5’-TATGCTGCACACCGCAA AAC-3’; 5’-CsVDR-QRT-R: ACGAAACGTTGCAGGGATCT-3’. Plasmid construction and plant transformation The two target sites of the AtVDR CRISPR/Cas9 vector were designed using the CRISPR design tool ( http://crispr.dbcls.jp ). The vector construction was conducted according to the procedure described by Xing et al. ( 2014 ) using the pKSE401 vector provided by Prof. Qi-Jun Chen from China Agricultural University. The constructed pKSE401- AtVDR vector plasmid was transformed into Agrobacterium tumefaciens GV3101 competent cells using the heat shock method and then used for Arabidopsis transformation. The target sites of the homozygous positive transgenic plants of the T 2 generation were identified using PCR sequencing. Extraction and analysis of photosynthetic pigment Different Arabidopsis gene-edited lines of AtVDR leaves were exposed to high-light (1000 mmolžm − 2 s − 1 ) stress for 10 h, and 0.1 g leaves were frozen immediately in liquid nitrogen for the de-epoxidation ratio analysis. The process of extracting pigments (violaxanthin, antheraxanthin, and zeaxanthin) from Arabidopsis thaliana leaves was described previously (Moulé et al. 2002). Briefly, samples were first extracted with 80% acetone and then with 100% acetone. After filtering, the pigment extracts were analyzed via HPLC with a YMC carotenoid 250×4.6 mmlžD s − 5 µm detection column (CT99S05-245WT). The mobile phase A of HPLC was 95% methanol: 5% water and the mobile phase B was methyl tert-butyl ether. The standard samples of violaxanthin, antheraxanthin, and zeaxanthin were purchased from Sigma ( https://www.sigmaaldrich.cn/CN/zh ). Fluorescence video imaging and chlorophyll fluorescence measurements The chlorophyll fluorescence parameters of wild-type and AtVDR knock-out lines (CL6, L6, L2) were measured with a Fluor Cam 1000-H handheld fluorescent protein imaging instrument (Photon Systems Instruments, Czech). Before measuring the data, the materials were treated in the dark for 30 min to determine the initial fluorescence (Fo). The maximum fluorescence (Fm) of all reaction centers was determined by a saturated pulse of 0.8 s at 6000 µmolžm − 2 s − 1 under dark adaptation, then, the materials were treated with light adaptation, and the actinic light was turned on with an intensity of 1000 µmolžm − 2 s − 1 for 10 min as the maximum fluorescence under light adaptation (Fm’) (Suarez et al. 2022). The main analysis of this experiment: NPQ (Non-photochemical quenching) was calculated as (Fm-Fm’)/Fm’, Fv/Fm (PSII photochemical efficiencies) was calculated as (Fm-Fo)/Fm. Results Phylogenetic analysis of VDRs Phylogenetic analysis was conducted to investigate the evolutionary relationships among VDE, VDL (VDE-like), and VDR (VDE-related) proteins. The analysis included 74 proteins from 28 sequenced species of algae and land plants, focusing on photosynthetic organisms. The resulting evolutionary tree consisted of three branches: VDEs, VDLs, and VDRs, consistent with previous studies (Coesel et al. 2008 ; Girolomoni et al. 2020 ). The analysis revealed that VDL and VDR proteins evolved from VDE protein clusters. VDL proteins were predominantly found in chromalveolates and absent in higher plants and green algae, while VDRs and VDEs were present in higher plants, chromalveolates, and green algae, consistent with previous findings (Fig. 1 ; Coesel et al. 2008 ; Girolomoni et al. 2020 ). Some higher plant species possessed two VDE proteins, whereas higher plants and algae had only one VDR protein. The CsVDR (Csa2G297200) showed the closest relationship with the VDR proteins of melon and watermelon, and it was also closely related to Arabidopsis AtVDR (AT2G21860). Additionally, CsVDR and AtVDR formed a clade with homologs from other dicotyledonous plants, separate from those of monocotyledonous plants (Fig. 1 ). Sequence analysis and subcellular localization analysis of CsVDR It has been reported that the sequences of VDLs and VDRs are similar to VDEs, and they both have a lipocalin superfamily protein domain (Coesel et al. 2008 ; Girolomoni et al. 2020 ). The amino acid sequence of CsVDR showed high homology with AtVDR, which includes a conserved lipocalin domain and Cys-rich domain. However, VDR protein has an additional amino acid sequence at the 5’ end (Fig. 2 a and b). Protein alignment revealed that CsVDR and AtVDR both have ten conserved cysteine residues within the N-terminal Cys-rich domain, which is also conserved in VDE proteins and is reported to be critical for substrate catalysis. On the other hand, the lipocalin domain is believed to bind the hydrophobic violaxanthin (V) substrate and contain the catalytic residues (Arnoux et al. 2009 ; Bugos et al. 1998 ). These conserved cysteine residues are also found in VDRs of other plants; however, VDRs do not have the C-terminal glutamate-rich domain, which is conserved in the plant VDE lipocalin superfamily domain (Fig. 2 b; Coesel et al. 2008 ). The analysis of lipocalin domain tertiary structures revealed that CsVDE and CsVDR were similar to AtVDE and contained two α-helices and nine β-sheets, forming a bucket structure (Fig. 2 b). The integrated three-dimensional spatial images showed a high overlap between CsVDR and CsVDE (Fig. 2 c). Additionally, we investigated the subcellular localization of CsVDR by fusing it with GFP and transfecting it into cucumber protoplasts or tobacco leaf cells. The results demonstrated that CsVDR was predominantly located in chloroplasts, which is consistent with the subcellular location of VDE proteins in other plants (Fig. 2 d and e; Li et al. 2013 ; Chen et al. 2017 ). In summary, CsVDR contains a conserved Cys-rich domain and liposome domain, and its protein is mainly localized in chloroplasts. Expression pattern exploration of CsVDR The interval between CsVDR and the upstream gene was 710 bp. Therefore, the 710 bp sequence was cloned as the CsVDR promoter and used to drive the GUS reporter gene for histochemical analysis. GUS activity was observed in various organs of the transgenic Arabidopsis plants, including cotyledons, true leaves, hypocotyls, ovary, root, fruit pods, stigma, floral stems, sepals, and vascular tissues of the stamen. However, GUS activity was not observed in the petals. Notably, GUS activity was higher in the vascular tissues of leaves and sepals compared to other tissues (Fig. 3 a). The expression level of CsVDR , as determined by qRT-PCR, was highest in mature leaves, followed by old leaves, flowers, and young leaves. It was relatively low in roots, stems, and fruits. Furthermore, the transcription of CsVDR increased with leaf development, peaking at the 20th day, and then decreased. These findings suggest that CsVDR is primarily expressed in photosynthetic organs and may play a role in light response (Fig. 3 b and c). Both CsVDR and AtVDR are respond to high-light stress To investigate the impact of excessive light on VDR genes expression, we conducted experiments using wild-type cucumbers and Arabidopsis plants. These plants were subjected to both high-light and normal-light conditions. Under normal-light conditions, the transcription level of CsVDR peaked at 2 hours and then gradually decreased to a minimum at 12 hours. However, under high-light conditions, the expression pattern of CsVDR showed a gradual increase at the beginning of the day, reaching its peak at 4 hours, followed by a decrease to a minimum at 8 hours. It remained at a low level until 12 hours (Fig. 4 a). In Arabidopsis , the transcription level of AtVDR remained relatively stable under normal-light conditions. Although there was a slight decrease in the expression level of AtVDR at 1 hour and 6 hours, the overall expression level gradually increased with time under high-light conditions. These results indicate that CsVDR and AtVDR exhibit a greater responsiveness to high light compared to normal light (Fig. 4 b). Atvdr mutation leads to reduced de-epoxidation ratio and NPQ values Arabidopsis VDR mutants ( Atvdr ) were generated using CRISPR/Cas9 gene editing technology to examine the effects of AtVDR on the xanthophyll cycle and NPQ. Three homozygous Atvdr T 2 lines (L2, CL6, and L6) were successfully identified (Fig. 5 a). After subjecting the Atvdr and WT plants to high-light treatment for 10 hours, the de-epoxidation rate of CL6 and L6 mutants was found to be lower compared to the WT (Fig. 5 b). Although the L2 lines did not exhibit significant changes compared to the wild type, their NPQ was lower than that of the wild type. This phenomenon may be attributed to the redundant functions of VDR and VDE in photoprotection. The original maximum fluorescence efficiency of PSII (Fv/Fm) was not altered in Atvdr compared to WT, indicating that the plants were grown under favorable conditions prior to treatment (Fig. 5 c; Chen et al., 2022 ). However, all the Atvdr mutants exhibited a noticeable reduction in NPQ (Fig. 5 c). These findings suggest that the Atvdr mutant has a diminished capacity for heat dissipation, decreased conversion of A and Z, lower NPQ levels compared to WT plants, and also demonstrates a certain degree of photoinhibition. Discussion Bioinformatic analysis of VDR and VDE In plants and algae, VDLs and VDRs are similar to VDEs and share similar functional domains, known as the lipid transporter-FABP superfamily (Fig. 2 a). This superfamily consists of a large group of proteins that bind small hydrophobic (lipophilic) molecules (Bugos et al. 1998 ). Carotenoids are hydrophobic molecules that participate in the xanthophyll cycle. Therefore, we hypothesized that VDRs may also be involved in carotenoid biosynthesis, similar to VDEs in plants and VDLs in algae (Coesel et al. 2008 ; Adams et al. 1991; Dautermann et al. 2020 ). The VDRs of higher plants contains a conserved cysteine residue at the N-terminal in the lipocalin superfamily domain. This residue can form disulfide bonds, which are critical for the function of VDE proteins (Fig. 2 a and b) (Flower et al. 1993 ). Additionally, the CsVDR and AtVDR proteins have a lipocalin domain similar to AtVDE. This domain consists of eight β-strands forming a conical barrel that encloses an internal ligand binding site. It may play a role in binding a substrate with a similar molecular structure, such as violaxanthin or other carotenoids (Fig. 2 c) (Bugos et al. 1998; Flower et al. 1993 ; Hieber et al. 2000 ). In conclusion, the conserved functional domains and amino acid residues present in the VDE and VDR proteins suggesting that they have similar functions in plants and may act on substrates with a similar molecular structure. The VDE and VDR genes were generated through gene duplication events before secondary endosymbiosis. The VDL proteins, found only in chromalveolate algae, resulted from a second duplication of the VDR proteins (Coesel et al. 2008 ). VDLs are known to catalyze the conversion of violaxanthin to neoxanthin and may also play a role in the production of other light-harvesting carotenoids like peridinin and vaucheriaxanthin (Dautermann et al. 2020 ). In algae, VDLs connect the xanthophyll cycle and the diadinoxanthin cycle (Dautermann et al. 2020 ). Phylogenetic analysis revealed the absence of the VDL genes in higher plants, which aligns with previous findings (Fig. 1 ) (Dautermann et al. 2020 ). However, VDR proteins are ubiquitous in higher plants. Considering the evolutionarily conserved functional domains of VDE, VDL, and VDR proteins, it is speculated that VDRs may also be involved in photoprotection and the catalysis of light-harvesting carotenoids in higher plants, albeit with some differences compared to algae due to distinct photoprotective mechanisms (Dautermann et al., 2020 ). Tissue specificity and subcellular localization of CsVDR It has been reported that VDEs exist in the thylakoid vesicles of higher plants. VDEs require ascorbic acid as a co-substrate and are activated by light-dependent intraluminal acidification (Hager 1969 ). The subcellular localization of the VDE proteins has also been studied in a variety of plants, including cucumber, rice, spinach, Cerasus humilis , and others (Li et al. 2013 ; Wang et al. 2021 ; Emanuelsson et al. 2003 ; Sun et al. 2019 ). However, the subcellular localization and gene function of VDRs have not been reported. This study demonstrates that CsVDR is located in the chloroplasts, consistent with previous studies on VDE (Li et al. 2013 ). It suggests that CsVDR and AtVDR may have a similar function in the photoresponse. qRT-PCR and GUS expression analyses revealed that CsVDR was highly expressed in green photosynthetic tissues, particularly in mature leaves (Fig. 3 ). This finding aligns with previous studies on CsVDE and LeVDE , which also demonstrated their predominant expression in photosynthetic tissues (Li et al. 2013 ; Han et al. 2010 ). Notably, the expression of VDEs has been reported in the immature leaves of lettuce and cucumber as well (Li et al. 2013 ; Bugos and Yamamoto 1996 ). The expression level of CsVDE increased during leaf development, peaking in mature leaves, and subsequently decreased (Li et al. 2013 ). Interestingly, a similar expression pattern was observed for CsVDR , suggesting that VDR and VDE exhibit similarities in their localization and tissue distribution. This implies that VDR protein may play a role in the photoresponse and is concomitant with leaf development, similar to VDE protein. CsVDR response to high-light conditions VDE proteins are responsible for catalyzing the xanthophyll cycle and have a significant role in regulating the heat dissipation capacity of plants through their impact on qE components (Jahns et al. 2009 ). VDR proteins have a high similarity to VDE proteins, and the expression level of CsVDR and AtVDR increases under high-light stress, indicating a clear response to high-light conditions (Fig. 4 ; Li et al. 2013 ). Interestingly, the response pattern of CsVDR to high-light stress was similar to that of CsVDE . Both reached their maximum transcription level after 4 hours of high-light stress and then decreased (Fig. 4 a; Li et al. 2013 ). These results lead us to speculate that VDEs and VDRs may be involved in the same high-light response process. Previous studies have shown that plants have limited efficiency in converting violaxanthin to zeaxanthin. The deletion or suppression of VDE in Arabidopsis ( Atnpq1 ) and tobacco (Niyogi et al. 1998 ; Chang et al. 2000 ) has been found to result in a reduction in NPQ value. In soybeans, the overexpression of the AtVDE , AtPsbS , and AtZEP has been shown to decrease the levels of violaxanthin (V) and increase the content of zeaxanthin (Z) during high-light exposure. This increase in photosynthetic efficiency under fluctuating light has led to a 33% increase in seed production (Souzal et al. 2022). The L6 and CL6 lines exhibited a decrease in the de-epoxidation ratio and NPQ. However, the de-epoxidation ratio of the L2 lines did not show significant changes compared to the wild type, although its NPQ was lower. This phenomenon is likely due to the redundant functions of VDR and VDE in the photoprotection process. VDE plays a major regulatory role under high-light stress in plants, while VDR plays an auxiliary role. Apart from the xanthophyll cycle, other protective mechanisms, such as the lutein epoxide cycle, may also exist to help plants avoid photoinhibition. This could explain the lack of significant change in the de-epoxidation ratio in the L2 line (Plazapla et al. 2007). Further studies can be conducted to explore the potential of VDR overexpression in improving plant photosynthetic efficiency under fluctuating light and increasing yield. Additionally, considering the similar protein structure, close evolutionary relationship, similar subcellular localization, and similar expression levels and phenotypes of VDR and VDE mutants, it is speculated that VDR may be involved in affecting the xanthophyll cycle pathway and thus influencing plant sensitivity to high-light stress. Conclusion In this study, CsVDR was successfully cloned and observed a highest expression level in mature leaves cultivated for 20 days in cucumber. CsVDR shared a high homology with VDE proteins and its protein was predominantly located in chloroplasts. CsVDR and AtVDR were identified as high-light response genes, while Atvdr mutants exhibited a decreasing trend in the de-epoxidation ratio of (A + Z)/(A + Z + V) and non-photochemical quenching (NPQ) compared to the wild-type (WT) lines, which suggesting that the xanthophyll cycle in Atvdr was less effective and more susceptible to photoinhibition of PSII under high-light stress. Declarations Acknowledgments We thank Prof. Zhenxian Zhang (College of horticulture, China Agricultural University) for providing the initial idea of this paper. Funding This work was supported by the National Natural Science Foundation of China (grant nos. 31801850), the National Key Research and Development Program of China (2019YFD1000300), the 111 Project (B17043), and the Construction of Beijing Science and Technology Innovation and Service Capacity in Top Subjects (CEFF-PXM2019_014207_000032). Author information Beijing Key Laboratory of Growth and Developmental Regulation for Protected Vegetable Crops, College of Horticulture, China Agricultural University, Beijing100193, P. R. China Jingwei Wei, Shi Zhang, Jing Zhang, Weike Sun, Yichao Huang, Si Ma, Syed Aizaz Ali Shah, Yongqiang Tian, Zhenxian Zhang, Lihong Gao, Xin Li State Key Laboratory of Vegetable Germplasm Innovation, Tianjin Kerenl Cucumber Research Institute, Tianjin 300192, P. R. China Hongyu Huang Contributions Zhenxian Zhang and Xin Li contributed to the study conception. Lihong Gao, Yongqiang Tian and Si Ma participated in the experimental design. Jing Zhang and Shi Zhang performed the experiment. Weike Sun, Yichao Huang and Syed Aizaz Ali Shah collected samples and statistical data. Hongyu Huang provided necessary resources for research completion. The first draft of the manuscript was written by Shi Zhang, Xin Li and Jingwei Wei reviewed the draft. All authors contributed to the article and approved the submission. Corresponding authors Correspondence to Xin Li ( [email protected] ). Conflict of interest The authors declare that the research has no competing interests. References Adams B. D., Adams W. W. (1991). The role of xanthophyll cycle carotenoids in the protection of photosynthesis. Trends In Plant Science,1(1), 21-26. https://doi.org/10.1016/S1360-1385(96)80019-7 Arnoux P., Morosinotto T., Saga G., Bassi R., Pignol D. (2009). A structural basis for the pH-dependent xanthophyll cycle in Arabidopsis thaliana. The Plant cell, 21 (7), 2036-44. https://doi.org/10.1105/tpc.109.068007 Bugos R.C., Hieber A. D., Yamamoto H.Y. (1998). Xanthophyll cycle enzymes are members of the lipocalin family, the first identified from plants. The Journal of biological chemistry, 273 (25), 15321-4. https://doi.org/10.1074/jbc.273.25.15321 Bugos R.C., Yamamoto H.Y. (1996). Molecular cloning of violaxanthin de-epoxidase from romaine lettuce and expression in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 93 (13), 6320-5. https://doi.org/10.1073/pnas.93.13.6320 Cazzaniga S., Dall' Osto L., Kong S.G., Wada M., Bassi R. (2013). Interaction between avoidance of photon absorption, excess energy dissipation and zeaxanthin synthesis against photooxidative stress in Arabidopsis. The Plant journal : for cell and molecular biology, 76 (4), 568-79. https://doi.org/10.1111/tpj.12314 Chang S.H., Bugos R.C., Sun W.H., Yamamoto H.Y. (2000). Antisense suppression of violaxanthin de-epoxidase in tobacco does not affect plant performance in controlled growth conditions. Photosynthesis research, 64 (1), 95-103. https://doi.org/10.1023/A:1026518524426 Chen H., Cheng Q., Chen Q., Ye X., Qu Y., Song W., Fahad S., Gao J., Saud S., Xu Y., Shen Y. (2022). Effects of Selenium on Growth and Selenium Content Distribution of Virus-Free Sweet Potato Seedlings in Water Culture. Frontiers in plant science, 13, 965649. https://doi.org/10.3389/fpls.2022.965649 Chen L., Yan Z., Xia Z., Cheng Y., Jiao Z., Sun B., Zhou T., Fan Z. (2017). A Violaxanthin Deepoxidase Interacts with a Viral Suppressor of RNA Silencing to Inhibit Virus Amplification. Plant physiology, 175 (4), 1774-1794. https://doi.org/10.1104/pp.17.00638 Coesel S., Oborník M., Varela J., Falciatore A., Bowler C. (2008). Evolutionary origins and functions of the carotenoid biosynthetic pathway in marine diatoms. PloS one, 3 (8), e2896. https://doi.org/10.1371/journal.pone.0002896 Dautermann O., Lyska D., Andersen-Ranberg J., Becker M., Fröhlich-Nowoisky J., Gartmann H., Krämer L.C., Mayr K., Pieper D., Rij L.M., Wipf H.M., Niyogi K.K., Lohr M. (2020). An algal enzyme required for biosynthesis of the most abundant marine carotenoids. Science advances, 6 (10), eaaw9183. https://doi.org/10.1126/sciadv.aaw9183 De Souza A.P., Burgess S.J., Doran L., Hansen J., Manukyan L., Maryn N., Gotarkar D., Leonelli L., Niyogi K.K., Long S.P. (2022). Soybean photosynthesis and crop yield are improved by accelerating recovery from photoprotection. Science, 377 (6608), 851-854. https://doi.org/10.1126/science.adc9831 Emanuelsson A., Eskling M., Åkerlund H. E. (2003). Chemical and mutational modification of histidines in violaxanthin de-epoxidase from Spinacia oleracea. Physiologia Plantarum, 119: 97-104. https://doi.org/10.1034/j.1399-3054.2003.00151.x Flower D. R., North A. C., Attwood T. K. (1993). Structure and sequence relationships in the lipocalins and related proteins. Protein science, 2(5), 753–761. https://doi.org/10.1002/pro.5560020507 García-Plazaola J.I., Matsubara S., Osmond C.B. (2007). The lutein epoxide cycle in higher plants: its relationships to other xanthophyll cycles and possible functions. Functional plant biology: FPB, 34 (9), 759-773. https://doi.org/10.1071/FP07095 Girolomoni L., Bellamoli F., de la Cruz Valbuena G., Perozeni F., D'Andrea C., Cerullo G., Cazzaniga S., Ballottari M. (2020). Evolutionary divergence of photoprotection in the green algal lineage: a plant-like violaxanthin de-epoxidase enzyme activates the xanthophyll cycle in the green alga Chlorella vulgaris modulating photoprotection. The New phytologist, 228 (1), 136-150. https://doi.org/10.1111/nph.16674 Guan C., Ji J., Zhang X., Li X., Jin C., Guan W., Wang G. (2015). Positive feedback regulation of a Lycium chinense-derived VDE gene by drought-induced endogenous ABA, and over-expression of this VDE gene improve drought-induced photo-damage in Arabidopsis. Journal of plant physiology, 175, 26-36. https://doi.org/10.1016/j.jplph.2014.06.022 Hager A. (1969). Light dependent decrease of the pH-value in a chloroplast compartment causing the enzymatic interconversion of violaxanthin to zeaxanthin; relations to photophosphorylation. Planta, 89(3), 224–243. https://doi.org/10.1007/BF00385028 Han H., Gao S., Li B., Dong X.C., Feng H.L., Meng Q.W. (2010). Overexpression of violaxanthin de-epoxidase gene alleviates photoinhibition of PSII and PSI in tomato during high light and chilling stress. Journal of plant physiology, 167 (3), 176-83. https://doi.org/10.1016/j.jplph.2009.08.009 Havaux M., Bonfils J.P., Lütz C., Niyogi K.K. (2000). Photodamage of the photosynthetic apparatus and its dependence on the leaf developmental stage in the npq1 Arabidopsis mutant deficient in the xanthophyll cycle enzyme violaxanthin de-epoxidase. Plant physiology, 124 (1), 273-84. https://doi.org/10.1104/pp.124.1.273 Hieber A. D., Bugos R. C., Yamamoto H. Y. (2000). Plant lipocalins: violaxanthin de-epoxidase and zeaxanthin epoxidase. Biochimica et biophysica acta, 1482(1-2), 84–91. https://doi.org/10.1016/s0167-4838(00)00141-2 Horton P., Hague A. (1988).Studies on the induction of chlorophyll fluorescence in isolated barley protoplasts. IV. Resolution of non-photochemical quenching. BBA - Bioenergetics, 932(1):107-115. https://doi.org 10.1016/0005-2728(88)90144-2. Huang H., Wang Z., Cheng J., Zhao W., Li X., Wang H., Zhang Z., Sui X. (2013). An efficient cucumber (Cucumis sativus L.) protoplast isolation and transient expression system. Scientia Horticulturae,150 (0), 206-212. https://doi.org/10.1016/j.scienta.2012.11.011 Jahns P., Latowski D., Strzalka K. (2009). Mechanism and regulation of the violaxanthin cycle: the role of antenna proteins and membrane lipids. Biochimica et biophysica acta, 1787 (1), 3-14. https://doi.org/10.1016/j.bbabio.2008.09.013 Jin H., Liu B., Luo L., Feng D., Wang P., Liu J., Da Q., He Y., Qi K., Wang J., Wang H.B. (2014). HYPERSENSITIVE TO HIGH LIGHT1 interacts with LOW QUANTUM YIELD OF PHOTOSYSTEM II1 and functions in protection of photosystem II from photodamage in Arabidopsis. The Plant cell, 26 (3), 1213-29. https://doi.org/10.1105/tpc.113.122424 Kong L., Sun M., Xie Y., Wang F., Zhao Z. (2015). Photochemical and antioxidative responses of the glume and flag leaf to seasonal senescence in wheat. Frontiers in plant science, 6, 358. https://doi.org/10.3389/fpls.2015.00358 Li X., Zhao W., Sun X., Huang H., Kong L., Niu D., Sui X., Zhang Z. (2013). Molecular cloning and characterization of violaxanthin de-epoxidase (CsVDE) in cucumber. PloS one, 8 (5), e64383. https://doi.org/10.1371/journal.pone.0064383 Lin W., Yu Z., Luo Y., He W., Yan G., Peng C. (2022). Photoprotection Differences between Dominant Tree Species at Mid- and Late-Successional Stages in Subtropical Forests in Different Seasonal Environments. International journal of molecular sciences, 23 (10), . https://doi.org/10.3390/ijms23105417 Liu S., Liu C., Wang X., Chen H. (2021). Seed-specific activity of the Arabidopsis β-glucosidase 19 promoter in transgenic Arabidopsis and tobacco. Plant cell reports, 40 (1), 213-221. https://doi.org/10.1007/s00299-020-02627-8 Müller-Moulé P., Conklin P.L., Niyogi K.K. (2002). Ascorbate deficiency can limit violaxanthin de-epoxidase activity in vivo. Plant physiology, 128 (3), 970-7. https://doi.org/10.1104/pp.010924 Niyogi K.K., Grossman A.R., Björkman O. (1998). Arabidopsis mutants define a central role for the xanthophyll cycle in the regulation of photosynthetic energy conversion. The Plant cell, 10 (7), 1121-34. https://doi.org/10.1105/tpc.10.7.1121 Payton P., Webb R., Kornyeyev D., Allen R., Holaday A.S. (2001). Protecting cotton photosynthesis during moderate chilling at high light intensity by increasing chloroplastic antioxidant enzyme activity. Journal of experimental botany, 52 (365), 2345-54. https://doi.org/10.1093/jexbot/52.365.2345 Retkute R., Smith-Unna S.E., Smith R.W., Burgess A.J., Jensen O.E., Johnson G.N., Preston S.P., Murchie E.H. (2015). Exploiting heterogeneous environments: does photosynthetic acclimation optimize carbon gain in fluctuating light?. Journal of experimental botany, 66 (9), 2437-47. https://doi.org/10.1093/jxb/erv055 Saga G., Giorgetti A., Fufezan C., Giacometti G.M., Bassi R., Morosinotto T. (2010). Mutation analysis of violaxanthin de-epoxidase identifies substrate-binding sites and residues involved in catalysis. The Journal of biological chemistry, 285 (31), 23763-70. https://doi.org/10.1074/jbc.M110.115097 Suárez J.C., Vanegas J.I., Anzola J.A., Contreras A.T., Urban M.O., Beebe S.E., Rao I.M. (2022). Impact of Web Blight on Photosynthetic Performance of an Elite Common Bean Line in the Western Amazon Region of Colombia. Plants (Basel, Switzerland), 11 (23), . https://doi.org/10.3390/plants11233238 Sun L.N., Wang F., Wang J.W., Sun L.J., Gao W.R., Song X.S. (2019). Overexpression of the ChVDE gene, encoding a violaxanthin de-epoxidase, improves tolerance to drought and salt stress in transgenic Arabidopsis. 3 Biotech, 9 (5), 197. https://doi.org/10.1007/s13205-019-1732-6 Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution, 28 (10), 2731-9. https://doi.org/10.1093/molbev/msr121 Wang X., Ren P., Ji L., Zhu B., Xie G. (2021). OsVDE, a xanthophyll cycle key enzyme, mediates abscisic acid biosynthesis and negatively regulates salinity tolerance in rice. Planta, 255 (1), 6. https://doi.org/10.1007/s00425-021-03802-1 Xing H.L., Dong L., Wang Z.P., Zhang H.Y., Han C.Y., Liu B., Wang X.C., Chen Q.J. (2014). A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC plant biology, 14, 327. https://doi.org/10.1186/s12870-014-0327-y Xu J., Li Z., Yang H., Yang X., Chen C., Li H. (2016). Genetic Diversity and Molecular Evolution of a Violaxanthin De-epoxidase Gene in Maize. Frontiers in genetics, 7,131. https://doi.org/10.3389/fgene.2016.00131 Yan K., Wu C., Zhang L., Chen X. (2015). Contrasting photosynthesis and photoinhibition in tetraploid and its autodiploid honeysuckle (Lonicera japonica Thunb.) under salt stress. Frontiers in plant science, 6, 227. https://doi.org/10.3389/fpls.2015.00227 Yang S., Meng D.Y., Hou L.L., Li Y., Guo F., Meng J.J., Wan S.B., Li X.G. (2015). Peanut violaxanthin de-epoxidase alleviates the sensitivity of PSII photoinhibition to heat and high irradiance stress in transgenic tobacco. Plant cell reports, 34 (8), 1417-28. https://doi.org/10.1007/s00299-015-1797-6 Supplementary Files SupplementarytableS1.xlsx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revisions 20 Jan, 2024 Reviewers agreed at journal 02 Jan, 2024 Reviewers invited by journal 02 Jan, 2024 Editor invited by journal 21 Dec, 2023 Editor assigned by journal 11 Dec, 2023 First submitted to journal 08 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3731188","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":264825385,"identity":"80ba6683-5286-4114-a6c1-ee5caef82072","order_by":0,"name":"Jingwei Wei","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jingwei","middleName":"","lastName":"Wei","suffix":""},{"id":264825386,"identity":"ae24fcd2-66be-48d6-9037-d9af3d05a202","order_by":1,"name":"Hongyu Huang","email":"","orcid":"","institution":"Tianjin Kerenl Cucumber Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Hongyu","middleName":"","lastName":"Huang","suffix":""},{"id":264825387,"identity":"2d02ff55-dfce-4caa-94c0-6190df71a8d5","order_by":2,"name":"Shi Zhang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shi","middleName":"","lastName":"Zhang","suffix":""},{"id":264825388,"identity":"c41f3d6f-5578-4485-beea-92e8ad05f9c1","order_by":3,"name":"Jing Zhang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Zhang","suffix":""},{"id":264825389,"identity":"56a28944-afb8-4714-b4a5-dfa8e2a15333","order_by":4,"name":"Weike Sun","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Weike","middleName":"","lastName":"Sun","suffix":""},{"id":264825390,"identity":"3326cae6-b6c5-4848-b982-40c2349dbbad","order_by":5,"name":"Yichao Huang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yichao","middleName":"","lastName":"Huang","suffix":""},{"id":264825391,"identity":"91a45a57-b50c-4bfa-b46b-38ebc34b2f01","order_by":6,"name":"Si Ma","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Si","middleName":"","lastName":"Ma","suffix":""},{"id":264825392,"identity":"ffbbe0a8-4acd-41f8-99ee-e0e15a60b229","order_by":7,"name":"Syed Aizaz Ali Shah","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Syed","middleName":"Aizaz Ali","lastName":"Shah","suffix":""},{"id":264825393,"identity":"6d319c1e-5c32-49e1-9f31-ae518950c690","order_by":8,"name":"Yongqiang Tian","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yongqiang","middleName":"","lastName":"Tian","suffix":""},{"id":264825394,"identity":"d3c7aae2-bf8d-42b7-93c7-13f359e883b3","order_by":9,"name":"Zhenxian Zhang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhenxian","middleName":"","lastName":"Zhang","suffix":""},{"id":264825395,"identity":"8c388996-ffb1-4a6e-b402-d7bdfc75e89e","order_by":10,"name":"Lihong Gao","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Lihong","middleName":"","lastName":"Gao","suffix":""},{"id":264825396,"identity":"c4ff9077-184f-4711-a0b7-3432c20cd868","order_by":11,"name":"Xin Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArklEQVRIiWNgGAWjYDACZgbGAx8gTAOitTAcnEGaFiA4zEOSFoPjvAcO29TYJTawN2+TYKi5Q1iLZDNfwuGcY8mJDTzHyiQYjj0jrIWfmcfgcG4Dc2KDRI6ZBGPDYcJa2EBaLBvqExvk3xCpBWwLUCXQFh4itUg28xgc7Dl23LiNJ63YIuEYEVoMzp8xfPCjplq2n/3wxhsfaojQAgdsICKBBA2jYBSMglEwCvAAABqTND8o0NLDAAAAAElFTkSuQmCC","orcid":"","institution":"China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2023-12-09 17:55:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3731188/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3731188/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49185608,"identity":"368885f7-93a7-46f9-a35c-8d49e71278cd","added_by":"auto","created_at":"2024-01-04 16:37:48","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3119393,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree depicting the relationship between violaxanthin de-epoxidase (VDE), VDE-related (VDR), and VDE-like (VDL) proteins.\u003c/strong\u003e The multiple sequence alignment analysis was performed using Clustal W, and the phylogenetic tree was constructed using the maximum likelihood tree (ML) method and MEGA X software. The \u003cem\u003eArabidopsis\u003c/em\u003eVDR protein and cucumber VDR protein are represented by black markers.\u003c/p\u003e","description":"","filename":"figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3731188/v1/0734af011789bff344d1abfe.jpg"},{"id":49185613,"identity":"9fc08f9f-b4b1-4308-812d-ec6c4a83554e","added_by":"auto","created_at":"2024-01-04 16:37:48","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":6009850,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStructural analysis and subcellular localization of CsVDR protein.\u003c/strong\u003e \u003cstrong\u003e(a)\u003c/strong\u003e Core domain analysis of CsVDR protein. \u003cstrong\u003e(b)\u003c/strong\u003e The amino acid sequence alignment of CsVDR protein. Dark purple indicating 100% amino acid homology, purple indicating 75% amino acid homology, and light purple indicating 50% amino acid homology. The positions of cysteine residues are marked with red asterisks, β-sheets with orange arrows, and α-helices with purple lines. The Cys-Rich domain is highlighted with a yellow box, and the Lipocalin domain with a green box. \u003cstrong\u003e(c)\u003c/strong\u003e Tertiary structure of the liopocalin domain within CsVDR and CsVDE proteins. \u003cstrong\u003e(d)\u003c/strong\u003eLocalization of CsVDR in cucumber protoplasts. \u003cstrong\u003e(e)\u003c/strong\u003e Subcellular localization of CsVDR in the tobacco leaf cells.\u003c/p\u003e","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3731188/v1/b9cc53524973569a23d4a960.jpg"},{"id":49185609,"identity":"3e9e23d1-2553-4da3-8b87-a2e141ece476","added_by":"auto","created_at":"2024-01-04 16:37:48","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1639885,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTissue localization and spatiotemporal expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCsVDR\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u0026nbsp; \u003cstrong\u003e(a)\u003c/strong\u003e GUS histochemical analysis in various tissues of transgenic \u003cem\u003eArabidopsis\u003c/em\u003e T\u003csub\u003e3\u003c/sub\u003e plants, driven by the \u003cem\u003eCsVDR\u003c/em\u003e’s promoter. The tissues examined include whole seedlings, true leaves, roots, flowers, and pods. \u003cstrong\u003e(b)\u003c/strong\u003e Quantitative real-time PCR analysis of \u003cem\u003eCsVDR\u003c/em\u003e expression in different cucumber tissues. Plants were cultivated in a greenhouse until fruits appeared, and samples were collected from various tissues. The data is presented as the mean value ± standard deviation (SD) of three to six replicates. \u003cstrong\u003e(c)\u003c/strong\u003e Analysis of \u003cem\u003eCsVDR\u003c/em\u003e expression during cucumber leaf development. Leaves were sampled every 5 days from day 0 to day 40. The data is presented as the mean ± standard deviation (SD) of three to six replicates.\u003c/p\u003e","description":"","filename":"figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3731188/v1/104783dd61fbf075e7d4a2ef.jpg"},{"id":49185612,"identity":"b0963cd0-30b0-4048-8ca3-176a99998cf7","added_by":"auto","created_at":"2024-01-04 16:37:48","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2292035,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRelative expression levels of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCsVDR\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAtVDR\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e under normal-light and high-light treatments.\u003c/strong\u003e\u0026nbsp; \u003cstrong\u003e(a)\u003c/strong\u003e \u003cem\u003eCsVDR\u003c/em\u003e responded to high light and normal light in wild-type cucumber. Wild-type cucumbers with 4-6 true leaves were exposed to high light (1200 mmol•m\u003csup\u003e-2\u003c/sup\u003es\u003csup\u003e-1\u003c/sup\u003e) and normal light (500 mmol•m\u003csup\u003e-2\u003c/sup\u003es\u003csup\u003e-1\u003c/sup\u003e) for 0 h, 2 h, 4 h, 8 h, and 12 hours. \u003cstrong\u003e(b)\u003c/strong\u003e \u003cem\u003eAtVDR\u003c/em\u003e responded to high light and normal light in wild-type \u003cem\u003eArabidopsis\u003c/em\u003e. Wild-type \u003cem\u003eArabidopsis thaliana\u003c/em\u003e with 4-6 true leaves exposed to high light (1000 mmol•m\u003csup\u003e-2\u003c/sup\u003es\u003csup\u003e-1\u003c/sup\u003e) and normal light (200 mmol•m\u003csup\u003e-2\u003c/sup\u003es\u003csup\u003e-1\u003c/sup\u003e) for 0 h, 1 h, 2 h, 4 h, 8 h, and 10 h.\u0026nbsp; Data are expressed as the mean ± standard deviation (SD) based on three technical replicates of three biological replicates.\u003c/p\u003e","description":"","filename":"figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3731188/v1/65a93f411f9706041d070950.jpg"},{"id":49185856,"identity":"6196c389-d565-4906-8c6f-dd3d1fa8e467","added_by":"auto","created_at":"2024-01-04 16:45:48","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3542189,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDe-epoxidation ratio (A+Z)/(V+A+Z) and NPQ assays of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAtVDR\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mutants and wild-type.\u003c/strong\u003e \u0026nbsp;\u003cstrong\u003e(a)\u003c/strong\u003e Three \u003cem\u003eAtVDR\u003c/em\u003e knockout lines (L2, CL6, L6) were obtained by CRISPR/Cas9 gene editing technology. L2 was a frameshift mutation whose sequence CCAATCATATTCGAACCAACTTTTTTGACTCAA was different from that of the WT. The CL6 line inserted one T base into the target sequence, and the L6 line inserted one A base into the target sequence. The CL6 and L6 lines inserted one base and resulted in the early termination of translation. \u003cstrong\u003e(b)\u003c/strong\u003e De-epoxidation ratios of wild-type and \u003cem\u003eAtVDR\u003c/em\u003e mutants under high-light (1000 mmol•m\u003csup\u003e-2\u003c/sup\u003es\u003csup\u003e-1\u003c/sup\u003e) treatment for 10 h. (c) Non-photochemical quenching (NPQ) and Fv/Fm of wild-type and \u003cem\u003eAtVDR\u003c/em\u003e mutants measured by a chlorophyll fluoreacence imaging system. Data are presented based on the mean ± standard deviation (SD) of three technical replicates of three biological replicates. A, antheraxanthin; Z, zeaxanthin; V, violaxanthin. NPQ=(Fm-Fm')/Fm'; Fv/Fm=(Fm-Fo)/Fm.\u003c/p\u003e","description":"","filename":"figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3731188/v1/1f6aab163eef5f7673e09492.jpg"},{"id":49186137,"identity":"67fb2de2-a3d5-4309-8e5e-82afb0338fe8","added_by":"auto","created_at":"2024-01-04 16:53:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1292632,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3731188/v1/32863410-ce51-457c-88a7-b70f48027f45.pdf"},{"id":49185611,"identity":"8c109b5a-7c8c-4931-b7a5-f1a1b2c633ef","added_by":"auto","created_at":"2024-01-04 16:37:48","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":28595,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarytableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3731188/v1/b541484a16341f6e50c68150.xlsx"}],"financialInterests":"","formattedTitle":"Functions of violaxanthin de­epoxidase-related (VDR) in the photoprotective response to high-light stress","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLight is a crucial energy source for plants, and a lack of sufficient light can hinder photosynthesis. However, excessive light absorption by plants can lead to photoinhibition, particularly in the presence of stress factors like drought and salt stress (Lin et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; He \u003cem\u003eet al.\u003c/em\u003e 2021). Over time, plants have developed sophisticated mechanisms to protect themselves from potential damage caused by excess light (Renata \u003cem\u003eet al.\u003c/em\u003e 2015). These mechanisms include leaf and chloroplast movement for light protection, NPQ processes that convert absorbed light energy into thermal energy, cyclic electron transport around PSI, and ROS-scavenging systems (Horton and Hague 1998; Jin et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Cazzaniga et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). However, severe damage and photo-oxidation can irreversibly deactivate the photosynthetic system, resulting in high-light stress, which ultimately impacts plant growth, crop yield, and quality (Paxton \u003cem\u003eet al.\u003c/em\u003e 2001).\u003c/p\u003e \u003cp\u003eThe xanthophyll cycle plays a crucial role in regulating the heat dissipation capacity of plants by affecting the qE (Quantum efficiency) component of NPQ (Kong et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In high-light conditions, violaxanthin de-epoxidase enzymes (VDEs) can catalyze the conversion of violaxanthin (V) to zeaxanthin (Z) through an intermediate called antheraxanthin (A) (Saga et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Zeaxanthin and antheraxanthin are involved in dissipating excess light energy as heat in plants, thereby protecting photosynthetic organs from light damage (Xu et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Previous studies have demonstrated that VDE exhibits significant sequence similarity in the middle and C-terminal regions, which contain the lipocalin superfamily domain (Arnoux et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). This domain comprises conserved cysteine residues that facilitate VDE's attachment to the thylakoid membrane under acidic pH conditions, allowing it to bind to its violaxanthin substrate (Arnoux et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenome sequencing has revealed that the VDRs (violaxanthin de-epoxidase-related genes) and VDLs (violaxanthin de-epoxidase-like genes) possess the lipocalin superfamily domain and belong to the VDE superfamily (Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Girolomoni et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). According to phylogenetic tree analysis, VDEs, VDLs, and VDRs exhibit external homology to the original VDEs, with the VDL and VDR proteins arising from two replication events (Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Girolomoni et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). While VDEs and VDRs are found in plants, the absence of VDL proteins could be attributed to their loss during evolution or their occurrence exclusively in secondary endosymbiotic photoautotrophs (Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Girolomoni et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrently, there are numerous studies investigating the role of VDEs in resistance to high-light stress. For instance, \u003cem\u003eArabidopsis VDE\u003c/em\u003e mutants (\u003cem\u003eAtnpq1\u003c/em\u003e) have demonstrated significant suppression of NPQ and leaf development-dependent photosynthetic defects damage (Havaux et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Niyogi et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). In tobacco, the overexpression of \u003cem\u003eLeVDE\u003c/em\u003e has been found to reduce its sensitivity to high-light inhibition (Guan \u003cem\u003eet al.\u003c/em\u003e 2014). Similarly, \u003cem\u003eAhVDE\u003c/em\u003e has shown the ability to alleviate PSII photoinhibition under high temperature and light stress in peanuts by enhancing xanthophyll cycle-dependent energy consumption (Yang et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). A recent study has revealed that overexpressing \u003cem\u003eAtVDE\u003c/em\u003e, \u003cem\u003eAtPsbS\u003c/em\u003e, or \u003cem\u003eAtZEP\u003c/em\u003e in soybeans can accelerate NPQ relaxation, thereby improving photosynthetic efficiency under fluctuating light conditions and increasing seed yield (Souzal \u003cem\u003eet al.\u003c/em\u003e 2022). While the function of VDEs in the high-light response of plants has been extensively studied, there is a lack of research on the function of VDRs, which are homologous to VDEs in plants.\u003c/p\u003e \u003cp\u003eHere, we preliminarily investigated the biological function of \u003cem\u003eCsVDR\u003c/em\u003e and \u003cem\u003eAtVDR\u003c/em\u003e. Subcellular localization experiments revealed that CsVDR-GFP protein was predominantly located in chloroplasts. GUS histochemical staining and qRT-PCR analysis demonstrated that \u003cem\u003eCsVDR\u003c/em\u003e was widely expressed in all tissues of \u003cem\u003eArabidopsis\u003c/em\u003e and cucumber, while the highest expression level of \u003cem\u003eCsVDR\u003c/em\u003e was presented in mature leaves cultivated for 20 days in cucumber. Additionally, it was remarkable that both \u003cem\u003eCsVDR\u003c/em\u003e and \u003cem\u003eAtVDR\u003c/em\u003e were high-light response genes. Whereas, under high-light stress, the de-epoxidation ratio of (A\u0026thinsp;+\u0026thinsp;Z)/(A\u0026thinsp;+\u0026thinsp;Z\u0026thinsp;+\u0026thinsp;V) and non-photochemical quenching (NPQ) were decreased within all CRISPR/Cas9 mediated gene-edited \u003cem\u003eArabidopsis\u003c/em\u003e mutants (\u003cem\u003eAtvdr\u003c/em\u003e), compared to wild-type (WT) lines. The xanthophyll cycle in \u003cem\u003eAtvdr\u003c/em\u003e was less effective and more susceptible to photoinhibition of PSII under high-light stress. Our study indicated that VDRs are functionally redundant with VDEs and played a crucial role in plant responses to high-light conditions, providing a theoretical basis for studying plant photoprotection pathways.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant material and sample collection\u003c/h2\u003e \u003cp\u003eCucumber (\u003cem\u003eCucumis sativus\u003c/em\u003e L., Xintaimici) plants were grown in 30\u0026times;30 cm seedlings basin in a growth chamber with 25\u0026deg;C/18\u0026deg;C (day/night), and photoperiod of 12 h/12 h (light/dark), and under a light intensity of 500 mmol m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. High-light response analysis was initiated when the plants grew to 4\u0026ndash;5 true leaves; the leaves were irradiated under high-light (1200 mmol\u0026#158;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003es\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) or control light (500 mmol\u0026#158;m-\u003csup\u003e2\u003c/sup\u003es\u003csup\u003e\u0026minus;1\u003c/sup\u003e) for 0 h, 2 h, 4 h, 8 h, and 12 h. For tissue expression analysis, plants were grown in the greenhouses at China Agricultural University until fruit development, and samples were extracted from different tissues for gene expression analysis. The leaf development expression analysis of \u003cem\u003eCsVDR\u003c/em\u003e, day 0 was defined as the first unexpanded leaf counted from the tip and recorded every five days. All the leaves were collected on the 40th day (marked as 0 d, 5 d, 15 d, 20 d, 25 d, 30 d, 35 d, and 40 d, respectively) for analysis.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eArabidopsis Col-0\u003c/em\u003e (ecotype Columbia) and mutants (\u003cem\u003eAtvdr\u003c/em\u003e) were grown in a growth chamber with the temperature (22\u0026deg;C/16\u0026deg;C) and light (200 \u0026micro;mol\u0026#158;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003es\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) for 10 h/14 h day/night cycle. High-light treatment was performed when the plant had grown 10\u0026ndash;15 rosette leaves. After the plants were exposed to 1000 mmol\u0026#158;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003es\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e of high-light or 200 mmol m-2 s-1 of control light for 0, 1, 2, 4, 6, 8, and 10 hours, the leaves were quickly sampled in liquid nitrogen and used for subsequent qRT-PCR experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eSequence analyses and phylogenetic tree analysis\u003c/h2\u003e \u003cp\u003eA phylogenetic tree was generated using MEGA X and a maximum likelihood tree method (Tamura et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The protein sequence of VDEs, VDLs and VDRs within Cucurbitaceae, \u003cem\u003eArabidopsis\u003c/em\u003e, Solanaceae, Gramineae, and Cyanobacteria were retrieved from NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), CuGenDB (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cucurbitgenomics.org/\u003c/span\u003e\u003cspan address=\"http://www.cucurbitgenomics.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), TAIR (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.arabidopsis.org/\u003c/span\u003e\u003cspan address=\"https://www.arabidopsis.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), Sol Genomics Network (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://solgenomics.net/\u003c/span\u003e\u003cspan address=\"https://solgenomics.net/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), Ensembl Plants (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://plants.ensembl.org/\u003c/span\u003e\u003cspan address=\"https://plants.ensembl.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and JGI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://img-dev.jgi.doe.gov/\u003c/span\u003e\u003cspan address=\"https://img-dev.jgi.doe.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), respectively. The sequence information of proteins used for the phylogenetic development analysis within algae and terrestrial plants is compiled in supplementary table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. The protein domain analysis, secondary structures analysis, and the tertiary structural analysis of VDE/VDR proteins were predicted based on the websites of NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), PSIPRED (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bioinf.cs.ucl.ac.uk/psipred/\u003c/span\u003e\u003cspan address=\"http://bioinf.cs.ucl.ac.uk/psipred/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and SWISS-MODEL (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://swissmodel.expasy.org/\u003c/span\u003e\u003cspan address=\"http://swissmodel.expasy.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), respectively. The whole proteins of VDE/VDR were analyzed for domain analysis and secondary structures analysis in this study, and the tertiary structure analysis was predicted using the central lipocalin domain, based on the research of Arnoux et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCloning of\u003c/b\u003e \u003cb\u003eCsVDR\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eAtVDR\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe sequences of \u003cem\u003eCsVDR\u003c/em\u003e and \u003cem\u003eAtVDR\u003c/em\u003e were initially identified from CuGenDB (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cucurbitgenomics.org/\u003c/span\u003e\u003cspan address=\"http://www.cucurbitgenomics.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and TAIR (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.arabidopsis.org/\u003c/span\u003e\u003cspan address=\"https://www.arabidopsis.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The \u003cem\u003eCsVDR\u003c/em\u003e was cloned from cucumber using the forward primer (5\u0026rsquo;-ATGAAAGTGGAGTTGAATTTCAATT-3\u0026rsquo;) and the reverse primer (5\u0026rsquo;-TTATTTAACCTCAATCACATTATGC-3\u0026rsquo;). The \u003cem\u003eAtVDR\u003c/em\u003e was cloned from \u003cem\u003eArabidopsis\u003c/em\u003e using the forward primer (5\u0026rsquo;-ATGGCGGCGATTCCTCTCAAAGCTC-3\u0026rsquo;) and the reverse primer (5\u0026rsquo;-TTAGTTGAATTTTTCTTCCGAGTCT-3\u0026rsquo;).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSubcellular localization analysis of CsVDR and AtVDR\u003c/h2\u003e \u003cp\u003eTo investigate the subcellular localization of CsVDR, the full-length CDS sequences of \u003cem\u003eCsVDR\u003c/em\u003e was cloned into the expression vector pBI121-GFP to obtain the recombinant vectors of CsVDR-GFP driven by a CMV35S promoter. Cucumber protoplasts were isolated from mesophyll tissues originating from cucumber young leaves. The protoplast extraction and plasmid transformation were conducted according to the procedure described by Huang et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In short, cucumber leaves were cut into thin strips, placed in an enzymolysis solution for cell dissociation, incubated in darkness with rotation (40\u0026ndash;50 r/min), and then filtered and combined with the plasmid and PEG4000-Ca\u003csup\u003e2+\u003c/sup\u003e solution. Transfection was stopped after the W5 (2M NaCl, 1M CaCl\u003csub\u003e2\u003c/sub\u003e, 2M KCl, 0.2M MES, ddH\u003csub\u003e2\u003c/sub\u003eO) solution was added and the GFP fluorescence signals were observed. The identification of CsVDR protein localization in tobacco leaf cells was performed via the \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transient transformation. The GFP fluorescent signals of CsVDR-GFP was detected with a confocal laser scanning microscope (Zeiss LSM510 META) with an excitation wavelength of 488 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eHistochemical analysis of GUS activity\u003c/h2\u003e \u003cp\u003eThe 710 bp upstream promoter of \u003cem\u003eCsVDR\u003c/em\u003e was cloned into the pCAMBIA1391 vector using a forward primer (5\u0026rsquo;-TATCCTTGTGAACCTCAATTTGATT-3\u0026rsquo;) and reverse primer (5\u0026rsquo;-TTCTGTTTTCTGAAAGCAAGGACGA-3\u0026rsquo;). The recombinant vector prom\u003cem\u003eCsVDR\u003c/em\u003e-GUS was transformed into \u003cem\u003eArabidopsis thaliana\u003c/em\u003e mediated by \u003cem\u003eAgrobacterium\u003c/em\u003e to obtain T\u003csub\u003e3\u003c/sub\u003e homozygous transgenic plants for GUS staining. Immersing different plant tissues in the staining solution containing 2 mM X-gluc (5-Bromo-4-chloro-3-indolyl-β-D-glucuronide), 50 mM sodium phosphate (pH 7.2), 10 mM EDTA (pH 8.0), 2 mM K ferrous cyanide, 2 mM K ferrous cyanide, and 0.1% (v/v) Triton X-100 (Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). After vacuum infiltration, the samples were dyed overnight at 37\u0026deg;C; then, the tissues were bleached with different concentrations of ethanol (50%, 70%, 95%, and 100%) to remove chlorophyll and photographed with a digital camera (Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e \u003cp\u003eQuantitative real-time PCR was carried out using FastFire qPCR PreMix (SYBR Green) (TIANGEN, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.tiangen.com/\u003c/span\u003e\u003cspan address=\"https://www.tiangen.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The \u003cem\u003eAtVDR\u003c/em\u003e qPCR primers were as follows: 5\u0026rsquo;-GGGAAAGGGAAGTCGTCGTT-3\u0026rsquo;; 5\u0026rsquo;-ACGAAACGTTGCAGGGATCT-3\u0026rsquo;. The \u003cem\u003eCsVDR\u003c/em\u003e qPCR primers were as follows: 5\u0026rsquo;-TATGCTGCACACCGCAA AAC-3\u0026rsquo;; 5\u0026rsquo;-CsVDR-QRT-R: ACGAAACGTTGCAGGGATCT-3\u0026rsquo;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid construction and plant transformation\u003c/h2\u003e \u003cp\u003eThe two target sites of the \u003cem\u003eAtVDR\u003c/em\u003e CRISPR/Cas9 vector were designed using the CRISPR design tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://crispr.dbcls.jp\u003c/span\u003e\u003cspan address=\"http://crispr.dbcls.jp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The vector construction was conducted according to the procedure described by Xing et al. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) using the pKSE401 vector provided by Prof. Qi-Jun Chen from China Agricultural University. The constructed pKSE401-\u003cem\u003eAtVDR\u003c/em\u003e vector plasmid was transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e GV3101 competent cells using the heat shock method and then used for \u003cem\u003eArabidopsis\u003c/em\u003e transformation. The target sites of the homozygous positive transgenic plants of the T\u003csub\u003e2\u003c/sub\u003e generation were identified using PCR sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eExtraction and analysis of photosynthetic pigment\u003c/h2\u003e \u003cp\u003eDifferent \u003cem\u003eArabidopsis\u003c/em\u003e gene-edited lines of \u003cem\u003eAtVDR\u003c/em\u003e leaves were exposed to high-light (1000 mmol\u0026#158;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003es\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) stress for 10 h, and 0.1 g leaves were frozen immediately in liquid nitrogen for the de-epoxidation ratio analysis. The process of extracting pigments (violaxanthin, antheraxanthin, and zeaxanthin) from \u003cem\u003eArabidopsis thaliana\u003c/em\u003e leaves was described previously (Moul\u0026eacute; \u003cem\u003eet al.\u003c/em\u003e 2002). Briefly, samples were first extracted with 80% acetone and then with 100% acetone. After filtering, the pigment extracts were analyzed via HPLC with a YMC carotenoid 250\u0026times;4.6 mml\u0026#158;D s\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e\u0026micro;m detection column (CT99S05-245WT). The mobile phase A of HPLC was 95% methanol: 5% water and the mobile phase B was methyl tert-butyl ether. The standard samples of violaxanthin, antheraxanthin, and zeaxanthin were purchased from Sigma (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.sigmaaldrich.cn/CN/zh\u003c/span\u003e\u003cspan address=\"https://www.sigmaaldrich.cn/CN/zh\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eFluorescence video imaging and chlorophyll fluorescence measurements\u003c/h2\u003e \u003cp\u003eThe chlorophyll fluorescence parameters of wild-type and \u003cem\u003eAtVDR\u003c/em\u003e knock-out lines (CL6, L6, L2) were measured with a Fluor Cam 1000-H handheld fluorescent protein imaging instrument (Photon Systems Instruments, Czech). Before measuring the data, the materials were treated in the dark for 30 min to determine the initial fluorescence (Fo). The maximum fluorescence (Fm) of all reaction centers was determined by a saturated pulse of 0.8 s at 6000 \u0026micro;mol\u0026#158;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003es\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e under dark adaptation, then, the materials were treated with light adaptation, and the actinic light was turned on with an intensity of 1000 \u0026micro;mol\u0026#158;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003es\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e for 10 min as the maximum fluorescence under light adaptation (Fm\u0026rsquo;) (Suarez \u003cem\u003eet al.\u003c/em\u003e 2022). The main analysis of this experiment: NPQ (Non-photochemical quenching) was calculated as (Fm-Fm\u0026rsquo;)/Fm\u0026rsquo;, Fv/Fm (PSII photochemical efficiencies) was calculated as (Fm-Fo)/Fm.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic analysis of VDRs\u003c/h2\u003e \u003cp\u003ePhylogenetic analysis was conducted to investigate the evolutionary relationships among VDE, VDL (VDE-like), and VDR (VDE-related) proteins. The analysis included 74 proteins from 28 sequenced species of algae and land plants, focusing on photosynthetic organisms. The resulting evolutionary tree consisted of three branches: VDEs, VDLs, and VDRs, consistent with previous studies (Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Girolomoni et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The analysis revealed that VDL and VDR proteins evolved from VDE protein clusters. VDL proteins were predominantly found in chromalveolates and absent in higher plants and green algae, while VDRs and VDEs were present in higher plants, chromalveolates, and green algae, consistent with previous findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Girolomoni et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Some higher plant species possessed two VDE proteins, whereas higher plants and algae had only one VDR protein. The CsVDR (Csa2G297200) showed the closest relationship with the VDR proteins of melon and watermelon, and it was also closely related to \u003cem\u003eArabidopsis\u003c/em\u003e AtVDR (AT2G21860). Additionally, CsVDR and AtVDR formed a clade with homologs from other dicotyledonous plants, separate from those of monocotyledonous plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSequence analysis and subcellular localization analysis of CsVDR\u003c/h2\u003e \u003cp\u003eIt has been reported that the sequences of VDLs and VDRs are similar to VDEs, and they both have a lipocalin superfamily protein domain (Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Girolomoni et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The amino acid sequence of CsVDR showed high homology with AtVDR, which includes a conserved lipocalin domain and Cys-rich domain. However, VDR protein has an additional amino acid sequence at the 5\u0026rsquo; end (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and b). Protein alignment revealed that CsVDR and AtVDR both have ten conserved cysteine residues within the N-terminal Cys-rich domain, which is also conserved in VDE proteins and is reported to be critical for substrate catalysis. On the other hand, the lipocalin domain is believed to bind the hydrophobic violaxanthin (V) substrate and contain the catalytic residues (Arnoux et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Bugos et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). These conserved cysteine residues are also found in VDRs of other plants; however, VDRs do not have the C-terminal glutamate-rich domain, which is conserved in the plant VDE lipocalin superfamily domain (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb; Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe analysis of lipocalin domain tertiary structures revealed that CsVDE and CsVDR were similar to AtVDE and contained two α-helices and nine β-sheets, forming a bucket structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). The integrated three-dimensional spatial images showed a high overlap between CsVDR and CsVDE (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Additionally, we investigated the subcellular localization of CsVDR by fusing it with GFP and transfecting it into cucumber protoplasts or tobacco leaf cells. The results demonstrated that CsVDR was predominantly located in chloroplasts, which is consistent with the subcellular location of VDE proteins in other plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed and e; Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In summary, CsVDR contains a conserved Cys-rich domain and liposome domain, and its protein is mainly localized in chloroplasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression pattern exploration of\u003c/b\u003e \u003cb\u003eCsVDR\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe interval between \u003cem\u003eCsVDR\u003c/em\u003e and the upstream gene was 710 bp. Therefore, the 710 bp sequence was cloned as the \u003cem\u003eCsVDR\u003c/em\u003e promoter and used to drive the GUS reporter gene for histochemical analysis. GUS activity was observed in various organs of the transgenic \u003cem\u003eArabidopsis\u003c/em\u003e plants, including cotyledons, true leaves, hypocotyls, ovary, root, fruit pods, stigma, floral stems, sepals, and vascular tissues of the stamen. However, GUS activity was not observed in the petals. Notably, GUS activity was higher in the vascular tissues of leaves and sepals compared to other tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The expression level of \u003cem\u003eCsVDR\u003c/em\u003e, as determined by qRT-PCR, was highest in mature leaves, followed by old leaves, flowers, and young leaves. It was relatively low in roots, stems, and fruits. Furthermore, the transcription of \u003cem\u003eCsVDR\u003c/em\u003e increased with leaf development, peaking at the 20th day, and then decreased. These findings suggest that \u003cem\u003eCsVDR\u003c/em\u003e is primarily expressed in photosynthetic organs and may play a role in light response (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb and c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBoth\u003c/b\u003e \u003cb\u003eCsVDR\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eAtVDR\u003c/b\u003e \u003cb\u003eare respond to high-light stress\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo investigate the impact of excessive light on VDR genes expression, we conducted experiments using wild-type cucumbers and \u003cem\u003eArabidopsis\u003c/em\u003e plants. These plants were subjected to both high-light and normal-light conditions. Under normal-light conditions, the transcription level of \u003cem\u003eCsVDR\u003c/em\u003e peaked at 2 hours and then gradually decreased to a minimum at 12 hours. However, under high-light conditions, the expression pattern of \u003cem\u003eCsVDR\u003c/em\u003e showed a gradual increase at the beginning of the day, reaching its peak at 4 hours, followed by a decrease to a minimum at 8 hours. It remained at a low level until 12 hours (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). In \u003cem\u003eArabidopsis\u003c/em\u003e, the transcription level of \u003cem\u003eAtVDR\u003c/em\u003e remained relatively stable under normal-light conditions. Although there was a slight decrease in the expression level of \u003cem\u003eAtVDR\u003c/em\u003e at 1 hour and 6 hours, the overall expression level gradually increased with time under high-light conditions. These results indicate that \u003cem\u003eCsVDR\u003c/em\u003e and \u003cem\u003eAtVDR\u003c/em\u003e exhibit a greater responsiveness to high light compared to normal light (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAtvdr\u003c/b\u003e \u003cb\u003emutation leads to reduced de-epoxidation ratio and NPQ values\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eArabidopsis VDR\u003c/em\u003e mutants (\u003cem\u003eAtvdr\u003c/em\u003e) were generated using CRISPR/Cas9 gene editing technology to examine the effects of \u003cem\u003eAtVDR\u003c/em\u003e on the xanthophyll cycle and NPQ. Three homozygous \u003cem\u003eAtvdr\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e lines (L2, CL6, and L6) were successfully identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). After subjecting the \u003cem\u003eAtvdr\u003c/em\u003e and WT plants to high-light treatment for 10 hours, the de-epoxidation rate of CL6 and L6 mutants was found to be lower compared to the WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). Although the L2 lines did not exhibit significant changes compared to the wild type, their NPQ was lower than that of the wild type. This phenomenon may be attributed to the redundant functions of VDR and VDE in photoprotection. The original maximum fluorescence efficiency of PSII (Fv/Fm) was not altered in \u003cem\u003eAtvdr\u003c/em\u003e compared to WT, indicating that the plants were grown under favorable conditions prior to treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec; Chen et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, all the \u003cem\u003eAtvdr\u003c/em\u003e mutants exhibited a noticeable reduction in NPQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). These findings suggest that the \u003cem\u003eAtvdr\u003c/em\u003e mutant has a diminished capacity for heat dissipation, decreased conversion of A and Z, lower NPQ levels compared to WT plants, and also demonstrates a certain degree of photoinhibition.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analysis of VDR and VDE\u003c/h2\u003e \u003cp\u003eIn plants and algae, VDLs and VDRs are similar to VDEs and share similar functional domains, known as the lipid transporter-FABP superfamily (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). This superfamily consists of a large group of proteins that bind small hydrophobic (lipophilic) molecules (Bugos et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Carotenoids are hydrophobic molecules that participate in the xanthophyll cycle. Therefore, we hypothesized that VDRs may also be involved in carotenoid biosynthesis, similar to VDEs in plants and VDLs in algae (Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Adams \u003cem\u003eet al.\u003c/em\u003e 1991; Dautermann et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The VDRs of higher plants contains a conserved cysteine residue at the N-terminal in the lipocalin superfamily domain. This residue can form disulfide bonds, which are critical for the function of VDE proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and b) (Flower et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). Additionally, the CsVDR and AtVDR proteins have a lipocalin domain similar to AtVDE. This domain consists of eight β-strands forming a conical barrel that encloses an internal ligand binding site. It may play a role in binding a substrate with a similar molecular structure, such as violaxanthin or other carotenoids (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec) (Bugos \u003cem\u003eet al.\u003c/em\u003e1998; Flower et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Hieber et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). In conclusion, the conserved functional domains and amino acid residues present in the VDE and VDR proteins suggesting that they have similar functions in plants and may act on substrates with a similar molecular structure.\u003c/p\u003e \u003cp\u003eThe VDE and VDR genes were generated through gene duplication events before secondary endosymbiosis. The VDL proteins, found only in chromalveolate algae, resulted from a second duplication of the VDR proteins (Coesel et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). VDLs are known to catalyze the conversion of violaxanthin to neoxanthin and may also play a role in the production of other light-harvesting carotenoids like peridinin and vaucheriaxanthin (Dautermann et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In algae, VDLs connect the xanthophyll cycle and the diadinoxanthin cycle (Dautermann et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Phylogenetic analysis revealed the absence of the VDL genes in higher plants, which aligns with previous findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) (Dautermann et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, VDR proteins are ubiquitous in higher plants. Considering the evolutionarily conserved functional domains of VDE, VDL, and VDR proteins, it is speculated that VDRs may also be involved in photoprotection and the catalysis of light-harvesting carotenoids in higher plants, albeit with some differences compared to algae due to distinct photoprotective mechanisms (Dautermann et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eTissue specificity and subcellular localization of CsVDR\u003c/h2\u003e \u003cp\u003eIt has been reported that VDEs exist in the thylakoid vesicles of higher plants. VDEs require ascorbic acid as a co-substrate and are activated by light-dependent intraluminal acidification (Hager \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1969\u003c/span\u003e). The subcellular localization of the VDE proteins has also been studied in a variety of plants, including cucumber, rice, spinach, \u003cem\u003eCerasus humilis\u003c/em\u003e, and others (Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Emanuelsson et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Sun et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, the subcellular localization and gene function of VDRs have not been reported. This study demonstrates that CsVDR is located in the chloroplasts, consistent with previous studies on VDE (Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). It suggests that CsVDR and AtVDR may have a similar function in the photoresponse.\u003c/p\u003e \u003cp\u003eqRT-PCR and GUS expression analyses revealed that \u003cem\u003eCsVDR\u003c/em\u003e was highly expressed in green photosynthetic tissues, particularly in mature leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This finding aligns with previous studies on \u003cem\u003eCsVDE\u003c/em\u003e and \u003cem\u003eLeVDE\u003c/em\u003e, which also demonstrated their predominant expression in photosynthetic tissues (Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Notably, the expression of VDEs has been reported in the immature leaves of lettuce and cucumber as well (Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Bugos and Yamamoto \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). The expression level of \u003cem\u003eCsVDE\u003c/em\u003e increased during leaf development, peaking in mature leaves, and subsequently decreased (Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Interestingly, a similar expression pattern was observed for \u003cem\u003eCsVDR\u003c/em\u003e, suggesting that \u003cem\u003eVDR\u003c/em\u003e and \u003cem\u003eVDE\u003c/em\u003e exhibit similarities in their localization and tissue distribution. This implies that VDR protein may play a role in the photoresponse and is concomitant with leaf development, similar to VDE protein.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCsVDR\u003c/b\u003e \u003cb\u003eresponse to high-light conditions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eVDE proteins are responsible for catalyzing the xanthophyll cycle and have a significant role in regulating the heat dissipation capacity of plants through their impact on qE components (Jahns et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). VDR proteins have a high similarity to VDE proteins, and the expression level of \u003cem\u003eCsVDR\u003c/em\u003e and \u003cem\u003eAtVDR\u003c/em\u003e increases under high-light stress, indicating a clear response to high-light conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Interestingly, the response pattern of \u003cem\u003eCsVDR\u003c/em\u003e to high-light stress was similar to that of \u003cem\u003eCsVDE\u003c/em\u003e. Both reached their maximum transcription level after 4 hours of high-light stress and then decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea; Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). These results lead us to speculate that VDEs and VDRs may be involved in the same high-light response process.\u003c/p\u003e \u003cp\u003ePrevious studies have shown that plants have limited efficiency in converting violaxanthin to zeaxanthin. The deletion or suppression of VDE in \u003cem\u003eArabidopsis\u003c/em\u003e (\u003cem\u003eAtnpq1\u003c/em\u003e) and tobacco (Niyogi et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Chang et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2000\u003c/span\u003e) has been found to result in a reduction in NPQ value. In soybeans, the overexpression of the \u003cem\u003eAtVDE\u003c/em\u003e, \u003cem\u003eAtPsbS\u003c/em\u003e, and \u003cem\u003eAtZEP\u003c/em\u003e has been shown to decrease the levels of violaxanthin (V) and increase the content of zeaxanthin (Z) during high-light exposure. This increase in photosynthetic efficiency under fluctuating light has led to a 33% increase in seed production (Souzal \u003cem\u003eet al.\u003c/em\u003e 2022). The L6 and CL6 lines exhibited a decrease in the de-epoxidation ratio and NPQ. However, the de-epoxidation ratio of the L2 lines did not show significant changes compared to the wild type, although its NPQ was lower. This phenomenon is likely due to the redundant functions of VDR and VDE in the photoprotection process. VDE plays a major regulatory role under high-light stress in plants, while VDR plays an auxiliary role. Apart from the xanthophyll cycle, other protective mechanisms, such as the lutein epoxide cycle, may also exist to help plants avoid photoinhibition. This could explain the lack of significant change in the de-epoxidation ratio in the L2 line (Plazapla \u003cem\u003eet al.\u003c/em\u003e 2007). Further studies can be conducted to explore the potential of VDR overexpression in improving plant photosynthetic efficiency under fluctuating light and increasing yield. Additionally, considering the similar protein structure, close evolutionary relationship, similar subcellular localization, and similar expression levels and phenotypes of VDR and VDE mutants, it is speculated that VDR may be involved in affecting the xanthophyll cycle pathway and thus influencing plant sensitivity to high-light stress.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, \u003cem\u003eCsVDR\u003c/em\u003e was successfully cloned and observed a highest expression level in mature leaves cultivated for 20 days in cucumber. CsVDR shared a high homology with VDE proteins and its protein was predominantly located in chloroplasts. \u003cem\u003eCsVDR\u003c/em\u003e and \u003cem\u003eAtVDR\u003c/em\u003e were identified as high-light response genes, while \u003cem\u003eAtvdr\u003c/em\u003e mutants exhibited a decreasing trend in the de-epoxidation ratio of (A\u0026thinsp;+\u0026thinsp;Z)/(A\u0026thinsp;+\u0026thinsp;Z\u0026thinsp;+\u0026thinsp;V) and non-photochemical quenching (NPQ) compared to the wild-type (WT) lines, which suggesting that the xanthophyll cycle in \u003cem\u003eAtvdr\u003c/em\u003e was less effective and more susceptible to photoinhibition of PSII under high-light stress.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Prof. Zhenxian Zhang (College of horticulture, China Agricultural University) for providing the initial idea of this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (grant nos. 31801850), the National Key Research and Development Program of China (2019YFD1000300), the 111 Project (B17043), and the Construction of Beijing Science and Technology Innovation and Service Capacity in Top Subjects (CEFF-PXM2019_014207_000032).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBeijing Key Laboratory of Growth and Developmental Regulation for Protected Vegetable Crops, College of Horticulture, China Agricultural University, Beijing100193, P. R. China\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJingwei Wei, Shi Zhang, Jing Zhang, Weike Sun, Yichao Huang, Si Ma, Syed Aizaz Ali Shah, Yongqiang Tian, Zhenxian Zhang, Lihong Gao, Xin Li\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eState Key Laboratory of Vegetable Germplasm Innovation, Tianjin Kerenl Cucumber Research Institute, Tianjin 300192, P. R. China\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHongyu Huang\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhenxian Zhang and Xin Li contributed to the study conception. Lihong Gao, Yongqiang Tian and Si Ma participated in the experimental design. Jing Zhang and Shi Zhang performed the experiment. Weike Sun, Yichao Huang and Syed Aizaz Ali Shah collected samples and statistical data. Hongyu Huang provided necessary resources for research completion. The first draft of the manuscript was written by Shi Zhang, Xin Li and Jingwei Wei reviewed the draft. All authors contributed to the article and approved the submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding authors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Xin Li ([email protected] ).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research has no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAdams B. D., Adams W. W. (1991). The role of xanthophyll cycle carotenoids in the protection of photosynthesis. Trends In Plant Science,1(1), 21-26. https://doi.org/10.1016/S1360-1385(96)80019-7\u003c/li\u003e\n\u003cli\u003eArnoux P., Morosinotto T., Saga G., Bassi R., Pignol D. (2009). A structural basis for the pH-dependent xanthophyll cycle in Arabidopsis thaliana. The Plant cell, 21 (7), 2036-44. https://doi.org/10.1105/tpc.109.068007\u003c/li\u003e\n\u003cli\u003eBugos R.C., Hieber A. D., Yamamoto H.Y. (1998). Xanthophyll cycle enzymes are members of the lipocalin family, the first identified from plants. The Journal of biological chemistry, 273 (25), 15321-4. https://doi.org/10.1074/jbc.273.25.15321\u003c/li\u003e\n\u003cli\u003eBugos R.C., Yamamoto H.Y. (1996). Molecular cloning of violaxanthin de-epoxidase from romaine lettuce and expression in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 93 (13), 6320-5. https://doi.org/10.1073/pnas.93.13.6320\u003c/li\u003e\n\u003cli\u003eCazzaniga S., Dall\u0026apos; Osto L., Kong S.G., Wada M., Bassi R. (2013). Interaction between avoidance of photon absorption, excess energy dissipation and zeaxanthin synthesis against photooxidative stress in Arabidopsis. The Plant journal : for cell and molecular biology, 76 (4), 568-79. https://doi.org/10.1111/tpj.12314\u003c/li\u003e\n\u003cli\u003eChang S.H., Bugos R.C., Sun W.H., Yamamoto H.Y. (2000). Antisense suppression of violaxanthin de-epoxidase in tobacco does not affect plant performance in controlled growth conditions. Photosynthesis research, 64 (1), 95-103. https://doi.org/10.1023/A:1026518524426\u003c/li\u003e\n\u003cli\u003eChen H., Cheng Q., Chen Q., Ye X., Qu Y., Song W., Fahad S., Gao J., Saud S., Xu Y., Shen Y. (2022). Effects of Selenium on Growth and Selenium Content Distribution of Virus-Free Sweet Potato Seedlings in Water Culture. Frontiers in plant science, 13, 965649. https://doi.org/10.3389/fpls.2022.965649\u003c/li\u003e\n\u003cli\u003eChen L., Yan Z., Xia Z., Cheng Y., Jiao Z., Sun B., Zhou T., Fan Z. (2017). A Violaxanthin Deepoxidase Interacts with a Viral Suppressor of RNA Silencing to Inhibit Virus Amplification. Plant physiology, 175 (4), 1774-1794. https://doi.org/10.1104/pp.17.00638\u003c/li\u003e\n\u003cli\u003eCoesel S., Oborn\u0026iacute;k M., Varela J., Falciatore A., Bowler C. (2008). Evolutionary origins and functions of the carotenoid biosynthetic pathway in marine diatoms. PloS one, 3 (8), e2896. https://doi.org/10.1371/journal.pone.0002896\u003c/li\u003e\n\u003cli\u003eDautermann O., Lyska D., Andersen-Ranberg J., Becker M., Fr\u0026ouml;hlich-Nowoisky J., Gartmann H., Kr\u0026auml;mer L.C., Mayr K., Pieper D., Rij L.M., Wipf H.M., Niyogi K.K., Lohr M. (2020). An algal enzyme required for biosynthesis of the most abundant marine carotenoids. Science advances, 6 (10), eaaw9183. https://doi.org/10.1126/sciadv.aaw9183\u003c/li\u003e\n\u003cli\u003eDe Souza A.P., Burgess S.J., Doran L., Hansen J., Manukyan L., Maryn N., Gotarkar D., Leonelli L., Niyogi K.K., Long S.P. (2022). Soybean photosynthesis and crop yield are improved by accelerating recovery from photoprotection. Science, 377 (6608), 851-854. https://doi.org/10.1126/science.adc9831\u003c/li\u003e\n\u003cli\u003eEmanuelsson A., Eskling M., \u0026Aring;kerlund H. E. (2003). Chemical and mutational modification of histidines in violaxanthin de-epoxidase from Spinacia oleracea. Physiologia Plantarum, 119: 97-104. https://doi.org/10.1034/j.1399-3054.2003.00151.x\u003c/li\u003e\n\u003cli\u003eFlower D. R., North A. C., Attwood T. K. (1993). Structure and sequence relationships in the lipocalins and related proteins. Protein science, 2(5), 753\u0026ndash;761. https://doi.org/10.1002/pro.5560020507\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-Plazaola J.I., Matsubara S., Osmond C.B. (2007). The lutein epoxide cycle in higher plants: its relationships to other xanthophyll cycles and possible functions. Functional plant biology: FPB, 34 (9), 759-773. https://doi.org/10.1071/FP07095\u003c/li\u003e\n\u003cli\u003eGirolomoni L., Bellamoli F., de la Cruz Valbuena G., Perozeni F., D\u0026apos;Andrea C., Cerullo G., Cazzaniga S., Ballottari M. (2020). Evolutionary divergence of photoprotection in the green algal lineage: a plant-like violaxanthin de-epoxidase enzyme activates the xanthophyll cycle in the green alga Chlorella vulgaris modulating photoprotection. The New phytologist, 228 (1), 136-150. https://doi.org/10.1111/nph.16674\u003c/li\u003e\n\u003cli\u003eGuan C., Ji J., Zhang X., Li X., Jin C., Guan W., Wang G. (2015). Positive feedback regulation of a Lycium chinense-derived VDE gene by drought-induced endogenous ABA, and over-expression of this VDE gene improve drought-induced photo-damage in Arabidopsis. Journal of plant physiology, 175, 26-36. https://doi.org/10.1016/j.jplph.2014.06.022\u003c/li\u003e\n\u003cli\u003eHager A. (1969). Light dependent decrease of the pH-value in a chloroplast compartment causing the enzymatic interconversion of violaxanthin to zeaxanthin; relations to photophosphorylation. Planta, 89(3), 224\u0026ndash;243. https://doi.org/10.1007/BF00385028\u003c/li\u003e\n\u003cli\u003eHan H., Gao S., Li B., Dong X.C., Feng H.L., Meng Q.W. (2010). Overexpression of violaxanthin de-epoxidase gene alleviates photoinhibition of PSII and PSI in tomato during high light and chilling stress. Journal of plant physiology, 167 (3), 176-83. https://doi.org/10.1016/j.jplph.2009.08.009\u003c/li\u003e\n\u003cli\u003eHavaux M., Bonfils J.P., L\u0026uuml;tz C., Niyogi K.K. (2000). Photodamage of the photosynthetic apparatus and its dependence on the leaf developmental stage in the npq1 Arabidopsis mutant deficient in the xanthophyll cycle enzyme violaxanthin de-epoxidase. Plant physiology, 124 (1), 273-84. https://doi.org/10.1104/pp.124.1.273\u003c/li\u003e\n\u003cli\u003eHieber A. D., Bugos R. C., Yamamoto H. Y. (2000). Plant lipocalins: violaxanthin de-epoxidase and zeaxanthin epoxidase. Biochimica et biophysica acta, 1482(1-2), 84\u0026ndash;91. https://doi.org/10.1016/s0167-4838(00)00141-2\u003c/li\u003e\n\u003cli\u003eHorton P., Hague A. (1988).Studies on the induction of chlorophyll fluorescence in isolated barley protoplasts. IV. Resolution of non-photochemical quenching. BBA - Bioenergetics, 932(1):107-115. https://doi.org 10.1016/0005-2728(88)90144-2.\u003c/li\u003e\n\u003cli\u003eHuang H., Wang Z., Cheng J., Zhao W., Li X., Wang H., Zhang Z., Sui X. (2013). An efficient cucumber (Cucumis sativus L.) protoplast isolation and transient expression system. Scientia Horticulturae,150 (0), 206-212. https://doi.org/10.1016/j.scienta.2012.11.011\u003c/li\u003e\n\u003cli\u003eJahns P., Latowski D., Strzalka K. (2009). Mechanism and regulation of the violaxanthin cycle: the role of antenna proteins and membrane lipids. Biochimica et biophysica acta, 1787 (1), 3-14. https://doi.org/10.1016/j.bbabio.2008.09.013\u003c/li\u003e\n\u003cli\u003eJin H., Liu B., Luo L., Feng D., Wang P., Liu J., Da Q., He Y., Qi K., Wang J., Wang H.B. (2014). HYPERSENSITIVE TO HIGH LIGHT1 interacts with LOW QUANTUM YIELD OF PHOTOSYSTEM II1 and functions in protection of photosystem II from photodamage in Arabidopsis. The Plant cell, 26 (3), 1213-29. https://doi.org/10.1105/tpc.113.122424\u003c/li\u003e\n\u003cli\u003eKong L., Sun M., Xie Y., Wang F., Zhao Z. (2015). Photochemical and antioxidative responses of the glume and flag leaf to seasonal senescence in wheat. Frontiers in plant science, 6, 358. https://doi.org/10.3389/fpls.2015.00358\u003c/li\u003e\n\u003cli\u003eLi X., Zhao W., Sun X., Huang H., Kong L., Niu D., Sui X., Zhang Z. (2013). Molecular cloning and characterization of violaxanthin de-epoxidase (CsVDE) in cucumber. PloS one, 8 (5), e64383. https://doi.org/10.1371/journal.pone.0064383\u003c/li\u003e\n\u003cli\u003eLin W., Yu Z., Luo Y., He W., Yan G., Peng C. (2022). Photoprotection Differences between Dominant Tree Species at Mid- and Late-Successional Stages in Subtropical Forests in Different Seasonal Environments. International journal of molecular sciences, 23 (10), . https://doi.org/10.3390/ijms23105417\u003c/li\u003e\n\u003cli\u003eLiu S., Liu C., Wang X., Chen H. (2021). Seed-specific activity of the Arabidopsis \u0026beta;-glucosidase 19 promoter in transgenic Arabidopsis and tobacco. Plant cell reports, 40 (1), 213-221. https://doi.org/10.1007/s00299-020-02627-8\u003c/li\u003e\n\u003cli\u003eM\u0026uuml;ller-Moul\u0026eacute; P., Conklin P.L., Niyogi K.K. (2002). Ascorbate deficiency can limit violaxanthin de-epoxidase activity in vivo. Plant physiology, 128 (3), 970-7. https://doi.org/10.1104/pp.010924\u003c/li\u003e\n\u003cli\u003eNiyogi K.K., Grossman A.R., Bj\u0026ouml;rkman O. (1998). Arabidopsis mutants define a central role for the xanthophyll cycle in the regulation of photosynthetic energy conversion. The Plant cell, 10 (7), 1121-34. https://doi.org/10.1105/tpc.10.7.1121\u003c/li\u003e\n\u003cli\u003ePayton P., Webb R., Kornyeyev D., Allen R., Holaday A.S. (2001). Protecting cotton photosynthesis during moderate chilling at high light intensity by increasing chloroplastic antioxidant enzyme activity. Journal of experimental botany, 52 (365), 2345-54. https://doi.org/10.1093/jexbot/52.365.2345\u003c/li\u003e\n\u003cli\u003eRetkute R., Smith-Unna S.E., Smith R.W., Burgess A.J., Jensen O.E., Johnson G.N., Preston S.P., Murchie E.H. (2015). Exploiting heterogeneous environments: does photosynthetic acclimation optimize carbon gain in fluctuating light?. Journal of experimental botany, 66 (9), 2437-47. https://doi.org/10.1093/jxb/erv055\u003c/li\u003e\n\u003cli\u003eSaga G., Giorgetti A., Fufezan C., Giacometti G.M., Bassi R., Morosinotto T. (2010). Mutation analysis of violaxanthin de-epoxidase identifies substrate-binding sites and residues involved in catalysis. The Journal of biological chemistry, 285 (31), 23763-70. https://doi.org/10.1074/jbc.M110.115097\u003c/li\u003e\n\u003cli\u003eSu\u0026aacute;rez J.C., Vanegas J.I., Anzola J.A., Contreras A.T., Urban M.O., Beebe S.E., Rao I.M. (2022). Impact of Web Blight on Photosynthetic Performance of an Elite Common Bean Line in the Western Amazon Region of Colombia. Plants (Basel, Switzerland), 11 (23), . https://doi.org/10.3390/plants11233238\u003c/li\u003e\n\u003cli\u003eSun L.N., Wang F., Wang J.W., Sun L.J., Gao W.R., Song X.S. (2019). Overexpression of the ChVDE gene, encoding a violaxanthin de-epoxidase, improves tolerance to drought and salt stress in transgenic Arabidopsis. 3 Biotech, 9 (5), 197. https://doi.org/10.1007/s13205-019-1732-6\u003c/li\u003e\n\u003cli\u003eTamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution, 28 (10), 2731-9. https://doi.org/10.1093/molbev/msr121\u003c/li\u003e\n\u003cli\u003eWang X., Ren P., Ji L., Zhu B., Xie G. (2021). OsVDE, a xanthophyll cycle key enzyme, mediates abscisic acid biosynthesis and negatively regulates salinity tolerance in rice. Planta, 255 (1), 6. https://doi.org/10.1007/s00425-021-03802-1\u003c/li\u003e\n\u003cli\u003eXing H.L., Dong L., Wang Z.P., Zhang H.Y., Han C.Y., Liu B., Wang X.C., Chen Q.J. (2014). A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC plant biology, 14, 327. https://doi.org/10.1186/s12870-014-0327-y\u003c/li\u003e\n\u003cli\u003eXu J., Li Z., Yang H., Yang X., Chen C., Li H. (2016). Genetic Diversity and Molecular Evolution of a Violaxanthin De-epoxidase Gene in Maize. Frontiers in genetics, 7,131. https://doi.org/10.3389/fgene.2016.00131\u003c/li\u003e\n\u003cli\u003eYan K., Wu C., Zhang L., Chen X. (2015). Contrasting photosynthesis and photoinhibition in tetraploid and its autodiploid honeysuckle (Lonicera japonica Thunb.) under salt stress. Frontiers in plant science, 6, 227. https://doi.org/10.3389/fpls.2015.00227\u003c/li\u003e\n\u003cli\u003eYang S., Meng D.Y., Hou L.L., Li Y., Guo F., Meng J.J., Wan S.B., Li X.G. (2015). Peanut violaxanthin de-epoxidase alleviates the sensitivity of PSII photoinhibition to heat and high irradiance stress in transgenic tobacco. Plant cell reports, 34 (8), 1417-28. https://doi.org/10.1007/s00299-015-1797-6\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-growth-regulation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"grow","sideBox":"Learn more about [Plant Growth Regulation](https://www.springer.com/journal/10725)","snPcode":"10725","submissionUrl":"https://submission.nature.com/new-submission/10725/3","title":"Plant Growth Regulation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Xanthophyll cycle, High-light, VDE, VDR","lastPublishedDoi":"10.21203/rs.3.rs-3731188/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3731188/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe xanthophyll cycle is crucial for protecting plants and algae from photodamage. While the resistance of the violaxanthin de-epoxidase enzyme (VDE) to high-light stress in the xanthophyll cycle has been extensively studied, there is limited knowledge about VDE-related (VDR) proteins, which share a close homologous relationship with VDEs. In this study, we conducted a preliminary investigation of VDR protein from the aspects of basic bioinformatics, spatiotemporal gene expression patterns, and strong light stress treatment. Through subcellular localization experiments, we observed that the CsVDR-GFP protein was predominantly located in chloroplasts. \u003cem\u003eCsVDR\u003c/em\u003e was expressed in all tissues of \u003cem\u003eArabidopsis\u003c/em\u003e and cucumber, with the highest expression level observed in mature leaves cultivated for 20 days in cucumber. Interestingly, both \u003cem\u003eCsVDR\u003c/em\u003e and \u003cem\u003eAtVDR\u003c/em\u003e were identified as high-light response genes. However, when subjected to high-light stress, all CRISPR/Cas9 mediated gene-edited \u003cem\u003eArabidopsis\u003c/em\u003e mutants (\u003cem\u003eAtvdr\u003c/em\u003e) exhibited a decreasing trend in the de-epoxidation ratio of (A+Z)/(A+Z+V) and non-photochemical quenching (NPQ) compared to the wild-type (WT) lines. This suggests that the xanthophyll cycle in \u003cem\u003eAtvdr\u003c/em\u003e was less effective and more susceptible to photoinhibition of PSII under high-light stress. Our findings provide evidence that VDR proteins play a role in regulating the high-light response in plants, thereby offering a theoretical basis for further investigation into plant photoprotective pathways.\u003c/p\u003e","manuscriptTitle":"Functions of violaxanthin de­epoxidase-related (VDR) in the photoprotective response to high-light stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-04 16:37:44","doi":"10.21203/rs.3.rs-3731188/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2024-01-20T08:57:36+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-01-02T12:50:31+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-02T12:31:11+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Plant Growth Regulation","date":"2023-12-21T23:42:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-12-11T16:06:36+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Growth Regulation","date":"2023-12-08T09:05:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-growth-regulation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"grow","sideBox":"Learn more about [Plant Growth Regulation](https://www.springer.com/journal/10725)","snPcode":"10725","submissionUrl":"https://submission.nature.com/new-submission/10725/3","title":"Plant Growth Regulation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"7cae0c5b-8029-4410-bb3a-ab67c985f793","owner":[],"postedDate":"January 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-04-30T22:11:24+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-04 16:37:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3731188","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3731188","identity":"rs-3731188","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}