Regeneration Potential of Mesenchymal Stem Cells in Cold Induced Burn Wounds

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-14

Human umbilical cord mesenchymal stem cells accelerated closure of cold-induced burn wounds in rats, promoting epidermal and dermal regeneration, neovascularization, and reduced inflammation.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text

The preprint investigated whether locally transplanted human umbilical cord mesenchymal stem cells (hUCMSCs), and their conditioned medium, improve regeneration in a rat cold-induced burn wound model, using fibroblast scratch assays, macroscopic wound closure measurements at days 1, 3, 7, and 14, and histology, immunohistochemistry, and time-dependent gene expression analyses. The hUCMSC-conditioned medium reduced scratch area in vitro, and in vivo hUCMSC transplantation markedly reduced wound area and promoted regenerated epidermis/dermis with restored hair follicles, alongside enhanced angiogenesis during later healing. Gene expression patterns showed reduced inflammatory cytokines and increased pro-angiogenic and remodeling cytokine expression at specific time points. A major limitation is that the work is a preprint that has not been peer reviewed, and it is confined to a rat model and pre-defined time points of wound healing phases. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Time-dependent initiation of wound healing phases and their associated healing mediators are crucial for injured skin regeneration. Mesenchymal stem cells (MSCs) secrete various paracrine factors which aid in wound healing via acceleration of cell migration, angiogenesis, tissue granulation, and modulation of inflammation at the wound site. Objective: This study was aimed to investigate thetherapeutic effect of human umbilical cord MSCs (hUCMSCs) in the regeneration of cold-induced burn wound model. Methods: hUCMSCs were characterized by immunocytochemistry and flow cytometry. Scratch assay was performed using rat skin fibroblasts treated with conditioned medium of hUCMSCs. An in vivo cold burn wound model was developed and hUCMSCs were locally transplanted. Macroscopic analysis of wound closure was done at days 1, 3, 7 and 14 corresponding to wound healing phases. Gene expression, histology and immunohistochemical analysis were performed to confirm complete wound repair. Results: We observed a significant reduction in the scratch area in the treated group as compared to the control. Wound area was remarkably reduced in the burn wound model transplanted with hUCMSCs well before the end of the experimental period (day 14). Histology showed intact collagen with regenerated epidermis, dermis and hair follicles, while immunohistochemistry showed enhanced angiogenesis in the last phase of healing in the treated group. Temporal gene expression showed significant reduction in inflammatory cytokines and upregulation of pro/angiogenic and remodeling cytokines at particular time points. Conclusion: It is concluded from this study that hUCMSCs accelerate wound closure with enhanced neovascularization and reduced inflammation in rat dermal wounds.
Full text 140,480 characters · extracted from preprint-html · click to expand
Regeneration Potential of Mesenchymal Stem Cells in Cold Induced Burn Wounds | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Regeneration Potential of Mesenchymal Stem Cells in Cold Induced Burn Wounds Fatima Jameel, Irfan Khan, Tuba Shakil Malick, Rida-e-Maria Qazi, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2546357/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Time-dependent initiation of wound healing phases and their associated healing mediators are crucial for injured skin regeneration. Mesenchymal stem cells (MSCs) secrete various paracrine factors which aid in wound healing via acceleration of cell migration, angiogenesis, tissue granulation, and modulation of inflammation at the wound site. Objective: This study was aimed to investigate thetherapeutic effect of human umbilical cord MSCs (hUCMSCs) in the regeneration of cold-induced burn wound model. Methods: hUCMSCs were characterized by immunocytochemistry and flow cytometry. Scratch assay was performed using rat skin fibroblasts treated with conditioned medium of hUCMSCs. An in vivo cold burn wound model was developed and hUCMSCs were locally transplanted. Macroscopic analysis of wound closure was done at days 1, 3, 7 and 14 corresponding to wound healing phases. Gene expression, histology and immunohistochemical analysis were performed to confirm complete wound repair. Results: We observed a significant reduction in the scratch area in the treated group as compared to the control. Wound area was remarkably reduced in the burn wound model transplanted with hUCMSCs well before the end of the experimental period (day 14). Histology showed intact collagen with regenerated epidermis, dermis and hair follicles, while immunohistochemistry showed enhanced angiogenesis in the last phase of healing in the treated group. Temporal gene expression showed significant reduction in inflammatory cytokines and upregulation of pro/angiogenic and remodeling cytokines at particular time points. Conclusion: It is concluded from this study that hUCMSCs accelerate wound closure with enhanced neovascularization and reduced inflammation in rat dermal wounds. Cold burn injury Scratch assay hUCMSCs Wound healing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Acute wound healing proceeds in well-organized overlapping phases and usually completes within 7 to 14 days [ 1 , 2 ]. Any collapse and alterations in these phases can disrupt the well-regulated healing process. The disruption in this mechanism may cause wounds to become more aggressive with impaired healing [ 1 , 3 ]. This impaired healing mostly occurs in the case of burn injuries which are considered the fourth most common type of injuries worldwide. These injuries are major clinical and public health concerns especially in low-income countries, which ultimately increase the financial burden on patients and hospitals [ 3 , 4 ]. Normally, burn wounds are classified as first, second (superficial), third and fourth (deep/extensive) degree wounds [ 5 ]. Extensive burn wounds are challenging to treat and sometimes do not heal completely [ 6 ]. There are many types of burn wounds; among them cold burn wounds are rare and uncommon, but they damage the structural and functional integrity of skin tissues [ 4 ]. They are broadly classified into acute (mild or superficial; heal within few weeks) and chronic (severe or deep; take time to heal) [ 7 ]. The local mechanism of cold burn injuries varies from prolonged exposure in a cold environment and sequentially categorized into the pre-freeze stage, freeze-thaw stage, vascular stasis, and progressive stage. These stages are based on the freezing rate, duration, and the extent of the injury [ 7 , 8 ]. The pathophysiology and healing process of these injuries are quite different from other burn injuries. Cold burn injuries directly cause cellular death by tissue freezing and form ice crystals within the cells [ 4 ]. Normally, skin loses its sensation at 10℃. With extended cooling or cold temperature of around 0℃ or less, the vascular and cellular contents become more viscous causing microvascular constriction and trans-endothelial plasma leakage. Tissue freezing disrupts the cellular integrity (cellular damages) due to the intracellular water crystallization (pre-freeze stage), narrowing of the blood vessels, platelet dysfunction (freeze-thaw stage), peripheral vasoconstriction, and thrombosis (vascular stasis), which leads to tissue hypoxia and necrosis (progressive stage) [ 4 , 7 , 8 ]. Understanding the mechanism of wound progression is crucial for burn care units to offer improved or appropriate treatment for cold burn wounds [ 8 ]. Several treatment options have been adopted, however, they have several limitations and drawbacks [ 6 ]. Stem cell therapy has emerged as a promising approach for chronic wounds including cold burns. hUCMSCs can be used in clinical applications for tissue regeneration and cutaneous wound healing [ 9 ]. They are known for having the characteristics of self-renewal, multipotent differentiation, and paracrine signaling [ 10 , 11 ]. Thus, they can regenerate the injured tissue with their direct or indirect effect. They migrate into the wound bed and contribute to the healing process via transdifferentiation into multiple skin cell types or appendages [ 11 , 12 ]. On the other hand, they can also promote wound healing by paracrine secretions. Paracrine signaling is the primary mechanism whereby the microenvironment of the burn wound can be enriched resulting in wound repair [ 10 , 11 ]. Locally transplanted MSCs create a favorable environment at the wound site by direct secretion of angiogenic and remodeling cytokines which aid in the healing process [ 12 , 13 , 14 ]. Similarly, conditioned medium contains the enriched growth factors secreted by stem cells under specific physiological conditions which are potentially used as wound healing mediators [ 15 ]. The use of enriched conditioned medium results in the indirect effect of stem cells in wound healing [ 16 ]. Considering the remarkable regenerative properties of hUCMSCs for wound repair, this study was conducted to evaluate their direct effect in vivo as well as indirect in vitro effect through the conditioned medium. In vitro wound regeneration and cell migration were analyzed in the presence of hUCMSC conditioned medium via scratch assay, while the effect of their local transplantation was analyzed in the in vivo rat wound model. The time points of the study were based on the corresponding wound healing phases activated through a regulated wound healing mechanism; hemostasis (clotting) / inflammation, cell proliferation (tissue granulation), and maturation (re-epithelization) [ 17 ]. The first phase (hemostasis/inflammation) begins instantly after an injury that includes narrowing of blood vessels, formation of fibrin clot, exudate formation, and infiltration of polymorphonucleocytes (PMNs) at the injured site [ 18 ]. Numerous inflammatory cytokines and growth factors including interleukins (IL-1β, IL-6), tumor necrosis factor alpha (TNF-α), transforming growth factor-beta (TGF-β), vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF) [ 17 , 18 ] are released which attract various cell types specifically neutrophils and monocytes through chemotaxis [ 19 ]. The inflammatory phase can last up to 3–6 days depending on the severity of the wound [ 2 , 17 ]. The proliferative phase activates with the migration of multiple skin cell types responsible for wound closure by the formation of granulation tissue, wound contraction, and restoration of new vasculature. This phase is important in wound healing and can last up to 6–14 days or several weeks [ 20 ]. Overlapping with the proliferation phase, maturation /remodeling phase is initiated which forms new connective tissues and dermal matrix [ 19 ]. In the first and last wound healing phases, interactions of cells with associated healing mediators are dominant, which progressively change the microenvironment of the wound away from an inflammatory phase towards the maturation phase [ 19 , 21 ]. 2. Materials And Methods 2.1. Chemicals/ reagents Chemicals and reagents utilized in this study are: Alexa fluor 488 secondary antibody (goat anti-mouse IgG) (A-11001, Invitrogen), Alexa fluor 546 goat anti-mouse secondary antibody (A-11003, Invitrogen), Alpha smooth muscle actin (α-SMA) (MA5-11547, Invitrogen), Bright green 2X qPCR master mix (G892, Applied Biological Materials Inc.), BSA (151429, MP Biomedical Inc.), CD29 (MAB-1981, Chemicon International), CD45 (CBL415, BD Pharminogen), CD73 (550256, Pharminogen), CD105 (MAB117, Sigma), cDNA kit (Fermentas, ThermoFisher Scientific), DAPI (157574, MP Biomedical Inc.), DMEM (11965-092, Gibco Life Technologies), DiI dye (2127433, Life Technologies Corporation), EDTA (600094, ThermoFisher Scientific), FBS (10438-026, Gibco Life Technologies), Hematoxylin & Eosin (H & E) (T.864.1, Carl-Roth), Isopropanol (64372, ThermoFisher Scientific), Ketamine hydrochloride (K2753-5G, Sigma), One-step RNA reagent (BS410A, Bio Basic), Paraformaldehyde (P087.1, Carl Roth), Penicillin/streptomycin (15140-122, Gibco Life Technologies), Sodium azide (30175, Serva), Sodium pyruvate (11360, Gibco Life Technologies), Triton X-100 (T8787, Sigma), Trypsin-EDTA (25200056, Gibco Life Technologies), Tween 20 (194724, MP Biomedical, Inc.), Vimentin (V6389, Sigma), Xylene (1330-20-7, ThermoFisher Scientific). 2.2. Study design This study was approved by the local Independent Ethical Committee (IEC) of the International Center for Chemical and Biological Sciences (ICCBS), University of Karachi (IEC/ ICCBS-036-HT-2018/Protocol/1.0) for the isolation of stem cells from human umbilical cord tissue. All animal experiments were performed according to the international guidelines for the care and use of laboratory animals and approved by the local institutional committee; Animal Study Protocol (ASP) Number 2020-010. Total n = 58 animals (Wistar male rats) were used for cold burn wound induction. Initially, n = 10 animals were used for the optimization of cold burn wound model, while the remaining animals were divided into two main groups (control and hUCMSC treated). Each group was further divided into four subgroups according to the wound healing phases. Group 1 (control) animals were exposed to the rod chilled with liquid nitrogen for 10 min. Group 2 animals were transplanted with hUCMSCs at the site of injury immediately after wound induction. Throughout the experimental period, general state of animals (wound lesion, body weight, exploratory behavior) was observed. After hUCMSC transplantation, macroscopic changes (edema and erythema formation, blistering, crust, tissue granulation, and re-epithelization) were observed. Histopathological, gene expression and immunohistochemical analyses were performed to observe the therapeutic potential of locally transplanted hUCMSCs at the specific wound healing phases. In vitro wound regeneration and cell migration were also observed as the indirect effect of hUCMSCs using their conditioned medium. Conditioned medium was obtained in a separate experiment when the scratch area of cultured hUCMSCs was completely filled following scratch induction. 2.3. Isolation of hUCMSCs Human umbilical cord tissues were obtained after caesarian section at the Zainab Panjwani Memorial Hospital with prior formal consent from donor parents. Each cord tissue (about 6–10 cm) was aseptically collected in a sterile bottle containing 1X phosphate buffered saline (PBS) and stored at 4℃ before processing. hUCMSCs were isolated using the protocol as described in our previous study [ 5 ]. Briefly, umbilical cord tissue was dissected into small pieces (about 2–3 mm). The explants (tissue pieces) were cultured in T-75 flasks containing Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), sodium pyruvate (1 mM), and antibiotics (100 units /mL penicillin and 100 µg/mL streptomycin). Culture flasks were incubated at 37℃ in a humidified atmosphere with 5% CO 2 . After 2–3 days, the exhausted medium was replaced with a fresh medium. hUCMSCs were identified by their ability to adhere to the plastic surface and by their spindle shape fibroblast like morphology. When cells reached confluence of about 70–80%, 1X trypsin-EDTA was added to detach the monolayered cells. The cells were subcultured to the next passage. Fresh medium was added after every 2–3 days. hUCMSCs of passage 2 (P2) were used in this study. 2.4. Characterization of hUCMSCs 2.4.1. Immunocytochemical analysis Immunocytochemical analysis was performed for the characterization of hUCMSCs as described in a previous study [ 18 ]. Briefly, cells were allowed to grow and adhere in a 24-well plate. Paraformaldehyde (4%) was added for 20 min to fix the cells. Triton X-100 (0.1%) was used for cell permeabilization. Blocking solution (2% BSA, 0.1% tween 20) was added to the cells for 1 h. Cells were then incubated overnight at 4°C with recommended dilutions of primary antibodies CD29, CD73, CD105, vimentin and CD45. Alexa fluor 546 goat anti-mouse secondary antibody was added to the cells at a dilution of 1:200 and incubated for 1 h at 37°C. Nuclei were stained with 0.5 µg/mL of diamidino-2-phenylindole (DAPI) and incubated for 10 min at room temperature. Cells were examined under a fluorescence microscope (TE2000 Nikon, Japan) at different magnifications. 2.4.2. Flow cytometric analysis Cell phenotyping was performed by flow cytometric analysis for the detection of specific cell surface markers. Confluent hUCMSCs were washed with PBS twice and detached by using cell dissociation buffer. Primary antibodies (CD73, CD105, vimentin and CD45) were added to the collected cells in the recommended dilutions and incubated at 37°C for 1 h. FACS solution (1% BSA, 1 mM EDTA, 0.1% sodium azide dissolved in PBS) was used for washing. Cells were labeled with Alexa fluor 546 goat anti-mouse secondary antibody at a dilution of 1:200 and analyzed by flow cytometer (FACS Celesta, Becton Dickinson). Unlabeled cells were used as negative control. 2.5. Preparation of conditioned medium To prepare conditioned medium, a scratch was introduced into the confluent monolayer of hUCMSCs with a sterile 200 µL tip. Cells were maintained using fresh DMEM at 37℃ for 72 h. The medium was then transferred to a sterile falcon tube and centrifuged at 1000 rpm for 8 min. The supernatant was then collected in a sterile microfuge tube and used as conditioned medium. 2.5.1. In vitro scratch assay Rat skin fibroblasts (CRL1213) obtained from the Biobank facility of the ICCBS, were used to develop in vitro wound. Cells were cultured in T-25 flasks with DMEM. The scratch was introduced in the confluent monolayer of fibroblasts with a 200 µL tip. After scratch induction, conditioned medium of hUCMSCs diluted with DMEM (3:1) was added to the treated group, while the control group was maintained with normal DMEM after scratch induction. Cells were then incubated at 37℃ for 48 h. Under the treatment of conditioned medium, fibroblast migration and healing potential were monitored at 24 and 48 h. 2.6. Animals Male Wistar rats weighing 180–250g and having average age of 2–3 months were used for the development of in vivo cold burn wound model. These rats were housed in the institutional animal resource facility and maintained at 24 ± 2ºC with a relative humidity of 55% ± 5% and 12 h light/dark cycle with access to food and water ad libitum. Animals were divided into two groups (control and treated burn wound). Each group was further divided into four subgroups according to the wound healing time points (days 1, 3, 7, and 14) with number of animals in each subgroup = 6 (Table 1). 2.6.1. Cold burn wound model Rats were weighed and anesthetized by intraperitoneal injection of ketamine hydrochloride and xylazine hydrochloride with optimized doses of 60 mg/kg and 7 mg/kg, respectively. Hair was removed from the dorsal surface, and skin was disinfected with 70% alcohol. A steel rod (1.5–2 cm in diameter) was used to produce a single consistent second-degree cold burn wound on the rat skin. Prior to wound induction, the rod was immersed in liquid nitrogen for 10–15 min, and placed on the skin surface for 10 seconds. After wound induction, diclofenac sodium (25 mg/mL) and antibiotics (penicillin and streptomycin 10,000 U/mL) were administered to the rats via subcutaneous injection in order to reduce pain and chances of infection, respectively. Wound tissues were harvested from the center of the lesion after euthanizing the animals by an overdose of sodium pentobarbital (200 mg/kg body weight) followed by cervical dislocation. 2.6.2. Cell tracking To track transplanted cells, DiI dye (5 µM) was used. hUCMSCs were trypsinized via 1X trypsin-EDTA. The cell pellet was washed twice with 1X PBS. Pellet was resuspended in the dye dissolved in serum free-DMEM and placed in the incubator for 7 min. Complete medium (serum containing DMEM) was then added to inhibit the reaction and cells were centrifuged at 1000 rpm for 8 min. The pellet was again washed twice and resuspended in 300 µL of PBS. 2.6.3. Transplantation of hUCMSCs When the skin temperature returned to normal body temperature (after 15 min), 1–1.5 million cells (resuspended in 300 µL of PBS) were subcutaneously injected. Cells were transplanted as a single dose at multiple peripheries of the wound. The area of wound closure was measured using sterile scale and calculated by the following formula; 2.6.4. Tissue harvesting Burn wound tissues were harvested from control and treated groups and investigated at days 1, 3, 7, and 14. Healing effect of a single dose of implanted cells was examined at the molecular level by temporal gene expression and histological analysis. 2.7. Temporal gene expression analysis Total RNA was isolated from the harvested tissues by using one-step RNA reagent. The concentration of total RNA was determined by measuring the absorbance at 260 nm. To synthesize cDNA, 1 µg of RNA was reverse transcribed via Revert aid first strand cDNA kit and amplified using bright green 2X qPCR master mix according to manufacturer’s instructions. Gene expression of corresponding cytokines (Table 2) was analyzed by quantitative real-time PCR (qPCR). Rat GAPDH gene was used as an internal housekeeping control and amplified along with the test genes. 2.8. Histological analysis Histological analysis of control and treated burn wound tissues was performed by staining the paraffin sections with hematoxylin & eosin (H & E) and Masson trichrome stains to examine the structural integrity, inflammation, collagen content, and epidermal regeneration after wound induction, as described in the previous studies [ 21 , 23 ]. Briefly, rats from all groups were sacrificed and their burn wound tissues were harvested at respective time points (days 1, 3, 7, 14). The harvested tissues were fixed, dehydrated, and embedded in paraffin at 60°C overnight. Tissue sections were cut at 6 µm thickness and transferred onto the gelatin coated glass slides. These sections were deparaffinized with 100% xylene and rehydrated via gradually decreased concentration of graded isopropanol. The sections were stained with H & E and Masson trichrome and observed at different magnifications under bright field microscope. 2.9. Immunohistochemical analysis Burn wound tissues of both groups were further analyzed by immunohistochemical staining to evaluate tissue vasculature and angiogenesis at day 14 of burn wound induction. Paraffin-embedded sections were deparaffinized in xylene, rehydrated in a gradually decreased concentration of isopropanol, and processed for the antigen retrieval step. Antigen retrieval of was performed by immersing the sections in citrate buffer at 95°C for 20 min. Permeabilization and blocking were performed with 0.5% triton-X-100 and blocking solution, respectively. Sections were incubated overnight at 4°C with primary antibody against α-smooth muscle actin (α-SMA) at a dilution of 1:100. Alexa fluor 488 goat anti-mouse secondary antibody was added to each section at 1:200 dilutions for 1 h at 37°C. DAPI was used to stain the nuclei. Images were captured at different magnifications under a fluorescence microscope. 2.10. Statistical analysis Statistical analysis was performed using SPSS software (IBM statistics 21). The comparison between control and treated groups was performed by Student’s t-test. Data of all experiments were stated as mean ± SEM and p-value ≤ 0.05 was considered statistically significant (*** = p ≤ 0.001, ** = p ≤ 0.01 and * = p ≤ 0.05). 3. Results 3.1. Morphological characteristics of isolated hUCMSCs MSCs isolated from human umbilical cord tissue were identified on the basis of their specific morphological features. After 10 days of isolation, cells migrated from the tissue explants and adhered to the flask surface. Isolated cells represented a homogenous population of MSCs in monolayer and showed rapid adherence to the plastic surface, with spindle-shaped fibroblast like morphology. They were termed as early passage 0 (P0). Later, when hUCMSCs proliferated upto 80% confluence, they were subcultured to passages P1 and P2, which subsequently showed widened and flattened morphology (Fig. 1 ). 3.2. Characterization of hUCMSCs 3.3. In vitro wound healing assessment (Scratch assay) 3.3.1. Microscopic analysis of wound closure Wound healing potential of hUCMSCs was analyzed in vitro by scratch assay. The area of wound closure was measured at 24 and 48 h in the presence of conditioned medium of hUCMSCs. Quantitative microscopic analysis showed enhanced cell migration and significant reduction in the scratch area (wound closure) in case of conditioned medium as compared to the normal control (Fig. 3 A). Statistical analysis showed that the scratch area was significantly reduced in the treated group after 48 h as compared to control (Fig. 3 B). 3.4. In vivo wound healing assessment 3.4.1. Macroscopic examination of wound closure Measurement of wound closure at different time points was performed as shown in Fig. 4 B, C. The treated group showed significant reduction in wound area after transplantation of hUCMSCs as compared to the control. The immediate response of the skin was also noted after cold injury; the exposed area remained frozen for a certain time period (1 min) (Fig. 4 A). Burn wound tissues were further examined to observe the extent of damages on the skin architecture. Control burn wound tissue showed destruction of the skin with extensive inflammation at days 1 and 3. Wound tissue at day 7 also showed inflammation and necrosis. At day 14, a thin and dry scab and granulation tissue formation were observed in the center of the wound lesion. Treated burn wound transplanted with hUCMSCs showed accelerated wound regeneration earlier than day 14 in comparison to the control. After transplantation, scab was observed at day 7 which exhibited granulation tissue formation. The scab was removed at day 14 and hair formation around the edge of the wounds was also noted. Burn wound tissue with transplanted hUCMSCs showed less inflammatory response, enhanced wound contraction, and improved tissue granulation with better skin architecture. 3.4.2. hUCMSC homing and migration Cells were labeled with DiI dye and transplanted into the in vivo burn wound model. After transplantation, cell viability, homing, and migration were observed after day 7 of burn wound induction. hUCMSCs homed at the peripheries of the wound site and restricted to the epidermis layer. Few transplanted cells were also observed in the deep wound which showed their migration towards injury (Fig. 4 D). 3.4.3. Gene expression related to wound healing phases Temporal change in gene expression of wound tissues at days 1, 3, 7, and 14 was analyzed as shown in Fig. 5 . Examination of hUCMSC treated burn wound tissues showed increased expression of anti-inflammatory cytokine (IL-13) at day 1, but its significant reduction was noted at day 3. Subsequent reduction in the expression of inflammatory cytokines (IL-6 and IL-1β) was noted on days 1 and 3 (Fig. 5 A). Temporal change in the gene expression of pro/angiogenic cytokines was also observed following treatment. VEGF was upregulated at day 1 but significantly downregulated at days 3 and 7. bFGF was significantly decreased at days 1, 3 and 7. TGF-β showed significant decrease at days 1 and 14, and significant increase at day 3 (Fig. 5 B). EGF and MMP9 remodeling cytokines released during the late healing (remodeling) phase, also showed varied expression. EGF, involved in re-epithelization, was significantly reduced at day 7, but significantly increased at day 14. MMP9, a remodeling cytokine, showed increased expression at day 7 but it is significantly decreased at day 14 (Fig. 5 C). The basal gene level of these cytokines was also examined in normal rat skin and compared with that of wound tissues. Inflammatory markers were significantly increased in burn wound tissues as compared to the normal skin tissue indicating no inflammation in the normal physiological condition (supplementary image; Fig. S1). 3.5. Histological findings of burn wound tissues Burn wound tissues along with normal skin were assessed by histological examination and quantification as shown in Fig. 6 . Histological analysis of normal skin showed intact collagen with intact layers of the skin (Fig. 6 A). The findings confirmed the acquisition of second degree cold burn wound as the epidermal and dermal layers were damaged. Wound tissues at day 1 showed inflammation along with distorted collagen and skin adnexa (hair follicles, sebaceous glands with injured epithelium). At day 3, destruction of epidermis with extensive inflammation around wound peripheries was observed. At day 7, burn wound tissues exhibited partially damaged epidermis and basement membrane with incomplete re-epithelialization. At day 14 (last phase of wound healing) reformation of epidermis, skin adnexa with the presence of distorted collagen and inflamed hair follicles, were observed. At this point, histological analysis exhibited incomplete wound regeneration. Wound tissues transplanted with hUCMSCs demonstrated dense collagen without the detachment of basement membrane and less inflammation at day 1. From day 3 to day 7, compact collagen, regenerated epidermis, and skin adnexa with the formation of new blood vessels were also noted. Histological examination of the healed wound at day 14 showed complete regeneration and re-epithelialization indicated by a flattened thick layer of keratinocytes with intact epidermis and basement membrane (Fig. 6 B and C). These findings were further confirmed by quantification via Image J software. The parameters including epidermal edges/thickness, area of tissue granulation, collagen content, and presence of skin adnexa (hair follicles) showed significant upregulation in hUCMSC treated burn wound tissues as compared to control (Fig. 6 D). 3.6. Analysis of wound tissue by immunohistochemistry Burn wound tissues of control and hUCMSC treated groups were further examined by immunohistochemical staining for α-SMA to evaluate tissue angiogenesis as shown in Fig. 7 . Increased number of blood vessels in hUCMSC treated burn wound tissue revealed enhanced neovascularization as compared to the control. In this study, we have successfully developed a consistent cold-induced burn wound model in rats and investigated the progress of wound healing at particular time points; days 1, 3, 7, and 14. hUCMSCs were transplanted at the burn wound site and healing potential was analyzed. The findings showed that the duration of wound healing was significantly reduced after cell transplantation in treated group as compared to the untreated control group. Previous studies demonstrate that in vivo transplanted hUCMSCs migrate to the site of injury through chemotaxis and regulate the microenvironment of the wound area [ 24 , 25 ]. Therefore, to examine the homing / migration of hUCMSCs, we transplanted labeled cells and tracked these cells at day 7 after burn wound induction. We found that transplanted cells homed to the site of injury and migrated preferentially towards the wound bed. Cell migration and proliferation are considered key underlying processes in wound healing which mainly occur due to the effect of wound healing growth (paracrine) factors. The role of paracrine factors secreted by hUCMSCs could be crucial in wound healing as they influence cell migration towards wound site, thus promoting wound repair and regeneration [ 26 ]. Locally transplanted hUCMSCs reduce inflammation by decreasing the levels of pro-inflammatory and inflammatory cytokines i.e. TNF-α, IL-1-β, IL-6, while accelerating wound closure by increasing the levels of cytokines involved in regeneration i.e. VEGF, TGF-β, FGF, EGF, MMP-9, etc [ 24, 27]. To confirm this, we harvested wound tissues at initial days when inflammation was at its peak. This was clearly observed in the burn wound group which showed increased level of inflammatory cytokines (IL-1β and IL-6). On the other hand, the expression levels of inflammatory cytokines (IL-1β and IL-6) were significantly decreased, while that of anti-inflammatory cytokine (IL-13) was increased in the treated group, due to immediate MSC transplantation. IL-13 is upregulated in response to inflammation. It is a positive therapeutic response of the transplanted MSCs to overcome excessive inflammation around the wound site by secreting anti-inflammatory cytokines. We also assessed the indirect healing effect of hUCMSCs by inducing in vitro wound via scratch assay using rat skin fibroblasts. Conditioned medium of hUCMSCs was used to see whether it enhances the migration of fibroblasts towards the scratch and promotes wound healing. Various studies suggest that the conditioned medium contains growth factors or paracrine mediators which facilitate cells to migrate towards the wound site and help in wound contraction [ 9 , 11 , 28 , 29 ]. Our findings are positively correlated with the reported studies as fibroblasts treated with conditioned medium have shown significantly accelerated cell migration towards the injury site and enhanced wound closure as compared to the untreated fibroblasts. The process of wound healing comprises multiple phases [ 30 ]. Along with the normal wound healing process, angiogenesis begins instantly after injury at the early phase. It mediates the restoration of a new vasculature of the injured tissue during the entire wound healing process [ 19 , 31 , 32 ]. Contribution of multiple cytokines such as VEGF, PDGF, FGF, TGF-β, Ang-1, HGF, has been reported as the angiogenesis begins [ 19, 33]. In our study, we analyzed gene expression of various cytokines corresponding to the multiple phases of wound healing. Our findings show that treatment with hUCMSCs resulted in increased expression of VEGF, FGF, EGF, TGF-β, IL-13, and MMP-9 (pro-angiogenic, angiogenic, and remodeling cytokines), while IL-1-β and IL-6 (inflammatory cytokines) were decreased. We also found upregulation of VEGF at day 1 and downregulation at days 3 and 7. Process of angiogenesis initiates as wound healing begins as demonstrated by the upregulation of VEGF receptors by the action of thrombin. This action promotes local termination of the basement membrane through which endothelial cells migrate and proliferate into the wound bed [ 31 ]. Its downregulation at later time points might indicate lack of proper vasculature, while slight upregulation represents restoration of angiogenesis or neovascularization induced by the effect of TGFβ. Cyclooxygenase-2 (COX − 2) which is stimulated during the initial phase of wound healing also promotes the production of VEGF and other stimulators of angiogenesis. It has also been shown that after the proliferative phase, angiogenesis is again stimulated by the activation of TGFβ which also regulates cell proliferation, cell migration, capillary tube formation, ECM deposition and the formation of tissue granulation. Thus, TGFβ is considered an important regulator of angiogenesis during the entire wound healing process [32,33]. We also found upregulation of MMP-9 in the proliferation phase. It is a remodeling cytokine also known as type 4 collagenase, which accelerates re-epithelization by the degradation of the damaged basement membrane and allows migration of various types of cells into the wound bed [ 34, 35]. The expression of MMP-9 is also reported to be transiently upregulated at the proliferative phase in case of an acute injury but as the wound heals, it returns to its basal level [34,36]. We further investigated protein expression of α-SMA in burn wound tissues of both control and hUCMSC treated groups via immunohistochemical staining. α-SMA is positively expressed on different cell types i.e. myofibroblasts, blood vessels, endothelial cells, hair follicles, etc. Myofibroblasts are considered intermediate between smooth muscle cells and fibroblasts [ 27 ]. They play a crucial role in wound contraction during the proliferation phase which is considered as the hallmark of healthy wound healing [ 34 ]. We observed an increase in blood vessel density with positive expression of α-SMA in the hUCMSC treated burn wound tissues at day 14, i.e. the remodeling phase. We also observed migration of stained infiltrated cells to the wound bed and enhanced neovascularization with increased number of blood vessels in the treated burn wound tissues as compared to the control. Histological analysis of burn wound tissues at days 1, 3, 7, and 14 further confirmed our macroscopic analysis. It further confirms the successful development of second-degree burn wound as indicated by the destruction of epidermis and dermis layers. In the case of control burn wound tissues at days 1 and 3, extensive destruction of epidermal and dermal layers was observed, while inflamed hair follicles and loose collagen network were observed at day 7, and cellular infiltration with incomplete re-epithelialization at day 14. In contrast, burn wounds treated with hUCMSCs showed intact epidermis with less inflammation at day 1. It can be considered as the positive impact of the transplanted cells during the inflammatory phase. The findings also showed positive results in the treated burn wounds at days 7 and 14. We observed enhanced neovascularization at day 7 with regenerated skin adnexa and epidermis, while complete re-epithelialization was also noted at day 14. 4. Conclusion It is concluded from this study that locally transplanted hUCMSCs promote wound healing by creating a favorable microenvironment via the secretion of wound healing factors around wound site. Conditioned medium enriched in wound healing mediators released by hUCMSCs under stress condition enhances the process of wound repair, as evident by the in vitro scratch wound assay. Molecular insight into the mechanism of in vivo burn wound healing revealed that hUCMSCs enhance the time of wound closure by promoting the anti-inflammatory response and neovascularization process. To the best of our knowledge, this is the first preclinical study where the effect of a single dose of transplanted hUCMSCs was evaluated at the local wound site of a second degree cold-induced burn wound. However, further analysis of wound healing mediators at the protein level is required to improve our understanding of the wound healing process and designing of the future clinical studies and clinical trials for both acute and chronic burn injuries in humans. Abbreviations Human Umbilical Cord (hUC), Human Umbilical Cord Mesenchymal Stem Cells (hUCMSCs), Mesenchymal Stem Cells (MSCs), Quantitative Polymerase Chain Reaction (qPCR), Polymorphonucleocytes (PMN), Alpha Smooth Muscle Actin (α-SMA), Extracellular Matrix (ECM), Transforming growth factor-beta (TGF-β), Tumor Necrosis Factor-alpha (TNF-α), Vascular Endothelial Growth Factor (VEGF), Cyclooxygenase-2 (COX-2), Epidermal Growth Factor (EGF), Matrix Metalloproteinase (MMP-9), Insulin Growth Factor (IGF), Phosphate Buffered Saline (PBS), Fetal Bovine Serum (FBS), Independent Ethical Committee (IEC), Animal Study Protocol (ASP), Dulbecco’s Modified Eagle’s Medium (DMEM). Declarations Compliance with Ethical Standards: All animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC) and assigned the Animal Study Protocol (ASP) number 2020-010. For the use of human samples, the study was approved by the Institutional Ethics Committee (IES) and assigned the number (IEC/ ICCBS-036-HT-2018/Protocol/1.0). Informed consents were obtained by the donors prior to sample acquisition. Conflict-of-interest: The authors have nothing to disclose. Data availability: The authors have disclosed original data in this manuscript. Funding information: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Acknowledgment Human umbilical cord samples were provided by Zainab Panjwani Memorial Hospital. Cell line CRL-1213 was provided by the Biobank facility of Dr. Panjwani Center for Molecular Medicine and Drug Research, International Center for Chemical and Biological Sciences, University of Karachi. References Almeida BMD, Nascimento MFD, Pereira-Filho RN, Melo GCD, Santos JCD, Oliveira CRD, Albuquerque-Júnior RLCD (2014) Immunohistochemical profile of stromal constituents and lymphoid cells over the course of wound healing in murine model. Acta Cir Bras 29(9):596–602. https://doi.org/10.1590/s0102-8650201400150007 Jiang D, Scharffetter-Kochanek K (2020) Mesenchymal stem cells adaptively respond to environmental cues thereby improving granulation tissue formation and wound healing. Front Cell Dev Biol 8:1–13. https://doi.org/10.3389/fcell.2020.00697 Arno AI, Amini-Nik S, Blit H, Al-Shehab M, Belo C, Herer E, Jeschke MG (2014) Human Wharton’s jelly mesenchymal stem cells promote skin wound healing through paracrine signaling. Stem Cell Res Ther 5(1):28–40. https://doi.org/10.1186/scrt417 Aryan A, Bayat M, Bonakdar S, Taheri S, Haghparast N, Bagheri M, Abdollahifar MA (2018) Human bone marrow mesenchymal stem cell conditioned medium promotes wound healing in deep second-degree burns in male rats. Cells Tissues Organs 206(6):317–329. https://doi.org/10.1159/000501651 Aslam S, Khan I, Jameel F, Zaidi MB, Salim A (2020) Umbilical cord-derived mesenchymal stem cells preconditioned with isorhamnetin: potential therapy for burn wounds. World J Stem Cells 12(12):1652–1666. https://doi.org/10.4252/wjsc.v12.i12.1652 Campbell KE, Baronoski S, Gloeckner M, Holloway S, Idensohn P, Langemo D, LeBlanc K (2018) Skin tears: prediction, prevention, assessment and management. Nurse Prescribing 16(12):600–607. https://doi.org/10.12968/npre.2018.16.12.600 Catar R, Moll G, Hosp I, Simon M, Luecht C, Zhao H, Wu D, Chen L, Kamhieh-Milz J, Korybalska K, Zickler D (2021) Transcriptional regulation of thrombin-induced endothelial VEGF induction and proangiogenic response. Cells 10(4):910. https://doi.org/10.3390/cells10040910 Dehkordi AN, Babaheydari FM, Chehelgerdi M, Dehkordi SR (2019) Skin tissue engineering: wound healing based on stem-cell-based therapeutic strategies. Stem Cell Res Ther 10(1):111–131. https://doi.org/10.1186/s13287-019-1212-2 Dolp R, Eylert G, Auger C, Aijaz A, Chen YA, Amini-Nik S, Parousis A, Datu AK, Jeschke MG (2021) Biological characteristics of stem cells derived from burned skin—a comparative study with umbilical cord stem cells. Stem Cell Res Ther 12(1):1–4. https://doi.org/10.1186/s13287-021-02140-z Dong L, Hao H, Liu J, Ti D, Tong C, Hou Q, Han W (2017) A conditioned medium of umbilical cord mesenchymal stem cells overexpressing Wnt7a promotes wound repair and regeneration of hair follicles in mice. Stem Cells Int 1–13. https://doi.org/10.1155/2017/3738071 Ghieh F, Jurjus R, Ibrahim A, Geagea AG, Daouk H, El Baba B, Jurjus A (2015) The use of stem cells in burn wound healing: a review. BioMed Res Int 7(2):1–9. https://doi.org/10.1155/2015/684084 Honnegowda TM, Kumar P, Udupa EGP, Kumar S, Kumar U, Rao P (2015) Role of angiogenesis and angiogenic factors in acute and chronic wound healing. Plast Aesthet Res 2(4):243–249. https://doi.org/10.4103/2347-9264.165438 Hu MS, Borrelli MR, Lorenz HP, Longaker MT, Wan DC (2018) Mesenchymal stromal cells and cutaneous wound healing: a comprehensive review of the background, role, and therapeutic potential. Stem Cells Int 1–13. https://doi.org/10.1155/2018/6901983 Hu MS, Leavitt T, Malhotra S, Duscher D, Pollhammer MS, Walmsley GG, Longaker MT Stem cell-based therapeutics to improve wound healing.Plast. Surg. Int. https://doi.org/10.1155/2015/383581 Imray C, Grieve A, Dhillon S, Caudwell Xtreme Everest Research Group (2009) Cold damage to the extremities: frostbite and non-freezing cold injuries. Postgrad Med J 85(1007):481–488. https://doi.org/10.1136/pgmj.2008.068635 Jamadagni PS, Jamadagni S, Mukherjee K, Upadhyay S, Gaidhani S, Hazra J (2016) Experimental and histopathological observation scoring methods for evaluation of wound healing properties of Jatyadi Ghrita. AYU 37:222–229. https://doi.org/10.4103/ayu.AYU_51_17 . 3–4 Jeschke MG, Rehou S, McCann MR, Shahrokhi S (2019) Allogeneic mesenchymal stem cells for treatment of severe burn injury. Stem Cell Res Ther 10(1):1–6. https://doi.org/10.1186/s13287-019-1465-9 Khalid RS, Khan I, Zaidi MB, Naeem N, Haneef K, Qazi REM, Salim A IL-7 overexpression enhances therapeutic potential of rat bone marrow mesenchymal stem cells for diabetic wounds.Wound Repair Regen.27,235–248. https://doi.org/10.1111/wrr.12706 Kusindarta DL, Wihadmadyatami H, Fibrianto YH, Nugroho WS, Susetya H, Musana DK, Wahyuni AETH (2016) Human umbilical mesenchymal stem cells conditioned medium promote primary wound healing regeneration. Vet World 9(6):605–610. https://doi.org/10.14202/vetworld.2016.605-610 Liu JS, Du J, Cheng X, Zhang XZ, Li Y, Chen XL (2019) Exosomal miR-451 from human umbilical cord mesenchymal stem cells attenuates burn-induced acute lung injury. J Chin Med Assoc 82(12):895–901. https://doi.org/10.1097/JCMA.0000000000000189 Liu L, Yu Y, Hou Y, Chai J, Duan H, Chu W, Du J (2014) Human umbilical cord mesenchymal stem cells transplantation promotes cutaneous wound healing of severe burned rats. PLoS ONE 9(2):e88348. https://doi.org/10.1371/journal.pone.0088348 Michopoulou A, Montmasson M, Garnier C, Lambert E, Dayan G, Rousselle P (2020) A novel mechanism in wound healing: Laminin 332 drives MMP9/14 activity by recruiting syndecan-1 and CD44. Matrix Biol 94:1–17. https://doi.org/10.1016/j.matbio.2020.06.004 Nizamoglu M, Tanm A, Vickersm T, Segarenm N, Barnesm D, Dziewulskim P (2016) Cold burn injuries in the UK: the 11-year experience of a tertiary burns center. Burns Trauma 4(1):36–43. https://doi.org/10.1186/s41038-016-0060-x Nuutila K, Samandari M, Endo Y, Zhang Y, Quint J, Schmidt TA, Sinha I (2021) In vivo printing of growth factor-eluting adhesive scaffolds improves wound healing. Bioactive Mater 8:296–308. http:/ doi.org/10.1016/j.bioactmat.2021.06.030 Oh EJ, Lee HW, Kalimuthu S, Kim TJ, Kim HM, Baek SH, Zhu L, Oh JM, Son SH, Chung HY, Ahn BC (2018) In vivo migration of mesenchymal stem cells to burn injury sites and their therapeutic effects in a living mouse model. J Control Release 79:79–88. https://doi.org/10.1016/j.jconrel.2018.04.020 Padeta I, Nugroho WS, Kusindarta DL, Fibrianto YH, Budipitojo T (2017) Mesenchymal stem cell-conditioned medium promote the recovery of skin burn wound. Asian J Anim Vet Adv 12(3):132–141. https://doi.org/10.3923/ajava.2017.132.141 Patel S, Srivastava S, Singh MR, Singh D (2019) Mechanistic insight into diabetic wounds: Pathogenesis, molecular targets and treatment strategies to pace wound healing. Biomedical Pharmacother 112:108615. https://doi.org/10.1016/j.biopha.2019.108615 Ram M, Singh V, Kumawat S, Kumar D, Lingaraju MC, Singh TU, Kumar D (2015) Deferoxamine modulates cytokines and growth factors to accelerate cutaneous wound healing in diabetic rats. Eur J Pharmacol 764:9–21. https://doi.org/10.1016/j.ejphar.2015.06.029 Rodgers K, Jadhav SS (2018) The application of mesenchymal stem cells to treat thermal and radiation burns. Adv Drug Deliv Rev 123:75–81. https://doi.org/10.1016/j.addr.2017.10.003 Rahman MS, Islam R, Rana MM, Spitzhorn LS, Rahman MS, Adjaye J, Asaduzzaman SM (2019) Characterization of burn wound healing gel prepared from human amniotic membrane and Aloe vera extract. BMC Complement Altern Med 19(1):1–15. http:/doi.org/10.1186/s12906-019-2525-5 Rowan MP, Cancio LC, Elster EA, Burmeister DM, Rose LF, Natesan S, Chung KK Burn wound healing and treatment: review and advancements. Crit. Care 19, 243–255. https://doi.org/.1186/s13054-015-0961-2. Shen C, Lie P, Miao T, Yu M, Lu Q, Feng T, Li H (2015) Conditioned medium from umbilical cord mesenchymal stem cells induces migration and angiogenesis. Mol Med Rep 120–30. https://doi.org/10.3892/mmr.2015.3409 . 12 Siddiqui E, Zia N, Feroze A, Awan S, Ali AL, Razzak JA, Latif A (2015) Burn injury characteristics: findings from the Pakistan national emergency department surveillance study. BMC Emergency Medicine 2015; 15(2): 1–7. https://doi.org/26692165 Sun J, Zhang Y, Song X, Zhu J, Zhu Q (2019) The healing effects of conditioned medium derived from mesenchymal stem cells on radiation-induced skin wounds in rats. Cell Transpl 28(1):105–115. https://doi.org/10.1177/0963689718807410 Walter MN, Wright KT, Fuller HR, MacNeil S, Johnson WEB (2010) Mesenchymal stem cell-conditioned medium accelerates skin wound healing: an in vitro study of fibroblast and keratinocyte scratch assays. Exp Cell Res 316(7):1271–1281. https://doi.org/10.1016/j.yexcr.2010.02.026 Yoon D, Cho YS, Joo SY, Seo CH, Cho YS (2020) A clinical trial with a novel collagen dermal substitute for wound healing in burn patients. Biomater Sci 8(3):823–829. https://doi.org/10.1039/c9bm01209e Tables Table 1: Experimental groups Groups Time points (days) Number of rats x Time points Model optimization __ 10 Burn wound with no treatment 1, 3, 7, 14 6×4 Burn wound treated with hUCMSCs 1, 3, 7, 14 6×4 Total number of animals n=58 Table 2: Targeted genes with their specific primer sequences and annealing temperatures Genes Primer Sequence (5’-3’) (Forward) Primer Sequence (5’-3’) (Reverse) Annealing Temperature (°C) GAPDH GGAAAGCTGTGGCGTGATGG GTAGGCCATGAGGTCCACCA 58 IL-1β TCATCTTTGAAGAAGAGCCCGT GTTCTGTCCATTGAGGTGGAGA 58 IL-6 GATGGATGCTTCCAAACTGGATA TGAATGACTCTGGCTTTGTCTTT 58 IL-13 TGGCTCTCGCTTGCCTT GCCAGCTGTCAGGTCCA 58 TGF- β CACTGCTCTTGTGACAGCAAA CGGTTCATGTCATGGATGGTG 58 VEGF-A CCAATTGAGACCCTGGTGGA TCCTATGTGCTGGCTTTGGT 58 FGF-2 AGCAGAAGAGAGAGGAGTTGTG TATTTCCGTGACCGGTAAGTGT 58 EGF TAACGGGCCTGACAGCA TGCACTGGCCCGAGTTA 58 MMP-9 TACCAGCTACTCGAACCAATCA AAATAAAAGGGCCGGTAAGGTG 58 GAPDH: Glyceraldehydes-3-phosphate dehydrogenase, IL-1β: Interleukin-1 beta, IL-6: Interleukin 6, IL-13: Interleukin 13, TGF-β: Transforming growth factor-beta, VEGF: Vascular endothelial growth factor, FGF: Fibroblast growth factor, EGF: Epidermal growth factor, MMP-9: Matrix metalloproteinase Supplementary Files graphicalabstract.tif Suppfigcaption.docx supplfig1.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2546357","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":175862266,"identity":"efb26f9e-dcd4-41b6-b5c3-44149f6eb917","order_by":0,"name":"Fatima Jameel","email":"","orcid":"","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fatima","middleName":"","lastName":"Jameel","suffix":""},{"id":175862267,"identity":"6f7a3748-9aed-4ac4-9e57-d80495fd0915","order_by":1,"name":"Irfan Khan","email":"","orcid":"","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":false,"prefix":"","firstName":"Irfan","middleName":"","lastName":"Khan","suffix":""},{"id":175862268,"identity":"5638bbda-21a0-48a9-be22-ccef33509b2f","order_by":2,"name":"Tuba Shakil Malick","email":"","orcid":"","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":false,"prefix":"","firstName":"Tuba","middleName":"Shakil","lastName":"Malick","suffix":""},{"id":175862269,"identity":"a1957470-24c8-47c8-863f-513f93db3d10","order_by":3,"name":"Rida-e-Maria Qazi","email":"","orcid":"","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":false,"prefix":"","firstName":"Rida-e-Maria","middleName":"","lastName":"Qazi","suffix":""},{"id":175862270,"identity":"859d36bb-8c64-4b5c-bd2e-6aaec146606e","order_by":4,"name":"Midhat Batool Zaidi","email":"","orcid":"","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":false,"prefix":"","firstName":"Midhat","middleName":"Batool","lastName":"Zaidi","suffix":""},{"id":175862271,"identity":"9181be54-4e66-4c11-a3e5-307bc2e2166e","order_by":5,"name":"Shumaila Khalid","email":"","orcid":"","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shumaila","middleName":"","lastName":"Khalid","suffix":""},{"id":175862272,"identity":"81176803-8c95-49cf-95d1-6a5b0281dfe5","order_by":6,"name":"Asmat Salim","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYDADPmYGxgcJELYBYeUHgJiNmYHZgEQtQCTBQIwW/v7TiZ8/MNTJs7Fzp1U8qLGzZ2Bv3iaBT4vEjdzNEgcYDhu2MfNuu5FwLDmxgedYGV4tDDd4NwC1HGAEa0lsOJDAIJFjhleL/Pmzm38cYKizB2kpAGqxZ5B/g1+LwYHcbUBbmBNBWhiAWhgbJHjwazG8kbvN4ozB4WSgls0SIL+08aQVW+DTIgd02I2Kijrbfv6zGz/+AIYYP/vhjTfwaYE6D4nNRlj5KBgFo2AUjAJCAAAmTEWEBR/4WgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-5181-0458","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":true,"prefix":"","firstName":"Asmat","middleName":"","lastName":"Salim","suffix":""},{"id":175862273,"identity":"2dfec379-af77-40eb-b086-c30521c8bd7c","order_by":7,"name":"Shazmeen Aslam","email":"","orcid":"","institution":"University of Karachi International Center for Chemical and Biological Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shazmeen","middleName":"","lastName":"Aslam","suffix":""},{"id":175862274,"identity":"ef353987-d25d-48ac-8636-c95dfc3623c6","order_by":8,"name":"Enam A. Khalil","email":"","orcid":"","institution":"The University of Jordan","correspondingAuthor":false,"prefix":"","firstName":"Enam","middleName":"A.","lastName":"Khalil","suffix":""}],"badges":[],"createdAt":"2023-02-03 10:55:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2546357/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2546357/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":32989533,"identity":"9176b075-0b4e-4b2d-9f80-1f2f2b78db04","added_by":"auto","created_at":"2023-02-15 15:57:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1190807,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMorphology of hUCMSCs at different passages:\u003c/strong\u003e hUCMSCs at (A, B) passage P0 exhibit extended cells from cord tissue at day 10 after isolation, (C) passage P1 with 80% confluence, and (D) passage P2 with homogenous population having spindle-shaped fibroblast-like morphology. All images were taken at 10X under phase contrast microscope.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/54fd5137b42c787b320c62d7.png"},{"id":32989195,"identity":"f1f46b8f-c39a-495e-a3b7-93659dc8ae65","added_by":"auto","created_at":"2023-02-15 15:49:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":10635568,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of hUCMSCs by immunocytochemistry and flow cytometry: \u003c/strong\u003e(A) Cells exhibit positive expression of CD29, CD73, CD105, and vimentin and negative expression of CD45. Cellswere examined under fluorescence microscope for immunocytochemical analysis. Alexa fluor 546 goat anti-mouse secondary antibody was used for detection and nuclei were stained with DAPI. Images were taken at 20X under fluorescence microscope. (B) Flow cytometry analysis shows more than 85% of the cells with positive expression of CD73, CD105, and vimentin, while CD45 which is a negative marker of hUCMSCs shows low expression and gated out before analysis.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/bd411d5df2534503e89c1e86.png"},{"id":32989189,"identity":"2e3008fb-028a-4f17-9494-0fed62495007","added_by":"auto","created_at":"2023-02-15 15:49:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":517926,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e wound closure \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003evia \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003escratch assay: \u003c/strong\u003e(A) Microscopic analysis of\u003cem\u003e \u003c/em\u003escratch area at 0, 24 to 48 h. Black arrows indicate the area of wound closure in normal and conditioned fibroblasts. All images were taken at 10X under phase contrast microscope. (B\u003cstrong\u003e) \u003c/strong\u003eGraphical representation of % wound closure at 0, 24 and 48 h. IBM SPSS statistic 21 software was used for Student’s t-test analysis. p-value ≤ 0.05 was considered statistically significant (*** = p ≤ 0.001, ** = p ≤ 0.01 and * = p ≤ 0.05).\u003c/p\u003e","description":"","filename":"Fig3..png","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/e947ef3d790b8ccf6f2816dd.png"},{"id":32989198,"identity":"38fcde3c-94ad-42b8-8739-35554895213e","added_by":"auto","created_at":"2023-02-15 15:49:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":26191196,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMeasurement of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e wound closure by macroscopic examination and cell tracking: \u003c/strong\u003e(A) Wound tissue at day 0 with freezing temperature and showing diameter of the wound (~2 cm). (B) Wound tissue at day 0 with normal temperature, and control and treated burn wound tissues with the % wound closure at\u003cstrong\u003e \u003c/strong\u003edifferent time points (days 1, 3, 7, and 14). IBM SPSS statistic 21 software was used for Student’s t-test analysis. p-value ≤ 0.05 was considered statistically significant (*** = p ≤ 0.001 and ** = p ≤ 0.01). (C) Same image of control and treated burn wound tissues with measuring scale. (D) hUCMSCs after \u003cem\u003ein vivo \u003c/em\u003etransplantation at day 7. hUCMSCs were labeled with DiI dye for \u003cem\u003ein vivo\u003c/em\u003e tracking. Images were taken at different magnifications (4X and 10X) under fluorescence microscope.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/205d4850c7a52ffcfbd14d27.png"},{"id":32989190,"identity":"73912d0a-c148-442b-9dd2-35053097d036","added_by":"auto","created_at":"2023-02-15 15:49:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1584726,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTemporal changes in gene expression of cytokines during different wound healing phases \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e: \u003c/strong\u003eQuantitative gene expression analysis of control and hUCMSCs treated burn wound tissues of (A)\u003cstrong\u003e \u003c/strong\u003einflammatory cytokines IL-1, IL-6, and IL-13 at days 1 and 3, (B) pro/angiogenic cytokines VEGF, TGF-β, and b-FGF at days 1, 3, 7 and 14, and (C) remodeling cytokines EGF and MMP-9 at days 7 and 14. IBM SPSS statistic 21 software was used for Student’s t-test analysis. p-value ≤ 0.05 was considered statistically significant (*** = p ≤ 0.001, ** = p ≤ 0.01 and * = p ≤ 0.05).\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/f8999a4e2f7d79492791ece6.png"},{"id":32989534,"identity":"febba58c-9015-4708-9e8c-c689ebcaa991","added_by":"auto","created_at":"2023-02-15 15:57:40","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5465427,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistological examination of normal rat skin, untreated control, and hUCMSC treated burn wound tissues\u003c/strong\u003e \u003cstrong\u003eby H \u0026amp; E and Masson trichrome staining: \u003c/strong\u003e(A) Healthy rat skin keratinocytes indicated by brown arrow. Black arrows indicate clusters of hair follicles with a well-defined structure associated with sebaceous glands (red arrow). Blue arrows indicate dense thick bundles of collagen fibers which indicate intact oriented skin. Subcutis layer (green arrow) shows well-defined adipose tissue (yellow arrow) and muscle fibers (white arrow). Images were taken at 4X and 10X under bright field microscope. (B, C) Control and hUCMSC treated burn wound tissues at different time points after wound induction. Images were taken at 10X under bright field microscope. (D) Quantification of histological parameters (epidermal thickness, area of tissue granulation, intensity of collagen content, and presence of skin adnexa (hair follicles) in untreated control, and hUCMSC treated burn wound tissues. IBM SPSS statistic 21 software was used for Student’s t-test analysis. p-value ≤ 0.05 was considered statistically significant where (*** = p ≤ 0.001, ** = p ≤ 0.01, and * = p ≤ 0.05).\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/b42459fd81adb3c870f4b1e6.png"},{"id":32989192,"identity":"135a4b74-860d-4c2f-b642-44e3a14750af","added_by":"auto","created_at":"2023-02-15 15:49:40","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":736546,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical analysis of burn wound tissues: \u003c/strong\u003eα-SMA in (A) untreated control, and (B) hUCMSC treated burn wound tissues at day 14 post wound induction. White arrows indicate α-SMA positive endothelial cells showing the formation of new blood vessels. Alexa fluor 488 goat anti-mouse secondary antibody was used for detection and nuclei were stained with DAPI. Images were taken at 10X under fluorescence microscope. (C) Quantitative analysis of α-SMA in both groups at day 14 post wound induction. IBM SPSS statistic 21 software was used for Student’s t-test analysis. p-value ≤ 0.05 was considered statistically significant (** = p ≤ 0.01).\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/680473886921ca7739bd045f.png"},{"id":34346477,"identity":"38813284-427a-4bc9-b1d7-3f04aa99fea5","added_by":"auto","created_at":"2023-03-16 10:33:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4892569,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/a4ac50f3-ab4e-4800-b827-90c7896c1ee4.pdf"},{"id":32989197,"identity":"94faea2d-4653-4c0c-98b6-2289d06bf27f","added_by":"auto","created_at":"2023-02-15 15:49:40","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":7186608,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/1f6887d99a7cf4b22bc4c14d.tif"},{"id":32989922,"identity":"ecc147d8-866b-494a-8374-9729fddb87db","added_by":"auto","created_at":"2023-02-15 16:05:40","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":16789,"visible":true,"origin":"","legend":"","description":"","filename":"Suppfigcaption.docx","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/3bfc043968e976f924c3d89e.docx"},{"id":32989196,"identity":"67330ee6-2b59-45a3-8c99-04df512d4b31","added_by":"auto","created_at":"2023-02-15 15:49:40","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":694562,"visible":true,"origin":"","legend":"","description":"","filename":"supplfig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-2546357/v1/9c07c47435128b701c2d1265.tif"}],"financialInterests":"","formattedTitle":"Regeneration Potential of Mesenchymal Stem Cells in Cold Induced Burn Wounds","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAcute wound healing proceeds in well-organized overlapping phases and usually completes within 7 to 14 days [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Any collapse and alterations in these phases can disrupt the well-regulated healing process. The disruption in this mechanism may cause wounds to become more aggressive with impaired healing [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This impaired healing mostly occurs in the case of burn injuries which are considered the fourth most common type of injuries worldwide. These injuries are major clinical and public health concerns especially in low-income countries, which ultimately increase the financial burden on patients and hospitals [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNormally, burn wounds are classified as first, second (superficial), third and fourth (deep/extensive) degree wounds [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Extensive burn wounds are challenging to treat and sometimes do not heal completely [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. There are many types of burn wounds; among them cold burn wounds are rare and uncommon, but they damage the structural and functional integrity of skin tissues [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. They are broadly classified into acute (mild or superficial; heal within few weeks) and chronic (severe or deep; take time to heal) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The local mechanism of cold burn injuries varies from prolonged exposure in a cold environment and sequentially categorized into the pre-freeze stage, freeze-thaw stage, vascular stasis, and progressive stage. These stages are based on the freezing rate, duration, and the extent of the injury [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The pathophysiology and healing process of these injuries are quite different from other burn injuries. Cold burn injuries directly cause cellular death by tissue freezing and form ice crystals within the cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Normally, skin loses its sensation at 10℃. With extended cooling or cold temperature of around 0℃ or less, the vascular and cellular contents become more viscous causing microvascular constriction and trans-endothelial plasma leakage. Tissue freezing disrupts the cellular integrity (cellular damages) due to the intracellular water crystallization (pre-freeze stage), narrowing of the blood vessels, platelet dysfunction (freeze-thaw stage), peripheral vasoconstriction, and thrombosis (vascular stasis), which leads to tissue hypoxia and necrosis (progressive stage) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Understanding the mechanism of wound progression is crucial for burn care units to offer improved or appropriate treatment for cold burn wounds [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Several treatment options have been adopted, however, they have several limitations and drawbacks [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Stem cell therapy has emerged as a promising approach for chronic wounds including cold burns. hUCMSCs can be used in clinical applications for tissue regeneration and cutaneous wound healing [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. They are known for having the characteristics of self-renewal, multipotent differentiation, and paracrine signaling [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Thus, they can regenerate the injured tissue with their direct or indirect effect. They migrate into the wound bed and contribute to the healing process \u003cem\u003evia\u003c/em\u003e transdifferentiation into multiple skin cell types or appendages [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. On the other hand, they can also promote wound healing by paracrine secretions. Paracrine signaling is the primary mechanism whereby the microenvironment of the burn wound can be enriched resulting in wound repair [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Locally transplanted MSCs create a favorable environment at the wound site by direct secretion of angiogenic and remodeling cytokines which aid in the healing process [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Similarly, conditioned medium contains the enriched growth factors secreted by stem cells under specific physiological conditions which are potentially used as wound healing mediators [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The use of enriched conditioned medium results in the indirect effect of stem cells in wound healing [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConsidering the remarkable regenerative properties of hUCMSCs for wound repair, this study was conducted to evaluate their direct effect \u003cem\u003ein vivo\u003c/em\u003e as well as indirect \u003cem\u003ein vitro\u003c/em\u003e effect through the conditioned medium. \u003cem\u003eIn vitro\u003c/em\u003e wound regeneration and cell migration were analyzed in the presence of hUCMSC conditioned medium \u003cem\u003evia\u003c/em\u003e scratch assay, while the effect of their local transplantation was analyzed in the \u003cem\u003ein vivo\u003c/em\u003e rat wound model. The time points of the study were based on the corresponding wound healing phases activated through a regulated wound healing mechanism; hemostasis (clotting) / inflammation, cell proliferation (tissue granulation), and maturation (re-epithelization) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The first phase (hemostasis/inflammation) begins instantly after an injury that includes narrowing of blood vessels, formation of fibrin clot, exudate formation, and infiltration of polymorphonucleocytes (PMNs) at the injured site [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Numerous inflammatory cytokines and growth factors including interleukins (IL-1β, IL-6), tumor necrosis factor alpha (TNF-α), transforming growth factor-beta (TGF-β), vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] are released which attract various cell types specifically neutrophils and monocytes through chemotaxis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The inflammatory phase can last up to 3\u0026ndash;6 days depending on the severity of the wound [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The proliferative phase activates with the migration of multiple skin cell types responsible for wound closure by the formation of granulation tissue, wound contraction, and restoration of new vasculature. This phase is important in wound healing and can last up to 6\u0026ndash;14 days or several weeks [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Overlapping with the proliferation phase, maturation /remodeling phase is initiated which forms new connective tissues and dermal matrix [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In the first and last wound healing phases, interactions of cells with associated healing mediators are dominant, which progressively change the microenvironment of the wound away from an inflammatory phase towards the maturation phase [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Chemicals/ reagents\u003c/h2\u003e \u003cp\u003eChemicals and reagents utilized in this study are: Alexa fluor 488 secondary antibody (goat anti-mouse IgG) (A-11001, Invitrogen), Alexa fluor 546 goat anti-mouse secondary antibody (A-11003, Invitrogen), Alpha smooth muscle actin (α-SMA) (MA5-11547, Invitrogen), Bright green 2X qPCR master mix (G892, Applied Biological Materials Inc.), BSA (151429, MP Biomedical Inc.), CD29 (MAB-1981, Chemicon International), CD45 (CBL415, BD Pharminogen), CD73 (550256, Pharminogen), CD105 (MAB117, Sigma), cDNA kit (Fermentas, ThermoFisher Scientific), DAPI (157574, MP Biomedical Inc.), DMEM (11965-092, Gibco Life Technologies), DiI dye (2127433, Life Technologies Corporation), EDTA (600094, ThermoFisher Scientific), FBS (10438-026, Gibco Life Technologies), Hematoxylin \u0026amp; Eosin (H \u0026amp; E) (T.864.1, Carl-Roth), Isopropanol (64372, ThermoFisher Scientific), Ketamine hydrochloride (K2753-5G, Sigma), One-step RNA reagent (BS410A, Bio Basic), Paraformaldehyde (P087.1, Carl Roth), Penicillin/streptomycin (15140-122, Gibco Life Technologies), Sodium azide (30175, Serva), Sodium pyruvate (11360, Gibco Life Technologies), Triton X-100 (T8787, Sigma), Trypsin-EDTA (25200056, Gibco Life Technologies), Tween 20 (194724, MP Biomedical, Inc.), Vimentin (V6389, Sigma), Xylene (1330-20-7, ThermoFisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Study design\u003c/h2\u003e \u003cp\u003e This study was approved by the local Independent Ethical Committee (IEC) of the International Center for Chemical and Biological Sciences (ICCBS), University of Karachi (IEC/ ICCBS-036-HT-2018/Protocol/1.0) for the isolation of stem cells from human umbilical cord tissue. All animal experiments were performed according to the international guidelines for the care and use of laboratory animals and approved by the local institutional committee; Animal Study Protocol (ASP) Number 2020-010. Total n\u0026thinsp;=\u0026thinsp;58 animals (Wistar male rats) were used for cold burn wound induction. Initially, n\u0026thinsp;=\u0026thinsp;10 animals were used for the optimization of cold burn wound model, while the remaining animals were divided into two main groups (control and hUCMSC treated). Each group was further divided into four subgroups according to the wound healing phases. Group 1 (control) animals were exposed to the rod chilled with liquid nitrogen for 10 min. Group 2 animals were transplanted with hUCMSCs at the site of injury immediately after wound induction. Throughout the experimental period, general state of animals (wound lesion, body weight, exploratory behavior) was observed. After hUCMSC transplantation, macroscopic changes (edema and erythema formation, blistering, crust, tissue granulation, and re-epithelization) were observed. Histopathological, gene expression and immunohistochemical analyses were performed to observe the therapeutic potential of locally transplanted hUCMSCs at the specific wound healing phases. \u003cem\u003eIn vitro\u003c/em\u003e wound regeneration and cell migration were also observed as the indirect effect of hUCMSCs using their conditioned medium. Conditioned medium was obtained in a separate experiment when the scratch area of cultured hUCMSCs was completely filled following scratch induction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Isolation of hUCMSCs\u003c/h2\u003e \u003cp\u003eHuman umbilical cord tissues were obtained after caesarian section at the Zainab Panjwani Memorial Hospital with prior formal consent from donor parents. Each cord tissue (about 6\u0026ndash;10 cm) was aseptically collected in a sterile bottle containing 1X phosphate buffered saline (PBS) and stored at 4℃ before processing. hUCMSCs were isolated using the protocol as described in our previous study [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Briefly, umbilical cord tissue was dissected into small pieces (about 2\u0026ndash;3 mm). The explants (tissue pieces) were cultured in T-75 flasks containing Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), sodium pyruvate (1 mM), and antibiotics (100 units /mL penicillin and 100 \u0026micro;g/mL streptomycin). Culture flasks were incubated at 37℃ in a humidified atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e. After 2\u0026ndash;3 days, the exhausted medium was replaced with a fresh medium. hUCMSCs were identified by their ability to adhere to the plastic surface and by their spindle shape fibroblast like morphology. When cells reached confluence of about 70\u0026ndash;80%, 1X trypsin-EDTA was added to detach the monolayered cells. The cells were subcultured to the next passage. Fresh medium was added after every 2\u0026ndash;3 days. hUCMSCs of passage 2 (P2) were used in this study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Characterization of hUCMSCs\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1. Immunocytochemical analysis\u003c/h2\u003e \u003cp\u003eImmunocytochemical analysis was performed for the characterization of hUCMSCs as described in a previous study [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Briefly, cells were allowed to grow and adhere in a 24-well plate. Paraformaldehyde (4%) was added for 20 min to fix the cells. Triton X-100 (0.1%) was used for cell permeabilization. Blocking solution (2% BSA, 0.1% tween 20) was added to the cells for 1 h. Cells were then incubated overnight at 4\u0026deg;C with recommended dilutions of primary antibodies CD29, CD73, CD105, vimentin and CD45. Alexa fluor 546 goat anti-mouse secondary antibody was added to the cells at a dilution of 1:200 and incubated for 1 h at 37\u0026deg;C. Nuclei were stained with 0.5 \u0026micro;g/mL of diamidino-2-phenylindole (DAPI) and incubated for 10 min at room temperature. Cells were examined under a fluorescence microscope (TE2000 Nikon, Japan) at different magnifications.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2. Flow cytometric analysis\u003c/h2\u003e \u003cp\u003eCell phenotyping was performed by flow cytometric analysis for the detection of specific cell surface markers. Confluent hUCMSCs were washed with PBS twice and detached by using cell dissociation buffer. Primary antibodies (CD73, CD105, vimentin and CD45) were added to the collected cells in the recommended dilutions and incubated at 37\u0026deg;C for 1 h. FACS solution (1% BSA, 1 mM EDTA, 0.1% sodium azide dissolved in PBS) was used for washing. Cells were labeled with Alexa fluor 546 goat anti-mouse secondary antibody at a dilution of 1:200 and analyzed by flow cytometer (FACS Celesta, Becton Dickinson). Unlabeled cells were used as negative control.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Preparation of conditioned medium\u003c/h2\u003e \u003cp\u003eTo prepare conditioned medium, a scratch was introduced into the confluent monolayer of hUCMSCs with a sterile 200 \u0026micro;L tip. Cells were maintained using fresh DMEM at 37℃ for 72 h. The medium was then transferred to a sterile falcon tube and centrifuged at 1000 rpm for 8 min. The supernatant was then collected in a sterile microfuge tube and used as conditioned medium.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.5.1. \u003cem\u003eIn vitro\u003c/em\u003e scratch assay\u003c/h2\u003e \u003cp\u003eRat skin fibroblasts (CRL1213) obtained from the Biobank facility of the ICCBS, were used to develop \u003cem\u003ein vitro\u003c/em\u003e wound. Cells were cultured in T-25 flasks with DMEM. The scratch was introduced in the confluent monolayer of fibroblasts with a 200 \u0026micro;L tip. After scratch induction, conditioned medium of hUCMSCs diluted with DMEM (3:1) was added to the treated group, while the control group was maintained with normal DMEM after scratch induction. Cells were then incubated at 37℃ for 48 h. Under the treatment of conditioned medium, fibroblast migration and healing potential were monitored at 24 and 48 h.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Animals\u003c/h2\u003e \u003cp\u003eMale Wistar rats weighing 180\u0026ndash;250g and having average age of 2\u0026ndash;3 months were used for the development of \u003cem\u003ein vivo\u003c/em\u003e cold burn wound model. These rats were housed in the institutional animal resource facility and maintained at 24\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026ordm;C with a relative humidity of 55% \u0026plusmn; 5% and 12 h light/dark cycle with access to food and water \u003cem\u003ead libitum.\u003c/em\u003e Animals were divided into two groups (control and treated burn wound). Each group was further divided into four subgroups according to the wound healing time points (days 1, 3, 7, and 14) with number of animals in each subgroup\u0026thinsp;=\u0026thinsp;6 (Table\u0026nbsp;1).\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.6.1. Cold burn wound model\u003c/h2\u003e \u003cp\u003eRats were weighed and anesthetized by intraperitoneal injection of ketamine hydrochloride and xylazine hydrochloride with optimized doses of 60 mg/kg and 7 mg/kg, respectively. Hair was removed from the dorsal surface, and skin was disinfected with 70% alcohol. A steel rod (1.5\u0026ndash;2 cm in diameter) was used to produce a single consistent second-degree cold burn wound on the rat skin. Prior to wound induction, the rod was immersed in liquid nitrogen for 10\u0026ndash;15 min, and placed on the skin surface for 10 seconds. After wound induction, diclofenac sodium (25 mg/mL) and antibiotics (penicillin and streptomycin 10,000 U/mL) were administered to the rats \u003cem\u003evia\u003c/em\u003e subcutaneous injection in order to reduce pain and chances of infection, respectively. Wound tissues were harvested from the center of the lesion after euthanizing the animals by an overdose of sodium pentobarbital (200 mg/kg body weight) followed by cervical dislocation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.6.2. Cell tracking\u003c/h2\u003e \u003cp\u003eTo track transplanted cells, DiI dye (5 \u0026micro;M) was used. hUCMSCs were trypsinized \u003cem\u003evia\u003c/em\u003e 1X trypsin-EDTA. The cell pellet was washed twice with 1X PBS. Pellet was resuspended in the dye dissolved in serum free-DMEM and placed in the incubator for 7 min. Complete medium (serum containing DMEM) was then added to inhibit the reaction and cells were centrifuged at 1000 rpm for 8 min. The pellet was again washed twice and resuspended in 300 \u0026micro;L of PBS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.6.3. Transplantation of hUCMSCs\u003c/h2\u003e \u003cp\u003eWhen the skin temperature returned to normal body temperature (after 15 min), 1\u0026ndash;1.5\u0026nbsp;million cells (resuspended in 300 \u0026micro;L of PBS) were subcutaneously injected. Cells were transplanted as a single dose at multiple peripheries of the wound. The area of wound closure was measured using sterile scale and calculated by the following formula;\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e2.6.4. Tissue harvesting\u003c/h2\u003e \u003cp\u003eBurn wound tissues were harvested from control and treated groups and investigated at days 1, 3, 7, and 14. Healing effect of a single dose of implanted cells was examined at the molecular level by temporal gene expression and histological analysis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Temporal gene expression analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from the harvested tissues by using one-step RNA reagent. The concentration of total RNA was determined by measuring the absorbance at 260 nm. To synthesize cDNA, 1 \u0026micro;g of RNA was reverse transcribed \u003cem\u003evia\u003c/em\u003e Revert aid first strand cDNA kit and amplified using bright green 2X qPCR master mix according to manufacturer\u0026rsquo;s instructions. Gene expression of corresponding cytokines (Table\u0026nbsp;2) was analyzed by quantitative real-time PCR (qPCR). Rat GAPDH gene was used as an internal housekeeping control and amplified along with the test genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Histological analysis\u003c/h2\u003e \u003cp\u003eHistological analysis of control and treated burn wound tissues was performed by staining the paraffin sections with hematoxylin \u0026amp; eosin (H \u0026amp; E) and Masson trichrome stains to examine the structural integrity, inflammation, collagen content, and epidermal regeneration after wound induction, as described in the previous studies [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Briefly, rats from all groups were sacrificed and their burn wound tissues were harvested at respective time points (days 1, 3, 7, 14). The harvested tissues were fixed, dehydrated, and embedded in paraffin at 60\u0026deg;C overnight. Tissue sections were cut at 6 \u0026micro;m thickness and transferred onto the gelatin coated glass slides. These sections were deparaffinized with 100% xylene and rehydrated \u003cem\u003evia\u003c/em\u003e gradually decreased concentration of graded isopropanol. The sections were stained with H \u0026amp; E and Masson trichrome and observed at different magnifications under bright field microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Immunohistochemical analysis\u003c/h2\u003e \u003cp\u003eBurn wound tissues of both groups were further analyzed by immunohistochemical staining to evaluate tissue vasculature and angiogenesis at day 14 of burn wound induction. Paraffin-embedded sections were deparaffinized in xylene, rehydrated in a gradually decreased concentration of isopropanol, and processed for the antigen retrieval step. Antigen retrieval of was performed by immersing the sections in citrate buffer at 95\u0026deg;C for 20 min. Permeabilization and blocking were performed with 0.5% triton-X-100 and blocking solution, respectively. Sections were incubated overnight at 4\u0026deg;C with primary antibody against α-smooth muscle actin (α-SMA) at a dilution of 1:100. Alexa fluor 488 goat anti-mouse secondary antibody was added to each section at 1:200 dilutions for 1 h at 37\u0026deg;C. DAPI was used to stain the nuclei. Images were captured at different magnifications under a fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using SPSS software (IBM statistics 21). The comparison between control and treated groups was performed by Student\u0026rsquo;s t-test. Data of all experiments were stated as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM and p-value\u0026thinsp;\u0026le;\u0026thinsp;0.05 was considered statistically significant (*** = p\u0026thinsp;\u0026le;\u0026thinsp;0.001, ** = p\u0026thinsp;\u0026le;\u0026thinsp;0.01 and * = p\u0026thinsp;\u0026le;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Morphological characteristics of isolated hUCMSCs\u003c/h2\u003e \u003cp\u003eMSCs isolated from human umbilical cord tissue were identified on the basis of their specific morphological features. After 10 days of isolation, cells migrated from the tissue explants and adhered to the flask surface. Isolated cells represented a homogenous population of MSCs in monolayer and showed rapid adherence to the plastic surface, with spindle-shaped fibroblast like morphology. They were termed as early passage 0 (P0). Later, when hUCMSCs proliferated upto 80% confluence, they were subcultured to passages P1 and P2, which subsequently showed widened and flattened morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Characterization of hUCMSCs\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.3. \u003cem\u003eIn vitro\u003c/em\u003e wound healing assessment (Scratch assay)\u003c/h2\u003e \u003cdiv id=\"Sec24\" class=\"Section3\"\u003e \u003ch2\u003e3.3.1. Microscopic analysis of wound closure\u003c/h2\u003e \u003cp\u003eWound healing potential of hUCMSCs was analyzed \u003cem\u003ein vitro\u003c/em\u003e by scratch assay. The area of wound closure was measured at 24 and 48 h in the presence of conditioned medium of hUCMSCs. Quantitative microscopic analysis showed enhanced cell migration and significant reduction in the scratch area (wound closure) in case of conditioned medium as compared to the normal control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Statistical analysis showed that the scratch area was significantly reduced in the treated group after 48 h as compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.4. \u003cem\u003eIn vivo\u003c/em\u003e wound healing assessment\u003c/h2\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003e3.4.1. Macroscopic examination of wound closure\u003c/h2\u003e \u003cp\u003eMeasurement of wound closure at different time points was performed as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, C. The treated group showed significant reduction in wound area after transplantation of hUCMSCs as compared to the control. The immediate response of the skin was also noted after cold injury; the exposed area remained frozen for a certain time period (1 min) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Burn wound tissues were further examined to observe the extent of damages on the skin architecture. Control burn wound tissue showed destruction of the skin with extensive inflammation at days 1 and 3. Wound tissue at day 7 also showed inflammation and necrosis. At day 14, a thin and dry scab and granulation tissue formation were observed in the center of the wound lesion. Treated burn wound transplanted with hUCMSCs showed accelerated wound regeneration earlier than day 14 in comparison to the control. After transplantation, scab was observed at day 7 which exhibited granulation tissue formation. The scab was removed at day 14 and hair formation around the edge of the wounds was also noted. Burn wound tissue with transplanted hUCMSCs showed less inflammatory response, enhanced wound contraction, and improved tissue granulation with better skin architecture.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003e3.4.2. hUCMSC homing and migration\u003c/h2\u003e \u003cp\u003eCells were labeled with DiI dye and transplanted into the \u003cem\u003ein vivo\u003c/em\u003e burn wound model. After transplantation, cell viability, homing, and migration were observed after day 7 of burn wound induction. hUCMSCs homed at the peripheries of the wound site and restricted to the epidermis layer. Few transplanted cells were also observed in the deep wound which showed their migration towards injury (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section3\"\u003e \u003ch2\u003e3.4.3. Gene expression related to wound healing phases\u003c/h2\u003e \u003cp\u003eTemporal change in gene expression of wound tissues at days 1, 3, 7, and 14 was analyzed as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. Examination of hUCMSC treated burn wound tissues showed increased expression of anti-inflammatory cytokine (IL-13) at day 1, but its significant reduction was noted at day 3. Subsequent reduction in the expression of inflammatory cytokines (IL-6 and IL-1β) was noted on days 1 and 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Temporal change in the gene expression of pro/angiogenic cytokines was also observed following treatment. VEGF was upregulated at day 1 but significantly downregulated at days 3 and 7. bFGF was significantly decreased at days 1, 3 and 7. TGF-β showed significant decrease at days 1 and 14, and significant increase at day 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). EGF and MMP9 remodeling cytokines released during the late healing (remodeling) phase, also showed varied expression. EGF, involved in re-epithelization, was significantly reduced at day 7, but significantly increased at day 14. MMP9, a remodeling cytokine, showed increased expression at day 7 but it is significantly decreased at day 14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). The basal gene level of these cytokines was also examined in normal rat skin and compared with that of wound tissues. Inflammatory markers were significantly increased in burn wound tissues as compared to the normal skin tissue indicating no inflammation in the normal physiological condition (supplementary image; Fig. S1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Histological findings of burn wound tissues\u003c/h2\u003e \u003cp\u003eBurn wound tissues along with normal skin were assessed by histological examination and quantification as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Histological analysis of normal skin showed intact collagen with intact layers of the skin (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The findings confirmed the acquisition of second degree cold burn wound as the epidermal and dermal layers were damaged. Wound tissues at day 1 showed inflammation along with distorted collagen and skin adnexa (hair follicles, sebaceous glands with injured epithelium). At day 3, destruction of epidermis with extensive inflammation around wound peripheries was observed. At day 7, burn wound tissues exhibited partially damaged epidermis and basement membrane with incomplete re-epithelialization. At day 14 (last phase of wound healing) reformation of epidermis, skin adnexa with the presence of distorted collagen and inflamed hair follicles, were observed. At this point, histological analysis exhibited incomplete wound regeneration. Wound tissues transplanted with hUCMSCs demonstrated dense collagen without the detachment of basement membrane and less inflammation at day 1. From day 3 to day 7, compact collagen, regenerated epidermis, and skin adnexa with the formation of new blood vessels were also noted. Histological examination of the healed wound at day 14 showed complete regeneration and re-epithelialization indicated by a flattened thick layer of keratinocytes with intact epidermis and basement membrane (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB and C). These findings were further confirmed by quantification \u003cem\u003evia\u003c/em\u003e Image J software. The parameters including epidermal edges/thickness, area of tissue granulation, collagen content, and presence of skin adnexa (hair follicles) showed significant upregulation in hUCMSC treated burn wound tissues as compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec30\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Analysis of wound tissue by immunohistochemistry\u003c/h2\u003e \u003cp\u003eBurn wound tissues of control and hUCMSC treated groups were further examined by immunohistochemical staining for α-SMA to evaluate tissue angiogenesis as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. Increased number of blood vessels in hUCMSC treated burn wound tissue revealed enhanced neovascularization as compared to the control.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn this study, we have successfully developed a consistent cold-induced burn wound model in rats and investigated the progress of wound healing at particular time points; days 1, 3, 7, and 14. hUCMSCs were transplanted at the burn wound site and healing potential was analyzed. The findings showed that the duration of wound healing was significantly reduced after cell transplantation in treated group as compared to the untreated control group. Previous studies demonstrate that \u003cem\u003ein vivo\u003c/em\u003e transplanted hUCMSCs migrate to the site of injury through chemotaxis and regulate the microenvironment of the wound area [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Therefore, to examine the homing / migration of hUCMSCs, we transplanted labeled cells and tracked these cells at day 7 after burn wound induction. We found that transplanted cells homed to the site of injury and migrated preferentially towards the wound bed.\u003c/p\u003e \u003cp\u003eCell migration and proliferation are considered key underlying processes in wound healing which mainly occur due to the effect of wound healing growth (paracrine) factors. The role of paracrine factors secreted by hUCMSCs could be crucial in wound healing as they influence cell migration towards wound site, thus promoting wound repair and regeneration [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Locally transplanted hUCMSCs reduce inflammation by decreasing the levels of pro-inflammatory and inflammatory cytokines i.e. TNF-α, IL-1-β, IL-6, while accelerating wound closure by increasing the levels of cytokines involved in regeneration i.e. VEGF, TGF-β, FGF, EGF, MMP-9, etc [ 24, 27]. To confirm this, we harvested wound tissues at initial days when inflammation was at its peak. This was clearly observed in the burn wound group which showed increased level of inflammatory cytokines (IL-1β and IL-6). On the other hand, the expression levels of inflammatory cytokines (IL-1β and IL-6) were significantly decreased, while that of anti-inflammatory cytokine (IL-13) was increased in the treated group, due to immediate MSC transplantation. IL-13 is upregulated in response to inflammation. It is a positive therapeutic response of the transplanted MSCs to overcome excessive inflammation around the wound site by secreting anti-inflammatory cytokines.\u003c/p\u003e \u003cp\u003eWe also assessed the indirect healing effect of hUCMSCs by inducing \u003cem\u003ein vitro\u003c/em\u003e wound \u003cem\u003evia\u003c/em\u003e scratch assay using rat skin fibroblasts. Conditioned medium of hUCMSCs was used to see whether it enhances the migration of fibroblasts towards the scratch and promotes wound healing. Various studies suggest that the conditioned medium contains growth factors or paracrine mediators which facilitate cells to migrate towards the wound site and help in wound contraction [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Our findings are positively correlated with the reported studies as fibroblasts treated with conditioned medium have shown significantly accelerated cell migration towards the injury site and enhanced wound closure as compared to the untreated fibroblasts.\u003c/p\u003e \u003cp\u003eThe process of wound healing comprises multiple phases [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Along with the normal wound healing process, angiogenesis begins instantly after injury at the early phase. It mediates the restoration of a new vasculature of the injured tissue during the entire wound healing process [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Contribution of multiple cytokines such as VEGF, PDGF, FGF, TGF-β, Ang-1, HGF, has been reported as the angiogenesis begins [ 19, 33]. In our study, we analyzed gene expression of various cytokines corresponding to the multiple phases of wound healing. Our findings show that treatment with hUCMSCs resulted in increased expression of VEGF, FGF, EGF, TGF-β, IL-13, and MMP-9 (pro-angiogenic, angiogenic, and remodeling cytokines), while IL-1-β and IL-6 (inflammatory cytokines) were decreased. We also found upregulation of VEGF at day 1 and downregulation at days 3 and 7. Process of angiogenesis initiates as wound healing begins as demonstrated by the upregulation of VEGF receptors by the action of thrombin. This action promotes local termination of the basement membrane through which endothelial cells migrate and proliferate into the wound bed [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Its downregulation at later time points might indicate lack of proper vasculature, while slight upregulation represents restoration of angiogenesis or neovascularization induced by the effect of TGFβ. Cyclooxygenase-2 (COX \u0026minus;\u0026thinsp;2) which is stimulated during the initial phase of wound healing also promotes the production of VEGF and other stimulators of angiogenesis. It has also been shown that after the proliferative phase, angiogenesis is again stimulated by the activation of TGFβ which also regulates cell proliferation, cell migration, capillary tube formation, ECM deposition and the formation of tissue granulation. Thus, TGFβ is considered an important regulator of angiogenesis during the entire wound healing process [32,33]. We also found upregulation of MMP-9 in the proliferation phase. It is a remodeling cytokine also known as type 4 collagenase, which accelerates re-epithelization by the degradation of the damaged basement membrane and allows migration of various types of cells into the wound bed [ 34, 35]. The expression of MMP-9 is also reported to be transiently upregulated at the proliferative phase in case of an acute injury but as the wound heals, it returns to its basal level [34,36].\u003c/p\u003e \u003cp\u003eWe further investigated protein expression of α-SMA in burn wound tissues of both control and hUCMSC treated groups \u003cem\u003evia\u003c/em\u003e immunohistochemical staining. α-SMA is positively expressed on different cell types i.e. myofibroblasts, blood vessels, endothelial cells, hair follicles, etc. Myofibroblasts are considered intermediate between smooth muscle cells and fibroblasts [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. They play a crucial role in wound contraction during the proliferation phase which is considered as the hallmark of healthy wound healing [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. We observed an increase in blood vessel density with positive expression of α-SMA in the hUCMSC treated burn wound tissues at day 14, i.e. the remodeling phase. We also observed migration of stained infiltrated cells to the wound bed and enhanced neovascularization with increased number of blood vessels in the treated burn wound tissues as compared to the control.\u003c/p\u003e \u003cp\u003eHistological analysis of burn wound tissues at days 1, 3, 7, and 14 further confirmed our macroscopic analysis. It further confirms the successful development of second-degree burn wound as indicated by the destruction of epidermis and dermis layers. In the case of control burn wound tissues at days 1 and 3, extensive destruction of epidermal and dermal layers was observed, while inflamed hair follicles and loose collagen network were observed at day 7, and cellular infiltration with incomplete re-epithelialization at day 14. In contrast, burn wounds treated with hUCMSCs showed intact epidermis with less inflammation at day 1. It can be considered as the positive impact of the transplanted cells during the inflammatory phase. The findings also showed positive results in the treated burn wounds at days 7 and 14. We observed enhanced neovascularization at day 7 with regenerated skin adnexa and epidermis, while complete re-epithelialization was also noted at day 14.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eIt is concluded from this study that locally transplanted hUCMSCs promote wound healing by creating a favorable microenvironment \u003cem\u003evia\u003c/em\u003e the secretion of wound healing factors around wound site. Conditioned medium enriched in wound healing mediators released by hUCMSCs under stress condition enhances the process of wound repair, as evident by the \u003cem\u003ein vitro\u003c/em\u003e scratch wound assay. Molecular insight into the mechanism of \u003cem\u003ein vivo\u003c/em\u003e burn wound healing revealed that hUCMSCs enhance the time of wound closure by promoting the anti-inflammatory response and neovascularization process. To the best of our knowledge, this is the first preclinical study where the effect of a single dose of transplanted hUCMSCs was evaluated at the local wound site of a second degree cold-induced burn wound. However, further analysis of wound healing mediators at the protein level is required to improve our understanding of the wound healing process and designing of the future clinical studies and clinical trials for both acute and chronic burn injuries in humans.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eHuman Umbilical Cord (hUC), Human Umbilical Cord Mesenchymal Stem Cells (hUCMSCs), Mesenchymal Stem Cells (MSCs), Quantitative Polymerase Chain Reaction (qPCR), Polymorphonucleocytes (PMN), Alpha Smooth Muscle Actin (\u0026alpha;-SMA), Extracellular Matrix (ECM), Transforming growth factor-beta (TGF-\u0026beta;), Tumor Necrosis Factor-alpha (TNF-\u0026alpha;), Vascular Endothelial Growth Factor (VEGF), Cyclooxygenase-2 (COX-2), Epidermal Growth Factor (EGF), Matrix Metalloproteinase (MMP-9), Insulin Growth Factor (IGF), Phosphate Buffered Saline (PBS), Fetal Bovine Serum (FBS), Independent Ethical Committee (IEC), Animal Study Protocol (ASP), Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompliance with Ethical Standards:\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eAll animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC) and assigned the Animal Study Protocol (ASP) number\u0026nbsp;2020-010.\u003c/p\u003e\u003cp\u003eFor the use of human samples, the study was approved by the Institutional Ethics Committee (IES) and assigned the number (IEC/ ICCBS-036-HT-2018/Protocol/1.0). \u0026nbsp;Informed consents were obtained by the donors prior to sample acquisition.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConflict-of-interest:\u003c/strong\u003e The authors have nothing to disclose.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eData availability:\u003c/strong\u003e The authors have disclosed original data in this manuscript. \u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eFunding information:\u0026nbsp;\u003c/strong\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eHuman umbilical cord samples were provided by\u0026nbsp;Zainab Panjwani Memorial Hospital. Cell line CRL-1213 was provided by the Biobank facility of\u0026nbsp;Dr. Panjwani Center for Molecular Medicine and Drug Research, International Center for Chemical and Biological Sciences, University of Karachi.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlmeida BMD, Nascimento MFD, Pereira-Filho RN, Melo GCD, Santos JCD, Oliveira CRD, Albuquerque-J\u0026uacute;nior RLCD (2014) Immunohistochemical profile of stromal constituents and lymphoid cells over the course of wound healing in murine model. Acta Cir Bras 29(9):596\u0026ndash;602. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/s0102-8650201400150007\u003c/span\u003e\u003cspan address=\"10.1590/s0102-8650201400150007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang D, Scharffetter-Kochanek K (2020) Mesenchymal stem cells adaptively respond to environmental cues thereby improving granulation tissue formation and wound healing. Front Cell Dev Biol 8:1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2020.00697\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2020.00697\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArno AI, Amini-Nik S, Blit H, Al-Shehab M, Belo C, Herer E, Jeschke MG (2014) Human Wharton\u0026rsquo;s jelly mesenchymal stem cells promote skin wound healing through paracrine signaling. Stem Cell Res Ther 5(1):28\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/scrt417\u003c/span\u003e\u003cspan address=\"10.1186/scrt417\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAryan A, Bayat M, Bonakdar S, Taheri S, Haghparast N, Bagheri M, Abdollahifar MA (2018) Human bone marrow mesenchymal stem cell conditioned medium promotes wound healing in deep second-degree burns in male rats. Cells Tissues Organs 206(6):317\u0026ndash;329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000501651\u003c/span\u003e\u003cspan address=\"10.1159/000501651\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAslam S, Khan I, Jameel F, Zaidi MB, Salim A (2020) Umbilical cord-derived mesenchymal stem cells preconditioned with isorhamnetin: potential therapy for burn wounds. World J Stem Cells 12(12):1652\u0026ndash;1666. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4252/wjsc.v12.i12.1652\u003c/span\u003e\u003cspan address=\"10.4252/wjsc.v12.i12.1652\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampbell KE, Baronoski S, Gloeckner M, Holloway S, Idensohn P, Langemo D, LeBlanc K (2018) Skin tears: prediction, prevention, assessment and management. Nurse Prescribing 16(12):600\u0026ndash;607. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12968/npre.2018.16.12.600\u003c/span\u003e\u003cspan address=\"10.12968/npre.2018.16.12.600\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCatar R, Moll G, Hosp I, Simon M, Luecht C, Zhao H, Wu D, Chen L, Kamhieh-Milz J, Korybalska K, Zickler D (2021) Transcriptional regulation of thrombin-induced endothelial VEGF induction and proangiogenic response. Cells 10(4):910. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells10040910\u003c/span\u003e\u003cspan address=\"10.3390/cells10040910\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDehkordi AN, Babaheydari FM, Chehelgerdi M, Dehkordi SR (2019) Skin tissue engineering: wound healing based on stem-cell-based therapeutic strategies. Stem Cell Res Ther 10(1):111\u0026ndash;131. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-019-1212-2\u003c/span\u003e\u003cspan address=\"10.1186/s13287-019-1212-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDolp R, Eylert G, Auger C, Aijaz A, Chen YA, Amini-Nik S, Parousis A, Datu AK, Jeschke MG (2021) Biological characteristics of stem cells derived from burned skin\u0026mdash;a comparative study with umbilical cord stem cells. Stem Cell Res Ther 12(1):1\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-021-02140-z\u003c/span\u003e\u003cspan address=\"10.1186/s13287-021-02140-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong L, Hao H, Liu J, Ti D, Tong C, Hou Q, Han W (2017) A conditioned medium of umbilical cord mesenchymal stem cells overexpressing Wnt7a promotes wound repair and regeneration of hair follicles in mice. Stem Cells Int 1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2017/3738071\u003c/span\u003e\u003cspan address=\"10.1155/2017/3738071\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhieh F, Jurjus R, Ibrahim A, Geagea AG, Daouk H, El Baba B, Jurjus A (2015) The use of stem cells in burn wound healing: a review. BioMed Res Int 7(2):1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2015/684084\u003c/span\u003e\u003cspan address=\"10.1155/2015/684084\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHonnegowda TM, Kumar P, Udupa EGP, Kumar S, Kumar U, Rao P (2015) Role of angiogenesis and angiogenic factors in acute and chronic wound healing. Plast Aesthet Res 2(4):243\u0026ndash;249. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/2347-9264.165438\u003c/span\u003e\u003cspan address=\"10.4103/2347-9264.165438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu MS, Borrelli MR, Lorenz HP, Longaker MT, Wan DC (2018) Mesenchymal stromal cells and cutaneous wound healing: a comprehensive review of the background, role, and therapeutic potential. Stem Cells Int 1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2018/6901983\u003c/span\u003e\u003cspan address=\"10.1155/2018/6901983\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu MS, Leavitt T, Malhotra S, Duscher D, Pollhammer MS, Walmsley GG, Longaker MT Stem cell-based therapeutics to improve wound healing.Plast. Surg. Int. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2015/383581\u003c/span\u003e\u003cspan address=\"10.1155/2015/383581\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImray C, Grieve A, Dhillon S, Caudwell Xtreme Everest Research Group (2009) Cold damage to the extremities: frostbite and non-freezing cold injuries. Postgrad Med J 85(1007):481\u0026ndash;488. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/pgmj.2008.068635\u003c/span\u003e\u003cspan address=\"10.1136/pgmj.2008.068635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJamadagni PS, Jamadagni S, Mukherjee K, Upadhyay S, Gaidhani S, Hazra J (2016) Experimental and histopathological observation scoring methods for evaluation of wound healing properties of Jatyadi Ghrita. AYU 37:222\u0026ndash;229. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/ayu.AYU_51_17\u003c/span\u003e\u003cspan address=\"10.4103/ayu.AYU_51_17\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 3\u0026ndash;4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeschke MG, Rehou S, McCann MR, Shahrokhi S (2019) Allogeneic mesenchymal stem cells for treatment of severe burn injury. Stem Cell Res Ther 10(1):1\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-019-1465-9\u003c/span\u003e\u003cspan address=\"10.1186/s13287-019-1465-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhalid RS, Khan I, Zaidi MB, Naeem N, Haneef K, Qazi REM, Salim A IL-7 overexpression enhances therapeutic potential of rat bone marrow mesenchymal stem cells for diabetic wounds.Wound Repair Regen.27,235\u0026ndash;248. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/wrr.12706\u003c/span\u003e\u003cspan address=\"10.1111/wrr.12706\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKusindarta DL, Wihadmadyatami H, Fibrianto YH, Nugroho WS, Susetya H, Musana DK, Wahyuni AETH (2016) Human umbilical mesenchymal stem cells conditioned medium promote primary wound healing regeneration. Vet World 9(6):605\u0026ndash;610. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.14202/vetworld.2016.605-610\u003c/span\u003e\u003cspan address=\"10.14202/vetworld.2016.605-610\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu JS, Du J, Cheng X, Zhang XZ, Li Y, Chen XL (2019) Exosomal miR-451 from human umbilical cord mesenchymal stem cells attenuates burn-induced acute lung injury. J Chin Med Assoc 82(12):895\u0026ndash;901. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/JCMA.0000000000000189\u003c/span\u003e\u003cspan address=\"10.1097/JCMA.0000000000000189\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Yu Y, Hou Y, Chai J, Duan H, Chu W, Du J (2014) Human umbilical cord mesenchymal stem cells transplantation promotes cutaneous wound healing of severe burned rats. PLoS ONE 9(2):e88348. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0088348\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0088348\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichopoulou A, Montmasson M, Garnier C, Lambert E, Dayan G, Rousselle P (2020) A novel mechanism in wound healing: Laminin 332 drives MMP9/14 activity by recruiting syndecan-1 and CD44. Matrix Biol 94:1\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.matbio.2020.06.004\u003c/span\u003e\u003cspan address=\"10.1016/j.matbio.2020.06.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNizamoglu M, Tanm A, Vickersm T, Segarenm N, Barnesm D, Dziewulskim P (2016) Cold burn injuries in the UK: the 11-year experience of a tertiary burns center. Burns Trauma 4(1):36\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s41038-016-0060-x\u003c/span\u003e\u003cspan address=\"10.1186/s41038-016-0060-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNuutila K, Samandari M, Endo Y, Zhang Y, Quint J, Schmidt TA, Sinha I (2021) In vivo printing of growth factor-eluting adhesive scaffolds improves wound healing. Bioactive Mater 8:296\u0026ndash;308. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp:/ doi.org/10.1016/j.bioactmat.2021.06.030\u003c/span\u003e\u003cspan address=\"http:// 10.1016/j.bioactmat.2021.06.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh EJ, Lee HW, Kalimuthu S, Kim TJ, Kim HM, Baek SH, Zhu L, Oh JM, Son SH, Chung HY, Ahn BC (2018) In vivo migration of mesenchymal stem cells to burn injury sites and their therapeutic effects in a living mouse model. J Control Release 79:79\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jconrel.2018.04.020\u003c/span\u003e\u003cspan address=\"10.1016/j.jconrel.2018.04.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePadeta I, Nugroho WS, Kusindarta DL, Fibrianto YH, Budipitojo T (2017) Mesenchymal stem cell-conditioned medium promote the recovery of skin burn wound. Asian J Anim Vet Adv 12(3):132\u0026ndash;141. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3923/ajava.2017.132.141\u003c/span\u003e\u003cspan address=\"10.3923/ajava.2017.132.141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatel S, Srivastava S, Singh MR, Singh D (2019) Mechanistic insight into diabetic wounds: Pathogenesis, molecular targets and treatment strategies to pace wound healing. Biomedical Pharmacother 112:108615. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2019.108615\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2019.108615\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRam M, Singh V, Kumawat S, Kumar D, Lingaraju MC, Singh TU, Kumar D (2015) Deferoxamine modulates cytokines and growth factors to accelerate cutaneous wound healing in diabetic rats. Eur J Pharmacol 764:9\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejphar.2015.06.029\u003c/span\u003e\u003cspan address=\"10.1016/j.ejphar.2015.06.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodgers K, Jadhav SS (2018) The application of mesenchymal stem cells to treat thermal and radiation burns. Adv Drug Deliv Rev 123:75\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.addr.2017.10.003\u003c/span\u003e\u003cspan address=\"10.1016/j.addr.2017.10.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahman MS, Islam R, Rana MM, Spitzhorn LS, Rahman MS, Adjaye J, Asaduzzaman SM (2019) Characterization of burn wound healing gel prepared from human amniotic membrane and Aloe vera extract. BMC Complement Altern Med 19(1):1\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp:/doi.org/10.1186/s12906-019-2525-5\u003c/span\u003e\u003cspan address=\"10.1186/s12906-019-2525-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRowan MP, Cancio LC, Elster EA, Burmeister DM, Rose LF, Natesan S, Chung KK Burn wound healing and treatment: review and advancements. Crit. Care 19, 243\u0026ndash;255. https://doi.org/.1186/s13054-015-0961-2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen C, Lie P, Miao T, Yu M, Lu Q, Feng T, Li H (2015) Conditioned medium from umbilical cord mesenchymal stem cells induces migration and angiogenesis. Mol Med Rep 120\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/mmr.2015.3409\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2015.3409\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiddiqui E, Zia N, Feroze A, Awan S, Ali AL, Razzak JA, Latif A (2015) Burn injury characteristics: findings from the Pakistan national emergency department surveillance study. \u003cem\u003eBMC Emergency Medicine\u003c/em\u003e 2015; 15(2): 1\u0026ndash;7. https://doi.org/26692165\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun J, Zhang Y, Song X, Zhu J, Zhu Q (2019) The healing effects of conditioned medium derived from mesenchymal stem cells on radiation-induced skin wounds in rats. Cell Transpl 28(1):105\u0026ndash;115. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0963689718807410\u003c/span\u003e\u003cspan address=\"10.1177/0963689718807410\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalter MN, Wright KT, Fuller HR, MacNeil S, Johnson WEB (2010) Mesenchymal stem cell-conditioned medium accelerates skin wound healing: an in vitro study of fibroblast and keratinocyte scratch assays. Exp Cell Res 316(7):1271\u0026ndash;1281. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.yexcr.2010.02.026\u003c/span\u003e\u003cspan address=\"10.1016/j.yexcr.2010.02.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoon D, Cho YS, Joo SY, Seo CH, Cho YS (2020) A clinical trial with a novel collagen dermal substitute for wound healing in burn patients. Biomater Sci 8(3):823\u0026ndash;829. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/c9bm01209e\u003c/span\u003e\u003cspan address=\"10.1039/c9bm01209e\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1: Experimental groups\u003c/p\u003e\n\u003ctable border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"322\"\u003e\n\u003cp\u003eGroups\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eTime points (days)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"137\"\u003e\n\u003cp\u003eNumber of rats x Time points\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"322\"\u003e\n\u003cp\u003eModel optimization\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e__\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"137\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"322\"\u003e\n\u003cp\u003eBurn wound with no treatment\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e1, 3, 7, 14\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"137\"\u003e\n\u003cp\u003e6\u0026times;4\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"322\"\u003e\n\u003cp\u003eBurn wound treated with hUCMSCs\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e1, 3, 7, 14\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"137\"\u003e\n\u003cp\u003e6\u0026times;4\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"322\"\u003e\n\u003cp\u003eTotal number of animals\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"137\"\u003e\n\u003cp\u003en=58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2: Targeted genes with their specific primer sequences and annealing temperatures\u003c/p\u003e\n\u003ctable border=\"1\" width=\"714\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eGenes\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n\u003cp\u003e(Forward)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n\u003cp\u003e(Reverse)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003eAnnealing Temperature\u003c/p\u003e\n\u003cp\u003e(\u0026deg;C)\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eGAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eGGAAAGCTGTGGCGTGATGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eGTAGGCCATGAGGTCCACCA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eIL-1\u0026beta;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eTCATCTTTGAAGAAGAGCCCGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eGTTCTGTCCATTGAGGTGGAGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eIL-6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eGATGGATGCTTCCAAACTGGATA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eTGAATGACTCTGGCTTTGTCTTT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eIL-13\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eTGGCTCTCGCTTGCCTT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eGCCAGCTGTCAGGTCCA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eTGF- \u0026beta;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eCACTGCTCTTGTGACAGCAAA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eCGGTTCATGTCATGGATGGTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eVEGF-A\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eCCAATTGAGACCCTGGTGGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eTCCTATGTGCTGGCTTTGGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eFGF-2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eAGCAGAAGAGAGAGGAGTTGTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eTATTTCCGTGACCGGTAAGTGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eEGF\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eTAACGGGCCTGACAGCA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eTGCACTGGCCCGAGTTA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"74\"\u003e\n\u003cp\u003eMMP-9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"266\"\u003e\n\u003cp\u003eTACCAGCTACTCGAACCAATCA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"262\"\u003e\n\u003cp\u003eAAATAAAAGGGCCGGTAAGGTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"113\"\u003e\n\u003cp\u003e58\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\" width=\"714\"\u003e\n\u003cp\u003eGAPDH: Glyceraldehydes-3-phosphate dehydrogenase, IL-1\u0026beta;: Interleukin-1 beta,\u0026nbsp; IL-6: Interleukin 6, IL-13: Interleukin 13, TGF-\u0026beta;: Transforming growth factor-beta, VEGF: Vascular endothelial growth factor, FGF: Fibroblast growth factor, EGF: Epidermal growth factor, MMP-9: Matrix metalloproteinase\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cold burn injury, Scratch assay, hUCMSCs, Wound healing","lastPublishedDoi":"10.21203/rs.3.rs-2546357/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2546357/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Time-dependent initiation of wound healing phases and their associated healing mediators are crucial for injured skin regeneration. Mesenchymal stem cells (MSCs) secrete various paracrine factors which aid in wound healing \u003cem\u003evia\u003c/em\u003e acceleration of cell migration, angiogenesis, tissue granulation, and modulation of inflammation at the wound site.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective: \u003c/strong\u003eThis study was aimed to investigate thetherapeutic effect of human umbilical cord MSCs (hUCMSCs) in the regeneration of cold-induced burn wound model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003ehUCMSCs were characterized by immunocytochemistry and flow cytometry. Scratch assay was performed using rat skin fibroblasts treated with conditioned medium of hUCMSCs. An \u003cem\u003ein vivo\u003c/em\u003e cold burn wound model was developed and hUCMSCs were locally transplanted. Macroscopic analysis of wound closure was done at days 1, 3, 7 and 14 corresponding to wound healing phases. Gene expression, histology and immunohistochemical analysis were performed to confirm complete wound repair.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eWe observed a significant reduction in the scratch area in the treated group as compared to the control. Wound area was remarkably reduced in the burn wound model transplanted with hUCMSCs well before the end of the experimental period (day 14). Histology showed intact collagen with regenerated epidermis, dermis and hair follicles, while immunohistochemistry showed enhanced angiogenesis in the last phase of healing in the treated group. Temporal gene expression showed significant reduction in inflammatory cytokines and upregulation of pro/angiogenic and remodeling cytokines at particular time points.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eIt is concluded from this study that hUCMSCs accelerate wound closure with enhanced neovascularization and reduced inflammation in rat dermal wounds.\u003c/p\u003e","manuscriptTitle":"Regeneration Potential of Mesenchymal Stem Cells in Cold Induced Burn Wounds","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-02-15 15:49:35","doi":"10.21203/rs.3.rs-2546357/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4573e063-967b-4e12-9769-bf01053bdf56","owner":[],"postedDate":"February 15th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-03-16T10:33:40+00:00","versionOfRecord":[],"versionCreatedAt":"2023-02-15 15:49:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2546357","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2546357","identity":"rs-2546357","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-06-02T02:00:03.124865+00:00
License: CC-BY-4.0