A guide to selecting high-performing antibodies for... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/14-1137" }, "headline": "A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot,...", "datePublished": "2025-10-17T16:08:51", "dateModified": "2025-10-17T16:08:51", "author": [ { "@type": "Person", "name": "Vera Ruíz Moleón" }, { "@type": "Person", "name": "Riham Ayoubi" }, { "@type": "Person", "name": "Charles Alende" }, { "@type": "Person", "name": "Maryam Fothouhi" }, { "@type": "Person", "name": "Joel Ryan" }, { "@type": "Person", "name": "Sara González Bolívar" }, { "@type": "Person", "name": "Donovan Worrall" }, { "@type": "Person", "name": "Thomas M Durcan" }, { "@type": "Person", "name": "Claire M Brown" }, { "@type": "Person", "name": "Vincent Francis" }, { "@type": "Person", "name": "Peter S. McPherson" }, { "@type": "Person", "name": "Carl Laflamme" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Optineurin (OPTN) is a multifunctional cytoplasmic adaptor protein implicated in maintaining neuronal homeostasis through its roles in selective autophagy, vesicle trafficking, and regulation of inflammatory signaling. Mutations in the OPTN gene are causally linked to several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and primary open-angle glaucoma. Here we have eight optineurin commercial antibodies for western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. These studies are part of a larger, collaborative initiative seeking to address antibody reproducibility issues by characterizing commercially available antibodies for human proteins and publishing the results openly as a resource for the scientific community. While the use of antibodies and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific needs." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/14-1137/v1", "name": "A guide to selecting high-performing antibodies for Optineurin (UniProt..." } } ] } Home Browse A guide to selecting high-performing antibodies for Optineurin (UniProt... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Moleón VR, Ayoubi R, Alende C et al. A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.12688/f1000research.169966.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Data Note A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] Vera Ruíz Moleón https://orcid.org/0000-0003-3728-3158 1 , Riham Ayoubi 1 , Charles Alende https://orcid.org/0009-0005-4611-6134 1 , [...] Maryam Fothouhi 1 , Joel Ryan 2 , Sara González Bolívar https://orcid.org/0000-0002-4299-8281 1 , Donovan Worrall https://orcid.org/0000-0001-5676-5473 1 , Thomas M Durcan 1 , Claire M Brown 2 , Vincent Francis https://orcid.org/0009-0000-7535-8718 1 , Peter S. McPherson 1 , Carl Laflamme https://orcid.org/0000-0001-5906-025X 1 Vera Ruíz Moleón https://orcid.org/0000-0003-3728-3158 1 , Riham Ayoubi 1 , [...] Charles Alende https://orcid.org/0009-0005-4611-6134 1 , Maryam Fothouhi 1 , Joel Ryan 2 , Sara González Bolívar https://orcid.org/0000-0002-4299-8281 1 , Donovan Worrall https://orcid.org/0000-0001-5676-5473 1 , Thomas M Durcan 1 , Claire M Brown 2 , Vincent Francis https://orcid.org/0009-0000-7535-8718 1 , Peter S. McPherson 1 , Carl Laflamme https://orcid.org/0000-0001-5906-025X 1 PUBLISHED 17 Oct 2025 Author details Author details 1 Neuroscience and Neurosurgery, McGill University, Montreal, Québec, Canada 2 Advanced BioImaging Facility, McGill University, Montreal, Québec, Canada Vera Ruíz Moleón Roles: Investigation Riham Ayoubi Roles: Investigation, Supervision, Writing – Original Draft Preparation Charles Alende Roles: Investigation Maryam Fothouhi Roles: Investigation Joel Ryan Roles: Investigation Sara González Bolívar Roles: Investigation Donovan Worrall Roles: Investigation Thomas M Durcan Roles: Investigation Claire M Brown Roles: Investigation Vincent Francis Roles: Writing – Review & Editing Peter S. McPherson Roles: Funding Acquisition, Supervision Carl Laflamme Roles: Conceptualization, Funding Acquisition, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the YCharOS (Antibody Characterization through Open Science) gateway. Abstract Optineurin (OPTN) is a multifunctional cytoplasmic adaptor protein implicated in maintaining neuronal homeostasis through its roles in selective autophagy, vesicle trafficking, and regulation of inflammatory signaling. Mutations in the OPTN gene are causally linked to several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and primary open-angle glaucoma. Here we have eight optineurin commercial antibodies for western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. These studies are part of a larger, collaborative initiative seeking to address antibody reproducibility issues by characterizing commercially available antibodies for human proteins and publishing the results openly as a resource for the scientific community. While the use of antibodies and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific needs. READ ALL READ LESS Keywords Q96CV9, OPTN, optineurin, antibody characterization, antibody validation, western blot, immunoprecipitation, immunofluorescence Corresponding Author(s) Carl Laflamme ( [email protected] ) Close Corresponding author: Carl Laflamme Competing interests: For this project, the authors developed partnerships with leading antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to this project at no cost. These partners include: Abcam, ABCD antibodies, ABclonal, Addgene, Aviva Systems Biology, BioTechne, Cell Signaling Technology, Developmental Studies Hybridoma Bank, GeneTex, Horizon Discovery, Institute for Protein Innovation, MilliporeSigma, Proteintech, Synaptic Systems, Thermo Fisher Scientific. Grant information: This work was supported in part by a grant from the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP was created as a public-private partnership by three leading ALS charities: the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. This work was also supported by the Government of Canada through Genome Canada, Genome Quebec, and Ontario Genomics (grant no. OGI-210). RA is supported by a Mitacs fellowship. This work was supported by the CQDM (by a grant from the Ministère de l’Économie, de l’Innovation et de l’Énergie du Québec). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2025 Moleón VR et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Moleón VR, Ayoubi R, Alende C et al. A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.12688/f1000research.169966.1 ) First published: 17 Oct 2025, 14 :1137 ( https://doi.org/10.12688/f1000research.169966.1 ) Latest published: 17 Oct 2025, 14 :1137 ( https://doi.org/10.12688/f1000research.169966.1 ) Introduction Optineurin (OPTN) is a multifunctional cytoplasmic adaptor protein implicated in maintaining neuronal homeostasis through its roles in selective autophagy, vesicle trafficking, and regulation of inflammatory signaling. 1 Mutations in the OPTN gene are causally linked to several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and primary open-angle glaucoma. 2 In the nervous system, OPTN functions as a selective autophagy receptor, mediating the clearance of damaged mitochondria and protein aggregates by interacting with LC3 and ubiquitinated substrates. 3 It also suppresses NF-κB signaling by sequestering polyubiquitin chains, thereby dampening neuroinflammation. 4 Loss-of-function or pathogenic mutations in OPTN disrupt these critical pathways, leading to protein accumulation, mitochondrial dysfunction, and chronic inflammatory responses that contribute to neuronal death. 5 Moreover, OPTN interacts with kinases such as TBK1, further linking it to the regulation of innate immune signaling in neurons and glial cells. 6 These findings highlight OPTN as a central node in neurodegenerative pathophysiology, making it a promising target for therapeutic intervention in diseases marked by impaired proteostasis and neuroinflammation. This research is part of a broader collaborative initiative in which academics, funders and commercial antibody manufacturers are working together to address antibody reproducibility issues by characterizing commercial antibodies for human proteins using standardized protocols, and openly sharing the data. 7 It consists of identifying human cell lines with adequate target protein expression and the development/contribution of equivalent knockout (KO) cell lines, followed by antibody characterization procedures using most commercially available renewable antibodies against the corresponding protein. 7 Here we characterized commercial optineurin antibodies, selected and donated by participant antibody manufacturers, for use in western blot, immunoprecipitation, and immunofluorescence (also referred to as immunocytochemistry), enabling biochemical and cellular assessment of optineurin properties and function. The platform for antibody characterization used to carry out this study was endorsed by a committee of industry academic representatives. The standardized consensus antibody characterization protocols are openly available on Protocol Exchange. 7 The authors do not engage in result analysis or offer explicit antibody recommendations. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Guidelines on how to interpret antibody characterization data found in this study are featured on the YCharOS gateway 8 and in Table 4 of this data note. 7 Table 1. Summary of the cell lines used. Institution Catalog number RRID (Cellosaurus) Cell line Genotype ATCC HTB-96 CVCL_0042 U2OS WT Montreal Neurological Institute - CVCL_A6LN U2OS OPTN KO Table 2. Summary of the optineurin antibodies tested. Company Catalog number Lot number RRID (Antibody Registry) Clonality Clone ID Host Concentration (μg/μl) Vendors recommended applications Abcam ab213556 ** 1028905-1 AB_2890221 recombinantmono EPR20654 rabbit 0.5 Wb,IP Abcam ab242146 ** GR108770-5 AB_2890222 recombinantmono EPR23059124 rabbit 0.5 Wb Bio-Techne NBP3-19900 ** 230464 AB_3073768 recombinantmono S01-2C5 rabbit 0.3 Wb Cell Signaling Technology 70928 ** 1 AB_3073769 recombinantmono E4P8C rabbit 0.2 Wb,IP,IF Proteintech 60293-1-Ig * 10001751 AB_2881408 monoclonal 6C1H4 mouse 1.7 Wb,IF Structural Genomics Consortium Z-OPTN-10 ** , a YSOPTNA-c001 - recombinantmono YSOPTNA-c001 human 1.0 IP Thermo Fisher Scientific 702766 ** 2248017 AB_2723432 recombinantmono 22H12L20 rabbit 0.5 Wb,IF Thermo Fisher Scientific 711879 ** 2226080 AB_2723433 Recombinantpoly - rabbit 0.5 Wb,IF ** = recombinant antibody. * = monoclonal antibody, NA = not available. Table 3. Table of secondary antibodies used. Company Secondary antibody Catalog number RRID (Antibody Registry) Clonality Concentration (μg/μL) Working concentration (μg/mL) Proteintech HRP-Goat Anti-Rabbit Antibody (H+L) RGAR001 AB_3073505 recombinant polyclonal 1.0 0.05 Proteintech HRP-Goat Anti-Mouse Antibody (H+L) RGAM001 AB_3068333 recombinant polyclonal 1.0 0.5 Cell Signaling Technology Protein A, HRP conjugate 12291 NA polyclonal 0.125 0.5 Millipore Sigma Peroxidase-conjugated monoclonal anti-Flag M2 A8592 AB_439702 monoclonal 1.1 0.5 Millipore Sigma Cy3-conjugated monoclonal anti-Flag M2 A9594 AB_439700 monoclonal 1.1 0.5 Thermo Fisher Scientific Alexa Fluor™ 555-Goat anti-Rabbit IgG (H+L) A-21429 AB_2535850 polyclonal 2.0 0.5 Thermo Fisher Scientific Alexa Fluor™ 555-Goat anti-Mouse IgG (H+L) A-21424 AB_141780 polyclonal 2.0 0.5 Table 4. Illustrations to assess antibody performance in all western blot, immunoprecipitation and immunofluorescence. Western blot Immunoprecipitation Immunofluorescence Results and discussion Our standard protocol involves comparing readouts from wild type (WT) and KO cell lines. 9 , 10 The first step was to identify a cell line(s) that expresses sufficient levels of a given protein to generate a measurable signal using antibodies. To this end, we examined the DepMap (Cancer Dependency Map Portal, RRID:SCR_017655) transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log 2 (transcripts per million “TPM” + 1), which we have found to be a suitable cut-off. 11 U2OS expresses the protein optineuron transcript at 0.89 log 2 TPM+1 and was identified as a suitable cell line and was modified with CRISPR/Cas9 to KO the corresponding OPTN gene ( Table 1 ). To screen all eight antibodies by western blot, U2OS WT and OPTN KO protein lysates were ran on SDS-PAGE, transferred onto nitrocellulose membranes, and then probed with eight antibodies in parallel ( Figure 1 ). Figure 1. optineurin antibody screening by western blot. Lysates of U2OS WT and OPTN KO were prepared, and 35 μg of protein were processed for western blot with the indicated optineurin antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the 4-20% Tris-Glycine polyacrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Antibody dilutions used: ab213556** at 1/5000, ab242146** at 1/1000, NBP3-19900** at 1/1000, 70928** at 1/1000, 60293-1-Ig* at 1/5000, Z-OPTN-10** at 1/1000, 702766** at 1/200, 711879** at 1/5000, were titrated as the signal was too weak or too strong when following the supplier’s recommendations. Predicted band size: 66 kDa. ** = recombinant antibody, * = monoclonal antibody. We then assessed the capability of all eight antibodies to capture optineurin from U2OS protein extracts using immunoprecipitation techniques, followed by western blot analysis. For the immunoblot step, a specific optineurin antibody identified previously (refer to Figure 1 ) was selected. Equal amounts of the starting material (SM) and the unbound fractions (UB), as well as the whole immunoprecipitate (IP) eluates were separated by SDS-PAGE ( Figure 2 ). Figure 2. optineurin antibody screening by immunoprecipitation. U2OS lysates were prepared, and immunoprecipitation was performed using 1 mg of lysate and 2.0 μg of the indicated optineurin antibodies pre-coupled to Dynabeads protein A or protein G or Flag-M2 magnetic beads. Samples were washed and processed for western blot with the optineurin antibody ab242146** used at 1/1000. The Ponceau stained transfers of each blot are shown. SM = 4% starting material; UB = 4% unbound fraction; IP = immunoprecipitate, HC = antibody heavy chain, LC = antibody light chain. ** = recombinant antibody, * = monoclonal antibody. For immunofluorescence, eight antibodies were screened using a mosaic strategy. First, U2OS WT and OPTN KO cells were labelled with different fluorescent dyes in order to distinguish the two cell lines, and the optineurin antibodies were evaluated. Both WT and KO lines imaged in the same field of view to reduce staining, imaging and image analysis bias ( Figure 3 ). Quantification of immunofluorescence intensity in hundreds of WT and KO cells was performed for each antibody tested, and the images presented in Figure 3 are representative of this analysis. 7 Figure 3. optineurin antibody screening by immunofluorescence. U2OS WT and OPTN KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated optineurin antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of the blue and red (grayscale) channels are shown. WT and KO cells are outlined with green and magenta dashed line, respectively. When an antibody was recommended for immunofluorescence by the supplier, we tested it at the recommended dilution. The rest of the antibodies were tested at 1 and 2 μg/ml, and the final concentration was selected based on the detection range of the microscope used and a quantitative analysis not shown here. Antibody dilutions used: Antibody dilution used: ab213556** at 1/500, ab242146** at 1/1000, NBP3-19900** at 1/300, 70928** at 1/400, 60293-1-Ig* at 1/1500, Z-OPTN-10** at 1/1500, 702766** at 1/500, 711879** at 1/250. Bars = 10 μm. ** = recombinant antibody, * = monoclonal antibody. In conclusion, we have screened eight optineurin commercial antibodies by western blot, immunoprecipitation, and immunofluorescence by comparing the signal produced by the antibodies in human U2OS WT and OPTN KO cells. To assist users in interpreting antibody performanyce, Table 4 outlines various scenarios in which antibodies may perform in all three applications. 11 High-quality and renewable antibodies that successfully detect optineurin were identified in all applications. Researchers who wish to study optineurin in a different species are encouraged to select high-quality antibodies, based on the results of this study, and investigate the predicted species reactivity of the manufacturer before extending their research. Limitations Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available optineurin antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners. We encourage readers to consult vendor documentation to identify the specific antigen each antibody is raised against, where such information is available. Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in oprineurin, only a brief overview of the protein’s function and its relevance in disease is provided. Optineurin experts are invited to analyze and interpret observed banding patterns in western blots and subcellular localization in immunofluorescence. Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. Moreover, the same antibody clones are donated by 2-3 manufacturers (cross-licensed antibodies), effectively serving as replicates and enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat. Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines. Method The standardized protocols used to carry out this KO cell line-based antibody characterization platform was established and approved by a collaborative group of academics, industry researchers and antibody manufacturers. The detailed materials and step-by-step protocols used to characterize antibodies in western blot, immunoprecipitation and immunofluorescence are openly available on Protocols.io ( protocols.io/view/a-consensus-platform-for-antibody-characterization ). 7 Brief descriptions of the experimental setup used to carry out this study can be found below. Cell lines and antibodies The cell lines, primary and secondary antibodies used in this study are listed in Table 1 , 2 , and 3 , respectively. To ensure consistency with manufacturer recommendations and account for proprietary formulations (where antibody concentrations are not disclosed), antibody usage is reported as dilution ratios rather than absolute concentrations. To facilitate proper citation and unambiguous identification, all cell lines and antibodies are referenced with their corresponding Research Resource Identifiers (RRIDs). 12 , 13 U2OS KO clone corresponding to the OPTN was generated with low passage cells at Source. Two guide RNAs were used to induce a stop codon in the U2OS gene (sequence guide 1: CUAAAUAAUCAAGCCAUGAA, sequence guide 2: GAGAAAUUGAAGGAAGAGCU). All cell lines used in this study were regularly tested for mycoplasma contamination and were confirmed to be mycoplasma-free. Antibody screening by western blot U2OS WT and OPTN KO cells were collected in RIPA buffer (25 mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo Fisher Scientific, cat. number 89901) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used. Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels (Thermo Fisher Scientific, cat. number WXP42012BOX) ran with Tris/Glycine/SDS buffer (Bio-Rad, cat. number 1610772), loaded in Laemmli loading sample buffer (Thermo Fisher Scientific, cat. number AAJ61337AD) and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4°C with 5% milk in TBS with 0,1% Tween 20 (TBST) (Cell Signalling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with iBright™ CL1500 Imaging System (Thermo Fisher Scientific, cat. number A44240). Antibody screening by immunoprecipitation Antibody-bead conjugates were prepared by adding 2 μg to 500 μl of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a microcentrifuge tube, together with 30 μl of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse and rat goat antibodies) (Thermo Fisher Scientific, cat. number 10002D and 10004D, respectively) or anti-Flag M2 magnetic beads (MilliporeSigma, cat. number M8823). Tubes were rocked for ~1 h at 4°C followed by two washes to remove unbound antibodies. U2OS WT lysates were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 x g for 15 min at 4°C. 0.5 ml aliquots at 1 mg/ml of lysate were incubated with an antibody-bead conjugate for ~1 h at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of IP buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Protein A: HRP was used as a secondary detection system at a concentration of 2.0 μg/ml. Antibody screening by immunofluorescence U2OS WT and OPTN KO cells were labelled with a green and a far-red fluorescence dye, respectively (Thermo Fisher Scientific, cat. number C2925 and C34565). The nuclei were labelled with DAPI (Thermo Fisher Scientific, cat. Number D3571) fluorescent stain. WT and KO cells were plated on 96-well plate with optically clear flat-bottom (Perkin Elmer, cat. number 6055300) as a mosaic and incubated for 24 hrs in a cell culture incubator at 37 o C, 5% CO 2 . Cells were fixed in 4% paraformaldehyde (PFA) (VWR, cat. number 100503-917) in phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL). Cells were permeabilized in PBS with 0,1% Triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary optineurin antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS. Images were acquired on an ImageXpress micro confocal high-content microscopy system (Molecular Devices), using a 20x NA 0.95 water immersion objective and scientific CMOS cameras, equipped with 395, 475, 555 and 635 nm solid state LED lights (lumencor Aura III light engine) and bandpass filters to excite DAPI, Cellmask Green, Alexa-555 and Cellmask Red, respectively. Images had pixel sizes of 0.68 x 0.68 microns, and a z-interval of 4 microns. For analysis and visualization, shading correction (shade only) was carried out for all images. Then, maximum intensity projections were generated using 3 z-slices. Segmentation was carried out separately on maximum intensity projections of Cellmask channels using CellPose 1.0, and masks were used to generate outlines and for intensity quantification. 14 Figures were assembled with Adobe Illustrator. Data availability Underlying data Zenodo: Dataset for the optineurin antibody screening study https://doi.org/10.5281/zenodo.7776013 . Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgment We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and KO cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources, and collaboration. Members of the group can be found below. We would also like to thank the Advanced BioImaging Facility (ABIF) consortium for their image analysis pipeline development and conduction (RRID:SCR_017697). Members of each group can be found below. NeuroSGC/YCharOS/EDDU collaborative group: Thomas M. Durcan, Aled M. Edwards, Peter S. McPherson, Chetan Raina and Wolfgang Reintsch. ABIF consortium: Claire M. Brown and Joel Ryan. Thank you to the Structural Genomics Consortium, a registered charity (no. 1097737), for your support on this project. The Structural Genomics Consortium receives funding from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. References 1. Ryan TA, Tumbarello DA: Optineurin: A Coordinator of Membrane-Associated Cargo Trafficking and Autophagy. Front. Immunol. 2018; 9 : 1024. PubMed Abstract | Publisher Full Text | Free Full Text 2. Guo Q, Wang J, Weng Q: The diverse role of optineurin in pathogenesis of disease. Biochem. Pharmacol. 2020; 180 : 114157. PubMed Abstract | Publisher Full Text 3. Qiu Y, Wang J, Li H, et al. : Emerging views of OPTN (optineurin) function in the autophagic process associated with disease. Autophagy. 2022; 18 (1): 73–85. PubMed Abstract | Publisher Full Text | Free Full Text 4. Zhao S, Chen R, An Y, et al. : Optineurin overexpression ameliorates neurodegeneration through regulating neuroinflammation and mitochondrial quality in a murine model of amyotrophic lateral sclerosis. Front. Aging Neurosci. 2025; 17 : 1522073. PubMed Abstract | Publisher Full Text | Free Full Text 5. Feng SM, Che CH, Feng SY, et al. : Novel mutation in optineurin causing aggressive ALS+/-frontotemporal dementia. Ann. Clin. Transl. Neurol. 2019; 6 (12): 2377–2383. PubMed Abstract | Publisher Full Text | Free Full Text 6. Li F, Xie X, Wang Y, et al. : Structural insights into the interaction and disease mechanism of neurodegenerative disease-associated optineurin and TBK1 proteins. Nat. Commun. 2016; 7 : 12708. PubMed Abstract | Publisher Full Text | Free Full Text 7. Ayoubi R, Ryan J, Gonzalez Bolivar S, et al. : A consensus platform for antibody characterization. Nat. Protoc. 2024. 8. Biddle MS, Virk HS: YCharOS open antibody characterisation data: Lessons learned and progress made. F1000Res. 2023; 12 : 1344. PubMed Abstract | Publisher Full Text | Free Full Text 9. Laflamme C, McKeever PM, Kumar R, et al. : Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8 : 8. Publisher Full Text 10. Alshafie W, Fotouhi M, Shlaifer I, et al. : Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11 : 977. Publisher Full Text 11. Ayoubi R, Ryan J, Biddle MS, et al. : Scaling of an antibody validation procedure enables quantification of antibody performance in major research applications. elife. 2023; 12 : 12. Publisher Full Text 12. Bandrowski A, Pairish M, Eckmann P, et al. : The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51 (D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text 13. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29 (2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text 14. Stringer C, Wang T, Michaelos M, et al. : Cellpose: a generalist algorithm for cellular segmentation. Nat. Methods. 2021; 18 (1): 100–106. PubMed Abstract | Publisher Full Text Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 17 Oct 2025 ADD YOUR COMMENT Comment Author details Author details 1 Neuroscience and Neurosurgery, McGill University, Montreal, Québec, Canada 2 Advanced BioImaging Facility, McGill University, Montreal, Québec, Canada Vera Ruíz Moleón Roles: Investigation Riham Ayoubi Roles: Investigation, Supervision, Writing – Original Draft Preparation Charles Alende Roles: Investigation Maryam Fothouhi Roles: Investigation Joel Ryan Roles: Investigation Sara González Bolívar Roles: Investigation Donovan Worrall Roles: Investigation Thomas M Durcan Roles: Investigation Claire M Brown Roles: Investigation Vincent Francis Roles: Writing – Review & Editing Peter S. McPherson Roles: Funding Acquisition, Supervision Carl Laflamme Roles: Conceptualization, Funding Acquisition, Writing – Review & Editing Competing interests For this project, the authors developed partnerships with leading antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to this project at no cost. These partners include: Abcam, ABCD antibodies, ABclonal, Addgene, Aviva Systems Biology, BioTechne, Cell Signaling Technology, Developmental Studies Hybridoma Bank, GeneTex, Horizon Discovery, Institute for Protein Innovation, MilliporeSigma, Proteintech, Synaptic Systems, Thermo Fisher Scientific. Grant information This work was supported in part by a grant from the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP was created as a public-private partnership by three leading ALS charities: the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. This work was also supported by the Government of Canada through Genome Canada, Genome Quebec, and Ontario Genomics (grant no. OGI-210). RA is supported by a Mitacs fellowship. This work was supported by the CQDM (by a grant from the Ministère de l’Économie, de l’Innovation et de l’Énergie du Québec). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (1) version 1 Published: 17 Oct 2025, 14:1137 https://doi.org/10.12688/f1000research.169966.1 Copyright © 2025 Moleón VR et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Moleón VR, Ayoubi R, Alende C et al. A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.12688/f1000research.169966.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 17 Oct 2025 Views 0 Cite How to cite this report: Buchanan A. Reviewer Report For: A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.5256/f1000research.187366.r425570 ) The direct URL for this report is: https://f1000research.com/articles/14-1137/v1#referee-response-425570 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 17 Feb 2026 Andrew Buchanan , AstraZeneca, Cambridge, UK; Stealth Biotech, Cambridge, Cambridgeshire, UK Approved VIEWS 0 https://doi.org/10.5256/f1000research.187366.r425570 This is a clear and well set put example of antibody quality control for a range of experiments. The data is straight forward to interpret from the figures and tables. This enables the reader to have a well informed choice ... Continue reading READ ALL This is a clear and well set put example of antibody quality control for a range of experiments. The data is straight forward to interpret from the figures and tables. This enables the reader to have a well informed choice of what antibody to take into their experimental setting for further validation. A minor point is that for DepMap the authors say > 2.5 log2 is a suitable cut-off, but they choose U2OS with 0.89 log2 TPM+1. However there was enough protein expression for the validation work. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Therapeutic antibody discovery and early development I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Buchanan A. Reviewer Report For: A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.5256/f1000research.187366.r425570 ) The direct URL for this report is: https://f1000research.com/articles/14-1137/v1#referee-response-425570 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Moshinsky D. Reviewer Report For: A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.5256/f1000research.187366.r440395 ) The direct URL for this report is: https://f1000research.com/articles/14-1137/v1#referee-response-440395 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 30 Dec 2025 Deborah Moshinsky , Institute for Protein Innovation, Boston, Massachusetts, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.187366.r440395 The authors tested 8 commercially available antibodies against optineurin (OPTN) for activity in Western Blot, Immunoprecipitation, and Immunofluorescence as part of a larger ongoing effort to address antibody reproducibility issues in Science. They first made knockout cells using a cell ... Continue reading READ ALL The authors tested 8 commercially available antibodies against optineurin (OPTN) for activity in Western Blot, Immunoprecipitation, and Immunofluorescence as part of a larger ongoing effort to address antibody reproducibility issues in Science. They first made knockout cells using a cell line that was shown to express the target. Then they ran bespoke assays using each of the 8 antibodies. Results were shown clearly. The authors describe briefly why they do not engage in result interpretation but did provide general guidance on interpreting data in their assays. Readers can surmise from the data which antibodies should work well in their applications of choice. For the choice of cell line, it is stated that cell lines that express the target at levels greater than 2.5 log 2 (transcripts per million “TPM” + 1) have been found to be a suitable cut-off. However, U2OS expresses the protein optineuron transcript at less than 2.5 (0.89 log 2 TPM+1). Please explain or note that this is an outlier. Also, as minor points 2 typos were identified in the article. "performanyce" is present in the paragraph starting with 'In conclusion' after Figure 3. Also, in the abstract, the word 'tested' is missing from the sentence, "Here we have eight optineurin commercial antibodies for western blot..." Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Antibody characterization and validation I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Moshinsky D. Reviewer Report For: A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.5256/f1000research.187366.r440395 ) The direct URL for this report is: https://f1000research.com/articles/14-1137/v1#referee-response-440395 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 17 Oct 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 1 17 Oct 25 read read Deborah Moshinsky , Institute for Protein Innovation, Boston, USA Andrew Buchanan , AstraZeneca, Cambridge, UK; Stealth Biotech, Cambridge, UK Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Buchanan A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 17 Feb 2026 | for Version 1 Andrew Buchanan , AstraZeneca, Cambridge, UK; Stealth Biotech, Cambridge, Cambridgeshire, UK 0 Views copyright © 2026 Buchanan A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This is a clear and well set put example of antibody quality control for a range of experiments. The data is straight forward to interpret from the figures and tables. This enables the reader to have a well informed choice of what antibody to take into their experimental setting for further validation. A minor point is that for DepMap the authors say > 2.5 log2 is a suitable cut-off, but they choose U2OS with 0.89 log2 TPM+1. However there was enough protein expression for the validation work. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Therapeutic antibody discovery and early development I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Buchanan A. Peer Review Report For: A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.5256/f1000research.187366.r425570) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1137/v1#referee-response-425570 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Moshinsky D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 30 Dec 2025 | for Version 1 Deborah Moshinsky , Institute for Protein Innovation, Boston, Massachusetts, USA 0 Views copyright © 2026 Moshinsky D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors tested 8 commercially available antibodies against optineurin (OPTN) for activity in Western Blot, Immunoprecipitation, and Immunofluorescence as part of a larger ongoing effort to address antibody reproducibility issues in Science. They first made knockout cells using a cell line that was shown to express the target. Then they ran bespoke assays using each of the 8 antibodies. Results were shown clearly. The authors describe briefly why they do not engage in result interpretation but did provide general guidance on interpreting data in their assays. Readers can surmise from the data which antibodies should work well in their applications of choice. For the choice of cell line, it is stated that cell lines that express the target at levels greater than 2.5 log 2 (transcripts per million “TPM” + 1) have been found to be a suitable cut-off. However, U2OS expresses the protein optineuron transcript at less than 2.5 (0.89 log 2 TPM+1). Please explain or note that this is an outlier. Also, as minor points 2 typos were identified in the article. "performanyce" is present in the paragraph starting with 'In conclusion' after Figure 3. Also, in the abstract, the word 'tested' is missing from the sentence, "Here we have eight optineurin commercial antibodies for western blot..." Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Antibody characterization and validation I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Moshinsky D. Peer Review Report For: A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved] . F1000Research 2025, 14 :1137 ( https://doi.org/10.5256/f1000research.187366.r440395) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1137/v1#referee-response-440395 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "A guide to selecting high-performing antibodies...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-1137/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/14-1137/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/14-1137/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Moleón VR et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-1137/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/14-1137", templates : { twitter : "A guide to selecting high-performing antibodies for Optineurin.... Moleón VR et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/14-1137/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/169966/187366") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "187366"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "444629": 0, "425570": 3, "425569": 0, "432431": 0, "440395": 5, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "124feb83-8339-4d3f-881b-d187e58e15d1"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.