Lysyl hydroxylase 2 mediated collagen post-translational modifications and functional outcomes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Lysyl hydroxylase 2 mediated collagen post-translational modifications and functional outcomes Masahiko Terajima, Yuki Taga, Tomoyuki Nakamura, Hou-Fu Guo, Yukako Kayashima, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1390058/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Lysyl hydroxylase 2 (LH2) is a member of LH family that catalyzes the hydroxylation of lysine (Lys) residues on collagen, and this particular isozyme has been implicated in various diseases. While its function as a telopeptidyl LH is generally accepted, several fundamental questions remain unanswered: 1, Does LH2 catalyze the hydroxylation of all telopeptidyl Lys residues of collagen? 2, Is LH2 involved in the helical Lys hydroxylation? 3, what are the functional consequences when LH2 is completely absent? To answer these questions, we generated LH2-null MC3T3 cells (LH2KO), and extensively characterized the type I collagen phenotypes in comparison with controls. Cross-link analysis demonstrated that the hydroxylysine-aldehyde (Hyl ald )-derived cross-links were completely absent from LH2KO collagen with concomitant increases in the Lys ald -derived cross-links. Mass spectrometric analysis revealed that, in LH2KO type I collagen, telopeptidyl Lys hydroxylation was completely abolished at all sites while helical Lys hydroxylation was slightly diminished in a site-specific manner. Moreover, di-glycosylated Hyl was diminished at the expense of mono-glycosylated Hyl. LH2KO collagen was highly soluble and digestible, fibril diameters were diminished, and mineralization impaired when compared to controls. Together, these data underscore the critical role of LH2-catalyzed collagen modifications in collagen stability, organization and mineralization. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Fibrillar type I collagen is a heterotrimeric molecule composed of two α1 and one α2 chains, and is the most abundant organic matrix component in vertebrates. The molecule consists of three structural domains: a central triple helical- (helical) and two nonhelical telopeptide domains at the amino- and carboxyl termini (N- and C-telo), and the molecules are packed into fibrils in the extracellular space to provide tissues with form and stability. To perform such functions, a series of specific lysine (Lys) post-translational modifications must occur within and outside of cells 1 . Inside the cell, specific Lys residues are hydroxylated to form 5-hydroxylysine 2 that can be further modified by O -linked glycosylation producing galactosyl-Hyl (G-Hyl) or glucosylgalactosyl-Hyl (GG-Hyl). Lys hydroxylation is catalyzed by lysyl hydroxylases 1–3 (LH1-3) encoded by Procollagen-lysine, 2-oxyglutarate, 5-dioxygenase ( PLOD 1–3 ) gene 3 , 4 . LH1 catalyzes Lys hydroxylation in the helical domain but the involvement of LH2 and LH3 in this function is not well defined. There are two isoforms of LH2: one includes a 63 bp-exon 13A (LH2b) and another does not (LH2a) 5 . LH2b is thought to be the key telopeptidyl LH but LH2a may also perform this function 6 . Glycosylation of Hyl is catalyzed by glycosyltransferase 25 domain containing (GLT25D) 1 and 2 to form G-Hyl, then by LH3 to produce GG-Hyl 7 , 8 . The extent of glycosylation may control the process of cross-link maturation 9 , 10 . Recent studies have demonstrated that the LH activities are regulated by specific endoplasmic reticulum (ER)-resident chaperone complexes 11 – 14 , and that defects in LHs and these regulators result in various connective tissue disorders 14 – 16 . In the extracellular space, Lys and Hyl residues in the N- and C-telo domains of the collagen molecule can be converted to aldehyde, i.e. Lys ald and Hyl ald , respectively, by the action of lysyl oxidases (LOXs). These aldehydes then initiate a series of condensation reactions with vicinal Lys ald , Lys, Hyl and histidine (His) residues to form intra- and intermolecular covalent cross-links 17 . Over 20 years ago, we proposed that LH2 may function as a telopeptidyl LH 18 . This hypothesis has been supported by several investigations including gain- and loss-of-function studies 2,19−21 . By co-expressing type I collagen α1 homotrimer and individual LH isoforms in insect cells, Takaluoma and co-workers showed that only LH2 could hydroxylate Lys in the α1 N-telo (9 N ) 22 although the extent of hydroxylation was relatively low (i.e. 25%) and the effect on the α1 C-telo Lys was not determined. Furthermore, Bank’s group identified LH2 as a telopeptidyl LH 21 , 23 based mainly on analysis of Hyl ald -derived pyridinoline (Pyr) cross-links, however, neither the telopeptidyl Lys hydroxylation nor other cross-links was examined. Using a LH2 mutant zebrafish model, Gistelinck et al. reported that Lys in the α1 C-telo of bone type I collagen (16 C ) was not hydroxylated in the mutant 24 , though neither Lys hydroxylation of the α1 and α2 N-telo domains nor the Hyl ald - or Lys ald -derived cross-links was analyzed in this study. More recently, Gistelinck et al reported detailed type I collagen phenotypes in bone obtained from a patient with Bruck syndrome 25 . Accumulating evidence indicates that LH2 plays pivotal roles in the pathogenesis of Bruck syndrome, fibrosis and cancer metastasis 21,23,26−31 . However, efforts to elucidate the function of LH2 at the cellular level in mammalian systems have been hampered since LH2 null mice die at early embryonic stage (E10.5) 32 . Thus, despite the critical importance of LH2 in these pathologies, the molecular basis is still not well understood. Here, we generated LH2 null osteoblastic cells and extensively characterized the effects of LH2 deficiency on type I collagen molecule and its functional outcomes on collagen cross-linking, solubility, fibrillogenesis and matrix mineralization. Results Generation and validation of LH2 null (KO) cells. To delete LH2, we transiently transfected MC3T3-E1 (MC) cells with plasmids expressing both Cas9 nuclease and oligonucleotides encoding sgRNAs targeting the exon 1 of the mouse Plod2 gene. Based on the two different algorithms, online CRISPR RGEN Tools and Off-Spotter, the sgRNAs were predicted to target only one gene, i.e. Plod2 , and no other off-targets were detected. We identified three LH2 null clones (KO-1, -2 and − 3) and used parental MC cells and those transfected with an empty vector (EV) as controls. Based on the real-time RCR analysis, the LH2 mRNA levels in KO cells were 5–7% of those in controls (Fig. 1 a). Western blot analysis showed that LH2 protein was not detected in any of these KO clones (Fig. 1 b), thus, they were subjected to further characterization. Other modifying enzymes and associated proteins. We then analyzed the protein levels of LH1 and LH3 in KO clones by Western blot analysis (Fig. 2 ). The results showed that both LH1 and LH3 were comparable to controls ( p > 0.05) though the former tended to be slightly lower in KO clones (Fig. 2 ). The collagen galactosyl transferase, GLT25D1, was significantly lower in the KO clones when compared to controls (Fig. 2 ). The reason for this is unclear, but the reduced level of GLT25D1 in KO could be partially compensated by unknown mechanisms since the total levels of G- + GG-Hyl in KO collagen were only slightly lower (< 10%) than those of controls at all glycosylation sites analyzed (see below). The LH2-specific chaperone, FK506-binding protein 65 (FKBP65) 14 , and an additional potential binding partner, cyclophilin B (CypB) 33 , showed slightly lower (~ 70% of controls) or similar level (~ 90%), respectively, in KO clones when compared to controls (Fig. 2 ). Other LH2-associated proteins, heat shock protein 47 (Hsp47) and immunoglobulin heavy-chain-binding protein (Bip) 34 , were also significantly lower in KO than controls (Fig. 2 ). Collagen Type. We first examined collagen types by mass spectrometric analysis 35 . The data revealed that type I collagen is by far the predominant collagen type with a small amount of type III in all of the culture samples, which is consistent with our previous report 36 . The percentages of type I calculated by I/(I+/III) × 100 were all > 96% and the difference between MC and KOs was within ~ 2% range (Supplementary Table S1) demonstrating that LH2 deficiency does not alter collagen types. Lys Hydroxylation Determined by High Performance Liquid Chromatography (HPLC) (8). In KO clones, levels of Lys hydroxylation in collagen were slightly but significantly decreased compared with those from MC and EV (Table 1 ). We then analyzed Lys modifications at specific molecular loci in type I collagen (see below). Lys Modifications at Specific Molecular Loci in Type I Collagen. Lys hydroxylation in the telopeptides : The relative abundance of Lys hydroxylation in the telopeptides of type I collagen, i.e. N-telo (α1 Lys-9 N and α2 Lys-5 N ) and C-telo (α1 Lys-16 C ) (note: α2 C-telo lacks Lys), were analyzed by LC-quadrupole time-of-flight (QTOF)-MS after sequential digestion by Grimontia collagenase and pepsin 37 (Table 2 and Fig. 3 ). Lys hydroxylation in MC and EV were essentially identical with no statistical difference, i.e. ~55.4% at α1 Lys-9 N , ~ 22.7% at α2 Lys-5 N and ~ 56.8% at α1 Lys-16 C . In the KO type I collagen, however, none of the Lys residues was hydroxylated in any of these sites (Table 2). These results unequivocally demonstrate that LH2 is responsible for Lys hydroxylation in all telopeptides of type I collagen and that other LHs cannot compensate for this function. Lys modifications in the helical domain We then analyzed Lys modifications in the helical domain of type I collagen by using tryptic digests of collagen as reported 12 , 33 , 37 (Table 2 and Fig. 3 ). In the helical domain, modified Lys residues were identified at 11 sites. The values in Fig. 3 represent percentages calculated as [Hyl / (Hyl + Lys) × 100] where Hyl includes glycosylated (G- and GG-) and non-glycosylated forms (Table 2). First, we examined the helical cross-linking sites, i.e. α1 Lys-87, α1 Lys-930, α2 Lys-87 and α2 Lys-933. At α1 Lys-87, a highly hydroxylated and the most heavily glycosylated site of type I collagen 9 , 10 , ~ 98% of Lys was hydroxylated in controls, MC and EV. In KO collagen, it was also almost all hydroxylated, showing only 2–4% less hydroxylated than controls (Table 2). For α1 Lys-930, using the collagenase-pepsin digest 37 , we analyzed Lys hydroxylation in the peptide containing α1 Lys-918/930 (GD K GETGEQGDRGI K GHR). In controls, these Lys residues were at least 87–89% hydroxylated (Hyl + Hyl), and those in KO, at least 82–86% hydroxylated, again showing only a slight decrease of Lys hydroxylation. At α2 Lys-87, it was 92–93% in controls and 93–96% in KO indicating that Lys hydroxylation in KO at this site is almost the same level or even slightly higher than controls. The α2 Lys-933 was 99–100% hydroxylated in both controls and KO collagens. Thus, Lys hydroxylation was only minimally affected at the helical cross-linking sites in KO collagen. Second, we examined the helical non-cross-linking sites, i.e. α1 Lys-99, -174, -219, -564 and α2 Lys-174 and − 219. For these sites the extent of Lys hydroxylation was almost the same at α1 Lys-99, slightly higher (1–4%) at α1 Lys-219, or up to ~ 20% lower at α1 Lys-174, -564, α2 Lys-174, α2 Lys-219 in KO type I collagen in comparison to controls. These data indicate that the contribution of LH2 towards helical Lys hydroxylation is low, especially at the cross-linking sites, and site-specific at non-crosslinking sites. We next calculated the extent of glycosylation of Hyl at six sites identified, i.e., α1 Lys-87, α1 Lys-99, α1 Lys-174, α1 Lys-564, α2 Lys-174, and α2 Lys-219 (Table 2). When calculated as percentages of non-glycosylated-Hyl and glycosylated (G- and GG-) forms in total Hyl, the relative abundance of glycosylated Hyl at α1 Lys-87, the major glycosylation site, was slightly but significantly lower (2–10%) and non-glycosylated-Hyl significantly higher in KO collagen compared to those of controls (Table 3 ). At all other sites, i.e. α1 Lys-99, α1 Lys-174, α1 Lys-564, α2 Lys-174, and α2 Lys-219, the same phenomena were observed between KO and control type I collagen (Table 3 ) with the exception of KO-3 exhibiting similar levels of non-glycosylated and glycosylated Hyl to controls at some sites ( p > 0.05, respectively). These data indicate that LH2 deficiency may cause diminished glycosylation at several sites. Interestingly, when a percentage of two glycosylation forms (G- + GG- = 100%) was calculated, GG- form was lower and G- form was higher at most sites in KO collagen when compared to controls (Table 4 ). These data suggest that LH2 deficiency causes a relative decrease of GG activity leading to relative increase in the G-Hyl form, in agreement with our recent report 6 . Pro 3-Hydroxylation. Several sites of 3-hydroxyproline (3-Hyp), i.e. α1 Pro-986 and consecutive modification sites (α1 Pro-707, 716, 719 and α2 Pro-707, 716, 719) 38 were identified (Supplementary Table S2). In KO type I collagen, slight but significant increases of Pro 3-hydroxylation were observed at α1 Pro-986 (~ 91–93% for MC/EV, and ~ 94–98% for KO), and at α1/α2 Pro-707, 716 and 719, indicating that LH2 could be involved in this modification (Supplementary Table S2). Collagen Cross-link Analysis. Control groups (MC and EV) showed essentially identical cross-link patterns (Fig. 4 ) with no statistical difference in any of the cross-links. The amounts of cross-links of control and KO collagens are summarized in Table 5 . In control groups, the major cross-link was DHLNL (Hyl ald × Hyl) representing ~ 67% of the total cross-links. The rest includes HLNL (Hyl ald × Lys or Lys ald × Hyl), Pyr (Hyl ald × Hyl ald × Hyl) and HHMD (Lys ald × Lys ald × His × Hyl). In KO collagen, none of the Hyl ald -derived cross-links (DHLNL, Pyr) were detected while Lys ald -derived cross-links, HLNL and HHMD, were both significantly increased by ~ 44 and ~ 400%, respectively. Though HLNL can be derived from Hyl ald or Lys ald , since Lys at the helical cross-linking sites are almost fully hydroxylated and telopeptidyl Lys is not hydroxylated in KO collagen (Table 2), it should be derived from Lys ald × Hyl in KO. In contrast to the striking difference in the type of cross-links, the difference in the total number of aldehydes involved in cross-linking is small (0.1–0.2 moles/mole of collagen) between control and KO collagens. This indicates that LOX/LOXL activities are not significantly affected in KO clones. Collagen Solubility, Fibrillogenesis and Matrix Mineralization. We then evaluated the biochemical, morphological, and functional outcomes of LH2KO. First, we found that LH2KO resulted in a marked increase in collagen solubility (Table 6 ). Approximately 38% of KO collagen was solubilized with 0.5 M acetic acid while only trace amounts were solubilized in controls, MC (3.5%) and EV (2.7%) ( p < 0.001). When the insoluble fractions with acetic acid (62.3–67.9% of KO and 96.5 and 97.3% of MC and EV collagens, respectively) were digested with pepsin, most of the KO collagen (53.7–61.6%) was solubilized while only 30.3 and 25.0% of collagen was solubilized in MC and EV, respectively ( p < 0.001). After these serial extractions, the final insoluble collagen represented only 6.3–9.2% in KO collagen whereas the majority of collagen (66.2–72.4%) still remained insoluble in MC and EV (Table 6 ). These results clearly demonstrate that the lack of LH2-catalyzed modifications, i.e. primarily telopeptidyl Lys hydroxylation and subsequent cross-linking, makes collagen highly soluble. Second, we examined the effects of LH2KO on collagen fibrillogenesis. Representative cross-sectional/longitudinal views of collagen fibrils and the diameter distribution obtained from the cultures of controls (MC and EV) and KO clones (KO-1, -2, and − 3) are shown in Fig. 5 . The fibrils in KO clones were generally circular in shape and overall similar to those of MC and EV. However, the collagen fibrils in all KO clones were sparse (Fig. 5 ) and the diameters were significantly smaller than those of MC and EV (Fig. 5 , p < 0.0001), indicating defective lateral growth of fibrils in KO collagen. Lastly, we assessed the effects of LH2KO on in vitro mineralization. The controls (MC and EV) and KO clones (1–3) were cultured for 28 days and subjected to mineralization assay using Alizarin red S staining (Fig. 6 ). In the controls (MC and EV), mineralized nodules were well formed at this point, however, no nodules were observed in KO clones (Fig. 6 a and b), demonstrating that the lack of LH2 results in defective matrix mineralization. Discussion In this study, by generating LH2KO clones, we extensively characterized the molecular phenotypes of type I collagen. The lack of LH2 resulted in complete absence of Lys hydroxylation in all telopeptides, i.e. N- (9 N ) and C-telo (16 C ) of an α1 and N-telo (5 N ) of an α2 chains, thus, LH2 is solely responsible for hydroxylation in all Lys residues in telopeptides. Consistent with these data, the Hyl ald -derived cross-links, the major cross-links in MC/EV collagen, were completely absent from KO collagen and were replaced with Lys ald -derived cross-links. Moreover, our data indicated that LH2 may also be involved in helical Lys hydroxylation in a site-specific manner. The lack of LH2-catalyzed modification has significant impact on collagen solubility, collagen fibrillogenesis and matrix mineralization. In addition, LH2 could be involved in glucosylation of galactosyl Hyl. Though the role of LH2 as telopeptidyl LH has been widely accepted 28 , the evidence reported thus far was not complete due mainly to the lack of appropriate models and analytical tools. Since LH2 KO mice die at early embryonic stage 32 , we generated LH2 KO clones using MC cells. MC cells are derived from normal mouse calvaria and collagen phenotypes are well-characterized 8 , 9 , 19 , 20 , 36 . MC cells synthesize predominantly type I collagen (> 96% of total collagen) 36 , 39 , Lys residues on type I collagen including cross-linking sites are only partially hydroxylated, all LHs (LH1-3) are well expressed, and collagen cross-links are sufficiently formed within 2 weeks of culture and mature with predictable kinetics 9 , 40 . These characteristics make MC cells an excellent model to investigate the biological functions of Lys modifications by manipulating specific LH gene expression and characterizing its effects on type I collagen 41 . Our current data unequivocally demonstrate that all Lys residues in telopeptides are hydroxylated solely by LH2, and neither LH1 nor LH3 can compensate for this function. It is not clear at this point what determines such substrate specificity for LH2. However, considering the fact that an acidic amino acid, Glu or Asp, is positioned next/close to telopeptidyl Lys residues (i.e. -Glu-Lys-Ser- in N- and C-telo of an α1 chain in both mouse and human, and -Asp-Lys-Gly- or -Asp-Gly-Lys-Gly- in N-telo of the mouse or human α2 chain, respectively), the presence of two basic Arg residues adjacent to the catalytic site of LH2 (R680 and R682) is likely important to determine such specificity 6 . Notably, these Arg residues are absent in LH1 or LH3 which explains their inability to compensate for LH2 deficiency. It is also interesting to note that, in MC/EV type I collagen, both N- and C-telo Lys residues of an α1 chain are ~ 50% hydroxylated while the N-telo Lys of an α2 chain is only ~ 20% hydroxylated. Possibly, the Asp-Lys-Gly- sequence of the latter that is also present in the helical domain may not be an optimal substrate for LH2. This is likely the reason why the Lys ald -involved cross-links are often derived from the α2 N-telo domain 10 , 42 , 43 . Duran et al. has recently reported that a chaperone complex formed by HSP47, FKBP65 and BiP modulates telopeptide Lys hydroxylation of type I procollagen chains. Defects of the complex members affected this modification either by enhancing (defect in Hsp47 and Bip) or diminishing (defect in Fkbp65) LH2 activity 34 . In contrast, Syx et al has stated that a mutant Hsp47, which showed a reduced binding to type I collagen, resulted in decreased LH2 44 . These inconsistent data suggest that Hsp47 may act as a positive or negative regulator of LH2 in a context-dependent manner. Interestingly, our present study showed that Fkbp65, Hsp47 and Bip protein levels were reduced in KO clones compared to MC (Fig. 2 ), suggesting that this chaperone complex may be destabilized by the lack of LH2. It has been speculated that LH2 also catalyzes helical Lys hydroxylation based on its ability to hydroxylate the Lys residues in the synthetic (Ile-Lys-Gly) 3 peptide and the data from the LH2/proα1(I) co-expression in an insect cell system 22 . The results indicate that, in this system, LH2 may function as a helical LH when LH1 and 3 are absent. However, the effect of LH2 expression on Lys hydroxylation at the specific molecular loci in an α1 chain including its C-telo domain or in an α2 chain including its N-telo domain were not investigated. Recently, Gistelinck et al has reported that, in the bone from a 4-year old patient carrying a PLOD2 heterozygous mutation, Lys in the α1(I) telopeptides was severely underhydroxylated while Lys at the helical cross-linking sites in type I collagen was normally hydroxylated 25 . Their findings are consistent with our current cell-based study showing that, when LH2 is absent, on the contrary to the changes in Lys hydroxylation in the telopetides, the extent of Lys hydroxylation in the helical domain was only minimally affected (Table 2, Fig. 3 ). It is important to note that, when these percentage differences are converted to the number of Hyl residues in a collagen molecule, the difference between MC/EV and KO is less than ± 0.03 residues at the cross-linking sites (α1–87, α1-918/930, α2–87, α2-933) and 0-0.2 residues at the non-cross-linking sites. Since Lys hydroxylation at the helical cross-linking sites is predominantly catalyzed by LH1 and its complex such as prolyl 3-hydroxylase 3 (P3H3), Synaptonemal Complex 65 (SC65) and CypB 13 , 33 , 45 , 46 , it is not surprising that absence of LH2 essentially does not affect Lys hydroxylation at these functionally critical sites in the helical domain. The significance of Lys hydroxylation at other sites in the helical domain is not well defined but, possibly, they may affect the interaction between collagen and collagen-binding proteins such as small leucine-rich proteoglycans and/or cell surface receptors such as integrins and discoidin domain receptor 2 47 . Recently, Ishikawa and co-workers reported that the cooperation between LH1 and P3H3 is required for Lys hydroxylation in the helical domain of type I collagen, and that P3H3 may function as helical LH at specific cross-linking sites 46 . They also reported that LH2 level remained unchanged in LH1 null mice 46 . In the present study, we did not find a significant change of LH1 protein in LH2 KO clones. These findings suggest that there is no apparent direct interaction between LH1 and LH2. Thus, LH2 deficiency caused only a minute change in Lys hydroxylation in the helical domain of type I collagen. One of the intriguing findings in the current study was that absence of LH2 affects Hyl glycosylation pattern. When the percentages of G- and GG- forms in total glycosylation forms (G- + GG-) are calculated, KO collagen showed that at most sites, the GG- was decreased at the expense of G- form in KO type I collagen (Table 4 ). Recently, we have reported that LH2 potentially has galactosylhydroxylysyl glucosyltransferase (GGT) activity 6 and the current data (Table 4 and Supplementary Table S3) supports this notion. During procollagen biosynthesis, prolyl 3-hydroxylation, another post-translational modification of collagen, is catalyzed by a complex composed of cartilage associated protein (CRTAP), prolyl 3-hydroxylase 1 (P3H1) and cyclophilin B (CypB) 48 . The deficiency of any of these components severely affects this modification leading to severe forms of recessive osteogenesis imperfecta 49 – 51 . It has been reported that the α1 Pro-986, the major site for this modification, is hydroxylated by P3H1 49 , and another modification site, α1/2 Pro-707, mainly by P3H2 52 . In the present study, we found that the extent of P3H at these sites was slightly increased in KO clones, suggesting that LH2 may interact with the P3H complex for prolyl-3-hydroxylation at these sites (Supplementary Table S2). Since LH2 interacts with CypB 33 , a P3H complex member, these slight changes could occur by the lack of this interaction. The impact of LH2 deficiency on collagen stability, fibrillogenesis and mineralization was striking. First, collagen solubility with dilute acid and pepsin digestion were markedly increased in KO collagen, i.e. > 90% of KO collagen was solubilized by these treatments while it was only ~ 30% in control groups. The marked increases in solubility in KO collagen can be explained by the differences in the nature of the cross-links. In KO collagen, since telopeptidyl Lys is not hydroxylated, the cross-links formed are all Lys ald -derived, aldimine cross-links such as deH-HLNL and deH-HHMD. The aldimine bond is known to be labile to dilute acids, thus, readily dissociated 53 . In contrast, the Hyl ald -derived bifunctional aldimine cross-links are spontaneously rearranged to ketoamines that are stable to dilute acids. The collagens containing the stable Hyl ald -derived cross-links are also more resistant against enzymatic degradation than those with the Lys ald -derived cross-links 54 , 55 . Since the total number of aldehydes involved in cross-linking is only slightly lower in KO collagen compared to the control (by ~ 8%), the data implies that the Hyl ald -derived cross-linking is critical to confer insolubility on type I collagen. This is likely the reason why collagen enriched in the Hyl ald -derived cross-links accumulates without being readily degraded by proteolytic enzymes in fibrosis 28 , 56 , 57 and also in desmoplastic tumors such as pancreatic ductal adenocarcinoma 58 , lung cancer 29 , breast cancer 59 , 60 and oral cancer 30 . Such stiffened collagen matrix may not only form a shelter for cancer cells to protect them from immune cells and anti-cancer drugs but also serve as a means for cancer cells to attach, migrate and metastasize efficiently 41 , 61 , 62 . Second, fibrillogenesis in LH2 KO collagen is also affected showing significantly smaller fibril diameters compared to those of controls. This could be due to several factors including: 1). since KO collagen is more susceptible to degradation (see above), collagen fibrils may not be able to grow, 2). altered Lys modifications (hydroxylation and glycosylation) of KO collagen may favor the association with collagen-binding proteins, such as decorin, that is known to inhibit collagen fibrillogenesis 63 – 65 , 3). altered post-translational modifications in KO collagen may inherently limit the growth of molecular packing into a fibril. Notably, when LH2 is overexpressed in MC cells, collagen fibrils are also smaller than controls 20 . This may indicate that the extent of LH2-mediated post-translational modifications should be kept at a certain range to establish an appropriate size of collagen fibrils in this cell culture system. In bone, fibrillar type I collagen functions as an organizer of mineral deposition and growth 66 – 68 . Since initial mineralization appears to occur in the intermolecular channel formed by contiguous hole zones in the collagen fibril 69 , the pattern of intermolecular cross-linking formed at the edge of hole zones should be critical to organize mineralization 70 . The LH2 KO collagen fibrils that contain abnormal cross-linking and are smaller in size may not serve well as a stable template to accommodate and organize matrix mineralization. This may in part cause defective bone formation as seen in Bruck syndrome 1 and 2, a disease that is caused by mutations in genes encoding LH2 chaperone FKBP65 and LH2, respectively. In addition to the structural function, LH2 may regulate cellular activities through its action on integrin β1 71 that may also impact the mineralization process. Recently, we have reported bone phenotypes of LH2 heterozygous mice (LH2 +/− ) in which LH2 expression levels are only ~ 50% of those of wild type mice (LH2 +/+ ). In this animal model, LH2 +/− femurs showed lower bone mineral density and inferior bone mechanical properties compared to those of LH2 +/+ mice 72 . When cultured, LH2 +/− osteoblastic cells mineralized poorly compared to those of LH2 +/− cells, which is consistent with our current study. Thus, while we cannot determine to what extent the LH2-catalyzed modification is directly involved in collagen mineralization, such modification appears to play a critical role in this process. LH2 has two isoforms: one with an additional 63 bp-exon 13A (LH2b) and the other without (LH2a) 5 . It is generally accepted that LH2b is the telopeptidyl LH, but recently it has been reported that LH2a is also capable of catalyzing Lys hydroxylation in the telopeptides 6 . Inducing these isoforms in the LH2 KO cells separately and characterizing collagen molecular phenotypes in these clones will provide valuable insights into their distinct or overlapping functions. This is now underway in our laboratory and will be the subject of the separate publication. In conclusion, this study demonstrates that the major function of LH2 is to hydroxylate the N- (α1 and α2 chains) and C-telopeptidyl (α1 chain) Lys residues of type I collagen. The deficiency of LH2 profoundly affects collagen cross-linking, solubility, fibrillogenesis, and mineralization. These results underscore the pivotal role of the LH2-mediated post-translational modifications in the formation and function of fibrillar collagen in bone. Methods Cell Lines and Culture Conditions. MC3T3-E1 subclone 4, a well characterized nontransformed mouse osteoblast-like cell line 73 , was purchased from American Type Culture Collection (CRL-2593). Cells were grown in α-minimum essential media (Invitrogen, Carlsbad, CA, USA) containing 10% FBS (Invitrogen) and supplemented with 100 units/ml penicillin G sodium and 100µg/ml streptomycin sulfate in a 5% CO 2 atmosphere at 37°C. The medium was changed twice a week. Generation of MC cells lacking LH2 by CRISPR/Cas9n gene editing. To generate LH2 deficient (KO) cells, we used double-nicking strategy to minimize off-target mutagenesis 74 . Two pairs of gRNAs (gRNA 1 [antisense: ctcctccgccacgcccaggc] and 2 [sense: acgcccgggcgcatccctgc]) were chosen to target the exon 1 of the mouse Plod2 gene. Oligonucleotide pairs containing these gRNA sequences were cloned into pX335 (Addgene) that contains D10A mutant Cas9 (Cas9n) 75 , to produce pX335-mLH2-1 and − 2. The sequence-verified pairs of pX335-mLH2-1 and − 2 (Eton Bioscience, Durham, NC, USA), together with a puromycin-containing plasmid were transfected into MC cells using FuGENE 6 transfection reagent (Roche Applied Sciences). The non-transfected MC cells and those transfected with the original pX335 plasmid (empty vector (EV); ligation of pX335 alone without annealed sgRNA oligo inert) were used as controls. After 48h, the transfected cells were trypsinized, single-cell sorted into 96-well plates by fluorescence-activated cell sorter (FACS), and maintained in α-minimum essential medium, 10% FBS, 100 units/ml penicillin, 100 µg/ml streptomycin, and 2 µg/ml Puromycin (InvivoGen, San Diego, CA, USA). The expanded cells were characterized by sequencing the targeted region of Plod2 gene and by comparing the level of LH2 with those of the EV and the non-transfected MC cells. Evaluation of Off-target Effect The specificity of the various gRNAs used in this study and their potential off-target cleavage probabilities were evaluated using two different algorithms, online CRISPR RGEN Tools and Off-Spotter design prior to deploying them in MC cells. Quantitative Real-time PCR. To determine the expression of Plod2 , MC, EV and KO clones were plated at a density of 2 × 10 5 cells/35mm-dish. After 48 h, total RNA was extracted with TRIzol reagent (Invitrogen). Expression levels of Plod2 mRNA were assessed by one-step quantitative reverse transcription polymerase chain reaction (RT-PCR) with ABI Prism 7500 (Applied Biosystems). The specific probe and primers set for Plod2 was purchased from ThermoFisher Scientific (TaqMan Gene Expression Assay, Mm00478767_m1). The mRNA expression levels were normalized to beta-actin ( Actb ; Mm01205647_g1) and analyzed by the 2 −ΔΔCT method 76 . Western Blot Analysis. To determine the protein level, the KO clones and controls were plated onto 35-mm dishes at a density of 3×10 5 cells/dish. After culturing for 7 days, the cells were washed with phosphate-buffered saline (PBS), lysed with radio-immunoprecipitation assay (RIPA) lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 0.5% Sodium deoxycholate, 0.1% SDS, and 1% NP-40), centrifuged at 1,2000 ×g and the supernatant was collected. The total protein concentration was measured by the Pierce BCA Protein Assay Kit (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer’s protocol. The cell lysate was mixed with 2× Laemmli Sample Buffer containing 2-mercaptoethanol (BIO-RAD) and 10 µg of total protein was applied to a 4–20% Mini-PROTEAN TGX Precast Protein Gel (BIO-RAD). The separated proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Immobilon-P, Millipore Corp., Bedford, MA, USA) and probed with rabbit polyclonal anti-LH2 antibody (Proteintech Group, Inc., Rosemont, IL, USA). Other protein levels were also characterized using rabbit polyclonal PLOD1 antibody (1:200, cat# 12475-1-AP, Proteintech), rabbit polyclonal PLOD2 antibody (1:100, cat# 21214-1-AP, Proteintech), rabbit polyclonal PLOD3 antibody (1:200, cat# 11027-1-AP, Proteintech), rabbit polyclonal GLT25D1 antibody (1:200, cat# 16768-1-AP, Proteintech), rabbit polyclonal Fkbp65 antibody (1:200, cat# 12172-1-AP, Proteintech), rabbit polyclonal CypB antibody (1:10,000, cat# PA1-027A, Thermo Fisher), rabbit polyclonal Hsp47 antibody (1:100, cat# 10875-1-AP, Proteintech), and rabbit polyclonal Bip antibody (1:100, cat# 11587-1-AP, Proteintech). Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Cell Signaling Technology) was used as a secondary antibody and HRP-conjugated anti-β-actin rabbit monoclonal antibody (13E5, Cell Signaling Technology) was used as an internal control for protein loading. The reactivities of HRP were detected with SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific) and the chemiluminescence was scanned using an Odyssey Infrared Imaging System (LI-COR Biosciences). Quantitation of proteins was performed using the Image Studio software version 4.0 (LI-COR) with normalization to β-actin levels and was then shown as the change relative to the protein levels in MC as 1.0. Collagen Preparation for Biochemical Analysis. MC, KO and EV clones were cultured in α-minimum essential media (Invitrogen) containing 10% FBS, 100 units/ml penicillin, and 100 µg/ml streptomycin. When the cells grew to confluence, the medium was replaced with that containing 50 µg/ml of ascorbic acid. After 2 weeks of culture, the cells/matrix layers were scraped, thoroughly washed with PBS and cold distilled water several times by repeated centrifugation at 4,000 xg, and lyophilized. Collagen Type Analysis. Collagen was extracted and purified from lyophilized cell/matrix layer of MC, EV, and KO clones by digestion with pepsin (Sigma-Aldrich, St. Louis, MO, USA; 5 mg/mL in 0.5 M acetic acid) and salt precipitation (0.7 M in 0.5 M acetic acid) as described previously 36 . Type I and III collagens were quantified by LC-MS using SI-collagen as an internal standard 35 . In brief, SI-collagen was first mixed into the purified collagen samples, and the samples were digested with sequencing grade trypsin (Promega, Madison, WI, USA; 1:50 enzyme/substrate ratio) in 100 mM Tris-HCl/1 mM CaCl 2 (pH 7.6) at 37°C for 16 hours after heat denaturation at 60°C for 30 min. Generated marker peptides of type I and III collagens (two peptides for each α chain; stable isotopically heavy and light ones) were monitored by LC-QqQ-MS on a 3200 QTRAP hybrid QqQ/linear ion trap mass spectrometer (AB Sciex, Foster City, CA, USA) with an Agilent 1200 Series HPLC system (Agilent Technologies, Palo Alto, CA, USA) using a BIOshell A160 Peptide C18 HPLC column (5 µm particle size, L × I.D. 150 mm × 2.1 mm; Supelco, Bellefonte, PA, USA) to determine the concentrations of type I and type III collagens. Reduction with NaB 3 H 4 . Lyophilized cell/matrix samples (~ 2.0 mg each) were suspended in buffer containing 0.15 M N-trismethyl-2-aminoethanesulfonic acid, and 0.05 M Tris-HCl, pH 7.4, and reduced with standardized NaB 3 H 4 . The specific activity of the NaB 3 H 4 was determined by the method previously reported 77 . The reduced samples were washed with cold distilled water several times by repeated centrifugation at 4,000 ×g and lyophilized. Quantification of Hyl by HPLC. Reduced collagen was hydrolyzed with 6 N HCl and subjected to amino acid analysis 78 . The level of total Hyl in a collagen molecule was calculated based on the value of 300 residues of Hyp per collagen molecule, which were quantified as residues/collagen molecule 8 . Site-specific Characterization of Post-translational Modifications of Type I collagen. The purified collagen samples were digested with trypsin as described above to analyze the Lys post-translational modifications at the specific molecular sites within the triple helical domain of type I collagen 37 . In addition, to analyze Lys hydroxylation at the telopeptide domains of type I collagen, the lyophilized cell/matrix samples were sequentially digested with bacterial collagenase and pepsin as previously reported 37 . In brief, the samples were digested with 0.01 mg/ml of collagenase from Grimontia hollisae (Nippi, Tokyo, Japan) 79 in 100 mM Tris-HCl/5 mM CaCl 2 (pH 7.5) at 37°C for 16 hours after heating at 60°C for 30 min. After addition of acetic acid (final 0.5 M), the collagenase-digests were further digested with 0.01 mg/ml of pepsin (Sigma-Aldrich) at 37°C for 16 hours. The trypsin- or collagenase/pepsin-digests were subjected to LC-QTOF-MS analysis on an ultra-high resolution QTOF mass spectrometer (maXis II, Bruker Daltonics, Bremen, Germany) coupled to a Shimadzu Prominence UFLC-XR system (Shimadzu, Kyoto, Japan) using an Ascentis Express C18 HPLC column (5 µm particle size, L ⋅ I.D. 150 mm ⋅ 2.1 mm; Supelco) 37 . Site occupancy of Lys hydroxylation/glycosylation (Lys, Hyl, G-Hyl, and GG-Hyl) was calculated using the peak area ratio of EICs (mass precision range = ± 0.05) of peptides containing the respective molecular species as previously reported 12 , 33 , 37 , 80 . Collagen Cross-link Analysis. Reduced collagen was hydrolyzed with 6 N HCl, and subjected to cross-link analysis as described previously 78 . Upon reduction, the dehydrodihydroxylysinonorleucine (dehydro-DHLNL)/its ketoamine, dehydrohydroxylysinonorleucine (dehydro-HLNL)/its ketoamine, and dehydrohistidinohydroxymerodesmosine (dehydro-HHMD) are reduced to stable secondary amines, DHLNL, HLNL, and HHMD. The reducible cross-links were analyzed as their reduced forms (i.e. DHLNL, HLNL, and HHMD, respectively). Hereafter, the terms DHLNL, HLNL, and HHMD will be used for both the unreduced and reduced forms. The levels of the major immature reducible, DHLNL, HLNL, and HHMD, and mature non-reducible cross-links, Pyr, were quantified as moles/mole of collagen 78 , 81 . Solubility of Collagen. Solubility of collagen from lyophilized cell/matrix samples were evaluated by sequential extraction using acetic acid and pepsin as described previously with slight modification 80 . In brief, collagen was first extracted using 0.5 M acetic acid at 4°C for 24 h, and subsequently extracted with 5 mg/ml high-purity pepsin (1:60,000; Wako Chemicals) in 0.5 M acetic acid at 4°C for 24 h. The acid- and pepsin-soluble fractions and the residual fraction were subjected to acid hydrolysis (6 N HCl, 110°C for 20 h in the gas phase under N 2 ) after addition of SI-collagen as an internal standard 35 . The acid hydrolysates were subjected to LC-MS analysis of 4-Hyp in MRM mode on the QqQ mass spectrometer using a ZIC-HILIC column (3.5 µm particle size, L ⋅ I.D. 150 mm ⋅ 2.1 mm; Merck Millipore, Billerica, MA, USA) 80 . Concentration of collagen was estimated by the peak area ratio of 4-Hyp to stable isotopically heavy 4-Hyp derived from SI-collagen. Measurements of Collagen Fibril Diameter by Transmission Electron Microscopy. MC, KO and EV clones were plated at a density of 2×10 5 cells/ 35-mm dishes and cultured in α-minimum essential medium, 10% FBS, 100 units/ml penicillin, 100 µg/ml streptomycin, 50 µg/ml ascorbic acid, and 2 mM β-glycerophosphate, for 2 weeks. The cell/matrix layers were washed with PBS, fixed with 2.5% EM grade glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.4. The samples were then postfixed in potassium ferrocyanide-reduced osmium for 1 h at room temperature. After rinsing with distilled water, the samples were dehydrated with a graded series of ethanol concentrations, and embedded in PolyBed-812 epoxy resin (Polysciences, Warrington, PA, USA). Sections of 70 nm thickness were cut, mounted on copper Formvar-carbon filmed grids, and stained with 4% uranyl acetate and Reynolds’ lead citrate 82 . Cross-sectional views of the collagen fibrils were observed using a LEO EM-910 transmission electron microscope operating at 80 kV (Carl Zeiss SMT, Peabody, MA, USA), and images were taken at 25,000×using a Gatan Orius SC1000 CCD camera with Digital Micrograph 3.11.0 (Gatan, Inc., Pleasanton, CA, USA). For each sample, the diameters of 3,000 fibrils were measured using ImageJ 1.44p software. In Vitro Mineralization Assay. MC, EV and KO clones were plated at a density of 2×10 5 cells/35-mm dish and cultured in α-minimum essential medium containing 10% FBS, 100 units/ml penicillin, and 100 µg/ml streptomycin. Upon confluence, cells were maintained in the mineralization medium containing 50 µg/ml ascorbic acid and 2 mM β-glycerophosphate and cultured for up to 4 weeks. The cell/matrix layer from each sample was washed with PBS, fixed with 100% methanol, and stained with 1% Alizarin Red S (Sigma Chemical, St. Louis, MO, USA). Then, the extent of mineralization was evaluated from the measurements of Alizarin Red S content by using the previous reported method 83 . Statistical Analyses. Statistical analyses were performed using Jmp®8.0 software (SAS Institute Inc., Cary, NC, USA). Statistical differences were determined by Kruskal-Wallis one-way analysis of variance and means comparison by Student’s t test. The data were presented as means ± standard deviation (S.D.), and a p value less than 0.05 was considered to be statistically significant. Declarations Data availability All data are contained within this manuscript and supporting information. The MS data sets for specific lysine post-translational modification in type I collagen have been deposited to the Zenodo repository (https://zenodo.org/record/5211220#.YRxpjOjniUk). The all source data are available from the corresponding author upon request. Author contributions MT: Data curation, formal analysis, investigation, visualization, writing-original draft; YT: Data curation, formal analysis, investigation, visualization, writing-original draft; TN: Data curation, Methodology, Resources, validation; HFG: Data curation, writing-review & editing; YK: Data curation, formal analysis, writing-review & editing; NMS: Funding acquisition, resources, writing-review & editing; KPS: Methodology, writing-review & editing; ALA: Funding acquisition, methodology, writing-review & editing; KM: methodology, resources, validation; JMK: Funding acquisition, methodology, writing-review & editing; MY: conceptualization, funding acquisition, methodology, project administration, supervision, writing-original draft, writing-review & editing. Funding This work was supported by NIH R01CA251067 to JMK and MY, Basic Science Fund from Nippi to YT, JSPS KAKENHI Grant Number JP19H03439 to TN, NIH R01 HL049277 to NMS, and Developmental Research Program Grant from the Yale Head and Neck SPORE NIDCR P50-DE030707 to ALA. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Competing interests The authors declare no competing interests. Additional information This article contains supplementary information. References Yamauchi, M. & Sricholpech, M. Lysine post-translational modifications of collagen. Essays Biochem 52 , 113–133, doi: 10.1042/bse0520113 (2012). Mercer, D. K., Nicol, P. F., Kimbembe, C. & Robins, S. P. Identification, expression, and tissue distribution of the three rat lysyl hydroxylase isoforms. Biochemical and Biophysical Research Communications 307 , 803–809, doi: 10.1016/s0006-291x(03)01262-2 (2003). Valtavaara, M. et al. Cloning and Characterization of a Novel Human Lysyl Hydroxylase Isoform Highly Expressed in Pancreas and Muscle. J Biol Chem 272 , 6831–6834 (1997). Valtavaara, M., Valtavaara, M., Szpirer, C., Szpirer, J. & Myllyla, R. Primary Structure, Tissue Distribution, and Chromosomal Localization of a Novel Isoform of Lysyl Hydroxylase (Lysyl Hydroxylase 3). The Journal of biological chemistry 273 , 12881–12886 (1998). Yeowell, H. N. & Walker, L. C. Tissue specificity of a new splice form of the human lysyl hydroxylase 2 gene. Matrix. Biol 18 , 179–187 (1999). Guo, H. F. et al. A collagen glucosyltransferase drives lung adenocarcinoma progression in mice. Communications biology 4 , 482, doi: 10.1038/s42003-021-01982-w (2021). Schegg, B., Hulsmeier, A. J., Rutschmann, C., Maag, C. & Hennet, T. Core glycosylation of collagen is initiated by two beta(1-O)galactosyltransferases. Mol Cell Biol 29 , 943–952, doi: 10.1128/MCB.02085-07 (2009). Sricholpech, M. et al. Lysyl hydroxylase 3 glucosylates galactosylhydroxylysine residues in type I collagen in osteoblast culture. The Journal of biological chemistry 286 , 8846–8856, doi: 10.1074/jbc.M110.178509 (2011). Sricholpech, M. et al. Lysyl Hydroxylase 3-mediated Glucosylation in Type I Collagen: MOLECULAR LOCI AND BIOLOGICAL SIGNIFICANCE. Journal of Biological Chemistry 287 , 22998–23009, doi: 10.1074/jbc.M112.343954 (2012). Terajima, M. et al. Glycosylation and cross-linking in bone type I collagen. The Journal of biological chemistry 289 , 22636–22647, doi: 10.1074/jbc.M113.528513 (2014). Ishikawa, Y., Boudko, S. & Bachinger, H. P. Ziploc-ing the structure: Triple helix formation is coordinated by rough endoplasmic reticulum resident PPIases. Biochimica et biophysica acta 1850 , 1983–1993, doi: 10.1016/j.bbagen.2014.12.024 (2015). Cabral, W. A. et al. Abnormal type I collagen post-translational modification and crosslinking in a cyclophilin B KO mouse model of recessive osteogenesis imperfecta. PLoS genetics 10 , e1004465, doi: 10.1371/journal.pgen.1004465 (2014). Heard, M. E. et al. Sc65-Null Mice Provide Evidence for a Novel Endoplasmic Reticulum Complex Regulating Collagen Lysyl Hydroxylation. PLoS genetics 12 , e1006002, doi: 10.1371/journal.pgen.1006002 (2016). Gjaltema, R. A., van der Stoel, M. M., Boersema, M. & Bank, R. A. Disentangling mechanisms involved in collagen pyridinoline cross-linking: The immunophilin FKBP65 is critical for dimerization of lysyl hydroxylase 2. Proc Natl Acad Sci U S A 113 , 7142–7147, doi: 10.1073/pnas.1600074113 (2016). Eyre, D. R. & Weis, M. A. Bone Collagen: New Clues to Its Mineralization Mechanism from Recessive Osteogenesis Imperfecta. Calcified tissue international 93 , 338–347, doi: 10.1007/s00223-013-9723-9 (2013). Kang, H., Aryal, A. C. S. & Marini, J. C. Osteogenesis imperfecta: new genes reveal novel mechanisms in bone dysplasia. Transl Res 181 , 27–48, doi: 10.1016/j.trsl.2016.11.005 (2017). Trackman, P. C. Enzymatic and non-enzymatic functions of the lysyl oxidase family in bone. Matrix biology: journal of the International Society for Matrix Biology 52–54 , 7–18, doi: 10.1016/j.matbio.2016.01.001 (2016). Uzawa, K. et al. Differential Expression of Human Lysyl Hydroxylase Genes, Lysine Hydroxylation, and Cross-Linking of Type I Collagen During Osteoblastic Differentiation In Vitro. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 14 , 1272–1280 (1999). Pornprasertsuk, S., Duarte, W. R., Mochida, Y. & Yamauchi, M. Lysyl hydroxylase-2b directs collagen cross-linking pathways in MC3T3-E1 cells. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 19 , 1349–1355, doi: 10.1359/JBMR.040323 (2004). Pornprasertsuk, S., Duarte, W. R., Mochida, Y. & Yamauchi, M. Overexpression of lysyl hydroxylase-2b leads to defective collagen fibrillogenesis and matrix mineralization. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 20 , 81–87, doi: 10.1359/JBMR.041026 (2005). van der Slot, A. J. et al. Identification of PLOD2 as telopeptide lysyl hydroxylase, an important enzyme in fibrosis. The Journal of biological chemistry 278 , 40967–40972, doi: 10.1074/jbc.M307380200 (2003). Takaluoma, K., Lantto, J. & Myllyharju, J. Lysyl hydroxylase 2 is a specific telopeptide hydroxylase, while all three isoenzymes hydroxylate collagenous sequences. Matrix biology: journal of the International Society for Matrix Biology 26 , 396–403, doi: 10.1016/j.matbio.2007.01.002 (2007). Bank, A. R. et al. Defective collagen crosslinking in bone, but not in ligament or cartilage, in Bruck syndrome: Indications for a bone-specific telopeptide lysyl hydroxylase on chromosome 17. Proc. Natl. Acad. Sci. USA 96 , 1054–1058 (1999). Gistelinck, C. et al. Loss of Type I Collagen Telopeptide Lysyl Hydroxylation Causes Musculoskeletal Abnormalities in a Zebrafish Model of Bruck Syndrome. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 31 , 1930–1942, doi: 10.1002/jbmr.2977 (2016). Gistelinck, C. et al. Abnormal Bone Collagen Cross-Linking in Osteogenesis Imperfecta/Bruck Syndrome Caused by Compound Heterozygous PLOD2 Mutations. JBMR plus 5 , e10454, doi: 10.1002/jbm4.10454 (2021). Gilkes, D. M. et al. Procollagen lysyl hydroxylase 2 is essential for hypoxia-induced breast cancer metastasis. Mol. Cancer Res 11 , 456–466, doi: 10.1158/1541-7786.MCR-12-0629 (2013). Eisinger-Mathason, T. S. et al. Hypoxia-dependent modification of collagen networks promotes sarcoma metastasis. Cancer Discov 3 , 1190–1205, doi: 10.1158/2159-8290.CD-13-0118 (2013). Piersma, B. & Bank, R. A. Collagen cross-linking mediated by lysyl hydroxylase 2: an enzymatic battlefield to combat fibrosis. Essays Biochem 63 , 377–338 (2019). Chen, Y. et al. Lysyl hydroxylase 2 induces a collagen cross-link switch in tumor stroma. The Journal of clinical investigation 125 , 1147–1162, doi: 10.1172/jci74725ds1 (2015). Saito, T. et al. Aberrant Collagen Cross-linking in Human Oral Squamous Cell Carcinoma. Journal of dental research 98 , 517–525, doi: 10.1177/0022034519828710 (2019). Maller, O. et al. Tumour-associated macrophages drive stromal cell-dependent collagen crosslinking and stiffening to promote breast cancer aggression. Nature materials, doi: 10.1038/s41563-020-00849-5 (2020). Kasamatsu, A. et al. Deficiency of lysyl hydroxylase 2 in mice causes systemic endoplasmic reticulum stress leading to early embryonic lethality. Biochem Biophys Res Commun 512 , 486–491, doi: 10.1016/j.bbrc.2019.03.091 (2019). Terajima, M. et al. Cyclophilin-B modulates collagen cross-linking by differentially affecting lysine hydroxylation in the helical and telopeptidyl domains of tendon type I collagen. The Journal of biological chemistry 291 , 9501–9512, doi: 10.1074/jbc.M115.699470 (2016). Duran, I. et al. A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 32 , 1309–1319, doi: 10.1002/jbmr.3095 (2017). Taga, Y., Kusubata, M., Ogawa-Goto, K. & Hattori, S. Stable isotope-labeled collagen: a novel and versatile tool for quantitative collagen analyses using mass spectrometry. J Proteome Res 13 , 3671–3678, doi: 10.1021/pr500213a (2014). Terajima, M. et al. Role of Glycosyltransferase 25 Domain 1 in Type I Collagen Glycosylation and Molecular Phenotypes. Biochemistry 58 , 5040–5051, doi: 10.1021/acs.biochem.8b00984 (2019). Terajima, M. et al. Cyclophilin B Deficiency Causes Abnormal Dentin Collagen Matrix. J Proteome Res 16 , 2914–2923, doi: 10.1021/acs.jproteome.7b00190 (2017). Taga, Y., Kusubata, M., Ogawa-Goto, K. & Hattori, S. Developmental Stage-dependent Regulation of Prolyl 3-Hydroxylation in Tendon Type I Collagen. The Journal of biological chemistry 291 , 837–847, doi: 10.1074/jbc.M115.686105 (2016). Hata, R. et al. Selective inhibition of type I collagen synthesis in osteoblastic cells by epidermal growth factor. Endocrinology 115 , 867–876 (1984). Kuboki, Y. & Mechanic, G. L. Comparative molecular distribution of cross-link in bone and dentin collagen. Structure-function relationships. Calcified tissue international 34 , 306–308, doi: 10.1007/bf02411256 (1982). Bota-Rabassedas, N. et al. Use of osteoblast-derived matrix to assess the influence of collagen modifications on cancer cells. Matrix biology plus 8 , 100047, doi: 10.1016/j.mbplus.2020.100047 (2020). Kang, A. H., Piez, K. A. & Gross, J. Characterization of the alpha-chains of chick skin collagen and the nature of the NH2-terminal cross-link region. Biochemistry 8 , 3648–3655, doi: 10.1021/bi00837a023 (1969). Hanson, A. D. & Eyre, D. R. Molecular Site Specificity of Pyridinoline and Pyrrole Cross-links in Type I Collagen of Human Bone. J. Biol. Chem. 271 , 26508–26516, doi: 10.1074/jbc.271.43.26508 (1996). Syx, D. et al. Aberrant binding of mutant HSP47 affects posttranslational modification of type I collagen and leads to osteogenesis imperfecta. PLoS genetics 17 , e1009339, doi: 10.1371/journal.pgen.1009339 (2021). Ishikawa, Y. et al. Mutation in cyclophilin B that causes hyperelastosis cutis in American Quarter Horse does not affect peptidylprolyl cis-trans isomerase activity but shows altered cyclophilin B-protein interactions and affects collagen folding. The Journal of biological chemistry 287 , 22253–22265, doi: 10.1074/jbc.M111.333336 (2012). Ishikawa, Y. et al. Type I and type V procollagen triple helix use different subsets of the molecular ensemble for lysine post-translational modifications in the rER. The Journal of biological chemistry 296 , 100453, doi: 10.1016/j.jbc.2021.100453 (2021). Sweeney, S. M. et al. Candidate cell and matrix interaction domains on the collagen fibril, the predominant protein of vertebrates. The Journal of biological chemistry 283 , 21187–21197, doi: 10.1074/jbc.M709319200 (2008). Choi, J. W., Schroeder, M. A., Sarkaria, J. N. & Bram, R. J. Cyclophilin B supports Myc and mutant p53-dependent survival of glioblastoma multiforme cells. Cancer Res 74 , 484–496, doi: 10.1158/0008-5472.CAN-13-0771 (2014). Morello, R. et al. CRTAP is required for prolyl 3- hydroxylation and mutations cause recessive osteogenesis imperfecta. Cell 127 , 291–304, doi: 10.1016/j.cell.2006.08.039 (2006). Cabral, W. A. et al. Prolyl 3-hydroxylase 1 deficiency causes a recessive metabolic bone disorder resembling lethal/severe osteogenesis imperfecta. Nat Genet 39 , 359–365, doi: 10.1038/ng1968 (2007). van Dijk, F. S. et al. PPIB mutations cause severe osteogenesis imperfecta. Am J Hum Genet 85 , 521–527, doi: 10.1016/j.ajhg.2009.09.001 (2009). Hudson, D. M. et al. Post-translationally abnormal collagens of prolyl 3-hydroxylase-2 null mice offer a pathobiological mechanism for the high myopia linked to human LEPREL1 mutations. The Journal of biological chemistry 290 , 8613–8622, doi: 10.1074/jbc.M114.634915 (2015). Bailey, A. J., Robins, S. P. & Balian, G. Biological significance of the intermolecular crosslinks of collagen. Nature 251 , 105–109, doi: 10.1038/251105a0 (1974). van der Slot-Verhoeven, A. J. et al. The type of collagen cross-link determines the reversibility of experimental skin fibrosis. Biochimica et biophysica acta 1740 , 60–67, doi: 10.1016/j.bbadis.2005.02.007 (2005). van den Bos, T., Speijer, D., Bank, R. A., Bromme, D. & Everts, V. Differences in matrix composition between calvaria and long bone in mice suggest differences in biomechanical properties and resorption: Special emphasis on collagen. Bone 43 , 459–468, doi: 10.1016/j.bone.2008.05.009 (2008). Ricard-Blum, S. et al. Mechanism of collagen network stabilization in human irreversible granulomatous liver fibrosis. Gastroenterology 111 , 172–182, doi: 10.1053/gast.1996.v111.pm8698196 (1996). van der Slot, A. J. et al. Increased formation of pyridinoline cross-links due to higher telopeptide lysyl hydroxylase levels is a general fibrotic phenomenon. Matrix biology: journal of the International Society for Matrix Biology 23 , 251–257 (2004). Tian, C. et al. Proteomic analyses of ECM during pancreatic ductal adenocarcinoma progression reveal different contributions by tumor and stromal cells. Proc Natl Acad Sci U S A 116 , 19609–19618, doi: 10.1073/pnas.1908626116 (2019). Maller, O. et al. Tumour-associated macrophages drive stromal cell-dependent collagen crosslinking and stiffening to promote breast cancer aggression. Nature materials 20 , 548–559, doi: 10.1038/s41563-020-00849-5 (2021). Terajima, M. et al. Collagen molecular phenotypic switch between non-neoplastic and neoplastic canine mammary tissues. Scientific reports 11 , 8659, doi: 10.1038/s41598-021-87380-y (2021). Yamauchi, M., Barker, T. H., Gibbons, D. L. & Kurie, J. M. The fibrotic tumor stroma. The Journal of clinical investigation 128 , 16–25, doi: 10.1172/JCI93554 (2018). Sato, K. et al. Lysyl hydroxylase 2-induced collagen cross-link switching promotes metastasis in head and neck squamous cell carcinomas. Neoplasia (New York, N.Y.) 23 , 594–606, doi: 10.1016/j.neo.2021.05.014 (2021). Vogel, K. G., Paulsson, M. & Heinegård, D. Specific inhibition of type I and type II collagen fibrillogenesis by the small proteoglycan of tendon. Biochem J 223 , 587–597, doi: 10.1042/bj2230587 (1984). Mochida, Y. et al. Decorin modulates collagen matrix assembly and mineralization. Matrix biology: journal of the International Society for Matrix Biology 28 , 44–52, doi: 10.1016/j.matbio.2008.11.003 (2009). Kalamajski, S. & Oldberg, A. The role of small leucine-rich proteoglycans in collagen fibrillogenesis. Matrix biology: journal of the International Society for Matrix Biology 29 , 248–253, doi: 10.1016/j.matbio.2010.01.001 (2010). Katz, E. P. & Li, S. T. Structure and function of bone collagen fibrils. Journal of molecular biology 80 , 1–15, doi: 10.1016/0022-2836(73)90230-1 (1973). Lee, D. D. & Glimcher, M. J. Three-dimensional spatial relationship between the collagen fibrils and the inorganic calcium phosphate crystals of pickerel (Americanus americanus) and herring (Clupea harengus) bone. Journal of molecular biology 217 , 487–501, doi: 10.1016/0022-2836(91)90752-r (1991). Silver, F. H. & Landis, W. J. Deposition of apatite in mineralizing vertebrate extracellular matrices: A model of possible nucleation sites on type I collagen. Connective tissue research 52 , 242–254, doi: 10.3109/03008207.2010.551567 (2011). Landis, W. J. & Jacquet, R. Association of calcium and phosphate ions with collagen in the mineralization of vertebrate tissues. Calcified tissue international 93 , 329–337, doi: 10.1007/s00223-013-9725-7 (2013). Yamauchi, M. & Katz, E. P. The post-translational chemistry and molecular packing of mineralizing tendon collagens. Connective tissue research 29 , 81–98 (1993). Ueki, Y. et al. PLOD2 Is Essential to Functional Activation of Integrin β1 for Invasion/Metastasis in Head and Neck Squamous Cell Carcinomas. iScience 23 , 100850, doi: 10.1016/j.isci.2020.100850 (2020). Saito, T. et al. Decrease of lysyl hydroxylase 2 activity causes abnormal collagen molecular phenotypes, defective mineralization and compromised mechanical properties of bone. Bone 154 , 116242, doi: 10.1016/j.bone.2021.116242 (2021). Wang, D. et al. Isolation and Characterization of MC3T3-E1 Preosteoblast Subclones with Distinct In Vitro and In Vivo Differentiation/Mineralization Potential. J. Bone Miner. Res. 14 , 893–903 (1999). Ran, F. A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154 , 1380–1389, doi: 10.1016/j.cell.2013.08.021 (2013). Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8 , 2281–2308, doi: 10.1038/nprot.2013.143 (2013). Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 , 402–408, doi: 10.1006/meth.2001.1262 (2001). Yamauchi, M., Katz, E. & Mechanic, G. Intermolecular Cross-Linking and Stereospecific Molecular Packing in Type Ι Collagen Fibrils of the Periodontal Ligament. Biochemistry 25 , 4907–4913 (1986). Yamauchi, M. & Shiiba, M. Lysine hydroxylationand cross-linking of collagen. Methods Mol. Biol. 446 , 95–108 (2008). Teramura, N. et al. Cloning of a novel collagenase gene from the gram-negative bacterium Grimontia (Vibrio) hollisae 1706B and its efficient expression in Brevibacillus choshinensis. J Bacteriol 193 , 3049–3056, doi: 10.1128/JB.01528-10 (2011). Terajima, M. et al. Cyclophilin B control of lysine post-translational modifications of skin type I collagen. PLoS genetics 15 , e1008196, doi: 10.1371/journal.pgen.1008196 (2019). Yamauchi, M. & Katz, E. The post-translational chemistry and molecular packing of mineralizing tendon collagens. Connect. Tissue Res. 29 , 81–98 (1993). Reynolds, E. The use of lead citrate at high pH as an electronopaque stain in electron microscopy. J. Cell Biol 17 , 208–212 (1963). Gregory, C. A., Gunn, W. G., Peister, A. & Prockop, D. J. An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Analytical biochemistry 329 , 77–84, doi: 10.1016/j.ab.2004.02.002 (2004). Tables Table 1 Hydroxylation of Lys in type I collagen from controls (MC and EV), and KO clones. MC EV KO-1 KO-2 KO-3 Hyl 14.1 14.5 12.5** ## 13.2* # 11.4* ## (S.D.) (0.21) (0.34) (0.14) (0.12) (0.58) Values represent mean Hyl residues/mole of collagen ± S.D. (n = 3) of triplicate analysis of the hydrolysates. * p < 0.05 and ** p < 0.01 between MC and KO; # p < 0.05 and ## p < 0.01 between EV and KO, respectively. Lys, lysine; Hyl, hydroxylysine; MC, MC3T3-E1; EV, empty vector; KO, knock-out. Table 2. Summary of site-specific modification analysis by mass spectrometry of non-cross-linked, hydroxylated and glycosylated residues in type I collagen from controls (MC and EV) and KO clones. Lys hydroxylation and its glycosylation (%) represents the relative levels of Lys, Hyl, G-Hyl, and GG-Hyl (Lys + Hyl + G-Hyl + GG-Hyl = 100%). Lys, lysine; Hyl, hydroxylysine; G-, galactosyl-; GG-, glucosylgalactosyl; MC, MC3T3-E1; EV, empty vector; KO, knock-out. Site occupancy (%) MC EV KO-1 KO-2 KO-3 α1(I) K87 Lys 1.9 ± 0.1 1.7 ± 0.1 5.6 ± 0.1*** ### 5.5 ± 0.2*** ### 3.8 ± 0.0*** ### Hyl 3.9 ± 0.2 3.2 ± 0.1 12.3 ± 1.2*** ### 11.9± 0.2*** ### 5.1± 0.1** ### G-Hyl 7.7 ± 0.2 7.8 ± 0.1 10.5 ± 0.3** ## 10.4 ± 0.3** ### 7.3 ± 0.7 GG-Hyl 86.4 ± 0.1 87.2 ± 0.1 71.6 ± 0.5*** ### 72.3 ± 0.6*** ### 83.8 ± 0.6* # α1(I) K99 Lys 69.4 ± 0.4 70.5 ± 0.3 70.4 ± 0.1 70.9 ± 0.3* 67.3 ± 0.1** ## Hyl 20.0 ± 0.4 19.7 ± 0.3 22.1 ± 0.1* ## 21.4 ± 0.4* ## 25.0 ± 0.1** ### G-Hyl 6.9 ± 0.1 6.4 ± 0.1 5.5 ± 0.1*** ## 5.6 ± 0.1*** ## 4.9 ± 0.1*** ### GG-Hyl 3.7 ± 0.1 3.4 ± 0.0 2.0 ± 0.0** ### 2.1 ± 0.0** ### 2.8 ± 0.0** ### α1(I) K174 Lys 53.3 ± 0.9 52.8 ± 0.3 64.3 ± 0.3** ### 64.6 ± 0.3** ### 57.7 ± 0.2* ### Hyl 41.2 ± 0.4 42.3 ± 0.1 33.1 ± 0.2*** ### 32.6 ± 0.2*** ### 38.4 ± 0.2** ### G-Hyl 3.1 ± 0.2 2.8 ± 0.2 1.9 ± 0.1** ## 2.0 ± 0.0* # 2.5 ± 0.0 GG-Hyl 2.4 ± 0.3 2.1 ± 0.1 0.7 ± 0.1* ### 0.8 ± 0.1* ### 1.3 ± 0.0* ### α1(I) K219 Lys 85.4 ± 0.2 87.0 ± 0.2 83.6 ± 0.3** ### 83.3 ± 0.3** ## 81.3 ± 0.2*** ### Hyl 14.6 ± 0.2 13.0 ± 0.2 16.4 ± 0.3** ### 16.7 ± 0.3** ## 18.7 ± 0.2*** ### α1(I) K564 Lys 66.6 ± 1.2 67.2 ± 0.3 73.6 ± 0.5** ### 72.5 ± 0.1* ## 67.5 ± 0.1 Hyl 24.1 ± 0.8 24.7 ± 0.2 22.3 ± 0.4 ## 23.1 ± 0.0 ## 27.3 ± 0.2* ### G-Hyl 4.3 ± 0.3 4.0 ± 0.2 2.6 ± 0.1** ## 2.8 ± 0.1* ## 3.0 ± 0.1* # GG-Hyl 4.9 ± 0.2 4.2 ± 0.2 1.5 ± 0.0*** ### 1.6 ± 0.2*** ### 2.2 ± 0.0*** ## α2(I) K87 Lys 8.4 ± 0.1 7.2 ± 0.2 7.2 ± 0.1*** 7.2 ± 0.1*** 4.1 ± 0.0*** ## Hyl 91.6 ± 0.1 92.8 ± 0.2 92.8 ± 0.1*** 92.8 ± 0.1*** 95.9 ± 0.0*** ## α2(I) K174 Lys 36.0 ± 1.4 35.6 ± 1.3 48.7 ± 0.3** ## 49.4 ± 0.4*** ## 39.8 ± 0.6* # Hyl 6.2 ± 0.4 6.0 ± 0.4 8.0 ± 0.3** ## 8.1 ± 0.4*** ## 4.6 ± 0.0* # G-Hyl 37.8 ± 0.3 38.4 ± 0.5 33.1 ± 0.7** ## 31.9 ± 0.9** ## 35.4 ± 0.1** ## GG-Hyl 20.0 ± 1.3 20.2 ± 0.6 10.2 ± 0.1** ## 10.6 ± 0.1** ## 20.1 ± 0.5 α2(I) K219 Lys 34.1 ± 0.5 34.3 ± 0.4 54.7 ± 0.5*** ### 54.9 ± 0.2*** ### 46.7 ± 0.2*** ### Hyl 62.2 ± 0.7 62.0 ± 0.1 43.9 ± 0.5*** ### 43.7 ± 0.3*** ### 50.6 ± 0.3*** ### G-Hyl 0.6 ± 0.3 0.7 ± 0.1 0.4 ± 0.1 # 0.3 ± 0.1 ## 0.5 ± 0.0 # GG-Hyl 3.2 ± 0.4 3.0 ± 0.4 1.1 ± 0.1* # 1.1 ± 0.1* ## 2.3 ± 0.0 α1(I) K918/930 Lys + Lys 2.1 ± 0.1 1.3 ± 0.0 3.4 ± 0.2** ## 4.6 ± 0.2** ## 5.2 ± 0.1*** ### Lys + Hyl 10.8 ± 0.1 9.5 ± 0.2 10.8 ± 0.1 ### 11.6 ± 0.1*** ### 12.6 ± 0.0*** ### Hyl + Hyl 87.1 ± 0.0 89.2 ± 0.2 85.8 ± 0.3* ### 83.8 ± 0.2*** ### 82.2 ± 0.1*** ### α2(I) K933 Lys 0.3 ± 0.2 0.3 ± 0.2 1.3 ± 0.1* ## 1.2 ± 0.1** ## 0.7 ± 0.1 Hyl 99.7 ± 0.2 99.7 ± 0.2 98.7 ± 0.1* # # 98.8 ± 0.1** ## 99.3 ± 0.1 α1(I) K9 N Lys 44.6 ± 0.5 48.0 ± 0.3 100 ± 0.0*** ### 100 ± 0.0*** ### 100 ± 0.0*** ### Hyl 55.4 ± 0.5 52.0 ± 0.3 0.0 ± 0.0*** ### 0.0 ± 0.0*** ### 0.0 ± 0.0*** ### α1(I) K16 C Lys 51.9 ± 0.2 43.2 ± 0.3 100 ± 0.0*** ### 100 ± 0.0*** ### 100 ± 0.0*** ### Hyl 48.1 ± 0.2 56.8 ± 0.3 0.0 ± 0.0*** ### 0.0 ± 0.0*** ### 0.0 ± 0.0*** ### α2(I) K5 N Lys 78.6 ± 0.8 77.3 ± 1.1 100 ± 0.0*** ### 100 ± 0.0*** ## 100 ± 0.0*** ### Hyl 21.4 ± 0.8 22.7 ± 1.1 0.0 ± 0.0*** ### 0.0 ± 0.0*** ## 0.0 ± 0.0*** ### Values represent mean ± S.D. (n=3) of triplicate analysis for each group. * p <0.05, ** p <0.01, and *** p <0.001 between MC and KO; # p <0.05, ## p <0.01, and ### p <0.001 between EV and KO, respectively. Table 3. Glycosylation of hydroxylysine residues estimated by mass spectrometry of non-cross-linked glycosylated residues. Glycosylation of Hyl residues (%) represents the relative levels of Glycosylated Hyl (G-Hyl + GG-Hyl). Hyl + Glycosylated Hyl = 100%. Hyl, hydroxylysine; G-, galactosyl-; GG-, glucosylgalactosyl-; MC, MC3T3-E1; EV, empty vector; KO, knock-out. Site occupancy (%) MC EV KO-1 KO-2 KO-3 α1(I) K87 Hyl 4.0 ± 0.2 3.3 ± 0.1 13.0 ± 0.3 *** ### 12.6 ± 0.2 *** ### 5.3 ± 0.1 ** ### Glycosylated-Hyl 96.0 ± 0.2 96.7 ± 0.1 87.0 ± 0.3 *** ### 87.4 ± 0.2 *** ### 94.7 ± 0.1 ** ### α1(I) K99 Hyl 65.3 ± 0.5 67.0 ± 0.6 74.5 ± 0.2 *** ### 73.5 ± 0.6 *** ### 76.5 ± 0.1 *** ### Glycosylated-Hyl 34.7 ± 0.5 33.0 ± 0.6 25.5 ± 0.2 *** ### 26.5 ± 0.6 *** ### 23.5 ± 0.1 *** ### α1(I) K174 Hyl 88.3 ± 1.0 89.7 ± 0.4 92.7 ± 0.5 ** ## 92.2 ± 0.2 ** ### 91.0 ± 0.2 * ## Glycosylated-Hyl 11.7 ± 1.0 10.3 ± 0.4 7.3 ± 0.5 ** ## 7.8 ± 0.2 ** ### 9.0 ± 0.2 * ## α1(I) K564 Hyl 72.3 ± 0.9 75.2 ± 0.2 84.3 ± 0.3 *** ### 83.8 ± 0.5 *** ### 84.2 ± 0.2 *** ### Glycosylated-Hyl 27.7 ± 0.9 24.8 ± 0.2 15.7 ± 0.3 *** ### 16.2 ± 0.5 *** ### 15.8 ± 0.2 *** ### α2(I) K174 Hyl 9.7 ± 0.5 9.2 ± 0.7 15.6 ± 0.8 *** ### 16.0 ± 1.1 *** ### 7.7 ± 0.1 Glycosylated-Hyl 90.3 ± 0.5 90.8 ± 0.7 84.4 ± 0.8 *** ### 84.0 ± 1.1 *** ### 92.3 ± 0.1 α2(I) K219 Hyl 94.3 ± 1.3 94.4 ± 0.8 96.8 ± 0.2 * ## 96.9 ± 0.5 * ## 94.9 ± 0.2 Glycosylated-Hyl 5.7 ± 1.3 5.6 ± 0.8 3.2 ± 0.2 * ## 3.1 ± 0.5 * ## 5.1 ± 0.2 Values represent mean ± S.D. (n=3) of triplicate analysis for each group. * p <0.05, ** p <0.01, and *** p <0.001 between MC and KO; # p <0.05, ## p <0.01, and ### p <0.001 between EV and KO, respectively. Table 4. Extent of two glycosylation forms of hydroxylysine in type I collagen isolated from MC and KO clone. Glycosylation of Hyl residues (%) represents the relative levels of G-Hyl, and GG-Hyl (G-Hyl + GG-Hyl = 100%). Hyl, hydroxylysine; G-, galactosyl-; GG-, glucosylgalactosyl-; MC, MC3T3-E1; EV, empty vector; KO, knock-out. Site occupancy (%) MC EV KO-1 KO-2 KO-3 α1(I) K87 G-Hyl 8.2 ± 0.2 8.2 ± 0.2 12.8 ± 0.4 *** ### 12.6 ± 0.5 *** ### 8.0 ± 0.9 GG-Hyl 91.8 ± 0.2 91.8 ± 0.2 87.2 ± 0.4 *** ### 87.4 ± 0.5 *** ### 92.0 ± 0.9 α1(I) K99 G-Hyl 64.9 ± 1.0 65.5 ± 0.5 73.2 ± 0.6 *** ### 72.3 ± 1.1 ** ### 63.9 ± 0.6 GG-Hyl 35.1 ± 1.0 34.5 ± 0.8 26.8 ± 0.6 ***### 27.7 ± 1.1 ** ### 36.1 ± 0.6 α1(I) K174 G-Hyl 56.8 ± 1.5 56.8 ± 2.2 73.0 ± 1.1 *** ### 71.5 ± 2.3 ** ## 65.8 ± 0.7 ** ## GG-Hyl 43.2 ± 1.5 43.2 ± 2.2 27.0 ± 1.1 *** ### 28.5 ± 2.3 ** ## 34.2 ± 0.7 ** ## α1(I) K564 G-Hyl 47.1 ± 1.4 48.9 ± 2.6 63.0 ± 1.8 *** ## 64.0 ± 3.5 ** ## 58.2 ± 1.2 *** ## GG-Hyl 52.9 ± 1.4 51.1 ± 2.6 37.0 ± 1.8 *** ## 36.0 ± 3.5 ** ## 41.8 ± 1.2 *** ## α2(I) K174 G-Hyl 65.3 ± 1.7 65.7 ± 0.5 76.5 ± 0.6 *** ### 75.1 ± 0.8 ** ### 63.8 ± 0.8 GG-Hyl 34.7 ± 1.7 34.3 ± 0.5 23.5 ± 0.6 *** ### 24.9 ± 0.8 ** ### 36.2 ± 0.8 α2(I) K219 G-Hyl 14.8 ± 4.5 18.6 ± 0.5 27.4 ± 5.5 23.5 ± 4.7 16.5 ± 1.8 GG-Hyl 85.2 ± 4.5 81.4 ± 0.5 72.6 ± 5.5 76.5 ± 4.7 83.5 ± 1.8 Values represent mean ± S.D. (n=3) of triplicate analysis for each group. ** p <0.01 and *** p <0.001 between MC and KO; ## p <0.01 and ### p <0.001 between EV and KO, respectively. Table 5. Levels of immature reducible cross-links (DHLNL and HLNL) and mature non-reducible cross-links (Pry and HHMD) from MC, EV, and KO clones. Cells/Clones DHLNL HLNL Pyr HHMD Total aldehydes MC 0.74 (0.01) 0.27 (0.02) 0.021 (0.004) 0.08 (0.02) 1.21 (0.05) EV 0.61 (0.05) 0.29 (0.01) 0.018 (0.001) 0.07 (0.01) 1.07 (0.02) KO-1 ND 0.37 (0.01) * ## ND 0.30 (0.02) *** ### 0.98 (0.02) * # KO-2 ND 0.39 (0.01) * ### ND 0.29 (0.01) *** ### 0.97 (0.03) * # KO-3 ND 0.36 (0.02) * # ND 0.28 (0.01) *** ### 0.93 (0.02) ** ## Total aldehydes = DHLNL + HLNL + 2 × Pyr + 2 × HHMD. Values represent mean moles/mole collagen ± S.D. (n=3) of triplicate analysis of the hydrolysates. * p <0.05, ** p <0.01, and *** p <0.001 between MC and KO; # p <0.05, ## p <0.01, and ### p <0.001 between EV and KO, respectively. DHLNL, dihydroxylysinonorleucine; HLNL, hydroxylysinonorleucine; HHMD, histidinohydroxymerodesmosine; Pyr, pyridinoline; MC, MC3T3-E1; EV, empty vector; KO, knock-out. Table 6. Solubility of collagen from MC, EV and KO clones. The numbers represent percentage of total collagen sequentially extracted with 0.5 M acetic acid and pepsin, and final residues. MC (%) EV (%) KO-1 (%) KO-2 (%) KO-3 (%) Acetic acid 3.5 (0.2) 2.7 (0.1) 37.1 (0.2) *** ### 37.7 (0.3) *** ### 32.1 (0.1) *** ### Pepsin 30.3 (0.4) 25.0 (0.3) 53.7 (0.1) *** ### 54.1 (0.3) *** ### 61.6 (0.1) *** ### Residue 66.2 (0.6) 72.4 (0.4) 9.2 (0.1) *** ### 8.2 (0.0) *** ### 6.3 (0.1) *** ### Values represent mean ± S.D. (n=3) of triplicate analysis of collagen from MC, EC, and KO clones. *** p <0.001 between MC and KO; ### p <0.001 between EV and KO, respectively. MC, MC3T3-E1; EV, empty vector; KO, knock-out. Additional Declarations No competing interests reported. Supplementary Files 31SupplementaryInformation2.28.22.pdf Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 06 Apr, 2022 Reviews received at journal 09 Mar, 2022 Reviewers agreed at journal 08 Mar, 2022 Reviewers invited by journal 02 Mar, 2022 Editor assigned by journal 02 Mar, 2022 Editor invited by journal 02 Mar, 2022 Submission checks completed at journal 02 Mar, 2022 First submitted to journal 23 Feb, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1390058","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":87661983,"identity":"851e1224-7f6c-4934-a5b4-4a0fc586bcd8","order_by":0,"name":"Masahiko Terajima","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Masahiko","middleName":"","lastName":"Terajima","suffix":""},{"id":87661984,"identity":"6743003b-ada4-43ed-acda-c4e887b35135","order_by":1,"name":"Yuki Taga","email":"","orcid":"","institution":"Nippi Research Institute of Biomatrix","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuki","middleName":"","lastName":"Taga","suffix":""},{"id":87661985,"identity":"1c2cef98-422c-4b4c-86ea-c8720081373c","order_by":2,"name":"Tomoyuki Nakamura","email":"","orcid":"","institution":"Kansai Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tomoyuki","middleName":"","lastName":"Nakamura","suffix":""},{"id":87661986,"identity":"375ff826-ea83-40e2-ac00-dc69b8bc08de","order_by":3,"name":"Hou-Fu Guo","email":"","orcid":"","institution":"University of Texas MD Anderson Cancer Center","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hou-Fu","middleName":"","lastName":"Guo","suffix":""},{"id":87661987,"identity":"14c1a8c4-6bd2-4f6d-b083-63ed14aeadd4","order_by":4,"name":"Yukako Kayashima","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yukako","middleName":"","lastName":"Kayashima","suffix":""},{"id":87661988,"identity":"487bb6f5-72d4-4e2e-8236-e166ff48af9c","order_by":5,"name":"Nobuyo Maeda-Smithies","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nobuyo","middleName":"","lastName":"Maeda-Smithies","suffix":""},{"id":87661989,"identity":"078ae636-7854-4202-9329-e612216bcb54","order_by":6,"name":"Kshitij Parag-Sharma","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kshitij","middleName":"","lastName":"Parag-Sharma","suffix":""},{"id":87661990,"identity":"9c5b4cf4-999b-41d0-a816-d82ef305ee93","order_by":7,"name":"Antonio L. Amelio","email":"","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Antonio","middleName":"L.","lastName":"Amelio","suffix":""},{"id":87661991,"identity":"d0323d83-7924-4cf5-84ef-74c20f7511e8","order_by":8,"name":"Kazunori Mizuno","email":"","orcid":"","institution":"Nippi Research Institute of Biomatrix","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kazunori","middleName":"","lastName":"Mizuno","suffix":""},{"id":87661992,"identity":"253de0cb-2209-43a3-94ee-c85bc04e1be6","order_by":9,"name":"Jonathan M. Kurie","email":"","orcid":"","institution":"University of Texas MD Anderson Cancer Center","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jonathan","middleName":"M.","lastName":"Kurie","suffix":""},{"id":87661993,"identity":"2a82578c-7fac-4176-8a2e-cbc70d5d781c","order_by":10,"name":"Mitsuo Yamauchi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYDACZmQOY4OEHITFhk8Lsh6gFmPCWhhQtTAkNhDSotvOf/gzTwVDYv+0w88kfu6wSN9wu/kBw4eywzi1mB1mZpPmOcOQOON2mplk7xmJ3A13jhkwzjiHXwszbxvQPbcTzKQZ24BabuQwAEXwamH+DNIy/3b6N5CWdAOQlr/4tTBIg7RsuJ0DtiUBrIURvxYzyTlnGIw33s4ptuxtkzCceSPN4GDPuXTcWs4ffPzhTQWD7Lzb6Rtv/Gyrk+e7kfzwwY8ya5xaoOC/YwMy9wAh9SBgT4yiUTAKRsEoGKEAAPaOVENNwu3XAAAAAElFTkSuQmCC","orcid":"","institution":"University of North Carolina at Chapel Hill","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Mitsuo","middleName":"","lastName":"Yamauchi","suffix":""}],"badges":[],"createdAt":"2022-02-23 19:44:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1390058/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1390058/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":18829574,"identity":"fb412618-54da-403d-9749-9ddee6b2d579","added_by":"auto","created_at":"2022-03-03 15:40:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":16922,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression of \u003cem\u003ePlod2\u003c/em\u003e (encoding LH2) and protein levels of LH2 in MC, EV, and KO clones. (a) The mRNA levels relative to the internal control (\u003cem\u003eActb\u003c/em\u003e) were assessed by quantitative real-time PCR (n=3). (b) The protein levels of LH2 were assessed by their immunoreactivities with the antibody (Ab) relative to that of β-actin and were then shown as the change relative to LH2 expression levels in MC as 1.0. Values represent means ± S.D. (n=3) from three independent experiments. ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO, respectively. Original blot is presented in Supplementary Figure S1. LH, lysyl hydroxylase; \u003cem\u003ePlod\u003c/em\u003e, procollagen-lysine, 2-oxoglutarate 5-dioxygenase; \u003cem\u003eActb\u003c/em\u003e, beta-actin; Ab, antibody; MC, MC3T3-E1; EV, empty vector; KO, knock-out.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/0f3d505bb80179f3d33f6c70.png"},{"id":18829166,"identity":"7e912eec-df8d-4c7e-b844-fcaeea196e2c","added_by":"auto","created_at":"2022-03-03 15:34:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":58207,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot analysis for lysine modifying enzymes and chaperone complex components in cell lysates obtained from MC, EV, and KO clones.\u003cstrong\u003e \u003c/strong\u003eThe protein levels were assessed by their immunoreactivities with the respective antibodies (Ab) relative to that of β-actin and were then shown as the change relative to LH2 expression levels in MC as 1.0. (a) LH1, (b) LH3, (c) GLT25D1, (d) CypB, (e) Fkbp65, (f) Hsp47, (g) Bip. Values represent mean ± S.D. (n=3) from three independent experiments. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO, respectively. Original blots are presented in Supplementary Figure S1. LH, lysyl hydroxylase; GLT25D1, glycosyltransferase 25 domain containing 1; CypB, cyclophilin B; Fkbp65, FK506-binding protein 65; Hsp47, heat shock protein 47; Bip, immunoglobulin heavy-chain-binding protein; Ab, antibody; MC, MC3T3-E1; EV, empty vector; KO, knock-out.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/15f8265ad12ecae03738950e.png"},{"id":18829446,"identity":"b5f6b324-7fba-467e-aa0d-b97b878d04db","added_by":"auto","created_at":"2022-03-03 15:37:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":147656,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtent of Lys hydroxylation at specific sites of type I collagen. \u003c/strong\u003e(a) Lys hydroxylation in the telopeptides, (b) Lys hydroxylation in the cross-linking and non-cross-linking helical sites (See Table 2). Values represent percentages of Lys hydroxylation calculated as Hyl/(Lys+Hyl) × 100. Hyl is a sum of non-glycosylated, G, and GG-Hyl (See Table 2). Lys, lysine; Hyl, hydroxylysine; G-, galactosyl-; GG-, glucosylgalactosyl-; MC, MC3T3-E1; EV, empty vector; KO, knock-out. Values represent mean ± S.D. (n=3) of triplicate for each group. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO, respectively. The relative levels at α1(I)K918/930 show the percentage of “Hyl + Hyl”. See Table 2.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/9717ddefb9de27e1d99e20f8.png"},{"id":18829163,"identity":"ef118cb5-94b7-4719-bb35-18a8a9e796a1","added_by":"auto","created_at":"2022-03-03 15:34:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":54050,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTypical chromatographic patterns of collagen cross-links from the acid hydrolysates of reduced collagen obtained from MC, EV, and KO clones.\u003c/strong\u003e In MC and EV, cross-links were composed of DHLNL, HLNL, HHMD, and Pyr. However, in KO, there was a lack of DHLNL and Pyr. DHLNL, dihydroxylysinonorleucine; HLNL, hydroxylysinonorleucine; HHMD, histidinohydroxymerodesmosine; Pyr, pyridinoline; MC, MC3T3-E1; EV, empty vector; KO, knock-out.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/2d2a47347b2e9f24e5e80f82.png"},{"id":18829575,"identity":"c8b605fd-3f16-4723-b60e-322546ad4f87","added_by":"auto","created_at":"2022-03-03 15:40:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":278523,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUltrastructural analysis of collagen fibrils in cell cultures by transmission electron microscopy.\u003c/strong\u003e The cross-sectional and longitudinal views of the collagen fibrils from MC, EV, and KO. KO collagen fibrils are markedly smaller in diameter. Scale bar represents 200 nm. Diameter distribution measured from cross-sections. Three thousand fibrils in each group were measured and plotted. MC, MC3T3-E1; EV, empty vector; KO, knock-out.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/c677046639d23e8272961f3d.png"},{"id":18829167,"identity":"92cab267-d237-4159-8d61-dac1957ac121","added_by":"auto","created_at":"2022-03-03 15:34:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":364573,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIn vitro\u003c/em\u003e mineralization assay. \u003c/strong\u003e(a)\u003cstrong\u003e \u003c/strong\u003eMC, EV, and KO clones were cultured in mineralization medium for 4 weeks. The cells/matrices were stained with Alizarin Red S. (b) Quantification of Alizarin Red S contents. The contents were measured by absorbance at 405 nm. Values represent mean ± S.D. (n=3) from three independent experiments. \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u0026lt;0.001\u003c/em\u003e between MC and KO; \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u0026lt;0.001\u003c/em\u003e between EV and KO. MC, MC3T3-E1; EV, empty vector; KO, knock-out.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/3f2913bbc70831657e91f4bf.png"},{"id":18829576,"identity":"612d130c-3614-40a0-993d-f62380edb1d1","added_by":"auto","created_at":"2022-03-03 15:40:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1661739,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/c23083b3-4a97-4996-b46c-66f813f810f4.pdf"},{"id":18829448,"identity":"c2516aaf-32c9-4a0f-b25d-8dae5b545f3e","added_by":"auto","created_at":"2022-03-03 15:37:51","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":617852,"visible":true,"origin":"","legend":"","description":"","filename":"31SupplementaryInformation2.28.22.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1390058/v1/11ee48c55fe3583fc5d24cc4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Lysyl hydroxylase 2 mediated collagen post-translational modifications and functional outcomes","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFibrillar type I collagen is a heterotrimeric molecule composed of two α1 and one α2 chains, and is the most abundant organic matrix component in vertebrates. The molecule consists of three structural domains: a central triple helical- (helical) and two nonhelical telopeptide domains at the amino- and carboxyl termini (N- and C-telo), and the molecules are packed into fibrils in the extracellular space to provide tissues with form and stability. To perform such functions, a series of specific lysine (Lys) post-translational modifications must occur within and outside of cells \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eInside the cell, specific Lys residues are hydroxylated to form 5-hydroxylysine \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e that can be further modified by \u003cem\u003eO\u003c/em\u003e-linked glycosylation producing galactosyl-Hyl (G-Hyl) or glucosylgalactosyl-Hyl (GG-Hyl). Lys hydroxylation is catalyzed by lysyl hydroxylases 1\u0026ndash;3 (LH1-3) encoded by Procollagen-lysine, 2-oxyglutarate, 5-dioxygenase (\u003cem\u003ePLOD 1\u0026ndash;3\u003c/em\u003e) gene \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. LH1 catalyzes Lys hydroxylation in the helical domain but the involvement of LH2 and LH3 in this function is not well defined. There are two isoforms of LH2: one includes a 63 bp-exon 13A (LH2b) and another does not (LH2a) \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. LH2b is thought to be the key telopeptidyl LH but LH2a may also perform this function \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Glycosylation of Hyl is catalyzed by glycosyltransferase 25 domain containing (GLT25D) 1 and 2 to form G-Hyl, then by LH3 to produce GG-Hyl \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. The extent of glycosylation may control the process of cross-link maturation \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Recent studies have demonstrated that the LH activities are regulated by specific endoplasmic reticulum (ER)-resident chaperone complexes \u003csup\u003e\u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, and that defects in LHs and these regulators result in various connective tissue disorders \u003csup\u003e\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In the extracellular space, Lys and Hyl residues in the N- and C-telo domains of the collagen molecule can be converted to aldehyde, i.e. Lys\u003csup\u003eald\u003c/sup\u003e and Hyl\u003csup\u003eald\u003c/sup\u003e, respectively, by the action of lysyl oxidases (LOXs). These aldehydes then initiate a series of condensation reactions with vicinal Lys\u003csup\u003eald\u003c/sup\u003e, Lys, Hyl and histidine (His) residues to form intra- and intermolecular covalent cross-links \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eOver 20 years ago, we proposed that LH2 may function as a telopeptidyl LH \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. This hypothesis has been supported by several investigations including gain- and loss-of-function studies \u003csup\u003e2,19\u0026minus;21\u003c/sup\u003e. By co-expressing type I collagen α1 homotrimer and individual LH isoforms in insect cells, Takaluoma and co-workers showed that only LH2 could hydroxylate Lys in the α1 N-telo (9\u003csup\u003eN\u003c/sup\u003e) \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e although the extent of hydroxylation was relatively low (i.e. 25%) and the effect on the α1 C-telo Lys was not determined. Furthermore, Bank\u0026rsquo;s group identified LH2 as a telopeptidyl LH \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e based mainly on analysis of Hyl\u003csup\u003eald\u003c/sup\u003e-derived pyridinoline (Pyr) cross-links, however, neither the telopeptidyl Lys hydroxylation nor other cross-links was examined. Using a LH2 mutant zebrafish model, Gistelinck et al. reported that Lys in the α1 C-telo of bone type I collagen (16\u003csup\u003eC\u003c/sup\u003e) was not hydroxylated in the mutant \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, though neither Lys hydroxylation of the α1 and α2 N-telo domains nor the Hyl\u003csup\u003eald\u003c/sup\u003e- or Lys\u003csup\u003eald\u003c/sup\u003e-derived cross-links was analyzed in this study. More recently, Gistelinck et al reported detailed type I collagen phenotypes in bone obtained from a patient with Bruck syndrome \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAccumulating evidence indicates that LH2 plays pivotal roles in the pathogenesis of Bruck syndrome, fibrosis and cancer metastasis \u003csup\u003e21,23,26\u0026minus;31\u003c/sup\u003e. However, efforts to elucidate the function of LH2 at the cellular level in mammalian systems have been hampered since LH2 null mice die at early embryonic stage (E10.5) \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Thus, despite the critical importance of LH2 in these pathologies, the molecular basis is still not well understood.\u003c/p\u003e \u003cp\u003eHere, we generated LH2 null osteoblastic cells and extensively characterized the effects of LH2 deficiency on type I collagen molecule and its functional outcomes on collagen cross-linking, solubility, fibrillogenesis and matrix mineralization.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eGeneration and validation of LH2 null (KO) cells.\u003c/strong\u003e To delete LH2, we transiently transfected MC3T3-E1 (MC) cells with plasmids expressing both Cas9 nuclease and oligonucleotides encoding sgRNAs targeting the exon 1 of the mouse \u003cem\u003ePlod2\u003c/em\u003e gene. Based on the two different algorithms, online CRISPR RGEN Tools and Off-Spotter, the sgRNAs were predicted to target only one gene, i.e. \u003cem\u003ePlod2\u003c/em\u003e, and no other off-targets were detected. We identified three LH2 null clones (KO-1, -2 and \u0026minus;\u0026thinsp;3) and used parental MC cells and those transfected with an empty vector (EV) as controls. Based on the real-time RCR analysis, the LH2 mRNA levels in KO cells were 5\u0026ndash;7% of those in controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea). Western blot analysis showed that LH2 protein was not detected in any of these KO clones (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb), thus, they were subjected to further characterization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOther modifying enzymes and associated proteins.\u003c/strong\u003e We then analyzed the protein levels of LH1 and LH3 in KO clones by Western blot analysis (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The results showed that both LH1 and LH3 were comparable to controls (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) though the former tended to be slightly lower in KO clones (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The collagen galactosyl transferase, GLT25D1, was significantly lower in the KO clones when compared to controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The reason for this is unclear, but the reduced level of GLT25D1 in KO could be partially compensated by unknown mechanisms since the total levels of G- + GG-Hyl in KO collagen were only slightly lower (\u0026lt;\u0026thinsp;10%) than those of controls at all glycosylation sites analyzed (see below). The LH2-specific chaperone, FK506-binding protein 65 (FKBP65) \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, and an additional potential binding partner, cyclophilin B (CypB) \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, showed slightly lower (~\u0026thinsp;70% of controls) or similar level (~\u0026thinsp;90%), respectively, in KO clones when compared to controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Other LH2-associated proteins, heat shock protein 47 (Hsp47) and immunoglobulin heavy-chain-binding protein (Bip) \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e, were also significantly lower in KO than controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCollagen Type.\u003c/strong\u003e We first examined collagen types by mass spectrometric analysis \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. The data revealed that type I collagen is by far the predominant collagen type with a small amount of type III in all of the culture samples, which is consistent with our previous report \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. The percentages of type I calculated by I/(I+/III) \u0026times; 100 were all \u0026gt;\u0026thinsp;96% and the difference between MC and KOs was within ~\u0026thinsp;2% range (Supplementary Table S1) demonstrating that LH2 deficiency does not alter collagen types.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLys Hydroxylation Determined by High Performance Liquid Chromatography (HPLC) (8).\u003c/strong\u003e In KO clones, levels of Lys hydroxylation in collagen were slightly but significantly decreased compared with those from MC and EV (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). We then analyzed Lys modifications at specific molecular loci in type I collagen (see below).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLys Modifications at Specific Molecular Loci in Type I Collagen.\u003c/strong\u003e \u003cem\u003eLys hydroxylation in the telopeptides\u003c/em\u003e: The relative abundance of Lys hydroxylation in the telopeptides of type I collagen, i.e. N-telo (\u0026alpha;1 Lys-9\u003csup\u003eN\u003c/sup\u003e and \u0026alpha;2 Lys-5\u003csup\u003eN\u003c/sup\u003e) and C-telo (\u0026alpha;1 Lys-16\u003csup\u003eC\u003c/sup\u003e) (note: \u0026alpha;2 C-telo lacks Lys), were analyzed by LC-quadrupole time-of-flight (QTOF)-MS after sequential digestion by \u003cem\u003eGrimontia\u003c/em\u003e collagenase and pepsin \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e (Table\u0026nbsp;2 and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Lys hydroxylation in MC and EV were essentially identical with no statistical difference, i.e. ~55.4% at \u0026alpha;1 Lys-9\u003csup\u003eN\u003c/sup\u003e, ~\u0026thinsp;22.7% at \u0026alpha;2 Lys-5\u003csup\u003eN\u003c/sup\u003e and ~\u0026thinsp;56.8% at \u0026alpha;1 Lys-16\u003csup\u003eC\u003c/sup\u003e. In the KO type I collagen, however, none of the Lys residues was hydroxylated in any of these sites (Table\u0026nbsp;2). These results unequivocally demonstrate that LH2 is responsible for Lys hydroxylation in all telopeptides of type I collagen and that other LHs cannot compensate for this function.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLys modifications in the helical domain\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe then analyzed Lys modifications in the helical domain of type I collagen by using tryptic digests of collagen as reported \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e (Table\u0026nbsp;2 and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). In the helical domain, modified Lys residues were identified at 11 sites. The values in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e represent percentages calculated as [Hyl / (Hyl\u0026thinsp;+\u0026thinsp;Lys) \u0026times; 100] where Hyl includes glycosylated (G- and GG-) and non-glycosylated forms (Table\u0026nbsp;2). First, we examined the helical cross-linking sites, i.e. \u0026alpha;1 Lys-87, \u0026alpha;1 Lys-930, \u0026alpha;2 Lys-87 and \u0026alpha;2 Lys-933. At \u0026alpha;1 Lys-87, a highly hydroxylated and the most heavily glycosylated site of type I collagen \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, ~\u0026thinsp;98% of Lys was hydroxylated in controls, MC and EV. In KO collagen, it was also almost all hydroxylated, showing only 2\u0026ndash;4% less hydroxylated than controls (Table\u0026nbsp;2). For \u0026alpha;1 Lys-930, using the collagenase-pepsin digest \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e, we analyzed Lys hydroxylation in the peptide containing \u0026alpha;1 Lys-918/930 (GD\u003cspan class=\"Underline\"\u003eK\u003c/span\u003eGETGEQGDRGI\u003cspan class=\"Underline\"\u003eK\u003c/span\u003eGHR). In controls, these Lys residues were at least 87\u0026ndash;89% hydroxylated (Hyl\u0026thinsp;+\u0026thinsp;Hyl), and those in KO, at least 82\u0026ndash;86% hydroxylated, again showing only a slight decrease of Lys hydroxylation. At \u0026alpha;2 Lys-87, it was 92\u0026ndash;93% in controls and 93\u0026ndash;96% in KO indicating that Lys hydroxylation in KO at this site is almost the same level or even slightly higher than controls. The \u0026alpha;2 Lys-933 was 99\u0026ndash;100% hydroxylated in both controls and KO collagens. Thus, Lys hydroxylation was only minimally affected at the helical cross-linking sites in KO collagen. Second, we examined the helical non-cross-linking sites, i.e. \u0026alpha;1 Lys-99, -174, -219, -564 and \u0026alpha;2 Lys-174 and \u0026minus;\u0026thinsp;219. For these sites the extent of Lys hydroxylation was almost the same at \u0026alpha;1 Lys-99, slightly higher (1\u0026ndash;4%) at \u0026alpha;1 Lys-219, or up to ~\u0026thinsp;20% lower at \u0026alpha;1 Lys-174, -564, \u0026alpha;2 Lys-174, \u0026alpha;2 Lys-219 in KO type I collagen in comparison to controls. These data indicate that the contribution of LH2 towards helical Lys hydroxylation is low, especially at the cross-linking sites, and site-specific at non-crosslinking sites.\u003c/p\u003e\n\u003cp\u003eWe next calculated the extent of glycosylation of Hyl at six sites identified, i.e., \u0026alpha;1 Lys-87, \u0026alpha;1 Lys-99, \u0026alpha;1 Lys-174, \u0026alpha;1 Lys-564, \u0026alpha;2 Lys-174, and \u0026alpha;2 Lys-219 (Table\u0026nbsp;2). When calculated as percentages of non-glycosylated-Hyl and glycosylated (G- and GG-) forms in total Hyl, the relative abundance of glycosylated Hyl at \u0026alpha;1 Lys-87, the major glycosylation site, was slightly but significantly lower (2\u0026ndash;10%) and non-glycosylated-Hyl significantly higher in KO collagen compared to those of controls (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). At all other sites, i.e. \u0026alpha;1 Lys-99, \u0026alpha;1 Lys-174, \u0026alpha;1 Lys-564, \u0026alpha;2 Lys-174, and \u0026alpha;2 Lys-219, the same phenomena were observed between KO and control type I collagen (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e) with the exception of KO-3 exhibiting similar levels of non-glycosylated and glycosylated Hyl to controls at some sites (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05, respectively). These data indicate that LH2 deficiency may cause diminished glycosylation at several sites. Interestingly, when a percentage of two glycosylation forms (G- + GG- = 100%) was calculated, GG- form was lower and G- form was higher at most sites in KO collagen when compared to controls (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). These data suggest that LH2 deficiency causes a relative decrease of GG activity leading to relative increase in the G-Hyl form, in agreement with our recent report \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePro 3-Hydroxylation.\u003c/strong\u003e Several sites of 3-hydroxyproline (3-Hyp), i.e. \u0026alpha;1 Pro-986 and consecutive modification sites (\u0026alpha;1 Pro-707, 716, 719 and \u0026alpha;2 Pro-707, 716, 719) \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e were identified (Supplementary Table S2). In KO type I collagen, slight but significant increases of Pro 3-hydroxylation were observed at \u0026alpha;1 Pro-986 (~\u0026thinsp;91\u0026ndash;93% for MC/EV, and ~\u0026thinsp;94\u0026ndash;98% for KO), and at \u0026alpha;1/\u0026alpha;2 Pro-707, 716 and 719, indicating that LH2 could be involved in this modification (Supplementary Table S2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCollagen Cross-link Analysis.\u003c/strong\u003e Control groups (MC and EV) showed essentially identical cross-link patterns (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e) with no statistical difference in any of the cross-links. The amounts of cross-links of control and KO collagens are summarized in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. In control groups, the major cross-link was DHLNL (Hyl\u003csup\u003eald\u003c/sup\u003e \u0026times; Hyl) representing\u0026thinsp;~\u0026thinsp;67% of the total cross-links. The rest includes HLNL (Hyl\u003csup\u003eald\u003c/sup\u003e \u0026times; Lys or Lys\u003csup\u003eald\u003c/sup\u003e \u0026times; Hyl), Pyr (Hyl\u003csup\u003eald\u003c/sup\u003e \u0026times; Hyl\u003csup\u003eald\u003c/sup\u003e \u0026times; Hyl) and HHMD (Lys\u003csup\u003eald\u003c/sup\u003e \u0026times; Lys\u003csup\u003eald\u003c/sup\u003e \u0026times; His \u0026times; Hyl). In KO collagen, none of the Hyl\u003csup\u003eald\u003c/sup\u003e-derived cross-links (DHLNL, Pyr) were detected while Lys\u003csup\u003eald\u003c/sup\u003e-derived cross-links, HLNL and HHMD, were both significantly increased by ~\u0026thinsp;44 and ~\u0026thinsp;400%, respectively. Though HLNL can be derived from Hyl\u003csup\u003eald\u003c/sup\u003e or Lys\u003csup\u003eald\u003c/sup\u003e, since Lys at the helical cross-linking sites are almost fully hydroxylated and telopeptidyl Lys is not hydroxylated in KO collagen (Table\u0026nbsp;2), it should be derived from Lys\u003csup\u003eald\u003c/sup\u003e \u0026times; Hyl in KO. In contrast to the striking difference in the type of cross-links, the difference in the total number of aldehydes involved in cross-linking is small (0.1\u0026ndash;0.2 moles/mole of collagen) between control and KO collagens. This indicates that LOX/LOXL activities are not significantly affected in KO clones.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCollagen Solubility, Fibrillogenesis and Matrix Mineralization.\u003c/strong\u003e We then evaluated the biochemical, morphological, and functional outcomes of LH2KO. First, we found that LH2KO resulted in a marked increase in collagen solubility (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). Approximately 38% of KO collagen was solubilized with 0.5 M acetic acid while only trace amounts were solubilized in controls, MC (3.5%) and EV (2.7%) (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). When the insoluble fractions with acetic acid (62.3\u0026ndash;67.9% of KO and 96.5 and 97.3% of MC and EV collagens, respectively) were digested with pepsin, most of the KO collagen (53.7\u0026ndash;61.6%) was solubilized while only 30.3 and 25.0% of collagen was solubilized in MC and EV, respectively (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). After these serial extractions, the final insoluble collagen represented only 6.3\u0026ndash;9.2% in KO collagen whereas the majority of collagen (66.2\u0026ndash;72.4%) still remained insoluble in MC and EV (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). These results clearly demonstrate that the lack of LH2-catalyzed modifications, i.e. primarily telopeptidyl Lys hydroxylation and subsequent cross-linking, makes collagen highly soluble. Second, we examined the effects of LH2KO on collagen fibrillogenesis. Representative cross-sectional/longitudinal views of collagen fibrils and the diameter distribution obtained from the cultures of controls (MC and EV) and KO clones (KO-1, -2, and \u0026minus;\u0026thinsp;3) are shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. The fibrils in KO clones were generally circular in shape and overall similar to those of MC and EV. However, the collagen fibrils in all KO clones were sparse (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e) and the diameters were significantly smaller than those of MC and EV (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), indicating defective lateral growth of fibrils in KO collagen. Lastly, we assessed the effects of LH2KO on \u003cem\u003ein vitro\u003c/em\u003e mineralization. The controls (MC and EV) and KO clones (1\u0026ndash;3) were cultured for 28 days and subjected to mineralization assay using Alizarin red S staining (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). In the controls (MC and EV), mineralized nodules were well formed at this point, however, no nodules were observed in KO clones (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ea and b), demonstrating that the lack of LH2 results in defective matrix mineralization.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, by generating LH2KO clones, we extensively characterized the molecular phenotypes of type I collagen. The lack of LH2 resulted in complete absence of Lys hydroxylation in all telopeptides, i.e. N- (9\u003csup\u003eN\u003c/sup\u003e) and C-telo (16\u003csup\u003eC\u003c/sup\u003e) of an α1 and N-telo (5\u003csup\u003eN\u003c/sup\u003e) of an α2 chains, thus, LH2 is solely responsible for hydroxylation in all Lys residues in telopeptides. Consistent with these data, the Hyl\u003csup\u003eald\u003c/sup\u003e-derived cross-links, the major cross-links in MC/EV collagen, were completely absent from KO collagen and were replaced with Lys\u003csup\u003eald\u003c/sup\u003e-derived cross-links. Moreover, our data indicated that LH2 may also be involved in helical Lys hydroxylation in a site-specific manner. The lack of LH2-catalyzed modification has significant impact on collagen solubility, collagen fibrillogenesis and matrix mineralization. In addition, LH2 could be involved in glucosylation of galactosyl Hyl.\u003c/p\u003e \u003cp\u003eThough the role of LH2 as telopeptidyl LH has been widely accepted \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, the evidence reported thus far was not complete due mainly to the lack of appropriate models and analytical tools. Since LH2 KO mice die at early embryonic stage \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, we generated LH2 KO clones using MC cells. MC cells are derived from normal mouse calvaria and collagen phenotypes are well-characterized \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. MC cells synthesize predominantly type I collagen (\u0026gt;\u0026thinsp;96% of total collagen) \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, Lys residues on type I collagen including cross-linking sites are only partially hydroxylated, all LHs (LH1-3) are well expressed, and collagen cross-links are sufficiently formed within 2 weeks of culture and mature with predictable kinetics \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. These characteristics make MC cells an excellent model to investigate the biological functions of Lys modifications by manipulating specific LH gene expression and characterizing its effects on type I collagen \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Our current data unequivocally demonstrate that all Lys residues in telopeptides are hydroxylated solely by LH2, and neither LH1 nor LH3 can compensate for this function. It is not clear at this point what determines such substrate specificity for LH2. However, considering the fact that an acidic amino acid, Glu or Asp, is positioned next/close to telopeptidyl Lys residues (i.e. -Glu-Lys-Ser- in N- and C-telo of an α1 chain in both mouse and human, and -Asp-Lys-Gly- or -Asp-Gly-Lys-Gly- in N-telo of the mouse or human α2 chain, respectively), the presence of two basic Arg residues adjacent to the catalytic site of LH2 (R680 and R682) is likely important to determine such specificity \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Notably, these Arg residues are absent in LH1 or LH3 which explains their inability to compensate for LH2 deficiency. It is also interesting to note that, in MC/EV type I collagen, both N- and C-telo Lys residues of an α1 chain are ~\u0026thinsp;50% hydroxylated while the N-telo Lys of an α2 chain is only\u0026thinsp;~\u0026thinsp;20% hydroxylated. Possibly, the Asp-Lys-Gly- sequence of the latter that is also present in the helical domain may not be an optimal substrate for LH2. This is likely the reason why the Lys\u003csup\u003eald\u003c/sup\u003e-involved cross-links are often derived from the α2 N-telo domain \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eDuran et al. has recently reported that a chaperone complex formed by HSP47, FKBP65 and BiP modulates telopeptide Lys hydroxylation of type I procollagen chains. Defects of the complex members affected this modification either by enhancing (defect in Hsp47 and Bip) or diminishing (defect in Fkbp65) LH2 activity \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. In contrast, Syx et al has stated that a mutant Hsp47, which showed a reduced binding to type I collagen, resulted in decreased LH2 \u003csup\u003e44\u003c/sup\u003e. These inconsistent data suggest that Hsp47 may act as a positive or negative regulator of LH2 in a context-dependent manner. Interestingly, our present study showed that Fkbp65, Hsp47 and Bip protein levels were reduced in KO clones compared to MC (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), suggesting that this chaperone complex may be destabilized by the lack of LH2.\u003c/p\u003e \u003cp\u003eIt has been speculated that LH2 also catalyzes helical Lys hydroxylation based on its ability to hydroxylate the Lys residues in the synthetic (Ile-Lys-Gly)\u003csub\u003e3\u003c/sub\u003e peptide and the data from the LH2/proα1(I) co-expression in an insect cell system \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The results indicate that, in this system, LH2 may function as a helical LH when LH1 and 3 are absent. However, the effect of LH2 expression on Lys hydroxylation at the specific molecular loci in an α1 chain including its C-telo domain or in an α2 chain including its N-telo domain were not investigated. Recently, Gistelinck et al has reported that, in the bone from a 4-year old patient carrying a \u003cem\u003ePLOD2\u003c/em\u003e heterozygous mutation, Lys in the α1(I) telopeptides was severely underhydroxylated while Lys at the helical cross-linking sites in type I collagen was normally hydroxylated \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Their findings are consistent with our current cell-based study showing that, when LH2 is absent, on the contrary to the changes in Lys hydroxylation in the telopetides, the extent of Lys hydroxylation in the helical domain was only minimally affected (Table\u0026nbsp;2, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). It is important to note that, when these percentage differences are converted to the number of Hyl residues in a collagen molecule, the difference between MC/EV and KO is less than \u0026plusmn;\u0026thinsp;0.03 residues at the cross-linking sites (α1\u0026ndash;87, α1-918/930, α2\u0026ndash;87, α2-933) and 0-0.2 residues at the non-cross-linking sites. Since Lys hydroxylation at the helical cross-linking sites is predominantly catalyzed by LH1 and its complex such as prolyl 3-hydroxylase 3 (P3H3), Synaptonemal Complex 65 (SC65) and CypB \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e, it is not surprising that absence of LH2 essentially does not affect Lys hydroxylation at these functionally critical sites in the helical domain. The significance of Lys hydroxylation at other sites in the helical domain is not well defined but, possibly, they may affect the interaction between collagen and collagen-binding proteins such as small leucine-rich proteoglycans and/or cell surface receptors such as integrins and discoidin domain receptor 2 \u003csup\u003e47\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRecently, Ishikawa and co-workers reported that the cooperation between LH1 and P3H3 is required for Lys hydroxylation in the helical domain of type I collagen, and that P3H3 may function as helical LH at specific cross-linking sites \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. They also reported that LH2 level remained unchanged in LH1 null mice \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. In the present study, we did not find a significant change of LH1 protein in LH2 KO clones. These findings suggest that there is no apparent direct interaction between LH1 and LH2. Thus, LH2 deficiency caused only a minute change in Lys hydroxylation in the helical domain of type I collagen.\u003c/p\u003e \u003cp\u003eOne of the intriguing findings in the current study was that absence of LH2 affects Hyl glycosylation pattern. When the percentages of G- and GG- forms in total glycosylation forms (G- + GG-) are calculated, KO collagen showed that at most sites, the GG- was decreased at the expense of G- form in KO type I collagen (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Recently, we have reported that LH2 potentially has galactosylhydroxylysyl glucosyltransferase (GGT) activity \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e and the current data (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Supplementary Table S3) supports this notion.\u003c/p\u003e \u003cp\u003eDuring procollagen biosynthesis, prolyl 3-hydroxylation, another post-translational modification of collagen, is catalyzed by a complex composed of cartilage associated protein (CRTAP), prolyl 3-hydroxylase 1 (P3H1) and cyclophilin B (CypB) \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. The deficiency of any of these components severely affects this modification leading to severe forms of recessive osteogenesis imperfecta \u003csup\u003e\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. It has been reported that the α1 Pro-986, the major site for this modification, is hydroxylated by P3H1 \u003csup\u003e49\u003c/sup\u003e, and another modification site, α1/2 Pro-707, mainly by P3H2 \u003csup\u003e52\u003c/sup\u003e. In the present study, we found that the extent of P3H at these sites was slightly increased in KO clones, suggesting that LH2 may interact with the P3H complex for prolyl-3-hydroxylation at these sites (Supplementary Table S2). Since LH2 interacts with CypB \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, a P3H complex member, these slight changes could occur by the lack of this interaction.\u003c/p\u003e \u003cp\u003eThe impact of LH2 deficiency on collagen stability, fibrillogenesis and mineralization was striking. First, collagen solubility with dilute acid and pepsin digestion were markedly increased in KO collagen, i.e. \u0026gt; 90% of KO collagen was solubilized by these treatments while it was only\u0026thinsp;~\u0026thinsp;30% in control groups. The marked increases in solubility in KO collagen can be explained by the differences in the nature of the cross-links. In KO collagen, since telopeptidyl Lys is not hydroxylated, the cross-links formed are all Lys\u003csup\u003eald\u003c/sup\u003e-derived, aldimine cross-links such as deH-HLNL and deH-HHMD. The aldimine bond is known to be labile to dilute acids, thus, readily dissociated \u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. In contrast, the Hyl\u003csup\u003eald\u003c/sup\u003e-derived bifunctional aldimine cross-links are spontaneously rearranged to ketoamines that are stable to dilute acids. The collagens containing the stable Hyl\u003csup\u003eald\u003c/sup\u003e-derived cross-links are also more resistant against enzymatic degradation than those with the Lys\u003csup\u003eald\u003c/sup\u003e-derived cross-links \u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. Since the total number of aldehydes involved in cross-linking is only slightly lower in KO collagen compared to the control (by ~\u0026thinsp;8%), the data implies that the Hyl\u003csup\u003eald\u003c/sup\u003e-derived cross-linking is critical to confer insolubility on type I collagen. This is likely the reason why collagen enriched in the Hyl\u003csup\u003eald\u003c/sup\u003e-derived cross-links accumulates without being readily degraded by proteolytic enzymes in fibrosis \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e,\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e and also in desmoplastic tumors such as pancreatic ductal adenocarcinoma \u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e, lung cancer \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, breast cancer \u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e and oral cancer \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Such stiffened collagen matrix may not only form a shelter for cancer cells to protect them from immune cells and anti-cancer drugs but also serve as a means for cancer cells to attach, migrate and metastasize efficiently \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e,\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e,\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e. Second, fibrillogenesis in LH2 KO collagen is also affected showing significantly smaller fibril diameters compared to those of controls. This could be due to several factors including: 1). since KO collagen is more susceptible to degradation (see above), collagen fibrils may not be able to grow, 2). altered Lys modifications (hydroxylation and glycosylation) of KO collagen may favor the association with collagen-binding proteins, such as decorin, that is known to inhibit collagen fibrillogenesis \u003csup\u003e\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e, 3). altered post-translational modifications in KO collagen may inherently limit the growth of molecular packing into a fibril. Notably, when LH2 is overexpressed in MC cells, collagen fibrils are also smaller than controls \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. This may indicate that the extent of LH2-mediated post-translational modifications should be kept at a certain range to establish an appropriate size of collagen fibrils in this cell culture system.\u003c/p\u003e \u003cp\u003eIn bone, fibrillar type I collagen functions as an organizer of mineral deposition and growth \u003csup\u003e\u003cspan additionalcitationids=\"CR67\" citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e\u003c/sup\u003e. Since initial mineralization appears to occur in the intermolecular channel formed by contiguous hole zones in the collagen fibril \u003csup\u003e\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e, the pattern of intermolecular cross-linking formed at the edge of hole zones should be critical to organize mineralization \u003csup\u003e\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e. The LH2 KO collagen fibrils that contain abnormal cross-linking and are smaller in size may not serve well as a stable template to accommodate and organize matrix mineralization. This may in part cause defective bone formation as seen in Bruck syndrome 1 and 2, a disease that is caused by mutations in genes encoding LH2 chaperone FKBP65 and LH2, respectively. In addition to the structural function, LH2 may regulate cellular activities through its action on integrin β1 \u003csup\u003e71\u003c/sup\u003e that may also impact the mineralization process.\u003c/p\u003e \u003cp\u003eRecently, we have reported bone phenotypes of LH2 heterozygous mice (LH2\u003csup\u003e+/\u0026minus;\u003c/sup\u003e) in which LH2 expression levels are only\u0026thinsp;~\u0026thinsp;50% of those of wild type mice (LH2\u003csup\u003e+/+\u003c/sup\u003e). In this animal model, LH2\u003csup\u003e+/\u0026minus;\u003c/sup\u003e femurs showed lower bone mineral density and inferior bone mechanical properties compared to those of LH2\u003csup\u003e+/+\u003c/sup\u003e mice \u003csup\u003e\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e. When cultured, LH2\u003csup\u003e+/\u0026minus;\u003c/sup\u003e osteoblastic cells mineralized poorly compared to those of LH2\u003csup\u003e+/\u0026minus;\u003c/sup\u003e cells, which is consistent with our current study. Thus, while we cannot determine to what extent the LH2-catalyzed modification is directly involved in collagen mineralization, such modification appears to play a critical role in this process.\u003c/p\u003e \u003cp\u003eLH2 has two isoforms: one with an additional 63 bp-exon 13A (LH2b) and the other without (LH2a) \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. It is generally accepted that LH2b is the telopeptidyl LH, but recently it has been reported that LH2a is also capable of catalyzing Lys hydroxylation in the telopeptides \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Inducing these isoforms in the LH2 KO cells separately and characterizing collagen molecular phenotypes in these clones will provide valuable insights into their distinct or overlapping functions. This is now underway in our laboratory and will be the subject of the separate publication.\u003c/p\u003e \u003cp\u003eIn conclusion, this study demonstrates that the major function of LH2 is to hydroxylate the N- (α1 and α2 chains) and C-telopeptidyl (α1 chain) Lys residues of type I collagen. The deficiency of LH2 profoundly affects collagen cross-linking, solubility, fibrillogenesis, and mineralization. These results underscore the pivotal role of the LH2-mediated post-translational modifications in the formation and function of fibrillar collagen in bone.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eCell Lines and Culture Conditions.\u003c/b\u003e MC3T3-E1 subclone 4, a well characterized nontransformed mouse osteoblast-like cell line \u003csup\u003e\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u003c/sup\u003e, was purchased from American Type Culture Collection (CRL-2593). Cells were grown in α-minimum essential media (Invitrogen, Carlsbad, CA, USA) containing 10% FBS (Invitrogen) and supplemented with 100 units/ml penicillin G sodium and 100\u0026micro;g/ml streptomycin sulfate in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere at 37\u0026deg;C. The medium was changed twice a week.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGeneration of MC cells lacking LH2 by CRISPR/Cas9n gene editing.\u003c/b\u003e To generate LH2 deficient (KO) cells, we used double-nicking strategy to minimize off-target mutagenesis \u003csup\u003e\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u003c/sup\u003e. Two pairs of gRNAs (gRNA 1 [antisense: ctcctccgccacgcccaggc] and 2 [sense: acgcccgggcgcatccctgc]) were chosen to target the exon 1 of the mouse \u003cem\u003ePlod2\u003c/em\u003e gene. Oligonucleotide pairs containing these gRNA sequences were cloned into pX335 (Addgene) that contains D10A mutant Cas9 (Cas9n) \u003csup\u003e\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e\u003c/sup\u003e, to produce pX335-mLH2-1 and \u0026minus;\u0026thinsp;2. The sequence-verified pairs of pX335-mLH2-1 and \u0026minus;\u0026thinsp;2 (Eton Bioscience, Durham, NC, USA), together with a puromycin-containing plasmid were transfected into MC cells using FuGENE 6 transfection reagent (Roche Applied Sciences). The non-transfected MC cells and those transfected with the original pX335 plasmid (empty vector (EV); ligation of pX335 alone without annealed sgRNA oligo inert) were used as controls. After 48h, the transfected cells were trypsinized, single-cell sorted into 96-well plates by fluorescence-activated cell sorter (FACS), and maintained in α-minimum essential medium, 10% FBS, 100 units/ml penicillin, 100 \u0026micro;g/ml streptomycin, and 2 \u0026micro;g/ml Puromycin (InvivoGen, San Diego, CA, USA). The expanded cells were characterized by sequencing the targeted region of \u003cem\u003ePlod2\u003c/em\u003e gene and by comparing the level of LH2 with those of the EV and the non-transfected MC cells.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eEvaluation of Off-target Effect\u003c/strong\u003e \u003cp\u003eThe specificity of the various gRNAs used in this study and their potential off-target cleavage probabilities were evaluated using two different algorithms, online CRISPR RGEN Tools and Off-Spotter design prior to deploying them in MC cells.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eQuantitative Real-time PCR.\u003c/b\u003e To determine the expression of \u003cem\u003ePlod2\u003c/em\u003e, MC, EV and KO clones were plated at a density of 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/35mm-dish. After 48 h, total RNA was extracted with TRIzol reagent (Invitrogen). Expression levels of \u003cem\u003ePlod2\u003c/em\u003e mRNA were assessed by one-step quantitative reverse transcription polymerase chain reaction (RT-PCR) with ABI Prism 7500 (Applied Biosystems). The specific probe and primers set for \u003cem\u003ePlod2\u003c/em\u003e was purchased from ThermoFisher Scientific (TaqMan Gene Expression Assay, Mm00478767_m1). The mRNA expression levels were normalized to beta-actin (\u003cem\u003eActb\u003c/em\u003e; Mm01205647_g1) and analyzed by the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method \u003csup\u003e\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern Blot Analysis.\u003c/b\u003e To determine the protein level, the KO clones and controls were plated onto 35-mm dishes at a density of 3\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/dish. After culturing for 7 days, the cells were washed with phosphate-buffered saline (PBS), lysed with radio-immunoprecipitation assay (RIPA) lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 0.5% Sodium deoxycholate, 0.1% SDS, and 1% NP-40), centrifuged at 1,2000 \u0026times;g and the supernatant was collected. The total protein concentration was measured by the Pierce BCA Protein Assay Kit (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer\u0026rsquo;s protocol. The cell lysate was mixed with 2\u0026times; Laemmli Sample Buffer containing 2-mercaptoethanol (BIO-RAD) and 10 \u0026micro;g of total protein was applied to a 4\u0026ndash;20% Mini-PROTEAN TGX Precast Protein Gel (BIO-RAD). The separated proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Immobilon-P, Millipore Corp., Bedford, MA, USA) and probed with rabbit polyclonal anti-LH2 antibody (Proteintech Group, Inc., Rosemont, IL, USA). Other protein levels were also characterized using rabbit polyclonal PLOD1 antibody (1:200, cat# 12475-1-AP, Proteintech), rabbit polyclonal PLOD2 antibody (1:100, cat# 21214-1-AP, Proteintech), rabbit polyclonal PLOD3 antibody (1:200, cat# 11027-1-AP, Proteintech), rabbit polyclonal GLT25D1 antibody (1:200, cat# 16768-1-AP, Proteintech), rabbit polyclonal Fkbp65 antibody (1:200, cat# 12172-1-AP, Proteintech), rabbit polyclonal CypB antibody (1:10,000, cat# PA1-027A, Thermo Fisher), rabbit polyclonal Hsp47 antibody (1:100, cat# 10875-1-AP, Proteintech), and rabbit polyclonal Bip antibody (1:100, cat# 11587-1-AP, Proteintech). Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Cell Signaling Technology) was used as a secondary antibody and HRP-conjugated anti-β-actin rabbit monoclonal antibody (13E5, Cell Signaling Technology) was used as an internal control for protein loading. The reactivities of HRP were detected with SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific) and the chemiluminescence was scanned using an Odyssey Infrared Imaging System (LI-COR Biosciences). Quantitation of proteins was performed using the Image Studio software version 4.0 (LI-COR) with normalization to β-actin levels and was then shown as the change relative to the protein levels in MC as 1.0.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCollagen Preparation for Biochemical Analysis.\u003c/b\u003e MC, KO and EV clones were cultured in α-minimum essential media (Invitrogen) containing 10% FBS, 100 units/ml penicillin, and 100 \u0026micro;g/ml streptomycin. When the cells grew to confluence, the medium was replaced with that containing 50 \u0026micro;g/ml of ascorbic acid. After 2 weeks of culture, the cells/matrix layers were scraped, thoroughly washed with PBS and cold distilled water several times by repeated centrifugation at 4,000 xg, and lyophilized.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCollagen Type Analysis.\u003c/b\u003e Collagen was extracted and purified from lyophilized cell/matrix layer of MC, EV, and KO clones by digestion with pepsin (Sigma-Aldrich, St. Louis, MO, USA; 5 mg/mL in 0.5 M acetic acid) and salt precipitation (0.7 M in 0.5 M acetic acid) as described previously \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Type I and III collagens were quantified by LC-MS using SI-collagen as an internal standard \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. In brief, SI-collagen was first mixed into the purified collagen samples, and the samples were digested with sequencing grade trypsin (Promega, Madison, WI, USA; 1:50 enzyme/substrate ratio) in 100 mM Tris-HCl/1 mM CaCl\u003csub\u003e2\u003c/sub\u003e (pH 7.6) at 37\u0026deg;C for 16 hours after heat denaturation at 60\u0026deg;C for 30 min. Generated marker peptides of type I and III collagens (two peptides for each α chain; stable isotopically heavy and light ones) were monitored by LC-QqQ-MS on a 3200 QTRAP hybrid QqQ/linear ion trap mass spectrometer (AB Sciex, Foster City, CA, USA) with an Agilent 1200 Series HPLC system (Agilent Technologies, Palo Alto, CA, USA) using a BIOshell A160 Peptide C18 HPLC column (5 \u0026micro;m particle size, L \u0026times; I.D. 150 mm \u0026times; 2.1 mm; Supelco, Bellefonte, PA, USA) to determine the concentrations of type I and type III collagens.\u003c/p\u003e \u003cp\u003e \u003cb\u003eReduction with NaB\u003c/b\u003e \u003csup\u003e \u003cb\u003e3\u003c/b\u003e \u003c/sup\u003e \u003cb\u003eH\u003c/b\u003e \u003csub\u003e \u003cb\u003e4\u003c/b\u003e \u003c/sub\u003e. Lyophilized cell/matrix samples (~\u0026thinsp;2.0 mg each) were suspended in buffer containing 0.15 M N-trismethyl-2-aminoethanesulfonic acid, and 0.05 M Tris-HCl, pH 7.4, and reduced with standardized NaB\u003csup\u003e3\u003c/sup\u003eH\u003csub\u003e4\u003c/sub\u003e. The specific activity of the NaB\u003csup\u003e3\u003c/sup\u003eH\u003csub\u003e4\u003c/sub\u003e was determined by the method previously reported \u003csup\u003e\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e\u003c/sup\u003e. The reduced samples were washed with cold distilled water several times by repeated centrifugation at 4,000 \u0026times;g and lyophilized.\u003c/p\u003e \u003cp\u003e \u003cb\u003eQuantification of Hyl by HPLC.\u003c/b\u003e Reduced collagen was hydrolyzed with 6 N HCl and subjected to amino acid analysis \u003csup\u003e\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e\u003c/sup\u003e. The level of total Hyl in a collagen molecule was calculated based on the value of 300 residues of Hyp per collagen molecule, which were quantified as residues/collagen molecule \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSite-specific Characterization of Post-translational Modifications of Type I collagen.\u003c/b\u003e The purified collagen samples were digested with trypsin as described above to analyze the Lys post-translational modifications at the specific molecular sites within the triple helical domain of type I collagen \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In addition, to analyze Lys hydroxylation at the telopeptide domains of type I collagen, the lyophilized cell/matrix samples were sequentially digested with bacterial collagenase and pepsin as previously reported \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In brief, the samples were digested with 0.01 mg/ml of collagenase from \u003cem\u003eGrimontia hollisae\u003c/em\u003e (Nippi, Tokyo, Japan) \u003csup\u003e\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u003c/sup\u003e in 100 mM Tris-HCl/5 mM CaCl\u003csub\u003e2\u003c/sub\u003e (pH 7.5) at 37\u0026deg;C for 16 hours after heating at 60\u0026deg;C for 30 min. After addition of acetic acid (final 0.5 M), the collagenase-digests were further digested with 0.01 mg/ml of pepsin (Sigma-Aldrich) at 37\u0026deg;C for 16 hours. The trypsin- or collagenase/pepsin-digests were subjected to LC-QTOF-MS analysis on an ultra-high resolution QTOF mass spectrometer (maXis II, Bruker Daltonics, Bremen, Germany) coupled to a Shimadzu Prominence UFLC-XR system (Shimadzu, Kyoto, Japan) using an Ascentis Express C18 HPLC column (5 \u0026micro;m particle size, L \u0026sdot; I.D. 150 mm \u0026sdot; 2.1 mm; Supelco) \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Site occupancy of Lys hydroxylation/glycosylation (Lys, Hyl, G-Hyl, and GG-Hyl) was calculated using the peak area ratio of EICs (mass precision range\u0026thinsp;=\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05) of peptides containing the respective molecular species as previously reported \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCollagen Cross-link Analysis.\u003c/b\u003e Reduced collagen was hydrolyzed with 6 N HCl, and subjected to cross-link analysis as described previously \u003csup\u003e\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e\u003c/sup\u003e. Upon reduction, the dehydrodihydroxylysinonorleucine (dehydro-DHLNL)/its ketoamine, dehydrohydroxylysinonorleucine (dehydro-HLNL)/its ketoamine, and dehydrohistidinohydroxymerodesmosine (dehydro-HHMD) are reduced to stable secondary amines, DHLNL, HLNL, and HHMD. The reducible cross-links were analyzed as their reduced forms (i.e. DHLNL, HLNL, and HHMD, respectively). Hereafter, the terms DHLNL, HLNL, and HHMD will be used for both the unreduced and reduced forms. The levels of the major immature reducible, DHLNL, HLNL, and HHMD, and mature non-reducible cross-links, Pyr, were quantified as moles/mole of collagen \u003csup\u003e\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e,\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSolubility of Collagen.\u003c/b\u003e Solubility of collagen from lyophilized cell/matrix samples were evaluated by sequential extraction using acetic acid and pepsin as described previously with slight modification \u003csup\u003e\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e\u003c/sup\u003e. In brief, collagen was first extracted using 0.5 M acetic acid at 4\u0026deg;C for 24 h, and subsequently extracted with 5 mg/ml high-purity pepsin (1:60,000; Wako Chemicals) in 0.5 M acetic acid at 4\u0026deg;C for 24 h. The acid- and pepsin-soluble fractions and the residual fraction were subjected to acid hydrolysis (6 N HCl, 110\u0026deg;C for 20 h in the gas phase under N\u003csub\u003e2\u003c/sub\u003e) after addition of SI-collagen as an internal standard \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. The acid hydrolysates were subjected to LC-MS analysis of 4-Hyp in MRM mode on the QqQ mass spectrometer using a ZIC-HILIC column (3.5 \u0026micro;m particle size, L \u0026sdot; I.D. 150 mm \u0026sdot; 2.1 mm; Merck Millipore, Billerica, MA, USA) \u003csup\u003e\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e\u003c/sup\u003e. Concentration of collagen was estimated by the peak area ratio of 4-Hyp to stable isotopically heavy 4-Hyp derived from SI-collagen.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMeasurements of Collagen Fibril Diameter by Transmission Electron Microscopy.\u003c/b\u003e MC, KO and EV clones were plated at a density of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/ 35-mm dishes and cultured in α-minimum essential medium, 10% FBS, 100 units/ml penicillin, 100 \u0026micro;g/ml streptomycin, 50 \u0026micro;g/ml ascorbic acid, and 2 mM β-glycerophosphate, for 2 weeks. The cell/matrix layers were washed with PBS, fixed with 2.5% EM grade glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.4. The samples were then postfixed in potassium ferrocyanide-reduced osmium for 1 h at room temperature. After rinsing with distilled water, the samples were dehydrated with a graded series of ethanol concentrations, and embedded in PolyBed-812 epoxy resin (Polysciences, Warrington, PA, USA). Sections of 70 nm thickness were cut, mounted on copper Formvar-carbon filmed grids, and stained with 4% uranyl acetate and Reynolds\u0026rsquo; lead citrate \u003csup\u003e\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e\u003c/sup\u003e. Cross-sectional views of the collagen fibrils were observed using a LEO EM-910 transmission electron microscope operating at 80 kV (Carl Zeiss SMT, Peabody, MA, USA), and images were taken at 25,000\u0026times;using a Gatan Orius SC1000 CCD camera with Digital Micrograph 3.11.0 (Gatan, Inc., Pleasanton, CA, USA). For each sample, the diameters of 3,000 fibrils were measured using ImageJ 1.44p software.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn Vitro Mineralization Assay.\u003c/b\u003e MC, EV and KO clones were plated at a density of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/35-mm dish and cultured in α-minimum essential medium containing 10% FBS, 100 units/ml penicillin, and 100 \u0026micro;g/ml streptomycin. Upon confluence, cells were maintained in the mineralization medium containing 50 \u0026micro;g/ml ascorbic acid and 2 mM β-glycerophosphate and cultured for up to 4 weeks. The cell/matrix layer from each sample was washed with PBS, fixed with 100% methanol, and stained with 1% Alizarin Red S (Sigma Chemical, St. Louis, MO, USA). Then, the extent of mineralization was evaluated from the measurements of Alizarin Red S content by using the previous reported method \u003csup\u003e\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistical Analyses.\u003c/b\u003e Statistical analyses were performed using Jmp\u0026reg;8.0 software (SAS Institute Inc., Cary, NC, USA). Statistical differences were determined by Kruskal-Wallis one-way analysis of variance and means comparison by Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test. The data were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (S.D.), and a \u003cem\u003ep\u003c/em\u003e value less than 0.05 was considered to be statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are contained within this manuscript and supporting information. The MS data sets for specific lysine post-translational modification in type I collagen have been deposited to the Zenodo repository (https://zenodo.org/record/5211220#.YRxpjOjniUk). The all source data are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMT:\u0026nbsp;Data curation, formal analysis, investigation, visualization, writing-original draft; YT: Data curation, formal analysis, investigation, visualization, writing-original draft; TN: Data curation, Methodology, Resources, validation; HFG: Data curation, writing-review \u0026amp; editing; YK: Data curation, formal analysis, writing-review \u0026amp; editing; NMS: Funding acquisition, resources, writing-review \u0026amp; editing; KPS: Methodology, writing-review \u0026amp; editing; ALA: Funding acquisition, methodology, writing-review \u0026amp; editing; KM: methodology, resources, validation; JMK: Funding acquisition, methodology, writing-review \u0026amp; editing; MY: conceptualization, funding acquisition, methodology, project administration, supervision, writing-original draft, writing-review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by NIH R01CA251067 to JMK and MY, Basic Science Fund from Nippi to YT, JSPS KAKENHI Grant Number JP19H03439 to TN, NIH R01 HL049277 to NMS, and Developmental Research Program Grant from the Yale Head and Neck SPORE NIDCR P50-DE030707 to ALA. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article contains supplementary information.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eYamauchi, M. \u0026amp; Sricholpech, M. Lysine post-translational modifications of collagen. Essays Biochem \u003cb\u003e52\u003c/b\u003e, 113\u0026ndash;133, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/bse0520113\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMercer, D. K., Nicol, P. F., Kimbembe, C. \u0026amp; Robins, S. P. Identification, expression, and tissue distribution of the three rat lysyl hydroxylase isoforms. Biochemical and Biophysical Research Communications \u003cb\u003e307\u003c/b\u003e, 803\u0026ndash;809, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0006-291x(03)01262-2\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValtavaara, M. \u003cem\u003eet al.\u003c/em\u003e Cloning and Characterization of a Novel Human Lysyl Hydroxylase Isoform Highly Expressed in Pancreas and Muscle. J Biol Chem \u003cb\u003e272\u003c/b\u003e, 6831\u0026ndash;6834 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValtavaara, M., Valtavaara, M., Szpirer, C., Szpirer, J. \u0026amp; Myllyla, R. Primary Structure, Tissue Distribution, and Chromosomal Localization of a Novel Isoform of Lysyl Hydroxylase (Lysyl Hydroxylase 3). The Journal of biological chemistry \u003cb\u003e273\u003c/b\u003e, 12881\u0026ndash;12886 (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYeowell, H. N. \u0026amp; Walker, L. C. Tissue specificity of a new splice form of the human lysyl hydroxylase 2 gene. Matrix. Biol \u003cb\u003e18\u003c/b\u003e, 179\u0026ndash;187 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, H. F. \u003cem\u003eet al.\u003c/em\u003e A collagen glucosyltransferase drives lung adenocarcinoma progression in mice. Communications biology \u003cb\u003e4\u003c/b\u003e, 482, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s42003-021-01982-w\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchegg, B., Hulsmeier, A. J., Rutschmann, C., Maag, C. \u0026amp; Hennet, T. Core glycosylation of collagen is initiated by two beta(1-O)galactosyltransferases. Mol Cell Biol \u003cb\u003e29\u003c/b\u003e, 943\u0026ndash;952, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/MCB.02085-07\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSricholpech, M. \u003cem\u003eet al.\u003c/em\u003e Lysyl hydroxylase 3 glucosylates galactosylhydroxylysine residues in type I collagen in osteoblast culture. The Journal of biological chemistry \u003cb\u003e286\u003c/b\u003e, 8846\u0026ndash;8856, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M110.178509\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSricholpech, M. \u003cem\u003eet al.\u003c/em\u003e Lysyl Hydroxylase 3-mediated Glucosylation in Type I Collagen: MOLECULAR LOCI AND BIOLOGICAL SIGNIFICANCE. Journal of Biological Chemistry \u003cb\u003e287\u003c/b\u003e, 22998\u0026ndash;23009, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M112.343954\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerajima, M. \u003cem\u003eet al.\u003c/em\u003e Glycosylation and cross-linking in bone type I collagen. The Journal of biological chemistry \u003cb\u003e289\u003c/b\u003e, 22636\u0026ndash;22647, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M113.528513\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshikawa, Y., Boudko, S. \u0026amp; Bachinger, H. P. Ziploc-ing the structure: Triple helix formation is coordinated by rough endoplasmic reticulum resident PPIases. Biochimica et biophysica acta \u003cb\u003e1850\u003c/b\u003e, 1983\u0026ndash;1993, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbagen.2014.12.024\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCabral, W. A. \u003cem\u003eet al.\u003c/em\u003e Abnormal type I collagen post-translational modification and crosslinking in a cyclophilin B KO mouse model of recessive osteogenesis imperfecta. PLoS genetics \u003cb\u003e10\u003c/b\u003e, e1004465, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1004465\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeard, M. E. \u003cem\u003eet al.\u003c/em\u003e Sc65-Null Mice Provide Evidence for a Novel Endoplasmic Reticulum Complex Regulating Collagen Lysyl Hydroxylation. PLoS genetics \u003cb\u003e12\u003c/b\u003e, e1006002, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1006002\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGjaltema, R. A., van der Stoel, M. M., Boersema, M. \u0026amp; Bank, R. A. Disentangling mechanisms involved in collagen pyridinoline cross-linking: The immunophilin FKBP65 is critical for dimerization of lysyl hydroxylase 2. Proc Natl Acad Sci U S A \u003cb\u003e113\u003c/b\u003e, 7142\u0026ndash;7147, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1600074113\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEyre, D. R. \u0026amp; Weis, M. A. Bone Collagen: New Clues to Its Mineralization Mechanism from Recessive Osteogenesis Imperfecta. Calcified tissue international \u003cb\u003e93\u003c/b\u003e, 338\u0026ndash;347, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00223-013-9723-9\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, H., Aryal, A. C. S. \u0026amp; Marini, J. C. Osteogenesis imperfecta: new genes reveal novel mechanisms in bone dysplasia. Transl Res \u003cb\u003e181\u003c/b\u003e, 27\u0026ndash;48, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.trsl.2016.11.005\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrackman, P. C. Enzymatic and non-enzymatic functions of the lysyl oxidase family in bone. Matrix biology: journal of the International Society for Matrix Biology \u003cb\u003e52\u0026ndash;54\u003c/b\u003e, 7\u0026ndash;18, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.matbio.2016.01.001\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUzawa, K. \u003cem\u003eet al.\u003c/em\u003e Differential Expression of Human Lysyl Hydroxylase Genes, Lysine Hydroxylation, and Cross-Linking of Type I Collagen During Osteoblastic Differentiation In Vitro. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research \u003cb\u003e14\u003c/b\u003e, 1272\u0026ndash;1280 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePornprasertsuk, S., Duarte, W. R., Mochida, Y. \u0026amp; Yamauchi, M. Lysyl hydroxylase-2b directs collagen cross-linking pathways in MC3T3-E1 cells. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research \u003cb\u003e19\u003c/b\u003e, 1349\u0026ndash;1355, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1359/JBMR.040323\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePornprasertsuk, S., Duarte, W. R., Mochida, Y. \u0026amp; Yamauchi, M. Overexpression of lysyl hydroxylase-2b leads to defective collagen fibrillogenesis and matrix mineralization. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research \u003cb\u003e20\u003c/b\u003e, 81\u0026ndash;87, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1359/JBMR.041026\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Slot, A. J. \u003cem\u003eet al.\u003c/em\u003e Identification of PLOD2 as telopeptide lysyl hydroxylase, an important enzyme in fibrosis. The Journal of biological chemistry \u003cb\u003e278\u003c/b\u003e, 40967\u0026ndash;40972, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M307380200\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakaluoma, K., Lantto, J. \u0026amp; Myllyharju, J. Lysyl hydroxylase 2 is a specific telopeptide hydroxylase, while all three isoenzymes hydroxylate collagenous sequences. Matrix biology: journal of the International Society for Matrix Biology \u003cb\u003e26\u003c/b\u003e, 396\u0026ndash;403, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.matbio.2007.01.002\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBank, A. R. \u003cem\u003eet al.\u003c/em\u003e Defective collagen crosslinking in bone, but not in ligament or cartilage, in Bruck syndrome: Indications for a bone-specific telopeptide lysyl hydroxylase on chromosome 17. \u003cem\u003eProc. Natl. Acad. Sci. USA\u003c/em\u003e \u003cb\u003e96\u003c/b\u003e, 1054\u0026ndash;1058 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGistelinck, C. \u003cem\u003eet al.\u003c/em\u003e Loss of Type I Collagen Telopeptide Lysyl Hydroxylation Causes Musculoskeletal Abnormalities in a Zebrafish Model of Bruck Syndrome. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research \u003cb\u003e31\u003c/b\u003e, 1930\u0026ndash;1942, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jbmr.2977\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGistelinck, C. \u003cem\u003eet al.\u003c/em\u003e Abnormal Bone Collagen Cross-Linking in Osteogenesis Imperfecta/Bruck Syndrome Caused by Compound Heterozygous PLOD2 Mutations. JBMR plus \u003cb\u003e5\u003c/b\u003e, e10454, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jbm4.10454\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilkes, D. M. \u003cem\u003eet al.\u003c/em\u003e Procollagen lysyl hydroxylase 2 is essential for hypoxia-induced breast cancer metastasis. Mol. Cancer Res \u003cb\u003e11\u003c/b\u003e, 456\u0026ndash;466, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/1541-7786.MCR-12-0629\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEisinger-Mathason, T. S. \u003cem\u003eet al.\u003c/em\u003e Hypoxia-dependent modification of collagen networks promotes sarcoma metastasis. Cancer Discov \u003cb\u003e3\u003c/b\u003e, 1190\u0026ndash;1205, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/2159-8290.CD-13-0118\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiersma, B. \u0026amp; Bank, R. A. Collagen cross-linking mediated by lysyl hydroxylase 2: an enzymatic battlefield to combat fibrosis. Essays Biochem \u003cb\u003e63\u003c/b\u003e, 377\u0026ndash;338 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, Y. \u003cem\u003eet al.\u003c/em\u003e Lysyl hydroxylase 2 induces a collagen cross-link switch in tumor stroma. The Journal of clinical investigation \u003cb\u003e125\u003c/b\u003e, 1147\u0026ndash;1162, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/jci74725ds1\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaito, T. \u003cem\u003eet al.\u003c/em\u003e Aberrant Collagen Cross-linking in Human Oral Squamous Cell Carcinoma. Journal of dental research \u003cb\u003e98\u003c/b\u003e, 517\u0026ndash;525, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/0022034519828710\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaller, O. \u003cem\u003eet al.\u003c/em\u003e Tumour-associated macrophages drive stromal cell-dependent collagen crosslinking and stiffening to promote breast cancer aggression. Nature materials, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41563-020-00849-5\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKasamatsu, A. \u003cem\u003eet al.\u003c/em\u003e Deficiency of lysyl hydroxylase 2 in mice causes systemic endoplasmic reticulum stress leading to early embryonic lethality. Biochem Biophys Res Commun \u003cb\u003e512\u003c/b\u003e, 486\u0026ndash;491, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2019.03.091\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerajima, M. \u003cem\u003eet al.\u003c/em\u003e Cyclophilin-B modulates collagen cross-linking by differentially affecting lysine hydroxylation in the helical and telopeptidyl domains of tendon type I collagen. The Journal of biological chemistry \u003cb\u003e291\u003c/b\u003e, 9501\u0026ndash;9512, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M115.699470\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuran, I. \u003cem\u003eet al.\u003c/em\u003e A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen. Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research \u003cb\u003e32\u003c/b\u003e, 1309\u0026ndash;1319, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jbmr.3095\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaga, Y., Kusubata, M., Ogawa-Goto, K. \u0026amp; Hattori, S. Stable isotope-labeled collagen: a novel and versatile tool for quantitative collagen analyses using mass spectrometry. J Proteome Res \u003cb\u003e13\u003c/b\u003e, 3671\u0026ndash;3678, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/pr500213a\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerajima, M. \u003cem\u003eet al.\u003c/em\u003e Role of Glycosyltransferase 25 Domain 1 in Type I Collagen Glycosylation and Molecular Phenotypes. Biochemistry \u003cb\u003e58\u003c/b\u003e, 5040\u0026ndash;5051, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.biochem.8b00984\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerajima, M. \u003cem\u003eet al.\u003c/em\u003e Cyclophilin B Deficiency Causes Abnormal Dentin Collagen Matrix. J Proteome Res \u003cb\u003e16\u003c/b\u003e, 2914\u0026ndash;2923, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jproteome.7b00190\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaga, Y., Kusubata, M., Ogawa-Goto, K. \u0026amp; Hattori, S. Developmental Stage-dependent Regulation of Prolyl 3-Hydroxylation in Tendon Type I Collagen. The Journal of biological chemistry \u003cb\u003e291\u003c/b\u003e, 837\u0026ndash;847, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M115.686105\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHata, R. \u003cem\u003eet al.\u003c/em\u003e Selective inhibition of type I collagen synthesis in osteoblastic cells by epidermal growth factor. Endocrinology \u003cb\u003e115\u003c/b\u003e, 867\u0026ndash;876 (1984).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuboki, Y. \u0026amp; Mechanic, G. L. Comparative molecular distribution of cross-link in bone and dentin collagen. Structure-function relationships. Calcified tissue international \u003cb\u003e34\u003c/b\u003e, 306\u0026ndash;308, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/bf02411256\u003c/span\u003e\u003c/span\u003e (1982).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBota-Rabassedas, N. \u003cem\u003eet al.\u003c/em\u003e Use of osteoblast-derived matrix to assess the influence of collagen modifications on cancer cells. Matrix biology plus \u003cb\u003e8\u003c/b\u003e, 100047, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mbplus.2020.100047\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, A. H., Piez, K. A. \u0026amp; Gross, J. Characterization of the alpha-chains of chick skin collagen and the nature of the NH2-terminal cross-link region. Biochemistry \u003cb\u003e8\u003c/b\u003e, 3648\u0026ndash;3655, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/bi00837a023\u003c/span\u003e\u003c/span\u003e (1969).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanson, A. D. \u0026amp; Eyre, D. R. Molecular Site Specificity of Pyridinoline and Pyrrole Cross-links in Type I Collagen of Human Bone. J. Biol. Chem. \u003cb\u003e271\u003c/b\u003e, 26508\u0026ndash;26516, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.271.43.26508\u003c/span\u003e\u003c/span\u003e (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSyx, D. \u003cem\u003eet al.\u003c/em\u003e Aberrant binding of mutant HSP47 affects posttranslational modification of type I collagen and leads to osteogenesis imperfecta. PLoS genetics \u003cb\u003e17\u003c/b\u003e, e1009339, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1009339\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshikawa, Y. \u003cem\u003eet al.\u003c/em\u003e Mutation in cyclophilin B that causes hyperelastosis cutis in American Quarter Horse does not affect peptidylprolyl cis-trans isomerase activity but shows altered cyclophilin B-protein interactions and affects collagen folding. The Journal of biological chemistry \u003cb\u003e287\u003c/b\u003e, 22253\u0026ndash;22265, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M111.333336\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshikawa, Y. \u003cem\u003eet al.\u003c/em\u003e Type I and type V procollagen triple helix use different subsets of the molecular ensemble for lysine post-translational modifications in the rER. The Journal of biological chemistry \u003cb\u003e296\u003c/b\u003e, 100453, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbc.2021.100453\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSweeney, S. M. \u003cem\u003eet al.\u003c/em\u003e Candidate cell and matrix interaction domains on the collagen fibril, the predominant protein of vertebrates. The Journal of biological chemistry \u003cb\u003e283\u003c/b\u003e, 21187\u0026ndash;21197, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M709319200\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi, J. W., Schroeder, M. A., Sarkaria, J. N. \u0026amp; Bram, R. J. Cyclophilin B supports Myc and mutant p53-dependent survival of glioblastoma multiforme cells. Cancer Res \u003cb\u003e74\u003c/b\u003e, 484\u0026ndash;496, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-13-0771\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorello, R. \u003cem\u003eet al.\u003c/em\u003e CRTAP is required for prolyl 3- hydroxylation and mutations cause recessive osteogenesis imperfecta. Cell \u003cb\u003e127\u003c/b\u003e, 291\u0026ndash;304, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2006.08.039\u003c/span\u003e\u003c/span\u003e (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCabral, W. A. \u003cem\u003eet al.\u003c/em\u003e Prolyl 3-hydroxylase 1 deficiency causes a recessive metabolic bone disorder resembling lethal/severe osteogenesis imperfecta. Nat Genet \u003cb\u003e39\u003c/b\u003e, 359\u0026ndash;365, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ng1968\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Dijk, F. S. \u003cem\u003eet al.\u003c/em\u003e PPIB mutations cause severe osteogenesis imperfecta. Am J Hum Genet \u003cb\u003e85\u003c/b\u003e, 521\u0026ndash;527, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ajhg.2009.09.001\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHudson, D. M. \u003cem\u003eet al.\u003c/em\u003e Post-translationally abnormal collagens of prolyl 3-hydroxylase-2 null mice offer a pathobiological mechanism for the high myopia linked to human LEPREL1 mutations. The Journal of biological chemistry \u003cb\u003e290\u003c/b\u003e, 8613\u0026ndash;8622, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M114.634915\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBailey, A. J., Robins, S. P. \u0026amp; Balian, G. Biological significance of the intermolecular crosslinks of collagen. Nature \u003cb\u003e251\u003c/b\u003e, 105\u0026ndash;109, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/251105a0\u003c/span\u003e\u003c/span\u003e (1974).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Slot-Verhoeven, A. J. \u003cem\u003eet al.\u003c/em\u003e The type of collagen cross-link determines the reversibility of experimental skin fibrosis. Biochimica et biophysica acta \u003cb\u003e1740\u003c/b\u003e, 60\u0026ndash;67, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbadis.2005.02.007\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan den Bos, T., Speijer, D., Bank, R. A., Bromme, D. \u0026amp; Everts, V. Differences in matrix composition between calvaria and long bone in mice suggest differences in biomechanical properties and resorption: Special emphasis on collagen. Bone \u003cb\u003e43\u003c/b\u003e, 459\u0026ndash;468, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bone.2008.05.009\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRicard-Blum, S. \u003cem\u003eet al.\u003c/em\u003e Mechanism of collagen network stabilization in human irreversible granulomatous liver fibrosis. Gastroenterology \u003cb\u003e111\u003c/b\u003e, 172\u0026ndash;182, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/gast.1996.v111.pm8698196\u003c/span\u003e\u003c/span\u003e (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Slot, A. J. \u003cem\u003eet al.\u003c/em\u003e Increased formation of pyridinoline cross-links due to higher telopeptide lysyl hydroxylase levels is a general fibrotic phenomenon. Matrix biology: journal of the International Society for Matrix Biology \u003cb\u003e23\u003c/b\u003e, 251\u0026ndash;257 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, C. \u003cem\u003eet al.\u003c/em\u003e Proteomic analyses of ECM during pancreatic ductal adenocarcinoma progression reveal different contributions by tumor and stromal cells. Proc Natl Acad Sci U S A \u003cb\u003e116\u003c/b\u003e, 19609\u0026ndash;19618, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1908626116\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaller, O. \u003cem\u003eet al.\u003c/em\u003e Tumour-associated macrophages drive stromal cell-dependent collagen crosslinking and stiffening to promote breast cancer aggression. Nature materials \u003cb\u003e20\u003c/b\u003e, 548\u0026ndash;559, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41563-020-00849-5\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerajima, M. \u003cem\u003eet al.\u003c/em\u003e Collagen molecular phenotypic switch between non-neoplastic and neoplastic canine mammary tissues. Scientific reports \u003cb\u003e11\u003c/b\u003e, 8659, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-021-87380-y\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamauchi, M., Barker, T. H., Gibbons, D. L. \u0026amp; Kurie, J. M. The fibrotic tumor stroma. The Journal of clinical investigation \u003cb\u003e128\u003c/b\u003e, 16\u0026ndash;25, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/JCI93554\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato, K. \u003cem\u003eet al.\u003c/em\u003e Lysyl hydroxylase 2-induced collagen cross-link switching promotes metastasis in head and neck squamous cell carcinomas. Neoplasia (New York, N.Y.) \u003cb\u003e23\u003c/b\u003e, 594\u0026ndash;606, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neo.2021.05.014\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogel, K. G., Paulsson, M. \u0026amp; Heineg\u0026aring;rd, D. Specific inhibition of type I and type II collagen fibrillogenesis by the small proteoglycan of tendon. Biochem J \u003cb\u003e223\u003c/b\u003e, 587\u0026ndash;597, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/bj2230587\u003c/span\u003e\u003c/span\u003e (1984).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMochida, Y. \u003cem\u003eet al.\u003c/em\u003e Decorin modulates collagen matrix assembly and mineralization. Matrix biology: journal of the International Society for Matrix Biology \u003cb\u003e28\u003c/b\u003e, 44\u0026ndash;52, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.matbio.2008.11.003\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalamajski, S. \u0026amp; Oldberg, A. The role of small leucine-rich proteoglycans in collagen fibrillogenesis. Matrix biology: journal of the International Society for Matrix Biology \u003cb\u003e29\u003c/b\u003e, 248\u0026ndash;253, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.matbio.2010.01.001\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatz, E. P. \u0026amp; Li, S. T. Structure and function of bone collagen fibrils. Journal of molecular biology \u003cb\u003e80\u003c/b\u003e, 1\u0026ndash;15, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0022-2836(73)90230-1\u003c/span\u003e\u003c/span\u003e (1973).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, D. D. \u0026amp; Glimcher, M. J. Three-dimensional spatial relationship between the collagen fibrils and the inorganic calcium phosphate crystals of pickerel (Americanus americanus) and herring (Clupea harengus) bone. Journal of molecular biology \u003cb\u003e217\u003c/b\u003e, 487\u0026ndash;501, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0022-2836(91)90752-r\u003c/span\u003e\u003c/span\u003e (1991).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilver, F. H. \u0026amp; Landis, W. J. Deposition of apatite in mineralizing vertebrate extracellular matrices: A model of possible nucleation sites on type I collagen. Connective tissue research \u003cb\u003e52\u003c/b\u003e, 242\u0026ndash;254, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3109/03008207.2010.551567\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLandis, W. J. \u0026amp; Jacquet, R. Association of calcium and phosphate ions with collagen in the mineralization of vertebrate tissues. Calcified tissue international \u003cb\u003e93\u003c/b\u003e, 329\u0026ndash;337, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00223-013-9725-7\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamauchi, M. \u0026amp; Katz, E. P. The post-translational chemistry and molecular packing of mineralizing tendon collagens. Connective tissue research \u003cb\u003e29\u003c/b\u003e, 81\u0026ndash;98 (1993).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUeki, Y. \u003cem\u003eet al.\u003c/em\u003e PLOD2 Is Essential to Functional Activation of Integrin β1 for Invasion/Metastasis in Head and Neck Squamous Cell Carcinomas. iScience \u003cb\u003e23\u003c/b\u003e, 100850, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2020.100850\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaito, T. \u003cem\u003eet al.\u003c/em\u003e Decrease of lysyl hydroxylase 2 activity causes abnormal collagen molecular phenotypes, defective mineralization and compromised mechanical properties of bone. Bone \u003cb\u003e154\u003c/b\u003e, 116242, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bone.2021.116242\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, D. \u003cem\u003eet al.\u003c/em\u003e Isolation and Characterization of MC3T3-E1 Preosteoblast Subclones with Distinct In Vitro and In Vivo Differentiation/Mineralization Potential. J. Bone Miner. Res. \u003cb\u003e14\u003c/b\u003e, 893\u0026ndash;903 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRan, F. A. \u003cem\u003eet al.\u003c/em\u003e Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell \u003cb\u003e154\u003c/b\u003e, 1380\u0026ndash;1389, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2013.08.021\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRan, F. A. \u003cem\u003eet al.\u003c/em\u003e Genome engineering using the CRISPR-Cas9 system. Nat Protoc \u003cb\u003e8\u003c/b\u003e, 2281\u0026ndash;2308, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nprot.2013.143\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak, K. J. \u0026amp; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods \u003cb\u003e25\u003c/b\u003e, 402\u0026ndash;408, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/meth.2001.1262\u003c/span\u003e\u003c/span\u003e (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamauchi, M., Katz, E. \u0026amp; Mechanic, G. Intermolecular Cross-Linking and Stereospecific Molecular Packing in Type Ι Collagen Fibrils of the Periodontal Ligament. Biochemistry \u003cb\u003e25\u003c/b\u003e, 4907\u0026ndash;4913 (1986).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamauchi, M. \u0026amp; Shiiba, M. Lysine hydroxylationand cross-linking of collagen. Methods Mol. Biol. \u003cb\u003e446\u003c/b\u003e, 95\u0026ndash;108 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeramura, N. \u003cem\u003eet al.\u003c/em\u003e Cloning of a novel collagenase gene from the gram-negative bacterium Grimontia (Vibrio) hollisae 1706B and its efficient expression in Brevibacillus choshinensis. J Bacteriol \u003cb\u003e193\u003c/b\u003e, 3049\u0026ndash;3056, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.01528-10\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerajima, M. \u003cem\u003eet al.\u003c/em\u003e Cyclophilin B control of lysine post-translational modifications of skin type I collagen. PLoS genetics \u003cb\u003e15\u003c/b\u003e, e1008196, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1008196\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamauchi, M. \u0026amp; Katz, E. The post-translational chemistry and molecular packing of mineralizing tendon collagens. Connect. Tissue Res. \u003cb\u003e29\u003c/b\u003e, 81\u0026ndash;98 (1993).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReynolds, E. The use of lead citrate at high pH as an electronopaque stain in electron microscopy. J. Cell Biol \u003cb\u003e17\u003c/b\u003e, 208\u0026ndash;212 (1963).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGregory, C. A., Gunn, W. G., Peister, A. \u0026amp; Prockop, D. J. An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Analytical biochemistry \u003cb\u003e329\u003c/b\u003e, 77\u0026ndash;84, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ab.2004.02.002\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eHydroxylation of Lys in type I collagen from controls (MC and EV), and KO clones.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eMC\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eEV\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eKO-1\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eKO-2\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eKO-3\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHyl\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e14.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e14.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e12.5** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e13.2* \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11.4* \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(S.D.)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(0.21)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(0.34)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(0.14)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(0.12)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(0.58)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\" align=\"left\"\u003e\n\u003cp\u003eValues represent mean Hyl residues/mole of collagen\u0026thinsp;\u0026plusmn;\u0026thinsp;S.D. (n\u0026thinsp;=\u0026thinsp;3) of triplicate analysis of the hydrolysates.\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"7\" align=\"left\"\u003e\n\u003cp\u003e*\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 between MC and KO; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 between EV and KO, respectively. Lys, lysine; Hyl, hydroxylysine; MC, MC3T3-E1; EV, empty vector; KO, knock-out.\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eSummary of site-specific modification analysis by mass spectrometry of non-cross-linked, hydroxylated and glycosylated residues in type I collagen from controls (MC and EV) and KO clones.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLys hydroxylation and its glycosylation (%) represents the relative levels of Lys, Hyl, G-Hyl, and GG-Hyl (Lys + Hyl + G-Hyl + GG-Hyl = 100%). Lys, lysine; Hyl, hydroxylysine; G-, galactosyl-; GG-, glucosylgalactosyl; MC, MC3T3-E1; EV, empty vector;\u0026nbsp;KO, knock-out.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.110429447852761%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.349693251533742%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"74.5398773006135%\"\u003e\n \u003cp\u003eSite occupancy (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003eMC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.413476263399694%\"\u003e\n \u003cp\u003eEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"19.448698315467077%\"\u003e\n \u003cp\u003eKO-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003eKO-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003eKO-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e1.9 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e1.7 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e5.6 \u0026plusmn; 0.1*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e5.5 \u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e3.8 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e3.9 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e3.2 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e12.3 \u0026plusmn; 1.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e11.9\u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e5.1\u0026plusmn; 0.1** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e7.7 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e7.8 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e10.5 \u0026plusmn; 0.3** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e10.4 \u0026plusmn; 0.3** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e7.3 \u0026plusmn; 0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e86.4 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e87.2 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e71.6 \u0026plusmn; 0.5*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e72.3 \u0026plusmn; 0.6*** \u0026nbsp; \u0026nbsp; \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e83.8 \u0026plusmn; 0.6* \u0026nbsp; \u0026nbsp; \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e69.4 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e70.5 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e70.4 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e70.9 \u0026plusmn; 0.3*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e67.3 \u0026plusmn; 0.1**\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e20.0 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e19.7 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e22.1 \u0026plusmn; 0.1* \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e21.4 \u0026plusmn; 0.4* \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e25.0 \u0026plusmn; 0.1** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e6.9 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e6.4 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e5.5 \u0026plusmn; 0.1*** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e5.6 \u0026plusmn; 0.1*** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e4.9 \u0026plusmn; 0.1*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e3.7 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e3.4 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e2.0 \u0026plusmn; 0.0** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e2.1 \u0026plusmn; 0.0** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e2.8 \u0026plusmn; 0.0** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e53.3 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e52.8 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e64.3 \u0026plusmn; 0.3** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e64.6 \u0026plusmn; 0.3** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e57.7 \u0026plusmn; 0.2* \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e41.2 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e42.3 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e33.1 \u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e32.6 \u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e38.4 \u0026plusmn; 0.2** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e3.1 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e2.8 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e1.9 \u0026plusmn; 0.1** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e2.0 \u0026plusmn; 0.0* \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e2.5 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e2.4 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e2.1 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e0.7 \u0026plusmn; 0.1* \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.8 \u0026plusmn; 0.1* \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e1.3 \u0026plusmn; 0.0* \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K219\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e85.4 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e87.0 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e83.6 \u0026plusmn; 0.3** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e83.3 \u0026plusmn; 0.3**\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e81.3 \u0026plusmn; 0.2***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e14.6 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e13.0 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e16.4 \u0026plusmn; 0.3** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e16.7 \u0026plusmn; 0.3** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e18.7 \u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K564\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e66.6 \u0026plusmn; 1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e67.2 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e73.6 \u0026plusmn; 0.5** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e72.5 \u0026plusmn; 0.1* \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e67.5 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e24.1 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e24.7 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e22.3 \u0026plusmn; 0.4\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e23.1 \u0026plusmn; 0.0\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e27.3 \u0026plusmn; 0.2* \u003csup\u003e###\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e4.3 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e4.0 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e2.6 \u0026plusmn; 0.1** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e2.8 \u0026plusmn; 0.1* \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e3.0 \u0026plusmn; 0.1* \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e4.9 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e4.2 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e1.5 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e1.6 \u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e2.2 \u0026plusmn; 0.0*** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e8.4 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e7.2 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e7.2 \u0026plusmn; 0.1***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e7.2 \u0026plusmn; 0.1***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e4.1 \u0026plusmn; 0.0*** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e91.6 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e92.8 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e92.8 \u0026plusmn; 0.1***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e92.8 \u0026plusmn; 0.1***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e95.9 \u0026plusmn; 0.0*** \u003csup\u003e##\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e36.0 \u0026plusmn; 1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e35.6 \u0026plusmn; 1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e48.7 \u0026plusmn; 0.3** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e49.4 \u0026plusmn; 0.4*** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e39.8 \u0026plusmn; 0.6* \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e6.2 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e6.0 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e8.0 \u0026plusmn; 0.3** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e8.1 \u0026plusmn; 0.4*** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e4.6 \u0026plusmn; 0.0* \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e37.8 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e38.4 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e33.1 \u0026plusmn; 0.7** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e31.9 \u0026plusmn; 0.9** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e35.4 \u0026plusmn; 0.1** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e20.0 \u0026plusmn; 1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e20.2 \u0026plusmn; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e10.2 \u0026plusmn; 0.1** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e10.6 \u0026plusmn; 0.1** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e20.1 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K219\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e34.1 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e34.3 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e54.7 \u0026plusmn; 0.5*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e54.9 \u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e46.7 \u0026plusmn; 0.2*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e62.2 \u0026plusmn; 0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e62.0 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e43.9 \u0026plusmn; 0.5*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e43.7 \u0026plusmn; 0.3*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e50.6 \u0026plusmn; 0.3*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e0.6 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e0.7 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e0.4 \u0026plusmn; 0.1\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.3 \u0026plusmn; 0.1\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.5 \u0026plusmn; 0.0\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e3.2 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e3.0 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e1.1 \u0026plusmn; 0.1* \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e1.1 \u0026plusmn; 0.1* \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e2.3 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K918/930\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys + Lys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e2.1 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e1.3 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e3.4 \u0026plusmn; 0.2**\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e4.6 \u0026plusmn; 0.2** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e5.2 \u0026plusmn; 0.1***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys + Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e10.8 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e9.5 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e10.8 \u0026plusmn; 0.1\u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e11.6 \u0026plusmn; 0.1*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e12.6 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl + Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e87.1 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e89.2 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e85.8 \u0026plusmn; 0.3* \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e83.8 \u0026plusmn; 0.2***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e82.2 \u0026plusmn; 0.1***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K933\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e0.3 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e0.3 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e1.3 \u0026plusmn; 0.1*\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e1.2 \u0026plusmn; 0.1**\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.7 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e99.7 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e99.7 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e98.7 \u0026plusmn; 0.1*\u003csup\u003e\u0026nbsp;#\u003c/sup\u003e\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e98.8 \u0026plusmn; 0.1**\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e99.3 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K9\u003csup\u003eN\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e44.6 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e48.0 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e55.4 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e52.0 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K16\u003csup\u003eC\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e51.9 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e43.2 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e48.1 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e56.8 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K5\u003csup\u003eN\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e78.6 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e77.3 \u0026plusmn; 1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e100 \u0026plusmn; 0.0***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.088820826952526%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.332312404287903%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e21.4 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"11.944869831546708%\"\u003e\n \u003cp\u003e22.7 \u0026plusmn; 1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.91730474732006%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.385911179173046%\"\u003e\n \u003cp\u003e0.0 \u0026plusmn; 0.0*** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"8\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003eValues represent mean \u0026plusmn; S.D. (n=3) of triplicate analysis for each group. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO, respectively.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. Glycosylation\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof hydroxylysine residues estimated by mass spectrometry of non-cross-linked glycosylated residues.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGlycosylation of Hyl residues (%) represents the relative levels of Glycosylated Hyl (G-Hyl + GG-Hyl). Hyl + Glycosylated Hyl = 100%. Hyl, hydroxylysine; G-, galactosyl-; GG-, glucosylgalactosyl-; MC, MC3T3-E1; EV, empty vector;\u0026nbsp;KO, knock-out.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.659192825112108%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.442451420029894%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" valign=\"top\" width=\"71.898355754858%\"\u003e\n \u003cp\u003eSite occupancy (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003eMC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003eEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003eKO-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003eKO-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003eKO-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e4.0 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e3.3 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e13.0 \u0026plusmn; 0.3\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e12.6 \u0026plusmn; 0.2\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e5.3 \u0026plusmn; 0.1\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eGlycosylated-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e96.0 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e96.7 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e87.0 \u0026plusmn; 0.3\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e87.4 \u0026plusmn; 0.2\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e94.7 \u0026plusmn; 0.1\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e65.3 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e67.0 \u0026plusmn; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e74.5 \u0026plusmn; 0.2\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e73.5 \u0026plusmn; 0.6\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e76.5 \u0026plusmn; 0.1\u003csup\u003e*** ###\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eGlycosylated-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e34.7 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e33.0 \u0026plusmn; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e25.5 \u0026plusmn; 0.2\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e26.5 \u0026plusmn; 0.6\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e23.5 \u0026plusmn; 0.1\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e88.3 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e89.7 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e92.7 \u0026plusmn; 0.5\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e92.2 \u0026plusmn; 0.2\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e91.0 \u0026plusmn; 0.2\u003csup\u003e* ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eGlycosylated-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e11.7 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e10.3 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e7.3 \u0026plusmn; 0.5\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e7.8 \u0026plusmn; 0.2\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e9.0 \u0026plusmn; 0.2\u003csup\u003e* ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K564\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e72.3 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e75.2 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e84.3 \u0026plusmn; 0.3\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e83.8 \u0026plusmn; 0.5\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e84.2 \u0026plusmn; 0.2\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eGlycosylated-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e27.7 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e24.8 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e15.7 \u0026plusmn; 0.3\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e16.2 \u0026plusmn; 0.5\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e15.8 \u0026plusmn; 0.2\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e9.7 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e9.2 \u0026plusmn; 0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e15.6 \u0026plusmn; 0.8\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e16.0 \u0026plusmn; 1.1\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e7.7 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eGlycosylated-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e90.3 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e90.8 \u0026plusmn; 0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e84.4 \u0026plusmn; 0.8\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e84.0 \u0026plusmn; 1.1\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e92.3 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K219\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eHyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e94.3 \u0026plusmn; 1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e94.4 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e96.8 \u0026plusmn; 0.2\u003csup\u003e* ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e96.9 \u0026plusmn; 0.5\u003csup\u003e* ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e94.9 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.64179104477612%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.417910447761194%\"\u003e\n \u003cp\u003eGlycosylated-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e5.7 \u0026plusmn; 1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e5.6 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e3.2 \u0026plusmn; 0.2\u003csup\u003e* ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e3.1 \u0026plusmn; 0.5\u003csup\u003e* ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e5.1 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003eValues represent mean \u0026plusmn; S.D. (n=3) of triplicate analysis for each group. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO, respectively.\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4. Extent of two glycosylation forms of hydroxylysine in type I collagen isolated from MC and KO clone.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGlycosylation of Hyl residues (%) represents the relative levels of G-Hyl, and GG-Hyl (G-Hyl + GG-Hyl = 100%). Hyl, hydroxylysine; G-, galactosyl-; GG-, glucosylgalactosyl-; MC, MC3T3-E1; EV, empty vector;\u0026nbsp;KO, knock-out.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.050822122571002%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.050822122571002%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" valign=\"top\" width=\"71.898355754858%\"\u003e\n \u003cp\u003eSite occupancy (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003eMC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003eEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003eKO-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003eKO-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003eKO-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e8.2 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e8.2 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e12.8 \u0026plusmn; 0.4\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e12.6 \u0026plusmn; 0.5\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e8.0 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e91.8 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e91.8 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e87.2 \u0026plusmn; 0.4\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e87.4 \u0026plusmn; 0.5\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e92.0 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e64.9 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e65.5 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e73.2 \u0026plusmn; 0.6\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e72.3 \u0026plusmn; 1.1\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e63.9 \u0026plusmn; 0.6\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e35.1 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e34.5 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e26.8 \u0026plusmn; 0.6\u003csup\u003e***###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e27.7 \u0026plusmn; 1.1\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e36.1 \u0026plusmn; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e56.8 \u0026plusmn; 1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e56.8 \u0026plusmn; 2.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e73.0 \u0026plusmn; 1.1\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e71.5 \u0026plusmn; 2.3\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e65.8 \u0026plusmn; 0.7\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e43.2 \u0026plusmn; 1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e43.2 \u0026plusmn; 2.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e27.0 \u0026plusmn; 1.1\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e28.5 \u0026plusmn; 2.3\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e34.2 \u0026plusmn; 0.7\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026alpha;1(I) K564\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e47.1 \u0026plusmn; 1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e48.9 \u0026plusmn; 2.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e63.0 \u0026plusmn; 1.8\u003csup\u003e*** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e64.0 \u0026plusmn; 3.5\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e58.2 \u0026plusmn; 1.2\u003csup\u003e*** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e52.9 \u0026plusmn; 1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e51.1 \u0026plusmn; 2.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e37.0 \u0026plusmn; 1.8\u003csup\u003e*** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e36.0 \u0026plusmn; 3.5\u003csup\u003e** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e41.8 \u0026plusmn; 1.2\u003csup\u003e*** ##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e65.3 \u0026plusmn; 1.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e65.7 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e76.5 \u0026plusmn; 0.6\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e75.1 \u0026plusmn; 0.8\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e63.8 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e34.7 \u0026plusmn; 1.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e34.3 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e23.5 \u0026plusmn; 0.6\u003csup\u003e*** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e24.9 \u0026plusmn; 0.8\u003csup\u003e** ###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e36.2 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026alpha;2(I) K219\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e14.8 \u0026plusmn; 4.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e18.6 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e27.4 \u0026plusmn; 5.5\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e23.5 \u0026plusmn; 4.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e16.5 \u0026plusmn; 1.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.029850746268657%\"\u003e\n \u003cp\u003eGG-Hyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e85.2 \u0026plusmn; 4.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.343283582089553%\"\u003e\n \u003cp\u003e81.4 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.522388059701493%\"\u003e\n \u003cp\u003e72.6 \u0026plusmn; 5.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e76.5 \u0026plusmn; 4.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.865671641791046%\"\u003e\n \u003cp\u003e83.5 \u0026plusmn; 1.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003eValues represent mean \u0026plusmn; S.D. (n=3) of triplicate analysis for each group. **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO, respectively.\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 5. Levels of immature reducible cross-links (DHLNL and HLNL) and mature non-reducible cross-links (Pry and HHMD) from MC, EV, and KO clones.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.534818941504179%\"\u003e\n \u003cp\u003eCells/Clones\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.041782729805014%\"\u003e\n \u003cp\u003eDHLNL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.016713091922007%\"\u003e\n \u003cp\u003eHLNL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.573816155988858%\"\u003e\n \u003cp\u003ePyr\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.802228412256266%\"\u003e\n \u003cp\u003eHHMD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.030640668523677%\"\u003e\n \u003cp\u003eTotal aldehydes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.534818941504179%\"\u003e\n \u003cp\u003eMC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.041782729805014%\"\u003e\n \u003cp\u003e0.74 (0.01)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.016713091922007%\"\u003e\n \u003cp\u003e0.27 (0.02)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.573816155988858%\"\u003e\n \u003cp\u003e0.021 (0.004)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.802228412256266%\"\u003e\n \u003cp\u003e0.08 (0.02)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.030640668523677%\"\u003e\n \u003cp\u003e1.21 (0.05)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.534818941504179%\"\u003e\n \u003cp\u003eEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.041782729805014%\"\u003e\n \u003cp\u003e0.61 (0.05)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.016713091922007%\"\u003e\n \u003cp\u003e0.29 (0.01)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.573816155988858%\"\u003e\n \u003cp\u003e0.018 (0.001)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.802228412256266%\"\u003e\n \u003cp\u003e0.07 (0.01)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.030640668523677%\"\u003e\n \u003cp\u003e1.07 (0.02)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.534818941504179%\"\u003e\n \u003cp\u003eKO-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.041782729805014%\"\u003e\n \u003cp\u003eND\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.016713091922007%\"\u003e\n \u003cp\u003e0.37 (0.01) * \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.573816155988858%\"\u003e\n \u003cp\u003eND\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.802228412256266%\"\u003e\n \u003cp\u003e0.30 (0.02) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.030640668523677%\"\u003e\n \u003cp\u003e0.98 (0.02) * \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.534818941504179%\"\u003e\n \u003cp\u003eKO-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.041782729805014%\"\u003e\n \u003cp\u003eND\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.016713091922007%\"\u003e\n \u003cp\u003e0.39 (0.01) \u0026nbsp; \u0026nbsp; * \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.573816155988858%\"\u003e\n \u003cp\u003eND\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.802228412256266%\"\u003e\n \u003cp\u003e0.29 (0.01) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.030640668523677%\"\u003e\n \u003cp\u003e0.97 (0.03) * \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.534818941504179%\"\u003e\n \u003cp\u003eKO-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.041782729805014%\"\u003e\n \u003cp\u003eND\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.016713091922007%\"\u003e\n \u003cp\u003e0.36 (0.02) * \u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.573816155988858%\"\u003e\n \u003cp\u003eND\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.802228412256266%\"\u003e\n \u003cp\u003e0.28 (0.01) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.030640668523677%\"\u003e\n \u003cp\u003e0.93 (0.02) ** \u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003eTotal aldehydes = DHLNL + HLNL + 2 \u0026times;\u0026nbsp;Pyr + 2 \u0026times; HHMD. Values represent mean moles/mole collagen \u0026plusmn; S.D. (n=3) of triplicate analysis of the hydrolysates. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO, respectively. DHLNL, dihydroxylysinonorleucine; HLNL, hydroxylysinonorleucine; HHMD, histidinohydroxymerodesmosine; Pyr, pyridinoline; MC, MC3T3-E1; EV, empty vector; KO, knock-out.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 6. Solubility of collagen from MC, EV and KO clones.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe numbers represent percentage of total collagen sequentially extracted with 0.5 M acetic acid and pepsin, and final residues.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003eMC (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003eEV (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003eKO-1 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003eKO-2 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003eKO-3 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.8953488372093%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003eAcetic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003e3.5 (0.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003e2.7 (0.1)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e37.1 (0.2) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e37.7 (0.3) ***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e32.1 (0.1) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.8953488372093%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003ePepsin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003e30.3 (0.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003e25.0 (0.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e53.7 (0.1) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e54.1 (0.3) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e61.6 (0.1) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.8953488372093%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"12.5%\"\u003e\n \u003cp\u003eResidue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003e66.2 (0.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.755813953488373%\"\u003e\n \u003cp\u003e72.4 (0.4)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e9.2 (0.1) ***\u003csup\u003e\u0026nbsp;###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e8.2 (0.0) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.69767441860465%\"\u003e\n \u003cp\u003e6.3 (0.1) *** \u003csup\u003e###\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.8953488372093%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003eValues represent mean \u0026plusmn; S.D. (n=3) of triplicate analysis of collagen from MC, EC, and KO clones.\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between MC and KO; \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 between EV and KO,\u0026nbsp;respectively. MC, MC3T3-E1; EV, empty vector; KO,\u0026nbsp;knock-out.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-1390058/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1390058/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLysyl hydroxylase 2 (LH2) is a member of LH family that catalyzes the hydroxylation of lysine (Lys) residues on collagen, and this particular isozyme has been implicated in various diseases. While its function as a telopeptidyl LH is generally accepted, several fundamental questions remain unanswered: 1, Does LH2 catalyze the hydroxylation of all telopeptidyl Lys residues of collagen? 2, Is LH2 involved in the helical Lys hydroxylation? 3, what are the functional consequences when LH2 is completely absent? To answer these questions, we generated LH2-null MC3T3 cells (LH2KO), and extensively characterized the type I collagen phenotypes in comparison with controls. Cross-link analysis demonstrated that the hydroxylysine-aldehyde (Hyl\u003csup\u003eald\u003c/sup\u003e)-derived cross-links were completely absent from LH2KO collagen with concomitant increases in the Lys\u003csup\u003eald\u003c/sup\u003e-derived cross-links. Mass spectrometric analysis revealed that, in LH2KO type I collagen, telopeptidyl Lys hydroxylation was completely abolished at all sites while helical Lys hydroxylation was slightly diminished in a site-specific manner. Moreover, di-glycosylated Hyl was diminished at the expense of mono-glycosylated Hyl. LH2KO collagen was highly soluble and digestible, fibril diameters were diminished, and mineralization impaired when compared to controls. Together, these data underscore the critical role of LH2-catalyzed collagen modifications in collagen stability, organization and mineralization.\u003c/p\u003e","manuscriptTitle":"Lysyl hydroxylase 2 mediated collagen post-translational modifications and functional outcomes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-03-03 15:34:49","doi":"10.21203/rs.3.rs-1390058/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-04-06T04:59:47+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-03-09T13:42:16+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8d27be23-a1c1-416f-9295-3222ace45905","date":"2022-03-08T14:00:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-03-02T11:13:53+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-03-02T11:06:42+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2022-03-02T10:52:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-03-02T10:50:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2022-02-23T19:31:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"329f9e3b-44cf-434a-906b-ba67ad45feb0","owner":[],"postedDate":"March 3rd, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-08-05T13:29:37+00:00","versionOfRecord":[],"versionCreatedAt":"2022-03-03 15:34:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1390058","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1390058","identity":"rs-1390058","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.