IGFBP3-mediated M2 Macrophage Polarization Enhances Resistance to Rosiglitazone and Cisplatin in Breast Cancer

IGFBP3-mediated M2 Macrophage Polarization Enhances Resistance to Rosiglitazone and Cisplatin in Breast Cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article IGFBP3-mediated M2 Macrophage Polarization Enhances Resistance to Rosiglitazone and Cisplatin in Breast Cancer Chunyi Gao, Gang Li, Tianhui Hu, Wang Guohua This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5174260/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Rosiglitazone (PPARγ agonist, RGZ) combined with chemotherapy drugs has proven effective in treating clinical breast cancer patients. However, the underlying targets and resistance mechanisms remain unclear, posing challenges in maintaining long-term efficacy. This study aimed to investigate the mechanisms of RGZ in macrophage polarization and evaluate its effects within the TME. Methods In vivo experiments were conducted using a patient-derived xenograft (PDX) nude mouse model resistant to chemotherapy, which simulates the clinical immune microenvironment. In vitro, the Thp-1 human monocytic cell line was induced to differentiate into macrophages and cocultured with MDA-MB-468 breast cancer cells. The effects of PPARγ agonists on the drug resistance of breast cancer cells in a coculture model were explored. Results An increase in M2 macrophages was observed in combination-resistant mice, with PPARγ activation by RGZ inducing macrophage differentiation toward the M2 phenotype. Knockdown of IGFBP3 in macrophages alleviated breast cancer cell resistance in the microenvironment by reversing polarization. Conclusion Our study revealed that targeting macrophage polarization through IGFBP3 can reverse the effects of PPARγ on macrophage polarization, promote cancer cell apoptosis and collectively reverse the resistance of tumor cells to combination therapy. These findings provide a new theoretical basis for anti-breast cancer treatment. macrophage polarization PPARγ IGFBP3 combination therapy resistance breast cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Breast cancer is the most commonly diagnosed malignancy in women, and its burden has been increasing globally [1]. Surgery is the mainstay of breast cancer therapy; however, it also causes some side effects, including lymphoedema and psychosocial fallout [2]. Therefore, exploring new and effective approaches is crucial for breast cancer treatment. Peroxisome proliferator-activated receptor gamma (PPARγ) is a ligand-activated nuclear receptor [3]. PPARγ agonists, such as rosiglitazone (RGZ) and pioglitazone, are used to treat type 2 diabetes (T2D) with insulin resistance (IR) [4]. These drugs have clinical importance because of their widespread and safe use in treating hypercholesterolemia (hyperlipidemia) and diabetes. The safety and cost-effectiveness of these drugs make them promising candidates for repurposing to inhibit tumor growth. In previous studies, RGZ displayed an antitumor effect in preclinical studies but a beneficial limit effect in breast cancer clinical trials [5, 6]. This could be due to the antagonism of cell-specific effects between tumor cells and immune cells [7]. Tumor-associated macrophages (TAMs) constitute the major component of all immune cells present in the tumor microenvironment (TME) [8], constituting up to 50% of the tumor mass in most human solid tumors, including breast cancer [9]. TAMs can change their phenotype in response to stimuli from the surrounding TME [10, 11]. In general, macrophages are immunoregulatory and suppress immune responses to tumor-derived antigens [12]. Even worse, they can induce resistance to multiple treatments in preclinical breast cancer models [13–15]. In some specific situations, macrophages can be antitumoral, offering support such as the suppression of angiogenesis or the stimulation of the T-cell response [16, 17]. However, the role of transferring macrophages remains unclear, and a better understanding of the polarization of macrophages in breast tumors will contribute to the further development of cancer immunotherapies. In the present study, a chemoresistant PDX nude model with an anti-inflammatory and tumor-promoting phenotype of TAMs and M2 macrophages that advanced gradually was established. In addition, the effects of chemotherapy combined with RGZ on breast tumor cells were analyzed. RGZ also promotes the transformation of macrophages to the beneficial type of tumor. The potential mechanism of RGZ in the regulation of macrophage polarization in breast cancer was subsequently explored through the activation of IGFBP3, which is driven by PPARγ. These findings suggest that IGFBP3 is a potential target for TAM immunotherapy in breast cancer. Methods Mice In this study, female BALB/c background nude mice (Shanghai Experimental Animal Center, Chinese Academy of Sciences, China) from 4--6 weeks were selected to establish a PDX model. The experimental mice were housed in individual ventilated cages under specific-pathogen-free conditions. All animal care and experimental protocols were carried out according to the Chinese Animal Management Rules of the Ministry of Health. All of the procedures were authorized by the Animal Ethics Committees of Nantong University. PDX mice were inoculated subcutaneously with patient-derived tumor tissue fragments and were used for the experiment when they passed to the F3 generation. All the mice used were age matched and were assigned randomly to groups. After the tumor volume reached 100–200 mm 3 , PDX mice were injected intraperitoneally (ip) with chemotherapeutic agents as indicated by the administration of cisplatin (5 mg/kg/3d), paclitaxel (5 mg/kg/3d), docetaxel (2 mg/kg/3d) or saline. Cell culture THP-1 and MDA-MB-468 cells were purchased from the Cell Bank of the Institute of Biochemistry and Cell Biology (Shanghai, China). The THP-1 cells were incubated in RPMI 1640 medium (Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS) (Gibco, Waltham, USA). The human breast cancer cell line MDA-MB-468 was maintained in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific) supplemented with 10% FBS. Both cell lines were maintained at 37 °C in an atmosphere containing 5% CO 2 . Both cell lines were used within 20 passages and confirmed to be mycoplasma free before use in studies. Real-time quantitative PCR TRIzol reagent (Invitrogen, Carlsbad, USA) was used to extract total RNA from the cell lines or tissue samples. Real-time quantitative PCR (qPCR) was performed in a total volume of 20 μL of SYBR Green PCR Master Mix (Roche, Germany). All reactions were performed in duplicate. The mRNA expression levels of the target genes were normalized to the GAPDH mRNA levels via the 2 -ΔΔCT method. The primer sequences are listed in Table 1: Gene Primer sequences GAPDH-F 5’-GCACCGTCAAGGCTGAGAAC-3’ GAPDH-R 5’-TGGTGAAGACGCCAGTGGA-3’ IL1-β-F 5’- TCCAGGATGAGGACATGAGCAC -3’ IL1-β-R 5’- GAACGTCACACACCAGCAGGTTA -3’ TNF-α-F 5’- GTTCTATGGCCCAGACCCTCAC -3’ TNF-α-R 5’- GGCACCACTAGTTGGTTGTCTTTG -3’ iNOS -F 5’- CAAGCACCTTGGAAGAGGAG -3’ iNOS -R 5’- AAGGCCAAACACAGCATACC -3’ CD16-F 5’-TTTGGACACCCAGATGTTTCAG-3’ CD16-R 5’-GTCTTCCTTGAGCACCTGGATC-3’ CD206-F 5’-CAAGGAAGGTTGGCATTTGT-3’ CD206-R 5’-CCTTTCAGTCCTTTGCAAGC-3’ TGF-β-F 5’-TGCGCTTGCAGAGATTAAAA-3’ TGF-β-R 5’-CGTCAAAAGACAGCCACTCA-3’ IL-10-F 5’-CCAAGCCTTATCGGAAATGA-3’ IL-10-R 5’-TTTTCACAGGGGAGAAATCG-3’ Western blotting The cells or tissues were harvested in lysis buffer containing 1% phosphatase inhibitor. Total proteins separated by SDS‒PAGE were transferred to nitrocellulose membranes (Millipore, USA), which were blocked in 5% w/v nonfat milk powder in TBST (0.1 M Tris, 1.2 M NaCl, pH 7.4 and 0.1% v/v Tween 20) for 2 h at room temperature and then incubated with primary antibody overnight at 4°C. The membrane was washed with TBST adequately and incubated with the secondary antibody (Jackson, West Grove, USA). Proteins were visualized with enhanced chemiluminescence (ECL) detection reagents. The primary and secondary antibodies used were as follows: B7-2/CD86 [Unconjugated] (NOVUS, USA), CD11b (NOVUS, USA), PPARγ (Abcam, USA), IGFBP3 (Abcam, USA), monoclonal anti-β-actin (Sigma, USA), goat anti-rabbit secondary (Bioworld, USA), rabbit anti-goat secondary (Bioworld, USA), and goat anti-mouse secondary (Jackson, USA) antibodies. Macrophage polarization THP-1 monocytes were differentiated into macrophages by 24 h of incubation with 150 nM phorbol 12-myristate 13-acetate (PMA) (Sigma, USA) in RPMI medium. Next, the macrophages were stimulated with 20 ng/ml IFNγ (PeproTech, USA) and 100 ng/ml LPS (Sigma, USA) for 48 h to obtain the M1 phenotype. The M2 phenotype was obtained by incubation with 20 ng/ml interleukin 4 (IL-4) (Sigma, USA) and 20 ng/ml interleukin 13 (IL-13) (PeproTech, USA) for 48 h. Afterwards, the cells were collected and analyzed. Apoptosis analysis by flow cytometry The cells in the exponential growth phase were trypsinized and resuspended in fresh culture medium at a density of 1×10 5 cells/well in a 6-well plate for 24 h at 37°C. After treatment, the cells were collected with 5% trypsin, washed twice with phosphate-buffered saline (PBS), and resuspended in binding buffer at a concentration of 5×10 5 cells/ml. The cells (100 μl) were stained with 5 μl of fluorescein isothiocyanate (FITC)-conjugated monoclonal antibody specific for Annexin V and 5 μl of propidium iodide (PI) (BD, USA) and then incubated in the dark at 25°C for 15 min. Subsequently, cell apoptosis was measured via flow cytometry (Beckman Coulter, USA). The data were analyzed with FlowJo 10. Cytotoxicity assays Cellular cytotoxicity was assessed by the level of lactate dehydrogenase (LDH) activity. THP-1 cells were seeded on inverted transwell plates, differentiated into macrophages for 24 h, washed and treated with IFNγ combined with LPS or IL-4 combined with IL-13 for 48 h. MDA-MB-468 cells were seeded on 24-well plates and incubated with polarized macrophages. After 48 h of exposure, the cocultured cells were washed for detection of LDH. LDH release was measured via a Cytotoxicity Detection Kit (Roche Diagnostics, Germany) according to the manufacturer's instructions. Cell Counting Kit-8 (CCK-8) assay Cell viability was measured via the Cell Counting Kit-8 (CCK-8) (D Dojindo Molecular Technologies, Japan) assay following the manufacturer’s protocol. The cells were seeded into 96-well plates at a density of 3000 cells/well. After treatment with different doses of cisplatin for 24 h, 48 h or 72 h, 10 µL of CCK-8 solution was added to the cells. One hour later, the absorbance was calculated with a microplate spectrophotometer (Multiskan™ GO, Thermo Fisher Scientific) at 450 nm. Infection with lentiviral shRNA For the lentiviral infection experiments, recombinant lentivirus (GenePharma, China) was used according to the manufacturer's protocol. THP-1 cells were seeded at 1 × 10 5 cells/well in a 12-well plate and incubated overnight. The next day, control shRNA lentivirus and IGFBP3 knockdown shRNA lentivirus were combined with 10 μg/ml polybrene (Sigma, USA) and then added to the THP-1 cells. At 48 h after transduction, THP-1 cells generated with the IGFBP3 shRNA lentivirus were cultured with puromycin-containing (4 to 8 μg/ml) medium for 2 weeks to select stable clones. Immunohistochemistry The tumor tissue was fixed in formalin, embedded in paraffin, sectioned and heated. Subsequently, the sections were deparaffinized, rehydrated, and subjected to antigen retrieval. After being blocked with 2% goat serum, the sections were incubated with the indicated antibodies against CD11b (NOVUS, USA) and CD86 (NOVUS, USA) overnight at 4°C. The next day, the sections were washed with PBS and then incubated with the corresponding secondary antibodies for 1 hour at room temperature. The sections were treated with DAB working solution and then visualized by microscopy. Immunofluorescence ICC staining was performed as described previously(11). The cells were processed routinely. For ICC staining, the following antibodies were used: B7-2/CD86 [Unconjugated] (NOVUS, USA), CD11b (NOVUS, USA), PPARγ (Abcam, USA), IGFBP3 (Abcam, USA), β-Tubulin (Cell Signaling Technology, USA), Caspase 3 (Invitrogen, UK) and goat anti-rabbit secondary antibodies (West Grove, USA). Nuclei were counterstained with DAPI (Beyotime, China). Immunostaining was visualized with a confocal laser scanning microscope (SP8, Leica, Germany). Dual-luciferase reporter assays TheIGFBP3 promoter fragments were amplified and cloned and inserted into the pGL3 basic vector. Luciferase activity was examined via a dual luciferase assay (Promega, Madison, WI, USA) following the manufacturer's instructions. Statistical analysis Data analysis was conducted via GraphPad Prism 9 (GraphPad Software, San Diego, CA). The results are presented as the means ± SDs. One-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to determine significant differences between groups. For data involving only two groups, an unpaired Student’s t test was employed. P values < 0.05 were considered statistically significant (*p < 0.05, **p < 0.01). Results The synergistic effects of cisplatin and RGZ yield significant antitumor effects To investigate the impact of immune cells on the breast cancer microenvironment, we utilized patient-derived xenograft (PDX) models for in vivo experiments. The subcutaneous tumor model was derived from a patient with triple-negative breast cancer (TNBC). PDX mice were treated with RGZ (5 mg/kg) or cisplatin (5 mg/kg) either separately or in combination. As shown in Fig. 1 A and B, there was no significant difference in tumor volume between the RGZ-treated group and the control group. However, the cisplatin-treated group presented a marked reduction in tumor burden. Notably, the combination treatment of RGZ and cisplatin resulted in more pronounced inhibition of the tumor burden than did cisplatin alone (Fig. 1 C). The safety of RGZ and cisplatin was assessed by monitoring the weights of the mice (Fig. 1 D). Our findings demonstrate that the synergistic effect of cisplatin and RGZ leads to enhanced antitumor efficacy. RGZ enhances the proapoptotic effects of chemotherapy To further validate the antitumor effects of RGZ in vitro, we treated MDA-MB-468 breast cancer cells with RGZ in the presence or absence of cisplatin. CCK-8 assays revealed a time- and dose-dependent increase in the cytotoxic effects of cisplatin (Supplemental Fig. 1A-C). Cotreatment with 25 µM RGZ and various doses of cisplatin for 48 hours significantly reduced cell viability (Fig. 2 A). Serum-free growth experiments indicated that 25 µM RGZ alone significantly inhibited cell proliferation (Fig. 2 B). Additionally, cotreatment with cisplatin and RGZ for 48 hours markedly increased the expression of the apoptosis marker caspase-3 in MDA-MB-468 cells (Fig. 2 C and D). Flow cytometry analysis revealed a significant increase in the number of apoptotic cells in the cisplatin/RGZ cotreatment group compared with the cisplatin-only group (Fig. 2 E-G). Lactate dehydrogenase (LDH) release, a marker of damage to the integrity of the cell membrane, was significantly greater in the RGZ-treated group than in the adriamycin (ADR) single-treatment group (Fig. 2 H). These results indicate that RGZ enhances the sensitivity of breast cancer cells to cisplatin, leading to increased cytotoxicity. Increased TAMs (M2) in cisplatin- and RGZ-resistant PDX model mice Given that cisplatin and RGZ have the most promising antitumor effects, we implanted tumor tissues from the cisplatin + RGZ group into nude mice and treated them with RGZ (5 mg/kg) and cisplatin (5 mg/kg) to establish resistant patient-derived xenograft (R-PDX) models. For the first two weeks, the R-PDX tumors presented a steady volume under RGZ treatment, indicating initial sensitivity to the drug. However, by the third week, a rapid increase in tumor volume was observed, suggesting the development of drug tolerance (Fig. 3 A). Previous studies have identified TAMs as critical drivers of chemoresistance. In our study, we examined both the infiltration and polarization of TAMs within the R-PDX tumor environment. We noted a decrease in the M1 macrophage marker IL-1β during the drug tolerance stage. Conversely, M2 macrophage markers, including TGF-β and CD206, were significantly elevated (Fig. 3 B-D). The frequency of CD206-positive M2 macrophages was greater in resistant tumors than in resistant tumors, whereas the percentage of CD86-positive M1 macrophages was lower (Fig. 3 E-G). These findings suggest that macrophage polarization plays a role in chemotherapy resistance. RGZ promotes M2 macrophage polarization in vitro To elucidate the mechanism underlying macrophage polarization, we established fully polarized macrophages derived from human monocytic THP-1 cells. CD11b is a primary marker for macrophages (M0), while CD86 and CD16 are markers for M1 macrophages, and CD206 is a marker for M2 macrophages. After a 24-hour incubation with 150 nM PMA, monocytes adhered to the dish bottom and displayed M0 characteristics. Stimulating M0 cells with 10 pg/mL LPS and 20 µg/mL IFN-γ for 24 hours resulted in detectable CD16 expression via immunocytochemistry. Similarly, incubating M0 cells with 20 µg/mL IL-4 and 20 µg/mL IL-13 for 24 hours increased CD206 levels (Fig. 4 A). RGZ treatment significantly increased the protein expression of CD206 and PPARγ in macrophages but reversed the increase in the expression of CD86 (Fig. 4 B and C). The mRNA levels of the M1-related genes INOS and IL-1β were significantly decreased in the RGZ-treated M1 group. In contrast, the expression of the M2-related genes CD206 and TGF-β was upregulated in both the M0 + RGZ and M1 + RGZ groups (Fig. 4 D). Compared with that in primary macrophages, CD206 expression was greater in the M0 + RGZ and M1 + RGZ groups (Fig. 4 E and G). Nile red staining revealed increased lipid content in macrophages exposed to RGZ (Fig. 4 F and H). These results indicate that RGZ promotes macrophage polarization toward the M2 phenotype and reverses the characteristics of M1 macrophages. M1 macrophages promote the apoptosis of breast cancer cells Our comprehensive analysis demonstrated that the activation of PPARγ by RGZ inhibits tumor cell proliferation, increases sensitivity to chemotherapy drugs, and promotes apoptosis in breast cancer cells. Additionally, RGZ treatment encouraged macrophages to polarize toward the M2 type, shifting their function from promoting inflammation to inhibiting inflammation, thus promoting the development of tumor cells. To better understand this interaction, we established a coculture system of macrophages and breast cancer cells to simulate the human TME (Fig. 5 A). After inducing macrophage polarization and coculturing them with breast cancer cells for 48 hours, RGZ was added to the coculture model for an additional 24 hours. LDH release assays indicated that in the absence of RGZ, M1-type macrophages induced increased LDH release from MDA-MB-468 cells because of the release of inflammatory factors. Conversely, M2-type macrophages, which release anti-inflammatory factors, downregulate LDH release from breast cancer cells. Upon RGZ treatment, LDH release increased in all groups, suggesting that the cytotoxic effect of RGZ on breast cancer cells outweighs the anti-inflammatory and drug resistance effects induced by M2-type polarization (Fig. 5 B). We further analyzed the combined effects of cisplatin and RGZ on tumor cell apoptosis via flow cytometry in a coculture system. The results revealed a significant increase in apoptosis in MDA-MB-468 cells treated with RGZ compared with those not in coculture (Fig. 5 C and E). Compared with M2-type macrophages, M1-type macrophages significantly increased early tumor cell apoptosis in the untreated group without RGZ (Fig. 5 D). There was no significant change in tumor cell apoptosis in the RGZ-treated group compared with the untreated group. IGFBP3 regulates M2 macrophage polarization induced by RGZ Previous studies have indicated that macrophages can be regulated by specific genetic targets. To identify the genes involved in RGZ-induced M2 macrophage polarization, we analyzed publicly available ChIP-seq data from RGZ-treated PMA-differentiated THP-1 cells and conducted additional ChIP-seq experiments on classic M1- and M2-polarized macrophages. We integrated data showing genes upregulated in the RGZ-treated group and those active in M2 but not M1 macrophages. Using the Venn tool ( https://bioinfogp.cnb.csic.es/tools/venny/index.html ), we identified six candidate genes: IFI27, IGFBP3, ISG15, MX1, MX2 , and XAF1 (Fig. 6 A). Among these genes, IGFBP3 was the only gene with a significant positive correlation (r > 0.3) with the M2 macrophage marker CD163 and no positive correlation with the M1 marker CD86, as shown in the TCGA breast cancer database (Supplemental Figure S2 , http://timer.cistrome.org/ ). A volcano plot further revealed high IGFBP3 expression in classic M2 macrophages (Fig. 6 B). In the GSE25608 dataset, THP-1 cells cultured with RGZ also presented elevated IGFBP3 expression (Fig. 6 C). Verification of IGFBP3 protein levels in THP-1 cells revealed that it was overexpressed in IL4-induced macrophages and primary macrophages (Fig. 6 D). To determine the role of IGFBP3 in macrophage polarization and tumor cell promotion, we constructed IGFBP3-knockdown THP-1 cell lines (Fig. 6 E). Cotreatment with IGFBP3 knockdown and cisplatin significantly increased late apoptotic tumor cell proportions, whereas early apoptosis remained unaffected (Supplemental Figure S3). In subsequent apoptosis assays, we evaluated the proportion of apoptotic tumor cells within a coculture system of IGFBP3-knockdown macrophages and breast cancer cells. Compared with the control group, the IGFBP3 knockdown group (shIGFBP3 + CIS) presented an increased proportion of early apoptotic breast cancer cells. Further treatment with RGZ (shIGFBP3 + ROSI + CIS) further increased early apoptosis (Fig. 6 F and G). Notably, compared with the RGZ-only group, the shIGFBP3 + ROSI + CIS group presented a significantly greater proportion of apoptotic cells (Fig. 6 H). These findings demonstrate that IGFBP3 knockdown combined with RGZ treatment significantly promotes apoptosis, thereby increasing tumor cell sensitivity to chemotherapeutic agents. IGFBP3 expression and clinical outcomes We further investigated the protein expression of IGFBP3 following RGZ treatment and found that low-dose RGZ (5 µM) significantly increased IGFBP3 protein levels (Fig. 7 A‒C). Furthermore, macrophages treated with a relatively high dose of RGZ (10 µM) presented a 2-fold increase in IGFBP3 reporter gene activity (Fig. 7 D). These findings indicate that PPARγ activation by RGZ enhances IGFBP3 expression. To validate the clinical relevance of IGFBP3 expression in breast cancer, we analyzed IGFBP3 levels in a cohort of 64 breast cancer patients. Immunohistochemical analysis revealed that high IGFBP3 expression was present in 46% of the tumor samples. High IGFBP3 expression was significantly correlated with poorer overall survival (OS) and number at risk (p = 0.033, Fig. 7 E and F). Discussion Clinical data indicate that combining tumor activity regulators with low-dose chemotherapy agents can produce impressive tumor responses, leading to sustained complete remission. The combination of RGZ and chemotherapeutic agents has demonstrated therapeutic potential. However, the utilization of PPARγ agonists in tumor therapy has experienced several failures. The target of RGZ, PPARγ, is multifaceted [18]. It is a major regulator of adipocyte differentiation. It enhances macrophage lipid uptake and lipid efflux and possesses anti-inflammatory properties. PPARγ is expressed in various cancers, including colon, prostate, and breast cancers [19]. PPARγ ligands generally exhibit antiproliferative effects in these contexts, but some studies have suggested that they may exacerbate the growth of certain tumors. Specifically, in breast cancer, RGZ promotes G0‒G1 cell cycle arrest, increases caspase-9 activity, and induces growth arrest and apoptosis in breast cancer cells [20–22]. This finding is consistent with our observations that RGZ induces apoptosis in the breast cancer cell line MDA-MB-468 in vitro. Recent studies have reported that RGZ exhibits antitumor activity in the early stages of tumor progression in vivo but fails in later stages of treatment [23]. Here, we demonstrate that the combination of RGZ and cisplatin has significant therapeutic effects in the early stages of breast cancer, whereas resistance develops in later stages in mice. This resistance may be related to changes in macrophage polarization within the TME. Macrophages exhibit plasticity [24]. They can be polarized into the classically activated M1 type through proinflammatory stimuli (e.g., IFN-γ and LPS) or the alternatively activated M2 type through anti-inflammatory stimuli (e.g., IL-4 and IL-13), depending on the growth factors in the immune environment. The M1-like phenotype is immunostimulatory and can inhibit tumor development and progression, whereas the M2-like phenotype promotes malignant tumor proliferation and metastasis, facilitates tumor immune evasion, and induces drug resistance. Most tumor-associated macrophages (TAMs) share similar markers, including CD206, CD163, CCL8, and Arg1 [25]. The M2 subtype is widely recognized as the predominant phenotype of protumor TAMs (pTAMs). The activation of various cellular signaling pathways, such as the NF-κB, P38 MAPK, Notch, and JAK/STAT signaling pathways, can direct macrophage polarization [26–29]. PPARγ is also considered to play crucial roles in promoting M2 macrophage polarization. We investigated the impact of RGZ on the expression of macrophage polarization-related markers. RGZ inhibited the expression of the M1 phenotype marker CD86. RGZ treatment increased the levels of the M2 markers CD206 and TGFβ. These findings further indicate that RGZ can reverse the M0 and M1 phenotypes of macrophages to the protumor M2 phenotype. Consistent with these results, RGZ induced the release of inflammatory factors (e.g., INOS and IL-1β), enhanced the phagocytic capacity of macrophages (an M2 marker), and increased the CD206/CD11b ratio. Above all, we demonstrated the paradoxical effects of RGZ in breast cancer. An in vitro coculture system of breast cancer cells and macrophages was established to simulate the human microenvironment. In isolated breast cancer cell cultures, treatment with RGZ increased LDH release and upregulated the expression of the apoptotic factor Caspase3. However, in coculture with macrophages, the apoptotic effect on breast cancer cells was diminished. This attenuation is presumed to be due to the polarization shift from M1 to M2 macrophages, which promotes tumor cell proliferation and resistance, counteracting RGZ-induced cell damage. To mitigate the reduction in RGZ efficacy due to macrophage polarization to the M2 phenotype observed during clinical administration, we conducted an extensive database analysis. This analysis revealed that insulin-like growth factor binding protein-3 (IGFBP3) was differentially expressed during both the macrophage polarization state and RGZ treatment. These findings suggest that IGFBP3 could be a potential target to counteract the regulation of macrophage polarization by PPARγ. IGFBP3 is a member of the IGFBP family that is capable of binding to IGF-I and IGF-II with high affinity, thus inhibiting cell actions mediated by IGF-I receptor activation [30, 31]. The overexpression of IGFBP3 has been observed in gliomas [32], nasopharyngeal carcinoma [33], esophageal squamous cell carcinoma [34], pancreatic ductal adenocarcinoma [35] and breast cancer [36, 37]. IGFBP3 expression is associated with poor patient prognosis [32, 36]. Previous reports have shown that high IGFBP3 expression in liver cancer patients is associated with an immunosuppressive phenotype [38]. T-cell infiltration is reduced in breast tumor environments deficient in IGFBP3 [39]. Our findings are consistent with this observation. Low doses of RGZ increase IGFBP3 expression and promote macrophage polarization toward the M2 phenotype. IGFBP3 knockdown reversed macrophage polarization to the M1 phenotype and indirectly enhanced the apoptosis of MDA-MB-468 cells in a coculture system. Dual-luciferase assays revealed that low doses of DAC significantly increased the binding affinity of IGFBP3 for the PPARγ promoter, supporting the role of IGFBP3 in macrophage polarization. To date, this is the first study to reveal the indispensable role of IGFBP3 in M2 macrophage polarization. This research reveals the potential mechanism of resistance development with long-term administration of the chemical drug cisplatin in combination with RGZ. Therefore, incorporating IGFBP3-targeted therapies could effectively reverse PPARγ-induced macrophage polarization and thereby alleviate the occurrence of resistance. Despite these significant findings, our study has several limitations. First, in the PDX mouse resistance model, we observed changes in macrophage infiltration with a high enrichment of M2 macrophages, suggesting that macrophage polarization mediates the development of resistance. However, other cells in the TME, such as T cells and endothelial cells, may also contribute. Additionally, the precise role of tumor IGFBP3 in different cancers remains contradictory [39], which limits the application of IGFBP3 inhibitors in combination therapies. The potential mechanisms involving PPARγ and IGFBP3 also require further investigation. Nonetheless, we believe that IGFBP3-targeted therapies will offer new insights for patients with breast cancer who frequently experience disease recurrence or refractory conditions in combination treatments. Conclusion Our study provides compelling evidence that IGFBP3-mediated M2 macrophage polarization plays a critical role in modulating the TME and influencing the sensitivity of breast cancer cells to chemotherapy. By promoting an immunosuppressive environment, IGFBP3 enhances tumor cell survival and resistance to treatment (Fig. 8). Targeting IGFBP3 in combination with PPARγ agonists such as RGZ could offer a novel therapeutic strategy to improve outcomes for patients with breast cancer, particularly those with high IGFBP3 expression. Further clinical validation and mechanistic studies are warranted to fully realize the potential of this approach. Declarations Ethics approval and consent to participate: All of the animal procedures were authorized by the Animal Ethics Committees of Nantong University. BC tissues were from patients in Affiliated Hospital of Nantong University. Ethical clearance for the research was acquired from the institution's ethics committee. Consent for publication: Not applicable. Availability of data and materials: The data that involved in this study are available in the supplementary material. Competing interests: The authors declare that they have no competing interests. Funding : This work was supported by the following funding: 1. Open research Project of the Key Laboratory of Prevention and Treatment of Cardiovascular and Cerebrovascular Diseases (Ministry of Education), Gannan Medical University (XN202005); 2. The Scientific Research Foundation of State Key Laboratory of Vaccines for Infectious Diseases，Xiang An Biomedicine Laboratory (2023XAKJ0101005); 3. Basic Research Program of Jiangsu Province (BE2018778). Authors' contributions: Concept and design: GW, TH, CG; Performing experiments and analysis of data: CG, GL; Contributing reagents, materials and other analytical tools: GW, TH; Writing the manuscript: CG, GW. All authors read and approved the final manuscript. References Trapani, D., et al., Global challenges and policy solutions in breast cancer control. Cancer Treat Rev, 2022. 104 : p. 102339. Saunders, C.M., Breast surgery: a narrative review. Med J Aust, 2022. 217 (5): p. 262-267. Wang, S., E.J. Dougherty, and R.L. Danner, PPARgamma signaling and emerging opportunities for improved therapeutics. Pharmacol Res, 2016. 111 : p. 76-85. Szychowski, K.A., et al., 4-thiazolidinone-based derivatives rosiglitazone and pioglitazone affect the expression of antioxidant enzymes in different human cell lines. Biomed Pharmacother, 2021. 139 : p. 111684. Burstein, H.J., et al., Use of the peroxisome proliferator-activated receptor (PPAR) gamma ligand troglitazone as treatment for refractory breast cancer: a phase II study. Breast Cancer Res Treat, 2003. 79 (3): p. 391-7. Yee, L.D., et al., Pilot study of rosiglitazone therapy in women with breast cancer: effects of short-term therapy on tumor tissue and serum markers. Clin Cancer Res, 2007. 13 (1): p. 246-52. Frohlich, E. and R. Wahl, Chemotherapy and chemoprevention by thiazolidinediones. Biomed Res Int, 2015. 2015 : p. 845340. Munir, M.T., et al., Tumor-Associated Macrophages as Multifaceted Regulators of Breast Tumor Growth. Int J Mol Sci, 2021. 22 (12). Solinas, G., et al., Tumor-associated macrophages (TAM) as major players of the cancer-related inflammation. J Leukoc Biol, 2009. 86 (5): p. 1065-73. Chen, D., et al., Metabolic regulatory crosstalk between tumor microenvironment and tumor-associated macrophages. Theranostics, 2021. 11 (3): p. 1016-1030. Vilbois, S., Y. Xu, and P.C. Ho, Metabolic interplay: tumor macrophages and regulatory T cells. Trends Cancer, 2024. 10 (3): p. 242-255. Marigo, I., et al., Tumor-induced tolerance and immune suppression by myeloid derived suppressor cells. Immunol Rev, 2008. 222 : p. 162-79. Xu, M., et al., Intratumoral Delivery of IL-21 Overcomes Anti-Her2/Neu Resistance through Shifting Tumor-Associated Macrophages from M2 to M1 Phenotype. J Immunol, 2015. 194 (10): p. 4997-5006. Chen, S., et al., Macrophages in immunoregulation and therapeutics. Signal Transduct Target Ther, 2023. 8 (1): p. 207. Li, M., et al., Metabolism, metabolites, and macrophages in cancer. J Hematol Oncol, 2023. 16 (1): p. 80. Noy, R. and J.W. Pollard, Tumor-associated macrophages: from mechanisms to therapy. Immunity, 2014. 41 (1): p. 49-61. Qian, B.Z. and J.W. Pollard, Macrophage diversity enhances tumor progression and metastasis. Cell, 2010. 141 (1): p. 39-51. Lehrke, M. and M.A. Lazar, The many faces of PPARgamma. Cell, 2005. 123 (6): p. 993-9. Grommes, C., G.E. Landreth, and M.T. Heneka, Antineoplastic effects of peroxisome proliferator-activated receptor gamma agonists. Lancet Oncol, 2004. 5 (7): p. 419-29. Bonofiglio, D., et al., Peroxisome proliferator-activated receptor-gamma activates p53 gene promoter binding to the nuclear factor-kappaB sequence in human MCF7 breast cancer cells. Mol Endocrinol, 2006. 20 (12): p. 3083-92. Bonofiglio, D., et al., Estrogen receptor alpha binds to peroxisome proliferator-activated receptor response element and negatively interferes with peroxisome proliferator-activated receptor gamma signaling in breast cancer cells. Clin Cancer Res, 2005. 11 (17): p. 6139-47. Bonofiglio, D., et al., Peroxisome proliferator-activated receptor gamma activates fas ligand gene promoter inducing apoptosis in human breast cancer cells. Breast Cancer Res Treat, 2009. 113 (3): p. 423-34. Caruso, J.A., et al., Loss of PPARgamma activity characterizes early protumorigenic stromal reprogramming and dictates the therapeutic window of opportunity. Proc Natl Acad Sci U S A, 2023. 120 (42): p. e2303774120. Harris, M.A., et al., Toward targeting the breast cancer immune microenvironment. Nat Rev Cancer, 2024. Cassetta, L., et al., Human Tumor-Associated Macrophage and Monocyte Transcriptional Landscapes Reveal Cancer-Specific Reprogramming, Biomarkers, and Therapeutic Targets. Cancer Cell, 2019. 35 (4): p. 588-602 e10. Lu, J., et al., Fargesin ameliorates osteoarthritis via macrophage reprogramming by downregulating MAPK and NF-kappaB pathways. Arthritis Res Ther, 2021. 23 (1): p. 142. Fang, J., et al., TcpC Inhibits M1 but Promotes M2 Macrophage Polarization via Regulation of the MAPK/NF-kappaB and Akt/STAT6 Pathways in Urinary Tract Infection. Cells, 2022. 11 (17). Zhong, J., et al., Ubiquitylation of MFHAS1 by the ubiquitin ligase praja2 promotes M1 macrophage polarization by activating JNK and p38 pathways. Cell Death Dis, 2017. 8 (5): p. e2763. Zhu, L.W., et al., Ficolin-A induces macrophage polarization to a novel pro-inflammatory phenotype distinct from classical M1. Cell Commun Signal, 2024. 22 (1): p. 271. Baxter, R.C., IGF binding proteins in cancer: mechanistic and clinical insights. Nat Rev Cancer, 2014. 14 (5): p. 329-41. Furstenberger, G. and H.J. Senn, Insulin-like growth factors and cancer. Lancet Oncol, 2002. 3 (5): p. 298-302. Chen, C.H., et al., Suppression of tumor growth via IGFBP3 depletion as a potential treatment in glioma. J Neurosurg, 2019. 132 (1): p. 168-179. Bao, L., et al., Overexpression of IGFBP3 is associated with poor prognosis and tumor metastasis in nasopharyngeal carcinoma. Tumor Biol, 2016. 37 (11): p. 15043-15052. Natsuizaka, M., et al., IGFBP3 promotes esophageal cancer growth by suppressing oxidative stress in hypoxic tumor microenvironment. Am J Cancer Res, 2014. 4 (1): p. 29-41. Xue, A., et al., Prognostic significance of growth factors and the urokinase-type plasminogen activator system in pancreatic ductal adenocarcinoma. Pancreas, 2008. 36 (2): p. 160-7. Marzec, K.A., R.C. Baxter, and J.L. Martin, Targeting Insulin-Like Growth Factor Binding Protein-3 Signaling in Triple-Negative Breast Cancer. Biomed Res Int, 2015. 2015 : p. 638526. Julovi, S.M., J.L. Martin, and R.C. Baxter, Nuclear Insulin-Like Growth Factor Binding Protein-3 As a Biomarker in Triple-Negative Breast Cancer Xenograft Tumors: Effect of Targeted Therapy and Comparison With Chemotherapy. Front Endocrinol (Lausanne), 2018. 9 : p. 120. Chen, J., et al., Construction and validation of a novel IGFBP3-related signature to predict prognosis and therapeutic decision making for Hepatocellular Carcinoma. PeerJ, 2023. 11 : p. e15554. Scully, T., et al., Enhancement of mammary tumor growth by IGFBP-3 involves impaired T-cell accumulation. Endocr Relat Cancer, 2018. 25 (2): p. 111-122. Additional Declarations No competing interests reported. Supplementary Files UncroppedgelsforWesternBlots.pdf SupplementalFigure1.png SupplementalFigure2.png SupplementalFigure3.png rawdata.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5174260","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":363009189,"identity":"b8a770d2-29fe-47fb-b46a-c40d411fdda4","order_by":0,"name":"Chunyi Gao","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chunyi","middleName":"","lastName":"Gao","suffix":""},{"id":363009190,"identity":"50dd2b47-f3b2-4315-a9df-07a20379ae8f","order_by":1,"name":"Gang Li","email":"","orcid":"","institution":"Nantong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Li","suffix":""},{"id":363009191,"identity":"fcec8323-9584-4deb-b977-4837782cc861","order_by":2,"name":"Tianhui Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAnElEQVRIiWNgGAWjYDACCQbGBxBWApE6eCQYmA1I1sImQZoWe+kes2renMMM/Ow5Bgw/dxBji8wZs5sztx1mkOx5Y8DYe4Yoh+WY3fgI1GJwI8eAmbGNSC0FiUAt9iRpYQDbIkG0lhtpxZIzt6XzSJx5VnCwlxgt7DOSN37m3WYtx9+evPHBT2K0wG0DEQdI0DAKRsEoGAWjAB8AACk7L3dZfV47AAAAAElFTkSuQmCC","orcid":"","institution":"Gannan Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Tianhui","middleName":"","lastName":"Hu","suffix":""},{"id":363009192,"identity":"24217528-9460-4c28-9fcc-175d370cc4d2","order_by":3,"name":"Wang Guohua","email":"","orcid":"","institution":"Nantong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wang","middleName":"","lastName":"Guohua","suffix":""}],"badges":[],"createdAt":"2024-09-29 09:53:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5174260/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5174260/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":68002358,"identity":"d63336a3-c76c-4a2a-826f-9e506b1b8cdd","added_by":"auto","created_at":"2024-11-01 08:11:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1764207,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEnhanced antitumor effects of combined RGZ and cisplatin treatment in PDX models. \u003c/strong\u003e(A) Comparison of tumor appearance across different treatment groups; scale bar = 2 cm. (B) Tumor growth of PDX models treated with RGZ (5 mg/kg) or cisplatin (5 mg/kg) separately or in combination for 20 days. (C) The tumor inhibition rates of the mice in each group at the end of drug treatment were determined, and the inhibitory effects of different drug treatments on tumor growth were quantitatively compared. (D) Changes in the weights of the mice in each group during drug treatment.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/b318c1b5eaf7df2d064e9fd0.png"},{"id":68002357,"identity":"d83f39e3-2907-477a-a616-87ddbbc9707f","added_by":"auto","created_at":"2024-11-01 08:11:45","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1654154,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of breast cancer cell growth by RGZ. \u003c/strong\u003e(A) CCK-8 assay for determining the survival rate of MDA-MB-468 cells exposed to various doses of cisplatin (0, 0.1, 0.3, 0.9, 2.7, or 8.1 ng/ml) with or without RGZ. (B) Viability of MDA-MB-468 cells treated with 25 μM RGZ for 72 hours (n=6). (C, D) Immunofluorescence analysis of caspase-3 expression in different treatment groups. (E-G) Apoptotic cell ratio in MDA-MB-468 cells after 24 hours of treatment, as detected by Annexin V-FITC and propidium iodide (PI) staining. (H) LDH absorbance values at 490 nm.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/433b6d21a235c906208764bf.png"},{"id":68002356,"identity":"b7a600a1-af3e-464d-96c4-4f6563dd5442","added_by":"auto","created_at":"2024-11-01 08:11:45","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1899400,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProlonged cisplatin treatment increased R-PDX \u003c/strong\u003elevels and increased the M2 macrophage population. (A) Tumor growth curve of R-PDX-treated mice treated with RGZ (5 mg/kg) or cisplatin (5 mg/kg) for 28 days. (B-D) Quantitative RT‒PCR analysis of IL-1β, TGF-β, and CD206 expression in R-PDXs at different resistance periods. (E) Tumor immunohistology showing CD206/CD11b and CD86 expression. Scale bars = 50 μm. (F-G) Number of macrophages with positive expression of CD206 and CD86 (n = 4).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/6c482b833384884c2e9f32ac.png"},{"id":68001444,"identity":"8bf2776c-4fea-4124-b26e-4c259f64f7b2","added_by":"auto","created_at":"2024-11-01 08:03:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2192862,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in macrophages before and after RGZ treatment. \u003c/strong\u003e(A) Images of macrophages in different states. (B-C) Western blot analysis of CD206, CD86, and PPARγ protein expression. (D) qRT‒qPCR analysis of INOS, IL-1β, CD206, and TGF-β mRNA expression. (E) Cell differentiation detected by immunocytochemistry. (F) Nile red staining was used to measure the cellular lipid content. (G) Statistical analysis of immunocytochemistry intensity. (H) Statistical analysis of the relative contents of Nile red-stained microspheres.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/762cde074b0cc8fd82ca2f53.png"},{"id":68001446,"identity":"a25051b0-3f17-47f4-8153-be397e2eb0b7","added_by":"auto","created_at":"2024-11-01 08:03:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1017154,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCoculture models and effects on tumor cell apoptosis.\u003c/strong\u003e (A) Coculture models of THP-1 and MDA-MB-468 cells. MDA-MB-468 cells were cultured at the bottom of culture plates with THP-1 cells on Transwell inserts placed into the culture plates. Experiments were performed on the cells cultured at the bottom. (B) Cells treated with 0.9 ng/ml cisplatin with or without 10 μM RGZ; cell death was measured by LDH release assay (n = 3 in each group, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05). (C-E) The breast cancer cell line MDA-MB-468 and induced macrophages were incubated with cisplatin for 48 hours with or without RGZ. Cell apoptosis was quantified via flow cytometry.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/a04ce1cb257fdce09708b92b.png"},{"id":68001447,"identity":"9f861e74-fcd2-49b2-a91b-a13f42949852","added_by":"auto","created_at":"2024-11-01 08:03:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5713,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIGFBP3 regulation and macrophage polarization in breast cancer.\u003c/strong\u003e (A) Coculture models of THP-1 and MDA-MB-468 cells. MDA-MB-468 cells were cultured at the bottom of culture plates with THP-1 cells on Transwell inserts placed into the plates. Experiments were performed on cells cultured at the bottom. (B) Cells treated with 0.9 ng/ml cisplatin with or without 10 μM RGZ; cell death was measured by LDH release assay (n = 3 in each group, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05). (C-E) The breast cancer cell line MDA-MB-468 and induced macrophages were incubated with cisplatin for 48 hours with or without RGZ. Cell apoptosis was quantified via flow cytometry.\u003c/p\u003e","description":"","filename":"placeholderimage.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/28b40878dba70a8295cd9dc9.png"},{"id":68001443,"identity":"66745d8e-4098-48bb-824c-f02dce7c63f2","added_by":"auto","created_at":"2024-11-01 08:03:46","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6096237,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRegulation of IGFBP3 transactivation by RGZ treatment and clinical validation of IGFBP3 in breast cancer patients.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A, C) Western blot analysis and quantification of IGFBP3 protein expression after treatment with 10 μM RGZ. (B) Western blot analysis of IGFBP3 protein levels following treatment with different doses of RGZ, which revealed a significant increase. (D) IGFBP3 reporter gene activity in macrophages treated with 10 μM RGZ, indicating a 2-fold increase. (E) Representative immunohistochemical images of breast cancer tissues with high and low IGFBP3 expression. (F) Kaplan‒Meier survival curves for OS and number at risk on the basis of IGFBP3 expression levels.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/a83a0ef51bf173af0f7edfd5.png"},{"id":68001448,"identity":"1d51ef46-68f0-420d-9f03-8bc8f1222342","added_by":"auto","created_at":"2024-11-01 08:03:46","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4969065,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/55fa0ae9495b592eeec06444.png"},{"id":68852690,"identity":"981d8efa-afe1-4cfa-bb5a-194110e4dfde","added_by":"auto","created_at":"2024-11-12 17:47:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":27646810,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/f1e94ad5-3097-4ec2-be5c-666543efeaff.pdf"},{"id":68001438,"identity":"0bd91595-42ad-4000-92f8-a19493556b90","added_by":"auto","created_at":"2024-11-01 08:03:45","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10990988,"visible":true,"origin":"","legend":"","description":"","filename":"UncroppedgelsforWesternBlots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/3e6bd2d8f90d8f0db0d8173a.pdf"},{"id":68001437,"identity":"ec7bc961-360e-48e7-998b-b3d171dc3f88","added_by":"auto","created_at":"2024-11-01 08:03:45","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":204228,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/1b58a6233eb4ccc08d71db6c.png"},{"id":68001441,"identity":"b7574b5c-636c-4f60-81a4-75a3fa8a6c29","added_by":"auto","created_at":"2024-11-01 08:03:45","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1687250,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/0d095fba58bf9d5ee9396cf9.png"},{"id":68001445,"identity":"a8ae6624-50ed-41ba-be21-17eaa7b7eef5","added_by":"auto","created_at":"2024-11-01 08:03:46","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":577804,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/81d714193d0734e3a4491eff.png"},{"id":68001450,"identity":"0549709b-158f-4b48-a271-53fdb28123bd","added_by":"auto","created_at":"2024-11-01 08:04:03","extension":"zip","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":401452411,"visible":true,"origin":"","legend":"","description":"","filename":"rawdata.zip","url":"https://assets-eu.researchsquare.com/files/rs-5174260/v1/c299eb264f109053637ae7c3.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"IGFBP3-mediated M2 Macrophage Polarization Enhances Resistance to Rosiglitazone and Cisplatin in Breast Cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBreast cancer is the most commonly diagnosed malignancy in women, and its burden has been increasing globally [1]. Surgery is the mainstay of breast cancer therapy; however, it also causes some side effects, including lymphoedema and psychosocial fallout [2]. Therefore, exploring new and effective approaches is crucial for breast cancer treatment. Peroxisome proliferator-activated receptor gamma (PPARγ) is a ligand-activated nuclear receptor [3]. PPARγ agonists, such as rosiglitazone (RGZ) and pioglitazone, are used to treat type 2 diabetes (T2D) with insulin resistance (IR) [4]. These drugs have clinical importance because of their widespread and safe use in treating hypercholesterolemia (hyperlipidemia) and diabetes. The safety and cost-effectiveness of these drugs make them promising candidates for repurposing to inhibit tumor growth. In previous studies, RGZ displayed an antitumor effect in preclinical studies but a beneficial limit effect in breast cancer clinical trials [5, 6]. This could be due to the antagonism of cell-specific effects between tumor cells and immune cells [7].\u003c/p\u003e \u003cp\u003eTumor-associated macrophages (TAMs) constitute the major component of all immune cells present in the tumor microenvironment (TME) [8], constituting up to 50% of the tumor mass in most human solid tumors, including breast cancer [9]. TAMs can change their phenotype in response to stimuli from the surrounding TME [10, 11]. In general, macrophages are immunoregulatory and suppress immune responses to tumor-derived antigens [12]. Even worse, they can induce resistance to multiple treatments in preclinical breast cancer models [13\u0026ndash;15]. In some specific situations, macrophages can be antitumoral, offering support such as the suppression of angiogenesis or the stimulation of the T-cell response [16, 17]. However, the role of transferring macrophages remains unclear, and a better understanding of the polarization of macrophages in breast tumors will contribute to the further development of cancer immunotherapies.\u003c/p\u003e \u003cp\u003eIn the present study, a chemoresistant PDX nude model with an anti-inflammatory and tumor-promoting phenotype of TAMs and M2 macrophages that advanced gradually was established. In addition, the effects of chemotherapy combined with RGZ on breast tumor cells were analyzed. RGZ also promotes the transformation of macrophages to the beneficial type of tumor. The potential mechanism of RGZ in the regulation of macrophage polarization in breast cancer was subsequently explored through the activation of IGFBP3, which is driven by PPARγ. These findings suggest that IGFBP3 is a potential target for TAM immunotherapy in breast cancer.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eMice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, female BALB/c background nude mice (Shanghai Experimental Animal Center, Chinese Academy of Sciences, China) from 4--6 weeks were selected to establish a PDX model. The experimental mice were housed in individual ventilated cages under specific-pathogen-free conditions. All animal care and experimental protocols were carried out according to the Chinese Animal Management Rules of the Ministry of Health. All of the procedures were authorized by the Animal Ethics Committees of Nantong University.\u003c/p\u003e\n\u003cp\u003ePDX mice were inoculated subcutaneously with patient-derived tumor tissue fragments and were used for the experiment when they passed to the F3 generation. All the mice used were age matched and were assigned randomly to groups. After the tumor volume reached 100\u0026ndash;200 mm\u003csup\u003e3\u003c/sup\u003e, PDX mice were injected intraperitoneally (ip) with chemotherapeutic agents as indicated by the administration of cisplatin (5 mg/kg/3d), paclitaxel (5 mg/kg/3d), docetaxel (2 mg/kg/3d) or saline.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eCell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTHP-1 and MDA-MB-468 cells were purchased from the Cell Bank of the Institute of Biochemistry and Cell Biology (Shanghai, China). The THP-1 cells were incubated in RPMI 1640 medium (Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS) (Gibco, Waltham, USA). The human breast cancer cell line MDA-MB-468 was maintained in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (Gibco, Thermo Fisher Scientific) supplemented with 10% FBS. Both cell lines were maintained at 37\u0026thinsp;\u0026deg;C in an atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e. Both cell lines were used within 20 passages and confirmed to be mycoplasma free before use in studies.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eReal-time quantitative PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTRIzol reagent (Invitrogen, Carlsbad, USA) was used to extract total RNA from the cell lines or tissue samples. Real-time quantitative PCR (qPCR) was performed in a total volume of 20 \u0026mu;L of SYBR Green PCR Master Mix (Roche, Germany). All reactions were performed in duplicate. The mRNA expression levels of the target genes were normalized to the GAPDH mRNA levels via the 2\u003csup\u003e-\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method. The primer sequences are listed in Table 1:\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003ePrimer sequences\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eGAPDH-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCACCGTCAAGGCTGAGAAC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eGAPDH-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TGGTGAAGACGCCAGTGGA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eIL1-\u0026beta;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- TCCAGGATGAGGACATGAGCAC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eIL1-\u0026beta;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- GAACGTCACACACCAGCAGGTTA -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eTNF-\u0026alpha;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- GTTCTATGGCCCAGACCCTCAC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eTNF-\u0026alpha;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- GGCACCACTAGTTGGTTGTCTTTG -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eiNOS -F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- CAAGCACCTTGGAAGAGGAG -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eiNOS -R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- AAGGCCAAACACAGCATACC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eCD16-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TTTGGACACCCAGATGTTTCAG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eCD16-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GTCTTCCTTGAGCACCTGGATC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eCD206-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CAAGGAAGGTTGGCATTTGT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eCD206-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CCTTTCAGTCCTTTGCAAGC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eTGF-\u0026beta;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TGCGCTTGCAGAGATTAAAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eTGF-\u0026beta;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CGTCAAAAGACAGCCACTCA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eIL-10-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CCAAGCCTTATCGGAAATGA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 37.613%;\"\u003e\n \u003cp\u003eIL-10-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 62.387%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TTTTCACAGGGGAGAAATCG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cells or tissues were harvested in lysis buffer containing 1% phosphatase inhibitor. Total proteins separated by SDS‒PAGE were transferred to nitrocellulose membranes (Millipore, USA), which were blocked in 5% w/v nonfat milk powder in TBST (0.1\u0026thinsp;M Tris, 1.2\u0026thinsp;M NaCl, pH 7.4 and 0.1% v/v Tween 20) for 2 h at room temperature and then incubated with primary antibody overnight at 4\u0026deg;C. The membrane was washed with TBST adequately and incubated with the secondary antibody (Jackson, West Grove, USA). Proteins were visualized with enhanced chemiluminescence (ECL) detection reagents. The primary and secondary antibodies used were as follows: B7-2/CD86 [Unconjugated] (NOVUS, USA), CD11b (NOVUS, USA), PPAR\u0026gamma; (Abcam, USA), IGFBP3 (Abcam, USA), monoclonal anti-\u0026beta;-actin (Sigma, USA), goat anti-rabbit secondary (Bioworld, USA), rabbit anti-goat secondary (Bioworld, USA), and goat anti-mouse secondary (Jackson, USA) antibodies.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eMacrophage polarization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTHP-1 monocytes were differentiated into macrophages by 24 h of incubation with 150 nM phorbol 12-myristate 13-acetate (PMA) (Sigma, USA) in RPMI medium. Next, the macrophages were stimulated with 20\u0026thinsp;ng/ml IFN\u0026gamma; (PeproTech, USA) and 100\u0026thinsp;ng/ml LPS (Sigma, USA) for 48\u0026thinsp;h to obtain the M1 phenotype. The M2 phenotype was obtained by incubation with 20 ng/ml interleukin 4 (IL-4) (Sigma, USA) and 20 ng/ml interleukin 13 (IL-13) (PeproTech, USA) for 48\u0026thinsp;h. Afterwards, the cells were collected and analyzed.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eApoptosis analysis by flow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cells in the exponential growth phase were trypsinized and resuspended in fresh culture medium at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well in a 6-well plate for 24 h at 37\u0026deg;C. After treatment, the cells were collected with 5% trypsin, washed twice with phosphate-buffered saline (PBS), and resuspended in binding buffer at a concentration of 5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/ml. The cells (100 \u0026mu;l) were stained with 5 \u0026mu;l of fluorescein isothiocyanate (FITC)-conjugated monoclonal antibody specific for Annexin V and 5 \u0026mu;l of propidium iodide (PI) (BD, USA) and then incubated in the dark at 25\u0026deg;C for 15 min. Subsequently, cell apoptosis was measured via flow cytometry (Beckman Coulter, USA). The data were analyzed with FlowJo 10.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eCytotoxicity assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCellular cytotoxicity was assessed by the level of lactate dehydrogenase (LDH) activity. THP-1 cells were seeded on inverted transwell plates, differentiated into macrophages for 24 h, washed and treated with IFN\u0026gamma; combined with LPS or IL-4 combined with IL-13 for 48 h. MDA-MB-468 cells were seeded on 24-well plates and incubated with polarized macrophages. After 48 h of exposure, the cocultured cells were washed for detection of LDH. LDH release was measured via a Cytotoxicity Detection Kit (Roche Diagnostics, Germany) according to the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Counting Kit-8 (CCK-8) assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell viability was measured via the Cell Counting Kit-8 (CCK-8) (D Dojindo Molecular Technologies, Japan) assay following the manufacturer\u0026rsquo;s protocol. The cells were seeded into 96-well plates at a density of 3000 cells/well. After treatment with different doses of cisplatin for 24 h, 48 h or 72 h, 10 \u0026micro;L of CCK-8 solution was added to the cells. One hour later, the absorbance was calculated with a microplate spectrophotometer (Multiskan\u0026trade; GO, Thermo Fisher Scientific) at 450 nm.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eInfection with lentiviral shRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the lentiviral infection experiments, recombinant lentivirus (GenePharma, China) was used according to the manufacturer\u0026apos;s protocol. THP-1 cells were seeded at 1 \u0026times; 10\u003csup\u003e5 \u003c/sup\u003ecells/well in a 12-well plate and incubated overnight. The next day, control shRNA lentivirus and IGFBP3 knockdown shRNA lentivirus were combined with 10 \u0026mu;g/ml polybrene (Sigma, USA) and then added to the THP-1 cells. At 48 h after transduction, THP-1 cells generated with the IGFBP3 shRNA lentivirus were cultured with puromycin-containing (4 to 8 \u0026mu;g/ml) medium for 2 weeks to select stable clones.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe tumor tissue was fixed in formalin, embedded in paraffin, sectioned and heated. Subsequently, the sections were deparaffinized, rehydrated, and subjected to antigen retrieval. After being blocked with 2% goat serum, the sections were incubated with the indicated antibodies against CD11b (NOVUS, USA) and CD86 (NOVUS, USA) overnight at 4\u0026deg;C. The next day, the sections were washed with PBS and then incubated with the corresponding secondary antibodies for 1 hour at room temperature. The sections were treated with DAB working solution and then visualized by microscopy.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eICC staining was performed as described previously(11). The cells were processed routinely. For ICC staining, the following antibodies were used: B7-2/CD86 [Unconjugated] (NOVUS, USA), CD11b (NOVUS, USA), PPAR\u0026gamma; (Abcam, USA), IGFBP3 (Abcam, USA), \u0026beta;-Tubulin (Cell Signaling Technology, USA), Caspase 3 (Invitrogen, UK) and goat anti-rabbit secondary antibodies (West Grove, USA). Nuclei were counterstained with DAPI (Beyotime, China). Immunostaining was visualized with a confocal laser scanning microscope (SP8, Leica, Germany).\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eDual-luciferase reporter assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTheIGFBP3 promoter fragments were amplified and cloned and inserted into the pGL3 basic vector. Luciferase activity was examined via a dual luciferase assay (Promega, Madison, WI, USA) following the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData analysis was conducted via GraphPad Prism 9 (GraphPad Software, San Diego, CA). The results are presented as the means \u0026plusmn; SDs. One-way analysis of variance (ANOVA) with Tukey\u0026rsquo;s multiple comparisons test was used to determine significant differences between groups. For data involving only two groups, an unpaired Student\u0026rsquo;s t test was employed. P values \u0026lt; 0.05 were considered statistically significant (*p \u0026lt; 0.05, **p \u0026lt; 0.01).\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eThe synergistic effects of cisplatin and RGZ yield significant antitumor effects\u003c/h2\u003e \u003cp\u003eTo investigate the impact of immune cells on the breast cancer microenvironment, we utilized patient-derived xenograft (PDX) models for in vivo experiments. The subcutaneous tumor model was derived from a patient with triple-negative breast cancer (TNBC). PDX mice were treated with RGZ (5 mg/kg) or cisplatin (5 mg/kg) either separately or in combination. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B, there was no significant difference in tumor volume between the RGZ-treated group and the control group. However, the cisplatin-treated group presented a marked reduction in tumor burden. Notably, the combination treatment of RGZ and cisplatin resulted in more pronounced inhibition of the tumor burden than did cisplatin alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). The safety of RGZ and cisplatin was assessed by monitoring the weights of the mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Our findings demonstrate that the synergistic effect of cisplatin and RGZ leads to enhanced antitumor efficacy.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eRGZ enhances the proapoptotic effects of chemotherapy\u003c/h2\u003e \u003cp\u003eTo further validate the antitumor effects of RGZ in vitro, we treated MDA-MB-468 breast cancer cells with RGZ in the presence or absence of cisplatin. CCK-8 assays revealed a time- and dose-dependent increase in the cytotoxic effects of cisplatin (Supplemental Fig.\u0026nbsp;1A-C). Cotreatment with 25 \u0026micro;M RGZ and various doses of cisplatin for 48 hours significantly reduced cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Serum-free growth experiments indicated that 25 \u0026micro;M RGZ alone significantly inhibited cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Additionally, cotreatment with cisplatin and RGZ for 48 hours markedly increased the expression of the apoptosis marker caspase-3 in MDA-MB-468 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and D). Flow cytometry analysis revealed a significant increase in the number of apoptotic cells in the cisplatin/RGZ cotreatment group compared with the cisplatin-only group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-G). Lactate dehydrogenase (LDH) release, a marker of damage to the integrity of the cell membrane, was significantly greater in the RGZ-treated group than in the adriamycin (ADR) single-treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). These results indicate that RGZ enhances the sensitivity of breast cancer cells to cisplatin, leading to increased cytotoxicity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eIncreased TAMs (M2) in cisplatin- and RGZ-resistant PDX model mice\u003c/h2\u003e \u003cp\u003eGiven that cisplatin and RGZ have the most promising antitumor effects, we implanted tumor tissues from the cisplatin\u0026thinsp;+\u0026thinsp;RGZ group into nude mice and treated them with RGZ (5 mg/kg) and cisplatin (5 mg/kg) to establish resistant patient-derived xenograft (R-PDX) models. For the first two weeks, the R-PDX tumors presented a steady volume under RGZ treatment, indicating initial sensitivity to the drug. However, by the third week, a rapid increase in tumor volume was observed, suggesting the development of drug tolerance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Previous studies have identified TAMs as critical drivers of chemoresistance. In our study, we examined both the infiltration and polarization of TAMs within the R-PDX tumor environment. We noted a decrease in the M1 macrophage marker IL-1β during the drug tolerance stage. Conversely, M2 macrophage markers, including TGF-β and CD206, were significantly elevated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-D). The frequency of CD206-positive M2 macrophages was greater in resistant tumors than in resistant tumors, whereas the percentage of CD86-positive M1 macrophages was lower (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-G). These findings suggest that macrophage polarization plays a role in chemotherapy resistance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eRGZ promotes M2 macrophage polarization in vitro\u003c/h2\u003e \u003cp\u003eTo elucidate the mechanism underlying macrophage polarization, we established fully polarized macrophages derived from human monocytic THP-1 cells. CD11b is a primary marker for macrophages (M0), while CD86 and CD16 are markers for M1 macrophages, and CD206 is a marker for M2 macrophages. After a 24-hour incubation with 150 nM PMA, monocytes adhered to the dish bottom and displayed M0 characteristics. Stimulating M0 cells with 10 pg/mL LPS and 20 \u0026micro;g/mL IFN-γ for 24 hours resulted in detectable CD16 expression via immunocytochemistry. Similarly, incubating M0 cells with 20 \u0026micro;g/mL IL-4 and 20 \u0026micro;g/mL IL-13 for 24 hours increased CD206 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). RGZ treatment significantly increased the protein expression of CD206 and PPARγ in macrophages but reversed the increase in the expression of CD86 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and C). The mRNA levels of the M1-related genes INOS and IL-1β were significantly decreased in the RGZ-treated M1 group. In contrast, the expression of the M2-related genes CD206 and TGF-β was upregulated in both the M0\u0026thinsp;+\u0026thinsp;RGZ and M1\u0026thinsp;+\u0026thinsp;RGZ groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Compared with that in primary macrophages, CD206 expression was greater in the M0\u0026thinsp;+\u0026thinsp;RGZ and M1\u0026thinsp;+\u0026thinsp;RGZ groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and G). Nile red staining revealed increased lipid content in macrophages exposed to RGZ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF and H). These results indicate that RGZ promotes macrophage polarization toward the M2 phenotype and reverses the characteristics of M1 macrophages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eM1 macrophages promote the apoptosis of breast cancer cells\u003c/h2\u003e \u003cp\u003eOur comprehensive analysis demonstrated that the activation of PPARγ by RGZ inhibits tumor cell proliferation, increases sensitivity to chemotherapy drugs, and promotes apoptosis in breast cancer cells. Additionally, RGZ treatment encouraged macrophages to polarize toward the M2 type, shifting their function from promoting inflammation to inhibiting inflammation, thus promoting the development of tumor cells. To better understand this interaction, we established a coculture system of macrophages and breast cancer cells to simulate the human TME (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). After inducing macrophage polarization and coculturing them with breast cancer cells for 48 hours, RGZ was added to the coculture model for an additional 24 hours. LDH release assays indicated that in the absence of RGZ, M1-type macrophages induced increased LDH release from MDA-MB-468 cells because of the release of inflammatory factors. Conversely, M2-type macrophages, which release anti-inflammatory factors, downregulate LDH release from breast cancer cells. Upon RGZ treatment, LDH release increased in all groups, suggesting that the cytotoxic effect of RGZ on breast cancer cells outweighs the anti-inflammatory and drug resistance effects induced by M2-type polarization (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). We further analyzed the combined effects of cisplatin and RGZ on tumor cell apoptosis via flow cytometry in a coculture system. The results revealed a significant increase in apoptosis in MDA-MB-468 cells treated with RGZ compared with those not in coculture (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and E). Compared with M2-type macrophages, M1-type macrophages significantly increased early tumor cell apoptosis in the untreated group without RGZ (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). There was no significant change in tumor cell apoptosis in the RGZ-treated group compared with the untreated group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eIGFBP3 regulates M2 macrophage polarization induced by RGZ\u003c/h2\u003e \u003cp\u003ePrevious studies have indicated that macrophages can be regulated by specific genetic targets. To identify the genes involved in RGZ-induced M2 macrophage polarization, we analyzed publicly available ChIP-seq data from RGZ-treated PMA-differentiated THP-1 cells and conducted additional ChIP-seq experiments on classic M1- and M2-polarized macrophages. We integrated data showing genes upregulated in the RGZ-treated group and those active in M2 but not M1 macrophages. Using the Venn tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioinfogp.cnb.csic.es/tools/venny/index.html\u003c/span\u003e\u003cspan address=\"https://bioinfogp.cnb.csic.es/tools/venny/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), we identified six candidate genes: \u003cem\u003eIFI27, IGFBP3, ISG15, MX1, MX2\u003c/em\u003e, and \u003cem\u003eXAF1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Among these genes, \u003cem\u003eIGFBP3\u003c/em\u003e was the only gene with a significant positive correlation (r\u0026thinsp;\u0026gt;\u0026thinsp;0.3) with the M2 macrophage marker CD163 and no positive correlation with the M1 marker CD86, as shown in the TCGA breast cancer database (Supplemental Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://timer.cistrome.org/\u003c/span\u003e\u003cspan address=\"http://timer.cistrome.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). A volcano plot further revealed high IGFBP3 expression in classic M2 macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). In the GSE25608 dataset, THP-1 cells cultured with RGZ also presented elevated IGFBP3 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Verification of IGFBP3 protein levels in THP-1 cells revealed that it was overexpressed in IL4-induced macrophages and primary macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). To determine the role of IGFBP3 in macrophage polarization and tumor cell promotion, we constructed IGFBP3-knockdown THP-1 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Cotreatment with IGFBP3 knockdown and cisplatin significantly increased late apoptotic tumor cell proportions, whereas early apoptosis remained unaffected (Supplemental Figure S3). In subsequent apoptosis assays, we evaluated the proportion of apoptotic tumor cells within a coculture system of IGFBP3-knockdown macrophages and breast cancer cells. Compared with the control group, the IGFBP3 knockdown group (shIGFBP3\u0026thinsp;+\u0026thinsp;CIS) presented an increased proportion of early apoptotic breast cancer cells. Further treatment with RGZ (shIGFBP3\u0026thinsp;+\u0026thinsp;ROSI\u0026thinsp;+\u0026thinsp;CIS) further increased early apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF and G). Notably, compared with the RGZ-only group, the shIGFBP3\u0026thinsp;+\u0026thinsp;ROSI\u0026thinsp;+\u0026thinsp;CIS group presented a significantly greater proportion of apoptotic cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). These findings demonstrate that IGFBP3 knockdown combined with RGZ treatment significantly promotes apoptosis, thereby increasing tumor cell sensitivity to chemotherapeutic agents.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eIGFBP3 expression and clinical outcomes\u003c/h2\u003e \u003cp\u003eWe further investigated the protein expression of IGFBP3 following RGZ treatment and found that low-dose RGZ (5 \u0026micro;M) significantly increased IGFBP3 protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA‒C). Furthermore, macrophages treated with a relatively high dose of RGZ (10 \u0026micro;M) presented a 2-fold increase in IGFBP3 reporter gene activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). These findings indicate that PPARγ activation by RGZ enhances IGFBP3 expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo validate the clinical relevance of IGFBP3 expression in breast cancer, we analyzed IGFBP3 levels in a cohort of 64 breast cancer patients. Immunohistochemical analysis revealed that high IGFBP3 expression was present in 46% of the tumor samples. High IGFBP3 expression was significantly correlated with poorer overall survival (OS) and number at risk (p\u0026thinsp;=\u0026thinsp;0.033, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE and F).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eClinical data indicate that combining tumor activity regulators with low-dose chemotherapy agents can produce impressive tumor responses, leading to sustained complete remission. The combination of RGZ and chemotherapeutic agents has demonstrated therapeutic potential. However, the utilization of PPARγ agonists in tumor therapy has experienced several failures. The target of RGZ, PPARγ, is multifaceted [18]. It is a major regulator of adipocyte differentiation. It enhances macrophage lipid uptake and lipid efflux and possesses anti-inflammatory properties. PPARγ is expressed in various cancers, including colon, prostate, and breast cancers [19]. PPARγ ligands generally exhibit antiproliferative effects in these contexts, but some studies have suggested that they may exacerbate the growth of certain tumors. Specifically, in breast cancer, RGZ promotes G0‒G1 cell cycle arrest, increases caspase-9 activity, and induces growth arrest and apoptosis in breast cancer cells [20\u0026ndash;22]. This finding is consistent with our observations that RGZ induces apoptosis in the breast cancer cell line MDA-MB-468 in vitro. Recent studies have reported that RGZ exhibits antitumor activity in the early stages of tumor progression in vivo but fails in later stages of treatment [23]. Here, we demonstrate that the combination of RGZ and cisplatin has significant therapeutic effects in the early stages of breast cancer, whereas resistance develops in later stages in mice. This resistance may be related to changes in macrophage polarization within the TME.\u003c/p\u003e \u003cp\u003eMacrophages exhibit plasticity [24]. They can be polarized into the classically activated M1 type through proinflammatory stimuli (e.g., IFN-γ and LPS) or the alternatively activated M2 type through anti-inflammatory stimuli (e.g., IL-4 and IL-13), depending on the growth factors in the immune environment. The M1-like phenotype is immunostimulatory and can inhibit tumor development and progression, whereas the M2-like phenotype promotes malignant tumor proliferation and metastasis, facilitates tumor immune evasion, and induces drug resistance. Most tumor-associated macrophages (TAMs) share similar markers, including CD206, CD163, CCL8, and Arg1 [25]. The M2 subtype is widely recognized as the predominant phenotype of protumor TAMs (pTAMs). The activation of various cellular signaling pathways, such as the NF-κB, P38 MAPK, Notch, and JAK/STAT signaling pathways, can direct macrophage polarization [26\u0026ndash;29]. PPARγ is also considered to play crucial roles in promoting M2 macrophage polarization. We investigated the impact of RGZ on the expression of macrophage polarization-related markers. RGZ inhibited the expression of the M1 phenotype marker CD86. RGZ treatment increased the levels of the M2 markers CD206 and TGFβ. These findings further indicate that RGZ can reverse the M0 and M1 phenotypes of macrophages to the protumor M2 phenotype. Consistent with these results, RGZ induced the release of inflammatory factors (e.g., INOS and IL-1β), enhanced the phagocytic capacity of macrophages (an M2 marker), and increased the CD206/CD11b ratio. Above all, we demonstrated the paradoxical effects of RGZ in breast cancer. An in vitro coculture system of breast cancer cells and macrophages was established to simulate the human microenvironment. In isolated breast cancer cell cultures, treatment with RGZ increased LDH release and upregulated the expression of the apoptotic factor Caspase3. However, in coculture with macrophages, the apoptotic effect on breast cancer cells was diminished. This attenuation is presumed to be due to the polarization shift from M1 to M2 macrophages, which promotes tumor cell proliferation and resistance, counteracting RGZ-induced cell damage.\u003c/p\u003e \u003cp\u003eTo mitigate the reduction in RGZ efficacy due to macrophage polarization to the M2 phenotype observed during clinical administration, we conducted an extensive database analysis. This analysis revealed that insulin-like growth factor binding protein-3 (IGFBP3) was differentially expressed during both the macrophage polarization state and RGZ treatment. These findings suggest that IGFBP3 could be a potential target to counteract the regulation of macrophage polarization by PPARγ. IGFBP3 is a member of the IGFBP family that is capable of binding to IGF-I and IGF-II with high affinity, thus inhibiting cell actions mediated by IGF-I receptor activation [30, 31]. The overexpression of IGFBP3 has been observed in gliomas [32], nasopharyngeal carcinoma [33], esophageal squamous cell carcinoma [34], pancreatic ductal adenocarcinoma [35] and breast cancer [36, 37]. IGFBP3 expression is associated with poor patient prognosis [32, 36]. Previous reports have shown that high IGFBP3 expression in liver cancer patients is associated with an immunosuppressive phenotype [38]. T-cell infiltration is reduced in breast tumor environments deficient in IGFBP3 [39]. Our findings are consistent with this observation. Low doses of RGZ increase IGFBP3 expression and promote macrophage polarization toward the M2 phenotype. IGFBP3 knockdown reversed macrophage polarization to the M1 phenotype and indirectly enhanced the apoptosis of MDA-MB-468 cells in a coculture system. Dual-luciferase assays revealed that low doses of DAC significantly increased the binding affinity of IGFBP3 for the PPARγ promoter, supporting the role of IGFBP3 in macrophage polarization.\u003c/p\u003e \u003cp\u003eTo date, this is the first study to reveal the indispensable role of IGFBP3 in M2 macrophage polarization. This research reveals the potential mechanism of resistance development with long-term administration of the chemical drug cisplatin in combination with RGZ. Therefore, incorporating IGFBP3-targeted therapies could effectively reverse PPARγ-induced macrophage polarization and thereby alleviate the occurrence of resistance. Despite these significant findings, our study has several limitations. First, in the PDX mouse resistance model, we observed changes in macrophage infiltration with a high enrichment of M2 macrophages, suggesting that macrophage polarization mediates the development of resistance. However, other cells in the TME, such as T cells and endothelial cells, may also contribute. Additionally, the precise role of tumor IGFBP3 in different cancers remains contradictory [39], which limits the application of IGFBP3 inhibitors in combination therapies. The potential mechanisms involving PPARγ and IGFBP3 also require further investigation. Nonetheless, we believe that IGFBP3-targeted therapies will offer new insights for patients with breast cancer who frequently experience disease recurrence or refractory conditions in combination treatments.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study provides compelling evidence that IGFBP3-mediated M2 macrophage polarization plays a critical role in modulating the TME and influencing the sensitivity of breast cancer cells to chemotherapy. By promoting an immunosuppressive environment, IGFBP3 enhances tumor cell survival and resistance to treatment (Fig.\u0026nbsp;8). Targeting IGFBP3 in combination with PPARγ agonists such as RGZ could offer a novel therapeutic strategy to improve outcomes for patients with breast cancer, particularly those with high IGFBP3 expression. Further clinical validation and mechanistic studies are warranted to fully realize the potential of this approach.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate: \u003c/strong\u003eAll of the animal procedures were authorized by the Animal Ethics Committees of Nantong University. BC tissues were from patients in Affiliated Hospital of Nantong University. Ethical clearance for the research was acquired from the institution\u0026apos;s ethics committee.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eConsent for publication: \u003c/strong\u003eNot applicable.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials: \u003c/strong\u003eThe data that involved in this study are available in the supplementary material.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eCompeting interests: \u003c/strong\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cstrong\u003e: \u003c/strong\u003eThis work was supported by the following funding:\u003c/p\u003e\n\u003cp\u003e1. Open research Project of the Key Laboratory of Prevention and Treatment of Cardiovascular and Cerebrovascular Diseases (Ministry of Education), Gannan Medical University (XN202005);\u003c/p\u003e\n\u003cp\u003e2. The Scientific Research Foundation of State Key Laboratory of Vaccines for Infectious Diseases，Xiang An Biomedicine Laboratory (2023XAKJ0101005);\u003c/p\u003e\n\u003cp\u003e3. Basic Research Program of Jiangsu Province (BE2018778).\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions: \u003c/strong\u003eConcept and design: GW, TH, CG; Performing experiments and analysis of data: CG, GL; Contributing reagents, materials and other analytical tools: GW, TH; Writing the manuscript: CG, GW. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTrapani, D., et al., \u003cem\u003eGlobal challenges and policy solutions in breast cancer control.\u003c/em\u003e Cancer Treat Rev, 2022. \u003cstrong\u003e104\u003c/strong\u003e: p. 102339.\u003c/li\u003e\n\u003cli\u003eSaunders, C.M., \u003cem\u003eBreast surgery: a narrative review.\u003c/em\u003e Med J Aust, 2022. \u003cstrong\u003e217\u003c/strong\u003e(5): p. 262-267.\u003c/li\u003e\n\u003cli\u003eWang, S., E.J. Dougherty, and R.L. Danner, \u003cem\u003ePPARgamma signaling and emerging opportunities for improved therapeutics.\u003c/em\u003e Pharmacol Res, 2016. \u003cstrong\u003e111\u003c/strong\u003e: p. 76-85.\u003c/li\u003e\n\u003cli\u003eSzychowski, K.A., et al., \u003cem\u003e4-thiazolidinone-based derivatives rosiglitazone and pioglitazone affect the expression of antioxidant enzymes in different human cell lines.\u003c/em\u003e Biomed Pharmacother, 2021. \u003cstrong\u003e139\u003c/strong\u003e: p. 111684.\u003c/li\u003e\n\u003cli\u003eBurstein, H.J., et al., \u003cem\u003eUse of the peroxisome proliferator-activated receptor (PPAR) gamma ligand troglitazone as treatment for refractory breast cancer: a phase II study.\u003c/em\u003e Breast Cancer Res Treat, 2003. \u003cstrong\u003e79\u003c/strong\u003e(3): p. 391-7.\u003c/li\u003e\n\u003cli\u003eYee, L.D., et al., \u003cem\u003ePilot study of rosiglitazone therapy in women with breast cancer: effects of short-term therapy on tumor tissue and serum markers.\u003c/em\u003e Clin Cancer Res, 2007. \u003cstrong\u003e13\u003c/strong\u003e(1): p. 246-52.\u003c/li\u003e\n\u003cli\u003eFrohlich, E. and R. Wahl, \u003cem\u003eChemotherapy and chemoprevention by thiazolidinediones.\u003c/em\u003e Biomed Res Int, 2015. \u003cstrong\u003e2015\u003c/strong\u003e: p. 845340.\u003c/li\u003e\n\u003cli\u003eMunir, M.T., et al., \u003cem\u003eTumor-Associated Macrophages as Multifaceted Regulators of Breast Tumor Growth.\u003c/em\u003e Int J Mol Sci, 2021. \u003cstrong\u003e22\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eSolinas, G., et al., \u003cem\u003eTumor-associated macrophages (TAM) as major players of the cancer-related inflammation.\u003c/em\u003e J Leukoc Biol, 2009. \u003cstrong\u003e86\u003c/strong\u003e(5): p. 1065-73.\u003c/li\u003e\n\u003cli\u003eChen, D., et al., \u003cem\u003eMetabolic regulatory crosstalk between tumor microenvironment and tumor-associated macrophages.\u003c/em\u003e Theranostics, 2021. \u003cstrong\u003e11\u003c/strong\u003e(3): p. 1016-1030.\u003c/li\u003e\n\u003cli\u003eVilbois, S., Y. Xu, and P.C. Ho, \u003cem\u003eMetabolic interplay: tumor macrophages and regulatory T cells.\u003c/em\u003e Trends Cancer, 2024. \u003cstrong\u003e10\u003c/strong\u003e(3): p. 242-255.\u003c/li\u003e\n\u003cli\u003eMarigo, I., et al., \u003cem\u003eTumor-induced tolerance and immune suppression by myeloid derived suppressor cells.\u003c/em\u003e Immunol Rev, 2008. \u003cstrong\u003e222\u003c/strong\u003e: p. 162-79.\u003c/li\u003e\n\u003cli\u003eXu, M., et al., \u003cem\u003eIntratumoral Delivery of IL-21 Overcomes Anti-Her2/Neu Resistance through Shifting Tumor-Associated Macrophages from M2 to M1 Phenotype.\u003c/em\u003e J Immunol, 2015. \u003cstrong\u003e194\u003c/strong\u003e(10): p. 4997-5006.\u003c/li\u003e\n\u003cli\u003eChen, S., et al., \u003cem\u003eMacrophages in immunoregulation and therapeutics.\u003c/em\u003e Signal Transduct Target Ther, 2023. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 207.\u003c/li\u003e\n\u003cli\u003eLi, M., et al., \u003cem\u003eMetabolism, metabolites, and macrophages in cancer.\u003c/em\u003e J Hematol Oncol, 2023. \u003cstrong\u003e16\u003c/strong\u003e(1): p. 80.\u003c/li\u003e\n\u003cli\u003eNoy, R. and J.W. Pollard, \u003cem\u003eTumor-associated macrophages: from mechanisms to therapy.\u003c/em\u003e Immunity, 2014. \u003cstrong\u003e41\u003c/strong\u003e(1): p. 49-61.\u003c/li\u003e\n\u003cli\u003eQian, B.Z. and J.W. Pollard, \u003cem\u003eMacrophage diversity enhances tumor progression and metastasis.\u003c/em\u003e Cell, 2010. \u003cstrong\u003e141\u003c/strong\u003e(1): p. 39-51.\u003c/li\u003e\n\u003cli\u003eLehrke, M. and M.A. Lazar, \u003cem\u003eThe many faces of PPARgamma.\u003c/em\u003e Cell, 2005. \u003cstrong\u003e123\u003c/strong\u003e(6): p. 993-9.\u003c/li\u003e\n\u003cli\u003eGrommes, C., G.E. Landreth, and M.T. Heneka, \u003cem\u003eAntineoplastic effects of peroxisome proliferator-activated receptor gamma agonists.\u003c/em\u003e Lancet Oncol, 2004. \u003cstrong\u003e5\u003c/strong\u003e(7): p. 419-29.\u003c/li\u003e\n\u003cli\u003eBonofiglio, D., et al., \u003cem\u003ePeroxisome proliferator-activated receptor-gamma activates p53 gene promoter binding to the nuclear factor-kappaB sequence in human MCF7 breast cancer cells.\u003c/em\u003e Mol Endocrinol, 2006. \u003cstrong\u003e20\u003c/strong\u003e(12): p. 3083-92.\u003c/li\u003e\n\u003cli\u003eBonofiglio, D., et al., \u003cem\u003eEstrogen receptor alpha binds to peroxisome proliferator-activated receptor response element and negatively interferes with peroxisome proliferator-activated receptor gamma signaling in breast cancer cells.\u003c/em\u003e Clin Cancer Res, 2005. \u003cstrong\u003e11\u003c/strong\u003e(17): p. 6139-47.\u003c/li\u003e\n\u003cli\u003eBonofiglio, D., et al., \u003cem\u003ePeroxisome proliferator-activated receptor gamma activates fas ligand gene promoter inducing apoptosis in human breast cancer cells.\u003c/em\u003e Breast Cancer Res Treat, 2009. \u003cstrong\u003e113\u003c/strong\u003e(3): p. 423-34.\u003c/li\u003e\n\u003cli\u003eCaruso, J.A., et al., \u003cem\u003eLoss of PPARgamma activity characterizes early protumorigenic stromal reprogramming and dictates the therapeutic window of opportunity.\u003c/em\u003e Proc Natl Acad Sci U S A, 2023. \u003cstrong\u003e120\u003c/strong\u003e(42): p. e2303774120.\u003c/li\u003e\n\u003cli\u003eHarris, M.A., et al., \u003cem\u003eToward targeting the breast cancer immune microenvironment.\u003c/em\u003e Nat Rev Cancer, 2024.\u003c/li\u003e\n\u003cli\u003eCassetta, L., et al., \u003cem\u003eHuman Tumor-Associated Macrophage and Monocyte Transcriptional Landscapes Reveal Cancer-Specific Reprogramming, Biomarkers, and Therapeutic Targets.\u003c/em\u003e Cancer Cell, 2019. \u003cstrong\u003e35\u003c/strong\u003e(4): p. 588-602 e10.\u003c/li\u003e\n\u003cli\u003eLu, J., et al., \u003cem\u003eFargesin ameliorates osteoarthritis via macrophage reprogramming by downregulating MAPK and NF-kappaB pathways.\u003c/em\u003e Arthritis Res Ther, 2021. \u003cstrong\u003e23\u003c/strong\u003e(1): p. 142.\u003c/li\u003e\n\u003cli\u003eFang, J., et al., \u003cem\u003eTcpC Inhibits M1 but Promotes M2 Macrophage Polarization via Regulation of the MAPK/NF-kappaB and Akt/STAT6 Pathways in Urinary Tract Infection.\u003c/em\u003e Cells, 2022. \u003cstrong\u003e11\u003c/strong\u003e(17).\u003c/li\u003e\n\u003cli\u003eZhong, J., et al., \u003cem\u003eUbiquitylation of MFHAS1 by the ubiquitin ligase praja2 promotes M1 macrophage polarization by activating JNK and p38 pathways.\u003c/em\u003e Cell Death Dis, 2017. \u003cstrong\u003e8\u003c/strong\u003e(5): p. e2763.\u003c/li\u003e\n\u003cli\u003eZhu, L.W., et al., \u003cem\u003eFicolin-A induces macrophage polarization to a novel pro-inflammatory phenotype distinct from classical M1.\u003c/em\u003e Cell Commun Signal, 2024. \u003cstrong\u003e22\u003c/strong\u003e(1): p. 271.\u003c/li\u003e\n\u003cli\u003eBaxter, R.C., \u003cem\u003eIGF binding proteins in cancer: mechanistic and clinical insights.\u003c/em\u003e Nat Rev Cancer, 2014. \u003cstrong\u003e14\u003c/strong\u003e(5): p. 329-41.\u003c/li\u003e\n\u003cli\u003eFurstenberger, G. and H.J. Senn, \u003cem\u003eInsulin-like growth factors and cancer.\u003c/em\u003e Lancet Oncol, 2002. \u003cstrong\u003e3\u003c/strong\u003e(5): p. 298-302.\u003c/li\u003e\n\u003cli\u003eChen, C.H., et al., \u003cem\u003eSuppression of tumor growth via IGFBP3 depletion as a potential treatment in glioma.\u003c/em\u003e J Neurosurg, 2019. \u003cstrong\u003e132\u003c/strong\u003e(1): p. 168-179.\u003c/li\u003e\n\u003cli\u003eBao, L., et al., \u003cem\u003eOverexpression of IGFBP3 is associated with poor prognosis and tumor metastasis in nasopharyngeal carcinoma.\u003c/em\u003e Tumor Biol, 2016. \u003cstrong\u003e37\u003c/strong\u003e(11): p. 15043-15052.\u003c/li\u003e\n\u003cli\u003eNatsuizaka, M., et al., \u003cem\u003eIGFBP3 promotes esophageal cancer growth by suppressing oxidative stress in hypoxic tumor microenvironment.\u003c/em\u003e Am J Cancer Res, 2014. \u003cstrong\u003e4\u003c/strong\u003e(1): p. 29-41.\u003c/li\u003e\n\u003cli\u003eXue, A., et al., \u003cem\u003ePrognostic significance of growth factors and the urokinase-type plasminogen activator system in pancreatic ductal adenocarcinoma.\u003c/em\u003e Pancreas, 2008. \u003cstrong\u003e36\u003c/strong\u003e(2): p. 160-7.\u003c/li\u003e\n\u003cli\u003eMarzec, K.A., R.C. Baxter, and J.L. Martin, \u003cem\u003eTargeting Insulin-Like Growth Factor Binding Protein-3 Signaling in Triple-Negative Breast Cancer.\u003c/em\u003e Biomed Res Int, 2015. \u003cstrong\u003e2015\u003c/strong\u003e: p. 638526.\u003c/li\u003e\n\u003cli\u003eJulovi, S.M., J.L. Martin, and R.C. Baxter, \u003cem\u003eNuclear Insulin-Like Growth Factor Binding Protein-3 As a Biomarker in Triple-Negative Breast Cancer Xenograft Tumors: Effect of Targeted Therapy and Comparison With Chemotherapy.\u003c/em\u003e Front Endocrinol (Lausanne), 2018. \u003cstrong\u003e9\u003c/strong\u003e: p. 120.\u003c/li\u003e\n\u003cli\u003eChen, J., et al., \u003cem\u003eConstruction and validation of a novel IGFBP3-related signature to predict prognosis and therapeutic decision making for Hepatocellular Carcinoma.\u003c/em\u003e PeerJ, 2023. \u003cstrong\u003e11\u003c/strong\u003e: p. e15554.\u003c/li\u003e\n\u003cli\u003eScully, T., et al., \u003cem\u003eEnhancement of mammary tumor growth by IGFBP-3 involves impaired T-cell accumulation.\u003c/em\u003e Endocr Relat Cancer, 2018. \u003cstrong\u003e25\u003c/strong\u003e(2): p. 111-122.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"macrophage polarization, PPARγ, IGFBP3, combination therapy resistance, breast cancer","lastPublishedDoi":"10.21203/rs.3.rs-5174260/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5174260/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eRosiglitazone (PPARγ agonist, RGZ) combined with chemotherapy drugs has proven effective in treating clinical breast cancer patients. However, the underlying targets and resistance mechanisms remain unclear, posing challenges in maintaining long-term efficacy. This study aimed to investigate the mechanisms of RGZ in macrophage polarization and evaluate its effects within the TME.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn vivo experiments were conducted using a patient-derived xenograft (PDX) nude mouse model resistant to chemotherapy, which simulates the clinical immune microenvironment. In vitro, the Thp-1 human monocytic cell line was induced to differentiate into macrophages and cocultured with MDA-MB-468 breast cancer cells. The effects of PPARγ agonists on the drug resistance of breast cancer cells in a coculture model were explored.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eAn increase in M2 macrophages was observed in combination-resistant mice, with PPARγ activation by RGZ inducing macrophage differentiation toward the M2 phenotype. Knockdown of IGFBP3 in macrophages alleviated breast cancer cell resistance in the microenvironment by reversing polarization.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur study revealed that targeting macrophage polarization through IGFBP3 can reverse the effects of PPARγ on macrophage polarization, promote cancer cell apoptosis and collectively reverse the resistance of tumor cells to combination therapy. These findings provide a new theoretical basis for anti-breast cancer treatment.\u003c/p\u003e","manuscriptTitle":"IGFBP3-mediated M2 Macrophage Polarization Enhances Resistance to Rosiglitazone and Cisplatin in Breast Cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-01 08:03:40","doi":"10.21203/rs.3.rs-5174260/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c323059b-2841-486c-9a41-6496c68d8503","owner":[],"postedDate":"November 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-12T17:38:39+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-01 08:03:40","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5174260","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5174260","identity":"rs-5174260","version":["v1"]},"buildId":"pf3fE39SIOqb-0xH_OWvX","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}