ELMO2 is an essential regulator of carotid artery development

ELMO2 is an essential regulator of carotid artery development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article ELMO2 is an essential regulator of carotid artery development Ralf Adams, Athira Suresh, Kai Kruse, Hendrik Arf, Rodrigo Diéguez-Hurtado This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5362441/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Jun, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract Engulfment and cell motility 2 (ELMO2) is a cytoskeletal adaptor protein necessary for cell migration and apoptotic cell removal. Loss-of-function mutations in ELMO2 cause intraosseous vascular malformation (VMOS), a human disease involving progressive expansion of craniofacial bones in combination with anomalies in blood vessels that emerge from the external carotid artery, as well as aneurysms in the internal carotid artery. Here we show that global inactivation of Elmo2 in mice leads to midgestation embryonic lethality due to dilation of the 3rd pharyngeal arch arteries and aneurysm formation in the common carotids. These vascular malformations are associated to defects in vascular smooth muscle cell organization and are phenocopied upon neural crest-specific deletion. In vitro experiments further confirm that ELMO2 regulates vascular smooth muscle cell adhesion, spreading and contractility through Rac1 activation and modulation of actin dynamics. Our findings provide new insights into the biological function of ELMO2 with relevant implications for understanding VMOS pathogenesis and raise the possibility of vessel-targeted diagnostic and treatment strategies. Biological sciences/Developmental biology/Angiogenesis Biological sciences/Developmental biology/Embryogenesis Biological sciences/Developmental biology/Experimental organisms/Model vertebrates/Mouse ELMO2 common carotid artery development vascular malformations embryonic lethality rare human disease Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Defective regulation of blood vessel growth and patterning is the cause of numerous hereditary but also spontaneous human diseases, and recent insight into the underlying molecular defects has enabled targeted therapeutic approaches 1 , 2 . Intraosseous vascular malformation (VMOS) is a very rare and poorly understood autosomal-recessive disorder involving progressive overgrowth of the mandible, maxilla and other craniofacial bones in combination with vascular alterations inside the affected skeletal elements 3 , 4 and in the carotid arteries or vessels that branch off from them, which are found enlarged or affected by aneurysms 5 . The causal relationship between vascular and skeletal malformations in VMOS remains unknown, but it has been suggested that dilated blood vessels inside lesions are insufficiently covered by vascular smooth muscle cells (VSMCs) 4 , 6 . Similar VSMC defects are associated with dilation and aneurysm formation in the dorsal aorta 7 . The identification of loss-of-function mutations in the human gene ELMO2 (Engulfment and cell motility 2) as a cause of VMOS was an important milestone for understanding the disease 3 , 8 , 9 . ELMO2 is a cytoplasmic protein known to regulate cytoskeletal dynamics by Rho-Rac regulation 10 . It belongs to the ELMO domain containing (ELMOD) family 11 and is conserved across different species 10 – 12 . Mammalian ELMO proteins (ELMO1, 2, and 3) share multiple homology domains such as Ras binding domain (RBD), Armadillo repeats, ELMO domain, pleckstrin homology (PH) domain, and C’ terminal proline-rich repeats 10 – 12 , which allow binding to Rho 3 , 10 – 14 , integrin-linked kinase (ILK) 15 – 17 , dedicator of cytokinesis (DOCK) 3 , 10 – 14 , 18 , 19 , and spectraplakin 20 – 22 . These interactions link ELMO proteins to Rac1 signaling and the control of cytoskeletal dynamics during cell adhesion, junction formation, polarity and cell migration 10 , 12 , 14 – 18 , 23 , 24 . While all ELMO proteins show high sequence homology and partially redundant functions 3 , 11 , 24 – 26 , global deletion of Elmo1 in mice only affects Sertoli cells in the male reproductive system 13 , whereas Elmo2 knockout mice die during embryonic gestation due to a yet uncharacterized phenotype 19 . The roles of Elmo2 in the vascular and skeletal system remain unexplored although it is known that signaling defects in functionally-associated proteins such as integrins, Ilk and Rac1 are responsible for cardiovascular and craniofacial abnormalities 27 – 32 . Vascular malformations are non-neoplastic congenital anomalies affecting blood vessels. They result from errors in the development program of the vascular system due to somatic or germline prenatal mutations 33 . Most sporadic vascular malformations are caused by somatic mutations that activate the RAS/MAPK/ERK and/or the PI3K/AKT/mTOR signaling pathways. Familial malformations are caused by loss-of-function mutations in genes related to TGFβ signaling, RASA1, glomulin or CCMs (cerebral cavernous malformations) 34 . Interestingly, vascular anomalies frequently occur in the head and neck 35 , and usually involve defects in the control of endothelial or mural cells, which together form the vascular wall. The vasculature of the head and neck region derives mostly from the pharyngeal arch arteries (PAAs), which are a series of six paired arteries that sequentially emerge from embryonic day (E) 9.5 to E10.0 in mice and connect the aortic sac to the paired dorsal aortae 36 . During development, the PAAs undergo complex remodeling to form the major arteries supplying the head, neck and upper thorax. The endothelial cells (ECs) of the PAAs are derived from Mesp1 -lineage positive mesoderm 28 , while the surrounding mural cells, namely pericytes and vascular smooth muscle cells (VSMCs), arise from the neural crest 37 . In addition, neural crest cells (NCCs) also give rise to most connective tissues in the head and neck region, including bone and cartilage. Here, we have used mouse genetics, advanced confocal and light-sheet microscopy, single cell RNA-sequencing (scRNA-seq), in vitro cell culture and biochemistry approaches to systematically investigate the functional role of Elmo2 during mouse embryonic development. We show that the gene product is indispensable for vascular morphogenesis of the 3rd PAA through the control of neural crest-derived VSMC contractile properties and highlight that vascular defects may be a primary cause of the lesions observed in VMOS patients. Results Loss of Elmo2 leads to carotid artery aneurysm and embryonic lethality In order to understand the in vivo function of Elmo2 , global knockout mice ( Elmo2 −/− ), obtained after ubiquitous Cre-mediated recombination of a “knockout-first” allele (Supplementary Fig. 1a and b), were compared to control littermates ( Elmo2 +/+ ) at different embryonic stages. Efficient deletion of Elmo2 -encoded transcripts and protein were confirmed by RT-qPCR and Western blot, respectively (Supplementary Fig. 1c and d). The first macroscopic evidence of deleterious phenotypic alterations (Fig. 1 a) was detected in E12.5 Elmo2 −/− embryos, which show small vascular lesions in the head and neck region. These lesions worsened during the following days of development, giving rise to subcutaneous edema and severe hemorrhages in the cervical region by E13.5 and E14.5. No surviving embryos were obtained beyond E15/E15.5. Taking advantage of β-galactosidase expression from the targeted allele, heterozygous ( Elmo2 +/− ) embryos, which develop normally, were assessed by X-Gal staining at E12.5. This approach revealed expression of Elmo2 in different structures including the dorsal aorta, laryngotracheal groove, vagus nerve, sympathetic chain ganglia, trachea, esophagus and pharyngeal arch arteries (Fig. 1 b and Supplementary Fig. 1e). In line with this expression pattern, the histological analysis of transverse sections from the cervical region of mutant embryos revealed a severe dilation of the third pharyngeal arch artery (3rd PAA) at E12.5 and of the carotid arteries at E13.5 (Fig. 1 c-e and Supplementary Fig. 1f). The complex and dynamic morphogenetic program that shapes hierarchical blood vessel organization in the trunk and cervical area (Supplementary Fig. 1g) prompted us to analyze the three-dimensional organization of the vascular tree in control and Elmo2 −/− embryos from E11.5 to E13.5 using whole-mount staining and light-sheet microscopy. This analysis showed that the first vascular defect in global knockout embryos, namely the dilation of the 3rd PAA, arises at E12.5. This vessel further remodels giving rise to the common carotid arteries 38 , which are severely dilated resulting in fusiform aneurysm formation in E13.5 mutants (Fig. 1 g). It is worth noting that these defects in vascular shape and diameter are rather specific to the 3rd PAA and only mildly affect other major vessels, including neighboring pharyngeal arch arteries (Supplementary Fig. 2a-e). Loss of Elmo2 leads to alterations in endothelial and vascular smooth muscle cells To characterize the vascular defects in Elmo2 −/− embryos in greater detail, the 3rd PAA and carotid arteries were analyzed by immunofluorescence staining and high-resolution confocal microscopy. This revealed discontinuities in the endothelial lining (Supplementary Fig. 3a) and significant changes in the size and morphology of ECs and their nuclei (Fig. 2 a-c) in mutant embryos relative to littermate controls. In addition, defects in the polarized expression of the luminal marker Podocalyxin were observed (Fig. 2 d) as well as ectopic expression of the VSMC markers α-smooth muscle actin (αSMA) and SM22α in ECs (Fig. 2 e and f). Despite normal and domain-specific expression of markers for lymphatic vessels (Prox1) and arteries (SOX17) (Fig. 1 e and 2 a), clusters of ECs in the dilated carotid arteries of Elmo2 −/− embryos express detectable levels of Endomucin, a marker that is normally absent from the arterial endothelium (Fig. 2 g and h). VSMC contractility is an important regulator of vascular tone in the adult organism but also in the embryo 39 , 40 . We therefore analyzed VSMCs around the 3rd PAA and carotid arteries by immunostaining against proteins associated with the contractile phenotype. This revealed that the expression levels of SM22α, αSMA and Calponin1 are comparable between control and Elmo2 −/− embryos (Supplementary Fig. 3b-g), arguing against major defects in VSMC abundance and differentiation. Likewise, no overt differences were detected for Nestin (Supplementary Fig. 3f), whose expression has been associated to the synthetic phenotype of VSMCs 41 . The staining intensity and distribution pattern of phospho-myosin light chain 2, a functional marker of VSMC contractility, also does not show obvious changes in the wall of mutant carotid arteries relative to littermate controls (Supplementary Fig. 3c). Although the expression of VSMC identity and differentiation markers appears unaffected, super-resolution confocal microscopy revealed that the normal alignment of αSMA + bundles with respect to the longest axis of the underlying endothelium is severely compromised in Elmo2 −/− embryos (Fig. 2 i-k). Whereas αSMA + fibers are oriented perpendicular to elongated ECs and thereby to the direction of blood flow in the control E12.5 3rd PAA, both EC elongation and the orientation of αSMA + bundles are disorganized after loss of Elmo2 . Furthermore, αSMA and SM22α immunosignals, which are strongly concentrated near the subendothelial basement membrane in VSMCs of control carotid arteries, have lost their normal polarization and multiple peaks of high staining intensity can be detected throughout the Elmo2 −/− vessel wall (Fig. 2 l and m). The same analysis also confirmed the abnormal expression of VSMC markers in the Elmo2 −/− carotid artery endothelium (Fig. 2 m). Next, we assessed whether significant changes in EC or VSMC proliferation are associated with the vessel enlargement in Elmo2 −/− mutants. To this end, we labelled mitotic cells in vivo by injection of 4-Ethynyl-2’-deoxyuridine (EdU) into pregnant females. This approach revealed strong increases in the absolute number of EdU + ECs and VSMCs in the 3rd PAA of E12.5 mutant embryos. However, these increases are no longer statistically significant after normalization to vessel perimeter and may therefore reflect the dilation of Elmo2 −/− carotid arteries (Supplementary Fig. 4a-d). Altogether, these results establish that ELMO2 is required for the normal development of the 3rd PAA and common carotid artery during embryogenesis. Transcriptomic analysis of Elmo2 mutants at single cell resolution To gain insight into the molecular changes resulting from the inactivation of Elmo2 , we performed single cell RNA-sequencing (scRNA-seq) of the 3rd PAA and surrounding mesenchyme dissected from control ( Elmo2 +/+ ), heterozygous ( Elmo2 +/− ) and mutant homozygous ( Elmo2 −/− ) E12.5 embryos. Integrated analysis of the transcriptome from these samples allowed identification of seven major cell populations with distinct expression signatures and enrichment of specific markers (Fig. 3 a and Supplementary Fig. 5a). The most abundant cell type is the mesenchymal stromal cell (MSC) population, which represents more than 70% of all cells. MSCs are followed by endothelial, immune and muscle cells, which are found in similar proportions and together represent ~ 20% of total cells. The remaining cell types are mostly erythrocytes, neurons and epithelial cells (Supplementary Fig. 5b). As expected, Elmo2 transcript expression is proportionally reduced in heterozygotes and is below the detection threshold in Elmo2 −/− samples (Fig. 3 b). Among the members of the Elmo family, Elmo2 has the highest expression, followed by Elmo1 and Elmo3 (Supplementary Fig. 5c), which do not show significant compensatory upregulation upon deletion of Elmo2 (Supplementary Fig. 5d). Furthermore, expression of Elmo2 is rather homogeneous across the different cell clusters with the highest level found in neurons and the lowest in the erythroid lineage (Fig. 3 c). Considering that the phenotypic changes in Elmo2 −/− mutants affect mostly the vascular compartment, the control and homozygous mutant EC population in our scRNA-seq data was subclustered for deeper analysis. Three main subsets with distinct markers were identified in a two-dimensional (2D) Uniform Manifold Approximation and Projection (UMAP) representation, namely venous, arterial and lymphatic ECs (Fig. 3 d and Supplementary Fig. 5e). Interestingly, color-labelling of cells corresponding to the control ( Elmo2 +/+ ) or knockout ( Elmo2 −/− ) samples within the subclustered EC dataset, highlighted an area characterized by overrepresentation of mutant cells in a specific 2D spatial location within the arterial subcluster (Fig. 3 e). In addition, differential gene expression analysis (DEG) allowed the identification of de-regulated genes in Elmo2 −/− cells relative to control. Interestingly, when a stringent selection criterion for highly statistically significant values is used (p-adjusted < 1 − 10 ), only a single gene ( Elmo2 ) is downregulated. In contrast, 38 genes are upregulated, 9 of them with a log2 fold change above 2 (Fig. 3 f). Notably, all these upregulated genes are either exclusively or primordially expressed in the mutant cell hotspot within the arterial subcluster (Fig. 3 g). Among the upregulated genes, Acta2 and Tagln were previously identified during our histology analysis because of their ectopic expression in arterial ECs of mutant embryos (Fig. 2 e and Supplementary Fig. 3b). Next, we followed a similar approach for the identification of subpopulations within the mesenchymal stromal cells (MSCs), which are a source of VSMCs during development 42 , 43 . Both the UMAP representation (Fig. 3 h) and marker analysis (Supplementary Fig. 5f) indicate that the differences between the 8 identified MSC subtypes are less defined than those found during the EC subclustering, potentially reflecting ongoing differentiation and incomplete terminal phenotypic specification. Likewise, cellular distribution of control and Elmo2 mutant cells within the MSC UMAP plot is rather homogeneous (Fig. 3 i) and only a few genes were found to be de-regulated (log2 fold change > 2 or <-2) when a cut-off for highly statistically significant differences (p-adjusted < 1 − 10 ) is applied (Fig. 3 j). Using this criteria, 4 downregulated ( Elmo2 , Hoxb6 , Car2 and Capn11 ) and 3 upregulated genes ( Cnmd , Matn1 and Acan ) were identified, without clear functional relationships among them. A similar profile of very limited or non-significant changes in gene expression was found for the other cell populations in our scRNA-seq data (Fig. 3 k). With the aim of gaining a broader understanding of biological processes potentially affected by gene expression changes in Elmo2 −/− ECs and MSCs, a gene set enrichment analysis including all de-regulated genes with a (less stringent) p-adjusted cut-off value of 0.01 and a log2 fold change > 0.5 or < -0.5 was performed. From the top gene ontology terms found (Supplementary Fig. 5g) there is no explicit relation to blood vessel development either in the ECs or MSCs population, yet different aspects related to extracellular matrix organization are highlighted for both cell types. Thus, unexpectedly, the analysis of the sc-RNAseq data reveals rather limited changes in gene expression and provides no clear explanation for the dramatic changes in the mutant common carotid arteries. Inactivation of Elmo2 in endothelial and smooth muscle cells For cell type-specific loss-of-function experiments, a conditional (loxP-flanked) allele of Elmo2 (Supplementary Fig. 1a) was established and validated by breeding it to homozygosity in a PGK-Cre +/T background 44 . As expected, ubiquitous expression of constitutively acting Cre led to widespread Elmo2 inactivation and phenocopied the vascular defects seen Elmo2 −/− embryos generated with the “knockout-first” approach (Supplementary Fig. 6a-c). Next, we generated EC-specific mutants by interbreeding of mice carrying the floxed Elmo2 allele and Tek-Cre transgenic animals 45 . Analysis with the R26-mTmG Cre-reporter 46 confirmed successful Tek-Cre -mediated recombination in the embryonic endothelium (Supplementary Fig. 7a). However, EC-specific Elmo2 mutants ( Elmo2 ΔEC ) showed no observable defects in vascular development (Supplementary Fig. 7b). In particular, the size and morphology of Elmo2 ΔEC carotid arteries (Supplementary Fig. 7b-c) or the expression of known markers of EC or VSMC (Supplementary Fig. 7d) are indistinguishable from control littermates. These results argue that the vascular malformations observed in global Elmo2 knockout embryos are not caused by cell-autonomous defects in the endothelium. Next, we conducted genetic experiments to address whether Elmo2 is required in VSMCs. To this end, a transgene expressing constitutive Cre under the transcriptional control of Transgelin (SM22α) ( Tagln-Cre 47 ) was introduced into the Elmo2 conditional (floxed) background and embryos at specific developmental stages were collected. Unexpectedly, the resulting smooth muscle cell-specific knockout embryos ( Elmo2 ΔSMC ) were macroscopically indistinguishable from control littermates at E13.5 (Fig. 4 a). Immunostaining-assisted analysis of histological sections revealed subtle, yet statistically significant dilation of the carotid arteries at E13.5 and E15.5 (Fig. 4 b-c and Supplementary Fig. 8a). Despite carotid artery dilation, other relevant features of the global knockout phenotype were not reproduced after Tagln-Cre -mediated deletion of Elmo2 . In particular, there were no signs of aneurysm formation, disorganized VSMC alignment, or altered endothelial morphology, polarity and gene expression (Fig. 4 d and Supplementary Fig. 8b). To rule out that the failure to reproduce the global knockout phenotype is caused by suboptimal Elmo2 deletion in VSMCs, the recombination efficiency of Tagln-Cre in E13.5 embryos was assessed with the R26-mTmG Cre-reporter. Analysis of GFP expression as surrogate marker of recombination clearly showed that the vast majority of VSMCs and mesenchymal cells around the carotid arteries (Fig. 4 e) and neighboring vessels (Supplementary Fig. 8c) are efficiently targeted by the Tagln-Cre . In summary, these results argue that Elmo2 deletion in VSMCs by means of a Transgelin-driven constitutive Cre-recombinase is not able to fully phenocopy the effects elicited upon global gene inactivation. Neural crest-specific deletion of Elmo2 phenocopies the global Elmo2 KO Neural crest cells contribute to many craniofacial tissues and are an important source of mural cells in the 3rd PAA and thereby the common carotid arteries 37 , 48 . We chose Wnt1-Cre2 transgenic mice 49 to study NCCs and their progeny, which would also address potential roles early in mural cell differentiation, whereas Tagln-Cre targets more differentiated VSMCs. In order to assess whether Wnt1-Cre2 allows targeting of neural crest-derived VSMCs progenitors and compare the recombination timing with that of Tagln-Cre , lineage tracing analysis using the R26-mTmG reporter allele were carried out for both lines. Notably, Wnt1-Cre2 -mediated labelling allows detection of a large number of GFP + cells that cluster around the vascular plexus giving rise to the 3rd PAA by E9.5, whereas Tagln -Cre-mediated recombination is restricted to the heart at the same stage (Supplementary Fig. 9a). In line with this result, expression of the VSMC markers αSMA and SM22α is limited to the heart and cannot be detected in mural cells around the blood vessels in the branchial arches (Supplementary Fig. 9b). Expression of SM22α in mural cells or the 3rd PAA is first detected at E10.5, which coincides with the emergence of Tagln-Cre -labelled GFP + cells in in this structure (Supplementary Fig. 9c). In contrast, at this timepoint, a much larger number of Wnt1-Cre2 -traced cells wrap around the 3rd PAA forming a surrounding layer that consists of both SM22α + VSMCs and yet undifferentiated cells (Supplementary Fig. 9c). At E11.5, recombination with both Cre lines generates robust perivascular GFP labeling in the relevant region (Supplementary Fig. 9d). We further analyzed the recombination pattern elicited by Wnt1-Cre2 in E13.5 embryos with special interest to the carotid arteries and neighboring vascular structures. Wnt1-Cre2 -mediated recombination targeted VSMCs around the carotid arteries with high efficacy but, as expected, spared the mesoderm-derived smooth muscle surrounding the vertebral arteries, dorsal aorta, and jugular veins, as well as the endothelial lining of blood vessels (Fig. 5 a and Supplementary Fig. 10a-c). Taken together, these results prove that Wnt1-Cre2 efficiently targets NCC-derived VSMCs and their progenitors in the early mouse embryo. Remarkably, neural crest-specific mutants ( Elmo2 ΔNCC ), generated by interbreeding of the Elmo2 conditional line with Wnt1-Cre2 , reproduce the vascular defects observed in the global knockout model. Macroscopic observation of E13.5 Elmo2 ΔNCC embryos revealed severe hemorrhaging in the cervical region and dorsal edema (Fig. 5 b) as well as massive dilation of the carotid arteries with aneurysm formation (Fig. 5 c and d). Moreover, the defects in the hierarchical expression pattern of αSMA and SM22α found in Elmo2 −/− embryos are also present upon neural crest-specific deletion (Fig. 5 e), as well as the disorganized alignment of αSMA + actin bundles with respect to the ECs’ longest axis (Fig. 5 f and g). Strikingly, phenotypic changes observed in the ECs of the global knockout, such as retained expression of Endomucin in arterial territories, discontinuous endothelial lining and ectopic expression of mesenchymal markers are also seen upon neural crest-specific Elmo2 deletion (Fig. 5 h and i). Given that Wnt1-Cre2 -driven recombination spares the endothelium, this result is further evidence that the EC defects in Elmo2 mutants are secondary and probably a consequence of the severe vessel dilation. Since neural crest cells give rise to parts of the autonomic nervous system and might therefore control vascular tone through VSMC innervation 50 , we bred the Elmo2 conditional knockout mice with the TH-IRES-Cre line 51 , which directs Cre recombination to catecholaminergic sympathetic neurons. Efficient and precise targeting of the paravertebral sympathetic ganglia is confirmed by GFP expression in the R26-mTmG Cre reporter background (Supplementary Fig. 10d). Nevertheless, Elmo2 deletion in these structures did not induce relevant phenotypic alterations and the resulting mutants survived to term and were obtained slightly above the expected ratio at birth (27.3% instead of 25%). Altogether, these results indicate that Elmo2 is essential for vascular diameter control in the developing carotid artery by regulating the properties of NCC-derived VSMC progenitors. ELMO2 controls contractile ability and actin dynamics of human VSMCs in vitro To gain insight into the cellular function of ELMO2, we next conducted experiments in cultured VSMCs. We opted for human brain vascular smooth muscle cells (HBVSMCs) because these cells, just like those wrapping around the 3rd PAA and carotid artery, are of neural crest origin 52 . Moreover, HBVSMCs express ~ 1000-fold higher levels of ELMO2 compared to ELMO1 (Supplementary Fig. 11a). Silencing RNA (siRNA)-mediated knockdown (KD) of ELMO2 in HBVSMCs significantly decreased transcript abundance already by 24h after treatment and this effect was maintained over several days (Fig. 6 a). At the protein level, significant reduction of ELMO2 was obvious at 48h after siRNA treatment, with the highest depletion achieved at 72-96h (Fig. 6 b), suggesting a slow protein turnover rate. In vitro , siELMO2 -treatment induced a compensatory ~ 2-fold increase in ELMO1 transcription, which coincides with the timepoints of highest ELMO2 protein depletion (Supplementary Fig. 11b), yet this upregulation may be of limited functional significance given the much higher endogenous expression of ELMO2 in HBVSMCs. Similar to our in vivo observations, siELMO2 -treated cells did not show relevant changes in the expression of known VSMC markers relative to siControl cells (Supplementary Fig. 11c-d). Likewise, the overall abundance of previously described ELMO2 interaction partners or downstream effectors relevant for cell adhesion, extracellular matrix binding and cell contractility were unchanged at the protein level (Supplementary Fig. 11e). The subcellular localization of integrin-linked kinase, a well described interactor of ELMO2, and the phosphorylation of myosin light chain 2, a key regulator of cell contractility, were comparable in KD and control cells (Supplementary Fig. 11d and f). On the contrary, analysis of F-actin by phalloidin staining (Supplementary Fig. 11d) revealed a slight reduction in the intensity and abundance of stress fibers in siELMO2 HBVSMCs, whereas cortical actin appeared unaffected. Next, we analyzed the functional performance of siELMO2 HBVSMCs in assays requiring active remodeling of the cytoskeleton. Loss of ELMO2 reduced cell attachment and spreading in Collagen I-coated culture plates at early timepoints (10min to 2h) relative to siControl cells. These defects were no longer detectable at 6h after seeding, when both the area and number of cells attached are indistinguishable between the KD and control conditions (Fig. 6 c-d and Supplementary Fig. 11g). Time-lapse video recordings from live-imaging co-culture experiments confirmed the delayed adhesion of siELMO2 cells (Supplementary Fig. 11h-i). Contrary to control cells, which extend filopodia-like cytoplasmic projections, spherical protrusions (blebs) were continuously formed and retracted in the membrane of KD cells (Fig. 6 e and Supplementary Movie 1a and b). Moreover, culture of siELMO2 HBVSMCs in 3D fibrin hydrogels lead to a similar reduction in cell spreading and cellular area relative to siControl cells, consistent with the results seen in 2D experiments (Fig. 6 f and g). In order to test the contractile capacity of VSMCs in vitro , we treated co-cultured control and KD cells with carbachol, a cholinergic agonist that increases cytoplasmic calcium levels and stimulates the RhoA/ROCK (Rho-associated kinase) pathway 53 . Live-imaging analysis showed significantly impaired contractility of ELMO2 KD cells, which were not able to efficiently retract their cellular projections upon carbachol treatment (Fig. 6 h-i and Supplementary Fig. 11j). Further verifying this observation, 3D collagen gel contraction assays confirmed that siELMO2 -treatment drastically impaired the contractile capacity of HBVSMCs (Fig. 6 j-k). These results point out to an important role for ELMO2 in the regulation of HBVSMC actin dynamics in the context of cell adhesion, spreading and contraction. With the aim of uncovering the reasons behind the deficient regulation of actin dynamics after ELMO2 downregulation, the ratio of globular (G)-actin to filamentous (F)-actin was determined as a readout of actin polymerization. F-actin abundance was found to be significantly decreased in siELMO2 HBVSMCs relative to siControl cells (Fig. 6 l), which showed a higher F-actin to G-actin ratio (Fig. 6 m). These changes in the functional state of the actin cytoskeleton may be, at least in part, a consequence of reduced active Rac1 in ELMO2 KD cells, as shown by a G-LISA-based activation assay (Fig. 6 n). The reduced abundance of F-actin prompted us to test the impact of pharmacological actin filament stabilization. For this, siControl and siELMO2 HBVSMCs were analyzed after treatment with jasplakinolide (JAS), a cyclic peptide known to bind and stabilize filamentous actin in vitro 54 . Notably, JAS allowed efficient formation of filopodia-like structures and improved adhesion and spreading of siELMO2 cells to an extent that makes them undistinguishable from control cells (Fig. 6 o-p and Supplementary Fig. 11k). Likewise, siELMO2 cells recovered their contractile ability after JAS treatment in the collagen gel contraction assays (Fig. 6 q-r). Altogether, these data indicate that promoting actin polymerization and stabilization restores functional features of ELMO2 deficient HBVSMCs. Timing of global Elmo2 deletion is determinant for aneurysm formation Our in vitro data point out to contractility defects as the most likely cause for the vascular dilation phenotype in vivo . Yet, the most severe phenotypic alterations are only triggered upon Elmo2 deletion in neural crest derived progenitors ( Wnt1-Cre2 -mediated recombination) and do not reach the same extent when contractile VSMCs are targeted (through Tagln-Cre ). In this regard, the early onset of Wnt1-Cre2 -mediated recombination in the 3rd PAA (Supplementary Fig. 9) and the mild phenotype of Tagln-Cre -generated Elmo2 mutants raise the possibility that the gene product is required during an early stage of vessel wall assembly. In order to directly assess this hypothesis, we bred the Elmo2 conditional knockout model with mice expressing an inducible recombinase (CreERT2) under control of the ubiquitously expressed Rosa26 locus ( R26-CreERT2 55 ). Pregnant dams were treated with 4-hydroxytamoxifen (4-OHT) at defined stages of embryonic development in order to resemble the recombination timing achieved with Wnt1- Cre2 and Tagln-Cre lines. 4-OHT treatment at E8.5 and E9.5, which coincides with the timing of Wnt1-Cre2 activity, induced severe vascular defects including carotid artery aneurysm by E13.5 (Fig. 7 a-c). These defects are identical to those observed upon global or NCC-specific Elmo2 inactivation and correspond to a complete depletion of ELMO2 protein (Fig. 7 d). In contrast, 4-OHT administration from E10.5 to E11.5, mimicking the later recombination by Tagln-Cre , did not lead to aneurysm formation by E13.5 but induced a milder dilation of the carotid arteries (Fig. 7 e-g). Given that the short time period between 4-OHT treatment and analysis in this treatment regime results in incomplete depletion of ELMO2 protein (Fig. 7 h), we tested whether a longer waiting interval could increase the severity of the resulting phenotype. Interestingly, 4-OHT administration from E10.5 to E11.5 with embryo collection at E15.5 (Fig. 7 i-k) did not aggravate the arterial dilation despite efficient ELMO2 reduction (Fig. 7 l). These results indicate that ELMO2 function is essential in the 3rd PAA in the early embryo but no longer required for carotid artery development in the second half of gestation. The early emergence of these defects in global and NCC-specific mutants establishes that Elmo2 is directly involved in the regulation of vascular morphogenesis, which argues that vascular defects are probably not secondary to skeletal overgrowth in VMOS patients. Furthermore, it is striking that ELMO2 is specifically required in the vessels supplying the mandible and maxilla, which raises the possibility that the defects in these skeletal elements are a consequence of the vascular dilation. Discussion ELMO family proteins and, in particular, the C. elegans ortholog CED-12, were initially identified as regulators of phagocytosis and cell migration, which act in concert with Dock family guanine nucleotide exchange factors (GEFs) and the small GTPase Rac1 14,56–59 . Later studies have added integrin-linked kinase as an interaction partner of ELMO with relevance for processes such as endosome trafficking, actin remodeling, and the regulation of microtubule dynamics 17 , 23 , 60 . While all three mammalian ELMO family members share a similar domain architecture and are established interaction partners of DOCK family members capable of regulating Rac1 activity 61 – 63 , mice carrying a global deletion of Elmo1 or Elmo3 are viable, whereas the inactivation of Elmo2 leads to lethality after midgestation 19 . The latter, as we show here, is a consequence of the essential role of ELMO2 in the 3rd PAA and common carotid artery development. Despite of massive vessel dilation and endothelial defects that probably reflect overstretching of the Elmo2 mutant arterial wall, alterations in gene expression, detected by scRNA-seq analysis, are unexpectedly minor. This applies to mutant ECs but also to MSCs, the largest cell cluster in our scRNA-seq data, which encompasses different populations of mural cells. The transcriptomic results are consistent with our phenotypic characterization of mutants, which shows that ELMO2 is not necessary for NCC migration into the pharyngeal arches nor for VSMC specification, as indicated by persisting expression of key markers in mutant cells. Accordingly, it should be considered whether the reported reduction or absence of VSMCs inside VMOS lesions 3 might be a consequence of vessel dilation and not a primary defect caused by ELMO2 loss-of-function mutations. Our in vitro experiments also support that ELMO2 is not controlling VSMC identity or survival but rather regulates cell contractility and spreading through Rac1 and the modulation of actin dynamics. In this context, it is worth noting that NCC-specific deletion of ILK and Rac1, two critical interaction partners of ELMO2 and well-established regulators of cytoskeletal dynamics, lead to impaired PAA development 31 , 64 . Neural crest cell migration, however, is not compromised in these mutants, similar to what we report for Elmo2 deficient embryos. Interestingly, inactivation of Ilk in NCCs impairs VSMC differentiation inside branchial arches 64 , which might reflect ELMO2-independent roles of ILK in cell adhesion and specification. On the other hand, NCC-specific deletion of Rac1 results in aberrant patterning of pharyngeal arch arteries, defective outflow tract septation and aneurysms in the vessels branching from the common arterial trunk, without impairing VSMC specification 31 . These phenotypic similarities argue that ELMO2 might act in concert with Rac1 and ILK, consistent with previous reports 10 , 15 , 16 . Given that ELMO2 function is critically required for the contractile and vessel-stabilizing function of NCC-derived smooth muscle cells surrounding the 3rd PAA, the absence of defects in other vascular structures is highly surprising. Strikingly, even the neighboring Elmo2 −/− PAAs remain normal or are affected to a very low degree. These differences cannot be explained by the ontogeny of the vascular components since both endothelial and mural cells of the PAAs are derived from the secondary heart field (SHF) 65 and the neural crest 48 , 66 – 68 , respectively. Of particular interest, vessel dilation in VMOS patients directly affects the external carotid arteries, whereas bilateral ophthalmic internal carotid artery aneurysms have also been reported 5 , suggesting that potentially overlapping mechanisms may be responsible for the increased susceptibility of these vessels in humans and the 3rd PAA derivates in mice. Redundant activity of other ELMO family members in unaffected vessels might be one explanation and future studies involving compound mutants might be able to address this question. During embryonic development, the PAAs undergo large-scale asymmetric morphogenesis to form critical structures of the aorta-associated arterial network. The extensive transformation of the pharyngeal arch vessels occurs within a dynamic biomechanical environment that is fundamentally influenced by blood flow and hemodynamic forces. Quantitative analysis of blood flow, velocity and wall pressure in avian embryos has shown that the 3rd PAA receives the largest amount of flow during stages that are equivalent to E10.5-E11.5 of mouse development 69 . In addition, it needs to be considered that 3rd PAAs persist and significantly contribute to the formation of the common carotid arteries, whereas the other PAAs partially or completely regress, which implies that their contribution to the adult vasculature is comparably minor 38 . These may be important factors explaining the localized phenotypic alterations. With regard to VMOS, our work establishes that vascular malformations emerge before the development of the craniofacial skeleton and therefore independently from bone defects. This finding is important because osteoblast lineage cells are a source of vascular endothelial growth factor A (VEGF-A), a master regulator of blood vessel growth and patterning, which might trigger vessel dilation and increased permeability in settings of bone overgrowth 70 , 71 . Thus, while the analysis of VMOS patients is usually confined to subjects with fully established lesions, more attention should be given to the detection of vascular alterations during onset and early development of the disease. In addition, our findings raise the possibility that carotid artery defects, altered blood flow and increased vascular permeability may be potential underlying causes of craniofacial bone overgrowth. This might also explain the strong involvement of the mandible and maxilla, which are supplied by arteries, namely the maxillary and facial arteries, that branch off from the external carotid arteries. The embryonic lethality of global and NCC-specific Elmo2 mutants currently precludes a direct investigation of the interplay between bone growth and the side branches of the carotid artery system. Moreover, there are limitations for experimental approaches involving inducible Cre recombinase systems because, as our results with R26-CreERT2 mice show, timing is critical and only early activation of Cre activity will induce the full range of defects in the 3rd PAA and common carotid artery. Human VMOS patients appear unaffected at birth and exhibit their first symptoms during childhood which progressively worsen during development to adulthood 4 , 72 . Future work should try to address whether mutations in human ELMO2 could lead to partial lethality during embryonic development. It should be also considered whether the previously reported residual activity of mutated ELMO2 gene products 3 might facilitate fetal survival but cause milder vascular defects that can trigger bone overgrowth. The sum of our findings firmly establishes that ELMO2 is necessary for normal formation of the 3rd PAA and the common carotid arteries. Moreover, our results raise important new questions regarding the etiology of VMOS and the potential benefit of vessel-targeting therapies for the treatment of this devastating disease. Materials and Methods Animals (Mouse) Animals used in this study were housed in the animal house of the Max Planck Institute for Molecular Biomedicine, Münster. Animals were kept in a temperature-controlled room (22°C +/- 1.5°C) with a 14h light:10h dark cycle and received food and water ad libitum . All animal procedures were conducted in accordance with the guidelines of the Max Planck Institute and approved by the Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen (LANUV, Az. No. 81-02.04.2023.A383). Mouse lines were maintained in a C57BL/6J background. Elmo2 LacZ embryonic stem cells were obtained from the European Mouse Mutant Cell Repository (EMMCR- clone H08) and injected to blastocysts. Chimeras were selected based on coat color and genotype, and were further inbred to obtain Elmo2 LacZ/+ animals. The Elmo2 LacZ allele has an internal ribosome entry site (IRES) sequence followed by the LacZ reporter gene and a polyadenylation signal (pA) upstream of the Elmo2 exon 7. To generate Elmo2 global knockout mice, female Elmo2 LacZ heterozygotes were bred to PGK-Cre 44 males. Offspring was backcrossed to wildtype animals and Cre-negative progeny carrying one copy of the Elmo2 knockout allele ( Elmo2 +/− ) was selected to maintain the line. For global deletion experiments, embryos were obtained by crossing heterozygous Elmo2 knockout ( Elmo2 +/− ) males and females. The Elmo2 floxed allele was generated by Flp-mediated excision of FRT flanked sequences in Elmo2 LacZ resulting in loxP sites flanking exon 7. In order to drive conditional deletion of Elmo2 , Cre-positive males from tissue-specific or tamoxifen-inducible mouse lines, bearing one copy of the Elmo2 floxed allele, were interbred with homozygous Elmo2 floxed females. The following Cre lines were used for the conditional deletion of Elmo2 in different cell types: Tek-Cre 45 for targeting the endothelium, Tagln-Cre 47 to induce recombination in committed VSMCs, Wnt1-Cre2 49 for deletion in neural crest cells and TH-IRES-Cre 51 to drive recombination in neuronal subpopulations. For global tamoxifen-inducible recombination the R26-CreERT 55 model was used and the R26-mTmG reporter 46 was utilized to monitor the efficiency and specificity of the different Cre-drivers. Embryos at specific developmental stages were obtained from timed matings. The day in which the vaginal plug is detected is considered as embryonic day (E) 0.5. For sample collection, pregnant females were sacrificed by CO 2 , the whole uterus removed and transferred to ice-cold PBS. Each embryo was carefully dissected out from the amnion and kept in ice-cold PBS for macroscopic imaging (AxioObserver, Zeiss). For immunostaining approaches embryos were fixed in 2% PFA overnight at 4°C with gentle agitation after severing off the head. For biochemistry experiments embryos were flash frozen in liquid nitrogen. Tamoxifen administration 4-hydroxy tamoxifen (4OHT, Sigma, Cat#H7904) was dissolved in a 1:1 mixture of ethanol-Kolliphor EL and stored in 1mg aliquots at -20°C. On the day of administration, 1mg 4OHT was thawed at 37°C and diluted with 200µL of prewarmed PBS. 1mg of progesterone (Sigma, Cat#P3972) dissolved in 200µL of a 1:10 mixture of ethanol-peanut oil was mixed with the 4OHT and administered to pregnant females by oral gavage on the specified days. Immunofluorescence 100–200µm tissue sections were obtained using a vibratome. Permeabilization and blocking was achieved by a 48h-long incubation of the samples in 0.5% Triton-X-100, 1% BSA dissolved in PBS (blocking buffer) at 4°C. Blocking buffer was used for dilution of primary and secondary antibodies, which were incubated at 4°C for 48h with gentle agitation. Sections were mounted with Fluoromount-G (Southern Biotech, Cat#0100-01) between two 60mm coverslips separated by a 0.2mm spacer. Whole-mount staining of early-stage embryos (E9.5 to E11.5) was performed in the same manner. Image acquisition was carried out using a confocal microscope (Zeiss, LSM880). Details of the primary and secondary antibodies used in this study are provided below: Antibodies Source Identifier Dilution Chicken polyclonal anti-GFP 2BScientific Ltd Cat# GFP-1010 RRID:AB_2307313 1:500 Chicken polyclonal anti-GFP Abcam Cat# ab13970 RRID:AB_300798 1:500 Goat polyclonal anti-CD31 R&D Systems Cat# AF3628 RRID:AB_2161028 1:200 Goat polyclonal anti-Podocalyxin R&D Systems Cat# AF1556 RRID:AB_354858 1:200 Goat polyclonal anti-Sox17 R&D Systems Cat# AF1924 RRID:AB_355060 1:100 Mouse monoclonal anti- Tubulin Sigma Cat# T5168 RRID:AB_477579 1:1000 Mouse monoclonal anti-Alpha smooth muscle actin Sigma Cat# A2547 RRID:AB_476701 1:400 Mouse monoclonal anti-Alpha smooth muscle actin-Cy3 conjugated Sigma Cat# C6198 RRID:AB_476856 1:400 Mouse monoclonal anti-Alpha smooth muscle actin-FITC conjugated Sigma Cat# F3777 RRID:AB_476977 1:400 Mouse monoclonal anti-Beta actin Invitrogen Cat# AM4302 RRID:AB_2536382 1:1000 Mouse monoclonal anti-Rac1 Millipore Cat# 05-389, RRID:AB_309712 1:100 Rabbit monoclonal anti-Calponin1 Cell Signaling Cat# 17819, RRID:AB_2798789 1:100 Rabbit monoclonal anti-Elmo1 Cell Signaling Cat# 14457 RRID:AB_2798484 1:1000 Rabbit monoclonal anti-ERG Abcam Cat# ab110639 RRID:AB_10864794 1:200 Rabbit monoclonal anti-ILK Abcam Cat# ab76468, RRID:AB_2126930 1:1000 - WB 1:100 - ICC Rabbit polyclonal anti-FAK Cell Signaling Cat# 3285, RRID:AB_2269034 1:1000 Rabbit polyclonal anti- phospho-FAK Cell Signaling Cat# 3283, RRID:AB_2173659 1:1000 Rabbit polyclonal anti- Phospho-Myosin Light Chain 2 Cell Signaling Cat# 3671, RRID:AB_330248 1:100 Rabbit polyclonal anti-Elmo2 ThermoFisher Cat# PA5-28725 RRID:AB_2546201 1:1000 Rabbit polyclonal anti-GAPDH Cell Signaling Cat# #2118, RRID:AB_561053 1:5000 Rabbit polyclonal anti-Parvin Cell Signaling Cat# ; #4026, RRID:AB_2158936 1:1000 Rabbit polyclonal anti-Prox-1 ReliaTech Cat# 102-PA32AG RRID:AB_10013821 1:100 Rabbit polyclonal anti-SM22a Abcam Cat# ab14106 RRID:AB_443021 1:100 Rabbit polyclonal anti-Vinculin Proteintech Cat# 26520-1-AP RRID:AB_2868558 1:1000 Rat monoclonal anti-Endomucin Santa Cruz Cat# SC-65495 RRID:AB_2100037 1:100 Rat monoclonal anti-Nestin Santa Cruz Cat# sc-101541, RRID:AB_1126570 1:100 Rat monoclonal anti-VE Cadherin BD Biosciences Cat# 555289 RRID:AB_395707 1:100 Donkey anti-chicken Alexa flour 488 Jackson Laboratories Cat# 703-545-155 1:400 Donkey anti-goat-Alexa Fluor 488 Invitrogen Cat# A11055 1:400 Donkey anti-goat-Alexa Fluor 546 Invitrogen Cat# A11056 1:400 Donkey anti-goat-Alexa Fluor 647 Invitrogen Cat# A21447 1:400 Donkey anti-rabbit-Alexa Fluor 488 Invitrogen Cat# A21206 1:400 Donkey anti-rabbit-Alexa Fluor 647 Invitrogen Cat# A31573 1:400 Donkey anti-rat-Alexa Fluor 488 Invitrogen Cat# A21208 1:400 Donkey anti-rat-Alexa Fluor Cy3 Jackson Immuno Research Cat# 712-165-153 1:400 Goat anti rabbit IgG- HRP Cell Signaling Cat# 7074 1:5000 Sheep anti mouse IgG- HRP Amersham Cat# NA931 1:5000 Whole-mount immunostaining and clearing of embryos from E11.5 to E13.5 was performed following the iDISCO protocol 73 and images were obtained using a light sheet microscope (M2Lasers, AURORA). Proliferation assay For labeling of proliferating cells, a 10mg/mL EdU solution was intraperitoneally injected to pregnant females (50mg/Kg body weight) 2h before sample collection. Embryos were fixed in 2% PFA and processed as previously described for immunostaining of vibratome sections. EdU + cells were detected using the Click-iT EdU Alexa-647 imaging kit (Invitrogen, cat. #C10340) following the manufacturer’s instructions. X-gal staining Embryos were fixed with X-gal fixative (1.5% paraformaldehyde, 0.2% glutaraldehyde, 5mM EGTA (pH 8.0), 2mM MgCl 2 , and 1X PBS, dissolved in water) for 90min at room temperature (RT) and washed 3 times with washing buffer (1X PBS, 2mM MgCl 2 , 0.001% sodium deoxycholate, 0.02% Nonidet P40 dissolved in water) for 30min. Samples were stained in prewarmed X-gal solution (1mg/mL X-gal (dissolved in dimethylformamide), 5mM K 3 Fe(CN) 6 , 5mM K 4 Fe(CN) 6 -3H 2 O, dissolved in washing buffer) and incubated at 37°C with gentle agitation. After overnight incubation, X-gal staining developed as visible blue signal. Samples were washed with PBS for 3 times at RT and counter stained with Eosin. Single cell RNA sequencing The 3rd PAA together with the surrounding mesenchyme was microdissected from freshly harvested E12.5 mouse embryos and immediately transferred to collection buffer (25mM HEPES in DMEM) in a 48-well plate. Once all samples were collected, they were transferred to 1.5mL tubes containing 100µL of pre-warmed digestion buffer (50mg/mL Liberase TM and 0.1mg/mL DNAse-1 in collection buffer) and incubated at 37°C for 15min with occasional mixing and cell disaggregation by pipetting with 200µL sterile filter tips. Enzymatic activity was stopped by adding 1mL of inactivation buffer (10% fetal calf serum in DMEM) per sample followed by filtering the cell suspension through a 40µm strainer. To increase the cell yield, the filter was further washed with 400µL of collection buffer and the flow through was collected. Samples were next centrifuged at 300g and RT for 7min. After careful aspiration of the supernatant, 100µL of red blood cell-lysis buffer were used to resuspend the pellet. After a 1min-RT incubation, 1.5mL of FACS buffer (0.22µm-filtered 2% heat inactivated fetal calf serum in PBS) was added and the samples were centrifuged (300g for 7min at 4°C) to pellet down the cells. Next, the supernatant was carefully aspirated and 100µL of FACS buffer were used to gently resuspend the cells. Cell yield was assessed with an automated cell counter (Logos biosystems, LUNA-II™) and single cells were further captured with the BD Rhapsody Express Single-Cell Analysis System (BD Biosciences). Library preparation was performed following manufacturer’s instructions (BD Rhapsody™ system mRNA WTA library preparation protocol) and sequenced using Illumina NextSeq 500. Raw FASTQ reads were quality and adapter trimmed using fastp (version 0.23.2 length cutoff 20, quality cutoff 15). The UMI and complex barcode were extracted and demultiplexed using custom scripts. The GRCm39 reference genome was merged with the reporter vector sequence to create a custom reference. STAR version 2.7.10a 74 was used to generate a reference genome index, with reporter features and Gencode annotations vM29, subset to lncRNA and protein-coding genes. FASTQ reads were mapped against the reference genome index using STAR with the settings “--soloType CB_UMI_Simple --soloCellFilter None --outSAMtype BAM SortedByCoordinate --soloFeatures GeneFull_Ex50pAS --soloCBstart 1 --soloCBlen 27 --soloUMIstart 28 --soloUMIlen 8 --soloCBwhitelist rhapsody_whitelist.txt --runRNGseed 1 --soloMultiMappers EM --readFilesCommand zcat”. Raw counts were imported as AnnData 75 objects. Low complexity barcodes were removed with the knee plot method, and cells with a mitochondrial mRNA content were further filtered out, as well as cells with unusually high total and gene counts, using manually determined cutoffs for each sample. Doublets were scored with Scrublet 0.2.3 76 . Finally, each sample’s gene expression matrix was normalized using Scran 1.22.1 77 ) with Leiden clustering 78 input at resolution 0.5. G2M and S phase scores were assigned to each cell using gene lists from 79 and the Scanpy 1.9.1 80 sc.tl.score_genes_cell_cycle function. For embedding, clustering and annotation, the normalized expression matrix was subset to the 3,000 most highly variable genes (HVG, sc.pp.highly_variable_genes, flavor “seurat”). The top 100 principal components (PCs) were calculated, and batch-corrected using Harmony 0.0.5 81 . The PCs served as basis for k-nearest neighbor calculation (sc.pp.neighbors, n_neighbors = 30), which were used as input for UMAP 82 layout (sc.tl.umap, min_dist = 0.3). Cell populations were clustered using scanpy.tl.leiden, and a suitable resolution was chosen for main cell type annotation. Cluster marker genes were calculated using a pseudobulk approach, comparing aggregate counts with 2 pseudo-replicates for each cluster to all remaining cells (pyDeSEQ2 0.4.8). Finally, expression of select marker genes was plotted using Matplotlib 3.8.4 83 (“imshow”) and clusters were annotated accordingly. The AnnData object was subset to MSCs and ECs, respectively, and the process detailed above for clustering and annotation was repeated, using the top 2000 HVGs and 50 PCs. Clusters were annotated at Leiden resolutions 0.05 and 0.3, for ECs and MSCs, respectively. Differentially expressed genes were calculated using a pseudobulk approach, comparing aggregate counts with 2 pseudoreplicates for WT and KO each (pyDeSEQ2 0.4.8). DE results were filtered for sex-specific genes due to the presence of cells from mixed-sex samples, and 7 genes were masked accordingly (Gm47283, Xist, Tmsb4x, Ddx3y, Eif2s3y, Uty, Kdm5d). Enrichr ( https://maayanlab.cloud/Enrichr/ ) was used to calculate gene set enrichment via the gseapy 0.10.8 “enrich” API. Up-, (P 0.5), down- (P < 0.01, log2FC < -0.5), and de-regulated (up or down) gene sets were tested separately. Cell culture All cell culture experiments were in compliance with S1 regulations. Cultured cells were maintained in 37°C incubator with 5% CO 2 . Human brain vascular smooth muscle cells (HBVSMCs, ScienCell, cat. #1100) were obtained as passage 0 (P0) and stored in liquid nitrogen. Cells were thawed and subcultured according to the manufacturer’s instructions. Cells were expanded up to passage 2 (P2) and frozen at this stage (stock). Freezing media was the usual Smooth Muscle cell Complete Media (SMCM; ScienCell, cat. no. #1101) supplemented with 10% FCS and 10% DMSO. From each T75 plate, 4 stock vials were prepared and frozen. For all experiments, a P2 vial was thawed in a poly-lysine coated T75 plate and expanded with complete media. From P4 to the end of experiments, cells were cultured with smooth muscle cell differentiation media (SMCM supplemented with 2% FCS and 20ng/mL TGFβ-1). Passage 4 and 5 were used to increase the number of cells and to allow smooth muscle cell contractile differentiation. This was achieved by seeding 15000 cells/cm 2 in poly-lysine coated T75 dishes and culturing them until reaching confluency with smooth muscle cell differentiation media. Functional experiments were performed at P6-P7. Quantitative RT-PCR (qPCR) Whole mouse embryos were flash frozen in liquid nitrogen, 400µL of lysis buffer were added to each sample before mechanical dissociation (Ultra-Turrax, IKA T25) and centrifugation (300g for 10min). The supernatant was collected for RNA isolation. For in vitro samples, cells grown in multi-well 24 cell culture plates were washed twice with sterile PBS and 200µL of freshly prepared 1X RNA protection buffer per well were added. Cells were manually disrupted with a pipette tip, collected in 2mL round-bottom tubes and stored at -80°C until RNA isolation. RNA isolation was performed using the Monarch Total RNA Miniprep Kit (New England Biolabs, cat. #T2010S) according to the manufacturer’s instructions. After RNA isolation, concentration of RNA was measured (NanoDrop 8000, ThermoFisher). cDNA was synthesized from 1µg of RNA by reverse transcription (LunaScript RT SuperMix kit, New England Biolabs, cat. #T2010S) reverse transcription. For gene expression analysis in HBVSMCs, the following Taqman probes were used: Human GAPDH-VIC (ThermoFisher, 4326317E), Human ELMO2 -FAM (ThermoFisher, Hs00223006_m1), Human ELMO1 -FAM (ThermoFisher, Hs00404992_m1), Human ACTA2 -FAM (ThermoFisher, Hs00426835_g1), Human TAGLN - FAM (ThermoFisher, Hs01038777_g1), Human NES -FAM (ThermoFisher, Hs04187831_g1), Human PDGFRB -FAM (ThermoFisher, Hs01019589_m1). Two different pairs of custom-designed primers flanking exon 7 of Elmo2 were used for SYBR Green-based analysis of gene expression in control and mutant mouse embryos. Primer 1 forward: CTGATGGAAAGGACCCAGTCA; reverse: AACTCCGTGGCGAAAGTCAC. Primer 2 forward: GAGAGTGGGACCAAGCTCCT; reverse: CTCTCTAGGATGGCCAGGGA. Gapdh was used as housekeeping gene. Forward primer: CCAATGTGTCCGTCGTGGAT; reverse primer: TGCCTGCTTCACCACCTTCT). Protein isolation Whole embryos were flash frozen in liquid nitrogen and stored at -80°C. Immediately before protein isolation, 400µL of lysis buffer (20mM Tris-HCl; pH 8.0, 150mM NaCl, 0.5% TritonX-100, 0.1% SDS, 0.1% Na-DOC, 2 mM EDTA, 0.1mg/mL DNase supplemented with protease and phosphatase inhibitors) were added to frozen samples and subjected to mechanical disruption with Ultra-Turrax (IKA T25) followed by incubation at 4°C for 30min in a rotating wheel. Samples were centrifuged at full speed for 15min to obtain the lysate. The supernatant was collected in a 2mL tube and 10µL of lysate were used for protein quantitation using ADV02 precision red advanced protein assay reagent (Cytoskeleton, cat. # ADV02). Equal protein concentrations were obtained by diluting the samples with lysis buffer. 3x Laemmli buffer (0.25M Tris base, 8%SDS, 40% glycerol, 20% beta-mercaptoethanol and 4mg/mL of bromophenol blue) was added to samples (1/3 volume of sample), mixed well, and boiled at 95°C for 5min. After allowing the samples to cool down for 5min, they were stored at -20°C until Western blotting. For in vitro samples, cells were placed on ice and washed twice with ice-cold PBS followed by addition of lysis buffer and incubation at 4°C for 20min. For a multiwell-6 plate (mw6), 2mL of PBS per well were used for washing and 150µL of lysis buffer per well were used for lysis. Cells were scraped using a precooled cell scraper and lysates were collected in 1.5mL tubes. Lysates were sonicated with an amplitude of 80 with 10 pulses per sample followed by centrifugation at full speed for 10min at 4°C. Supernatant was collected in a 1.5mL tube. Quantitation and storage were performed as described above. Western blot For Western blotting, upper stacking gel (1.5M Tris HCL, 0.4% SDS dissolved in water, pH 8.8) and lower resolving gel (0.5M Tris HCl, 0.4% SDS dissolved in water, pH 6.8) were prepared. 20 kDa to 124 kDa proteins were separated in 10% resolving gels, whereas 125 kDa to 250 kDa proteins were separated in 8% resolving gels. Equal amounts of protein sample were briefly heated at 95°C, cooled down at RT for 2min, spined down for 15sec and loaded into the wells of the gel. During the electrophoresis run along the stacking gel, the voltage was set to 80V and to 120V once the samples reached the resolving gel. After obtaining the required size separation, samples were transferred to an activated PVDF membrane (activated in methanol for 15sec) over 1.5h at 25V. The membrane was blocked with 1% skim milk for 1h at RT and probed with primary and HRP-conjugated secondary antibodies. ECL prime reagent was used for the detection of bands. Gene knockdown Silencer select siELMO2 (ThermoFisher, cat. #Hs00223006_m1), which covers most of the ELMO2 splice variants, was used for knockdown experiments by forward transfection. Cells were seeded at a density of 6000 cells/cm 2 and cultured overnight. The following day media was exchanged before transfection. A mixture of DMEM-diluted siRNA (24nM) and lipofectamine RNAiMax (Invitrogen, cat. #13778150) was added drop-wise to the cells and the plate was placed in the incubator overnight after proper mixing. The following day, media was refreshed and cells were kept in culture until the collection time with media changes every other day. Immunofluorescence for cell culture Cells were washed twice with PBS (without Ca 2+ and Mg 2+ ) and fixed with 2% PFA (filtered through 0.22µm syringe) at RT for 15min. Permeabilization was achieved by incubating cells with 2% Triton X-100 for 15min at RT. At the end of incubation cells were washed once with PBS and blocked with 1% BSA in PBS for 30min. Primary and secondary antibody incubations were done at 4°C overnight. Gel contraction assay Control and ELMO2 knockdown cells were trypsinized 96h after siRNA treatment and counted. 5x10 05 cells from each sample were transferred to 1.5mL tubes placed on ice and the final volume was adjusted to 500µL with media. In a 2mL round-bottom tube placed on ice, 500µL of collagen-gel forming media (250µL of 8.69mg/mL Collagen I, 190µL of SMC- differentiation media, and 60µL of 0.1M NaOH) were prepared. Cells and collagen-gel forming media were mixed in a 1:1 ratio and 500µL of this mixture were immediately added to a well of a mw24 plate kept at RT. After 1h, solidified gels were dislodged from the walls of the wells and 500µL of media were added on top. Images of gels at t = 0 were acquired with a stereo microscope. After a 12h incubation at 37°C, gel contraction was observed and the corresponding images acquired (t = 12h). For the rescue experiment, 96h after knockdown, siControl and siELMO2 cells were treated with 100nM Jasplakinolide (Sigma, cat. #J4580) for 1h. Subsequently cells were washed twice with PBS and cultured in normal media. After 2h cells were trypsinized and collected for gel contraction assay as described above. Area of the gels at t = 0 and t = 12h was measured with Fiji and the percentage of gel contraction was calculated. Carbachol-induced contraction siControl and siELMO2 knockdown cells were labelled 48h after transfection with 1nM CellTracker-Green (Invitrogen, cat. #C7025) and CellTracker-Orange (Invitrogen, cat. #C34551), respectively. After a 24h-long incubation cells were trypsinized and counted. 6000 cells from each sample were mixed and added to a polylysine-coated Ibidi 8-well µ-slide (Ibidi, cat. #80806) and allowed to attach. 96h after transfection, media was refreshed and the µ-slide was transferred to a live-imaging microscope equipped with controlled temperature (37°C) and CO 2 levels (5%). Once the imaging positions and focal plane were defined, media supplemented with 1mM carbachol was added and the contraction response of the cells imaged during 15min. The area of individual cells before carbachol stimulation (t = 0) and 15min after treatment (t = 15min) was measured using Fiji to calculate the percentage of contraction. Spreading and attachment assay (2D) siControl and siELMO2 treated cells were labelled 48h post transfection with CellTracker reagents as described before. 96h after transfection, cells were trypsinized and counted. 6000 cells from each condition were mixed and added to an ibidi 8-well µ-slide coated with 2% collagen. Attached cells were fixed at different time points (10min, 30min, 1h, 2h, and 6h) after seeding. For live-imaging experiments, 6000 cells treated with siControl or siELMO2 siRNA were mixed and added to collagen-coated ibidi 8-well µ-slide, which was imaged overnight under usual cell culture conditions (37°C with 5% CO 2 ). For the rescue experiment, 96h post transfection, siControl and siELMO2 cells were treated with 100nM Jasplakinolide (Sigma, cat. #J4580) for 1h. Subsequently cells were washed twice with PBS and fresh media was provided. After 30min cells were trypsinized and collected for attachment assay. Cells were seeded into collagen-coated wells and, after 10min, attached cells were fixed. Morphology analysis of cells in fibrin gels (3D) siControl and siELMO2 treated cells were labelled 48h post transfection with CellTracker reagents as described before. Cells were trypsinized 96h after transfection and counted. 6000 cells from each condition were mixed and resuspended in 1mL of media. Fibrinogen (Sigma, cat. #F8630) was prepared at a final clottable concentration of 10mg/mL and sterilized by passing the solution through a 0.22µm syringe filter before further dilution to the final working concentration (2mg/mL in PBS). 968µL of fibrinogen were mixed with 32µL of aprotinin (Sigma, cat. #A1153, 4U/mL) and the whole volume (1mL) mixed with the cell suspension. 250µL of this mixture were added to each well of an ibidi 8-well µ-slide which is pre-loaded with 2µL of thrombin (Sigma, cat. #T4648, 0.1U/µL). Gel polymerizes after a 30min incubation at RT. 100µL of media were added on top of the gels and the plates were incubated overnight at 37°C and 5% CO 2 . Next day the gels were fixed with 2% PFA and imaged. Rac1 activation assay For the analysis of Rac1 activation, the luminescence-based G-LISA Rac-1 activation assay biochem kit (Cytoskeleton Inc., cat. #BK126) was used. Protein samples were collected from siControl and siELMO2 treated cells and snap frozen in liquid nitrogen until the day of experiment. 10µL of protein lysate were used for assessing protein concentration using the AVD02 reagent or the reagent included in the kit. Protein sample preparation and G-LISA was performed according to the manufacturer’s instructions. Analysis of G-actin to F-actin ratio G-actin to F-actin ratio analysis was performed as previously described 84 . Briefly, cells were lysed in an actin-stabilizing lysis buffer (50 mM PIPES, pH 6.9, 50 mM NaCl, 5 mM MgCl 2 , 5 mM EGTA, 0.2 mM dithiothreitol, 0.1% NP40, 0.1% Tween 20, 5% glycerol, 1 mM ATP and protease inhibitors). Lysates were subjected to ultracentrifugation (150,000g) at 4°C for 70min. The supernatant (G-actin fraction) was collected to pre-labelled tubes and stored at 4°C until protein quantitation. 200µL of actin depolymerizing buffer (50 mM PIPES, pH 6.9, 5 mM MgCl 2 , 10 mM CaCl 2 , 5 µM cytochalasin D) were added to the pellet (F-actin fraction) and this was solubilized by sonication. Equal amount of G-actin and F-actin fractions from control and knockdown cells were loaded to an SDS-PAGE gel, transferred to a PVDF membrane, and stained for β-actin to determine the amount of G-actin and F-actin. Quantification and statistical analysis Quantitative data is reported as mean ± SEM. Statistical analyses were performed with Graphpad Prism10 v.10.2.1 (Perkin Elmer). Comparisons between groups were performed after analysis of distribution using the D’Agostino & Pearson omnibus test or the Shapiro-Wilk normality test, depending on sample size. Two-tailed unpaired t-test was used for groups with normal distribution and equal variance, whereas Welch’s t-test was used for groups with normal distribution and unequal variance. When the groups do not have a normal distribution, the Mann Whitney test was used. Comparisons among multiple groups were done with one-way ANOVA with specific post-hoc test. In the figure legends, n stands for the number of biological replicates. Statistical significance was assessed with a 95% confidence interval. Declarations Data availability The single-cell RNA-seq data is deposited at GEO (record GSE278960, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE278960). Access for reviewers is provided with the token “edknwueilnojlun”. Code availability Custom code for scRNA-seq analysis, based on existing packages and own contributions, is available at https://keeper.mpdl.mpg.de/d/48ad2fd8170a459982c8/. Access for reviewers is provided with the token “HzMhkB46WBDlBeZG”. This study did not generate new unique reagents. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Prof. Dr. Ralf H. Adams ( [email protected] ). Acknowledgments We are grateful to the following Service Units of the Max Planck Institute for Molecular Biomedicine (MPI-BM, Münster, Germany): Animal Facility, Flow Cytometry, BioOptic Service, Sequencing and Bioinformatics. We thank Dr. Stefan Volkery and Dr. Nils Kirschnick (MPI-BM) for their technical support during light sheet microscopy and Anja Michelbach from the group of Prof. Dr. Sara Wickström (MPI-BM) for the G-actin:F-actin assay protocol. We also thank Vinayak Sivaramakrishnan (Tissue Morphogenesis Department, MPI-BM) for illustration. The study was supported by the Max Planck Society (R.H.A.), the European Research Council (AdG 101139772, PROTECT; R.H.A.), the DFG (CRC 1366, project no. 394046768; R.H.A.), and the Cells in Motion (CiM) graduate school (A.S.). Author Contributions A.S., R.D.H. and R.H.A. designed the study. A.S. performed the majority of the experiments. H.A. and R.D.H. performed some of the experiments. K.K performed the bioinformatic transcriptomic analysis and wrote the corresponding methods. R.D.H supervised A.S. during the study. A.S., R.D.H. and R.H.A. wrote the manuscript. Disclosures The authors declare no competing interests. References Coulie J, Boon L, Vikkula M (2022) Molecular pathways and possible therapies for head and neck vascular anomalies. J Oral Pathol Med 51:878–887. https://doi.org/10.1111/jop.13318 Seront E, Hermans C, Boon LM, Vikkula M (2024) Targeted treatments for vascular malformations: current state of the art. J Thromb Haemost. https://doi.org/10.1016/j.jtha.2024.07.013 Cetinkaya A et al (2016) Loss-of-Function Mutations in ELMO2 Cause Intraosseous Vascular Malformation by Impeding RAC1 Signaling. Am J Hum Genet 99:299–317. https://doi.org/10.1016/j.ajhg.2016.06.008 Vargel I et al (2002) Hereditary intraosseous vascular malformation of the craniofacial region: an apparently novel disorder. Am J Med Genet 109:22–35. https://doi.org/10.1002/ajmg.10282 Vargel I, Cil BE, Kiratli P, Akinci D, Erk Y (2004) Hereditary intraosseous vascular malformation of the craniofacial region: imaging findings. Br J Radiol 77:197–203. https://doi.org/10.1259/bjr/88438282 Werdich XQ, Jakobiec FA, Curtin HD, Fay A (2014) A clinical, radiologic, and immunopathologic study of five periorbital intraosseous cavernous vascular malformations. Am J Ophthalmol 158, 816–826 e811 https://doi.org/10.1016/j.ajo.2014.07.004 Lu H et al (2021) Vascular Smooth Muscle Cells in Aortic Aneurysm: From Genetics to Mechanisms. J Am Heart Assoc 10:e023601. https://doi.org/10.1161/JAHA.121.023601 Bertino F, Trofimova AV, Gilyard SN, Hawkins CM (2021) Vascular anomalies of the head and neck: diagnosis and treatment. Pediatr Radiol 51:1162–1184. https://doi.org/10.1007/s00247-021-04968-2 Persky MS, Yoo HJ, Berenstein A (2003) Management of vascular malformations of the mandible and maxilla. Laryngoscope 113:1885–1892. https://doi.org/10.1097/00005537-200311000-00005 Xu X, Jin T (2019) ELMO proteins transduce G protein-coupled receptor signal to control reorganization of actin cytoskeleton in chemotaxis of eukaryotic cells. Small GTPases 10:271–279. https://doi.org/10.1080/21541248.2017.1318816 East MP, Bowzard JB, Dacks JB, Kahn RA (2012) ELMO domains, evolutionary and functional characterization of a novel GTPase-activating protein (GAP) domain for Arf protein family GTPases. J Biol Chem 287:39538–39553. https://doi.org/10.1074/jbc.M112.417477 Patel M et al (2010) An evolutionarily conserved autoinhibitory molecular switch in ELMO proteins regulates Rac signaling. Curr Biol 20:2021–2027. https://doi.org/10.1016/j.cub.2010.10.028 Elliott MR et al (2010) Unexpected requirement for ELMO1 in clearance of apoptotic germ cells in vivo. Nature 467:333–337. https://doi.org/10.1038/nature09356 Gumienny TL et al (2001) CED-12/ELMO, a novel member of the CrkII/Dock180/Rac pathway, is required for phagocytosis and cell migration. Cell 107:27–41. https://doi.org/10.1016/s0092-8674(01)00520-7 Ho E, Dagnino L (2012) Emerging role of ILK and ELMO2 in the integration of adhesion and migration pathways. Cell Adh Migr 6:168–172. https://doi.org/10.4161/cam.20399 Ho E et al (2009) Integrin-linked kinase interactions with ELMO2 modulate cell polarity. Mol Biol Cell 20:3033–3043. https://doi.org/10.1091/mbc.e09-01-0050 Jackson BC, Ivanova IA, Dagnino L (2015) An ELMO2-RhoG-ILK network modulates microtubule dynamics. Mol Biol Cell 26:2712–2725. https://doi.org/10.1091/mbc.E14-10-1444 Abu-Thuraia A et al (2015) Axl phosphorylates Elmo scaffold proteins to promote Rac activation and cell invasion. Mol Cell Biol 35:76–87. https://doi.org/10.1128/MCB.00764-14 Tran V et al (2022) Biasing the conformation of ELMO2 reveals that myoblast fusion can be exploited to improve muscle regeneration. Nat Commun 13:7077. https://doi.org/10.1038/s41467-022-34806-4 Boland A, Cote JF, Barford D (2023) Structural biology of DOCK-family guanine nucleotide exchange factors. FEBS Lett 597:794–810. https://doi.org/10.1002/1873-3468.14523 Chen HJ et al (2006) The role of microtubule actin cross-linking factor 1 (MACF1) in the Wnt signaling pathway. Genes Dev 20:1933–1945. https://doi.org/10.1101/gad.1411206 Salem D, Fecek RJ (2023) Role of microtubule actin crosslinking factor 1 (MACF1) in bipolar disorder pathophysiology and potential in lithium therapeutic mechanism. Transl Psychiatry 13:221. https://doi.org/10.1038/s41398-023-02483-6 Ho E, Ivanova IA, Dagnino L (2016) Integrin-linked kinase and ELMO2 modulate recycling endosomes in keratinocytes. Biochim Biophys Acta 1863:2892–2904. https://doi.org/10.1016/j.bbamcr.2016.09.007 Margaron Y, Fradet N, Cote JF (2013) ELMO recruits actin cross-linking family 7 (ACF7) at the cell membrane for microtubule capture and stabilization of cellular protrusions. J Biol Chem 288:1184–1199. https://doi.org/10.1074/jbc.M112.431825 Hamoud N, Tran V, Croteau LP, Kania A, Cote J (2014) F. G-protein coupled receptor BAI3 promotes myoblast fusion in vertebrates. Proc Natl Acad Sci U S A 111:3745–3750. https://doi.org/10.1073/pnas.1313886111 Makihara S et al (2018) Polarized Dock Activity Drives Shh-Mediated Axon Guidance. Dev Cell 46, 410–425 e417 https://doi.org/10.1016/j.devcel.2018.07.007 Arnold TD, Zang K, Vallejo-Illarramendi A (2013) Deletion of integrin-linked kinase from neural crest cells in mice results in aortic aneurysms and embryonic lethality. Dis Model Mech 6:1205–1212. https://doi.org/10.1242/dmm.011866 Liang D et al (2014) Mesodermal expression of integrin alpha5beta1 regulates neural crest development and cardiovascular morphogenesis. Dev Biol 395:232–244. https://doi.org/10.1016/j.ydbio.2014.09.014 Morioka T et al (2014) An important role of endothelial hairy-related transcription factors in mouse vascular development. Genesis 52:897–906. https://doi.org/10.1002/dvg.22825 Shen D et al (2011) Aortic aneurysm generation in mice with targeted deletion of integrin-linked kinase in vascular smooth muscle cells. Circ Res 109:616–628. https://doi.org/10.1161/CIRCRESAHA.110.239343 Thomas PS, Kim J, Nunez S, Glogauer M, Kaartinen V (2010) Neural crest cell-specific deletion of Rac1 results in defective cell-matrix interactions and severe craniofacial and cardiovascular malformations. Dev Biol 340:613–625. https://doi.org/10.1016/j.ydbio.2010.02.021 Turlo KA et al (2012) An essential requirement for beta1 integrin in the assembly of extracellular matrix proteins within the vascular wall. Dev Biol 365:23–35. https://doi.org/10.1016/j.ydbio.2012.01.027 Van Damme A, Seront E, Dekeuleneer V, Boon LM, Vikkula M (2020) New and Emerging Targeted Therapies for Vascular Malformations. Am J Clin Dermatol 21:657–668. https://doi.org/10.1007/s40257-020-00528-w Nguyen HL, Boon LM, Vikkula M (2017) Vascular Anomalies Caused by Abnormal Signaling within Endothelial Cells: Targets for Novel Therapies. Semin Intervent Radiol 34:233–238. https://doi.org/10.1055/s-0037-1604296 Brahmbhatt AN, Skalski KA, Bhatt AA (2020) Vascular lesions of the head and neck: an update on classification and imaging review. Insights Imaging 11:19. https://doi.org/10.1186/s13244-019-0818-3 Hiruma T, Nakajima Y, Nakamura H (2002) Development of pharyngeal arch arteries in early mouse embryo. J Anat 201:15–29. https://doi.org/10.1046/j.1469-7580.2002.00071.x Etchevers HC, Vincent C, Le Douarin NM, Couly GF (2001) The cephalic neural crest provides pericytes and smooth muscle cells to all blood vessels of the face and forebrain. Development 128:1059–1068. https://doi.org/10.1242/dev.128.7.1059 Anderson RH, Bamforth SD (2022) Morphogenesis of the Mammalian Aortic Arch Arteries. Front Cell Dev Biol 10:892900. https://doi.org/10.3389/fcell.2022.892900 Arima Y et al (2012) Preotic neural crest cells contribute to coronary artery smooth muscle involving endothelin signalling. Nat Commun 3:1267. https://doi.org/10.1038/ncomms2258 Brozovich FV et al (2016) Mechanisms of Vascular Smooth Muscle Contraction and the Basis for Pharmacologic Treatment of Smooth Muscle Disorders. Pharmacol Rev 68:476–532. https://doi.org/10.1124/pr.115.010652 Huang YL et al (2008) Epidermal growth factor up-regulates the expression of nestin through the Ras-Raf-ERK signaling axis in rat vascular smooth muscle cells. Biochem Biophys Res Commun 377:361–366. https://doi.org/10.1016/j.bbrc.2008.09.143 Donadon M, Santoro MM (2021) The origin and mechanisms of smooth muscle cell development in vertebrates. Development 148. https://doi.org/10.1242/dev.197384 Sinha S, Iyer D, Granata A (2014) Embryonic origins of human vascular smooth muscle cells: implications for in vitro modeling and clinical application. Cell Mol Life Sci 71:2271–2288. https://doi.org/10.1007/s00018-013-1554-3 Lallemand Y, Luria V, Haffner-Krausz R, Lonai P (1998) Maternally expressed PGK-Cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res 7:105–112. https://doi.org/10.1023/a:1008868325009 Koni PA et al (2001) Conditional vascular cell adhesion molecule 1 deletion in mice: impaired lymphocyte migration to bone marrow. J Exp Med 193:741–754. https://doi.org/10.1084/jem.193.6.741 Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L (2007) A global double-fluorescent Cre reporter mouse. Genesis 45:593–605. https://doi.org/10.1002/dvg.20335 Holtwick R et al (2002) Smooth muscle-selective deletion of guanylyl cyclase-A prevents the acute but not chronic effects of ANP on blood pressure. Proc Natl Acad Sci U S A 99:7142–7147. https://doi.org/10.1073/pnas.102650499 Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM (2000) Fate of the mammalian cardiac neural crest. Development 127:1607–1616. https://doi.org/10.1242/dev.127.8.1607 Lewis AE, Vasudevan HN, O'Neill AK, Soriano P, Bush JO (2013) The widely used Wnt1-Cre transgene causes developmental phenotypes by ectopic activation of Wnt signaling. Dev Biol 379:229–234. https://doi.org/10.1016/j.ydbio.2013.04.026 Bruno RM et al (2012) Sympathetic regulation of vascular function in health and disease. Front Physiol 3:284. https://doi.org/10.3389/fphys.2012.00284 Lindeberg J et al (2004) Transgenic expression of Cre recombinase from the tyrosine hydroxylase locus. Genesis 40:67–73. https://doi.org/10.1002/gene.20065 Majesky MW (2007) Developmental basis of vascular smooth muscle diversity. Arterioscler Thromb Vasc Biol 27:1248–1258. https://doi.org/10.1161/ATVBAHA.107.141069 Martinsen A, Dessy C, Morel N (2014) Regulation of calcium channels in smooth muscle: new insights into the role of myosin light chain kinase. Channels (Austin) 8:402–413. https://doi.org/10.4161/19336950.2014.950537 Bubb MR, Senderowicz AMJ, Sausville EA, Duncan KLK, Korn ED (1994) Jasplakinolide, a Cytotoxic Natural Product, Induces Actin Polymerization and Competitively Inhibits the Binding of Phalloidin to F-Actin. J Biol Chem 269:14869–14871 Ventura A et al (2007) Restoration of p53 function leads to tumour regression in vivo. Nature 445:661–665. https://doi.org/10.1038/nature05541 Grimsley CM et al (2004) Dock180 and ELMO1 proteins cooperate to promote evolutionarily conserved Rac-dependent cell migration. J Biol Chem 279:6087–6097. https://doi.org/10.1074/jbc.M307087200 Reddien PW, Horvitz HR (2000) CED-2/CrkII and CED-10/Rac control phagocytosis and cell migration in Caenorhabditis elegans. Nat Cell Biol 2:131–136. https://doi.org/10.1038/35004000 Wu YC, Tsai MC, Cheng LC, Chou CJ, Weng NY (2001) C. elegans CED-12 acts in the conserved crkII/DOCK180/Rac pathway to control cell migration and cell corpse engulfment. Dev Cell 1:491–502. https://doi.org/10.1016/s1534-5807(01)00056-9 Zhou Z, Caron E, Hartwieg E, Hall A, Horvitz HR (2001) The C. elegans PH domain protein CED-12 regulates cytoskeletal reorganization via a Rho/Rac GTPase signaling pathway. Dev Cell 1:477–489. https://doi.org/10.1016/s1534-5807(01)00058-2 Toret CP, Collins C, Nelson WJ (2014) An Elmo-Dock complex locally controls Rho GTPases and actin remodeling during cadherin-mediated adhesion. J Cell Biol 207:577–587. https://doi.org/10.1083/jcb.201406135 Brugnera E et al (2002) Unconventional Rac-GEF activity is mediated through the Dock180-ELMO complex. Nat Cell Biol 4:574–582. https://doi.org/10.1038/ncb824 Chang L et al (2020) Structure of the DOCK2-ELMO1 complex provides insights into regulation of the auto-inhibited state. Nat Commun 11:3464. https://doi.org/10.1038/s41467-020-17271-9 Rival CM et al (2019) Phosphatidylserine on viable sperm and phagocytic machinery in oocytes regulate mammalian fertilization. Nat Commun 10:4456. https://doi.org/10.1038/s41467-019-12406-z Dai X et al (2013) Requirement for integrin-linked kinase in neural crest migration and differentiation and outflow tract morphogenesis. BMC Biol 11:107. https://doi.org/10.1186/1741-7007-11-107 Wang X et al (2017) Endothelium in the pharyngeal arches 3, 4 and 6 is derived from the second heart field. Dev Biol 421:108–117. https://doi.org/10.1016/j.ydbio.2016.12.010 Jiao J et al (2016) Differentiation defect in neural crest-derived smooth muscle cells in patients with aortopathy associated with bicuspid aortic valves. EBioMedicine 10:282–290. https://doi.org/10.1016/j.ebiom.2016.06.045 Li J et al (2005) Myocardin-related transcription factor B is required in cardiac neural crest for smooth muscle differentiation and cardiovascular development. Proc Natl Acad Sci U S A 102:8916–8921. https://doi.org/10.1073/pnas.0503741102 Xie WB et al (2013) Smad2 and myocardin-related transcription factor B cooperatively regulate vascular smooth muscle differentiation from neural crest cells. Circ Res 113:e76–86. https://doi.org/10.1161/CIRCRESAHA.113.301921 Lindsey SE, Butcher JT, Vignon-Clementel IE (2018) Cohort-based multiscale analysis of hemodynamic-driven growth and remodeling of the embryonic pharyngeal arch arteries. Development 145. https://doi.org/10.1242/dev.162578 Grosso A et al (2023) VEGF dose controls the coupling of angiogenesis and osteogenesis in engineered bone. NPJ Regen Med 8:15. https://doi.org/10.1038/s41536-023-00288-1 Liu Y, Olsen BR (2014) Distinct VEGF functions during bone development and homeostasis. Arch Immunol Ther Exp (Warsz) 62:363–368. https://doi.org/10.1007/s00005-014-0285-y Vargel I, Calis M, Canter HI, Cil BE (2019) Clinical and Molecular Study of ELMO-2-Related Massive Intraosseous Vascular Malformations: Lessons Learned From 25 Years of Follow-up. Ann Plast Surg 83:293–299. https://doi.org/10.1097/SAP.0000000000001786 Renier N et al (2014) iDISCO: a simple, rapid method to immunolabel large tissue samples for volume imaging. Cell 159:896–910. https://doi.org/10.1016/j.cell.2014.10.010 Dobin A et al (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29:15–21. https://doi.org/10.1093/bioinformatics/bts635 Virshup I, Rybakov S, Theis FJ, Angerer P, Wolf FA (2024) anndata: Access and store annotated data matrices. J Open Source Softw 9 Wolock SL, Lopez R, Klein AM, Scrublet (2019) Computational Identification of Cell Doublets in Single-Cell Transcriptomic Data. Cell Syst 8, 281–291 e289 https://doi.org/10.1016/j.cels.2018.11.005 Lun AT, Bach K, Marioni JC (2016) Pooling across cells to normalize single-cell RNA sequencing data with many zero counts. Genome Biol 17:75. https://doi.org/10.1186/s13059-016-0947-7 Traag VA, Waltman L, van Eck NJ (2019) From Louvain to Leiden: guaranteeing well-connected communities. Sci Rep 9:5233. https://doi.org/10.1038/s41598-019-41695-z Tirosh I et al (2016) Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 352:189–196. https://doi.org/10.1126/science.aad0501 Wolf FA, Angerer P, Theis FJ (2018) SCANPY: large-scale single-cell gene expression data analysis. Genome Biol 19:15. https://doi.org/10.1186/s13059-017-1382-0 Korsunsky I et al (2019) Fast, sensitive and accurate integration of single-cell data with Harmony. Nat Methods 16:1289–1296. https://doi.org/10.1038/s41592-019-0619-0 McInnes L, Healy J, Saul N, Großberger L (2018) UMAP: Uniform Manifold Approximation and Projection. J Open Source Softw 3 Hunter JD, Matplotlib (2007) A 2D Graphics Environment. Comput Sci Eng 9:90–95. https://doi.org/10.1109/MCSE.2007.55 Le HQ et al (2016) Mechanical regulation of transcription controls Polycomb-mediated gene silencing during lineage commitment. Nat Cell Biol 18:864–875. https://doi.org/10.1038/ncb3387 Additional Declarations There is NO Competing Interest. Supplementary Files SureshMovie1asiControl.avi Movie 1a SureshMovie1bsiELMO2.avi Movie 1b SureshSupplementaryFigures.pdf Cite Share Download PDF Status: Published Journal Publication published 02 Jun, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5362441","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":373080556,"identity":"a65194f7-dd8b-4e99-a0b1-c93a1a2cf126","order_by":0,"name":"Ralf Adams","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABPElEQVRIie3QsUuEUBzA8Z8ItjxpfUPUX3BgHNhwRH9Ii3JwLgpCi4ODt+jUtV50f8RB8GZF8JZH1/jAKG+5yUE4agrr2RV3pVRjkN9Bn8qH33sCtLX9yUSv4JdqEQIoX7+iJiIMx2siaRsS/o6grRHfkaMgGnrg9g46F/Tx2rbhVJmdx6vCuYfOVXALuVMje1TnJDEOCbNIOlbAmtKbAQ7pGah31BYmtEYw6EEGUiwQJpMUKS/WlJkqRL4GKjM1UfbrZHfBp5TxCZnTJSd8ykPeLaLyg5R1gvnGBD/WSWhKa8KQgiOvIkYoyl4D4VP0kdEnbKC+neWSmiqmiYb4WSCaJA0b60de8dQ7JvN4mdrPYI1mtFs4rravpsEiy936X67S3u/i9ksEGClhM9gkfn7EO9lPoq2tre1f9AqfVXsCsJmsRQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-3031-7677","institution":"Max Planck Institute for Molecular Biomedicine","correspondingAuthor":true,"prefix":"","firstName":"Ralf","middleName":"","lastName":"Adams","suffix":""},{"id":373080557,"identity":"7aac5900-3003-4dcc-8462-ff6879bdad9d","order_by":1,"name":"Athira Suresh","email":"","orcid":"https://orcid.org/0009-0002-3776-8374","institution":"Max Planck Institute for Molecular Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Athira","middleName":"","lastName":"Suresh","suffix":""},{"id":373080558,"identity":"c2f73812-ca14-4fc3-82f1-0d872acc9c12","order_by":2,"name":"Kai Kruse","email":"","orcid":"https://orcid.org/0000-0002-7951-7357","institution":"Max Planck Institute for Molecular Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Kruse","suffix":""},{"id":373080559,"identity":"6720c8ac-b762-42fa-b82f-5e8a088e92f2","order_by":3,"name":"Hendrik Arf","email":"","orcid":"https://orcid.org/0000-0002-2038-705X","institution":"Max Planck Institute for Molecular Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Hendrik","middleName":"","lastName":"Arf","suffix":""},{"id":373080560,"identity":"4054639d-7e07-4747-b225-7a67e1094032","order_by":4,"name":"Rodrigo Diéguez-Hurtado","email":"","orcid":"https://orcid.org/0000-0002-2055-599X","institution":"Max Planck Institute for Molecular Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Rodrigo","middleName":"","lastName":"Diéguez-Hurtado","suffix":""}],"badges":[],"createdAt":"2024-10-30 16:25:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5362441/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5362441/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-025-60105-9","type":"published","date":"2025-06-02T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68153515,"identity":"6c0cf3a8-50a9-4ac1-9c9f-2aea050f316e","added_by":"auto","created_at":"2024-11-04 07:36:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1434630,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGlobal deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElmo2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e leads to carotid artery aneurysm and embryonic lethality\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea)\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative images of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e embryos at different developmental stages showing hemorrhages in the cervical region and subcutaneous edema (white arrowheads) in knockout mice. Scale bars, 2 mm.\u003c/p\u003e\n\u003cp\u003eb)\u0026nbsp;\u0026nbsp;\u0026nbsp; Transverse section of an E12.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eembryo stained with X-gal (blue) and Eosin (red) showing expression of \u003cem\u003eElmo2\u003c/em\u003e in the laryngotracheal groove. Higher magnification (bottom panel) shows relevant vascular structures: dorsal aorta (DA), third pharyngeal arch artery (3\u003csup\u003erd\u003c/sup\u003e PAA), jugular vein (JV) and jugular lymph sac (JLS). Scale bars, 2 mm.\u003c/p\u003e\n\u003cp\u003ec)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of area and perimeter of the third pharyngeal arch artery (3\u003csup\u003erd\u003c/sup\u003e PAA) in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E12.5 embryos. Mean ± SEM, n=8. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ed)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of area and perimeter of the carotid artery (CA) in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E13.5 embryos. Mean ± SEM, n=4. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ee)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E12.5 embryos stained for nuclei (DAPI, blue), veins and capillaries (EMCN, green), vascular smooth muscle cells (αSMA, red), lymphatic endothelial cell nuclei (Prox1, magenta) and endothelial cells (CD31, grey). Higher magnification insets on the right panel are indicated as dashed boxes in the respective overview images and show relevant vascular structures: third pharyngeal arch artery (PAA), jugular vein (JV) and jugular lymph sac (JLS). Scale bars, 200 µm (overview) and 50 µm (higher magnification).\u003c/p\u003e\n\u003cp\u003ef)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative light sheet microscopy 3D images of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e embryos at different developmental stages stained for endothelial cells (CD31, red) and vascular smooth muscle cells (αSMA or SM22α, gray). Vascular structures of interest are indicated: pharyngeal arch arteries (PAA) or carotid arteries (CA). Scale bars, 300 µm in each dimension.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/d9e28593f014fc8743788348.png"},{"id":68153316,"identity":"169d57a6-1b33-4b32-9eeb-1d31df5a7add","added_by":"auto","created_at":"2024-11-04 07:28:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1036743,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoss of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElmo2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e causes defects in the third pharyngeal arch and carotid arteries\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of the 3\u003csup\u003erd\u003c/sup\u003e PAA stained for endothelial junctions (VE-Cadherin, red) and arterial endothelial cell nuclei (SOX17, green) showing endothelial cell enlargement and aberrant junctions in E12.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e embryos. Scale bars, 10 µm.\u003c/p\u003e\n\u003cp\u003eb)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of endothelial nuclear area in the 3\u003csup\u003erd\u003c/sup\u003e PAA of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eE12.5 embryos. Mean ± SEM, n=5. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ec)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of endothelial nuclear circularity in the 3\u003csup\u003erd\u003c/sup\u003e PAA of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eE12.5 embryos. Mean ± SEM, n=4. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ed)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of carotid artery (CA) stained with an endothelial cell-luminal marker (podocalyxin, gray) showing abluminal mislocalization (white arrowheads) in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E13.5 embryos. Scale bars, 25 µm.\u003c/p\u003e\n\u003cp\u003ee)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of the 3\u003csup\u003erd\u003c/sup\u003e PAA stained for endothelial cells (CD31, green) and vascular smooth muscle cells (SM22α, red) showing ectopic expression of SM22α in endothelial cells (white arrowheads) of E12.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e embryos. Scale bars, 25 µm.\u003c/p\u003e\n\u003cp\u003ef)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of relative number of endothelial cells (ERG\u003csup\u003e+\u003c/sup\u003e) with ectopic expression of vascular smooth muscle marker (αSMA\u003csup\u003e+\u003c/sup\u003e) normalized to vessel perimeter (PM) in the 3\u003csup\u003erd\u003c/sup\u003e PAA of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eE12.5 embryos. Mean ± SEM, n=6. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eg)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of carotid arteries (CA) stained for veins/capillaries (EMCN, green) and endothelial cells (CD31, red) showing persistent expression of vein markers in the CA (white arrowheads) of E13.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e embryos. Scale bars, 25 µm.\u003c/p\u003e\n\u003cp\u003eh)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of the relative area (%) within the carotid artery with persistent expression of the vein/capillaries marker endomucin (EMCN\u003csup\u003e+\u003c/sup\u003e) in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eE13.5 embryos. Mean ± SEM, n=4. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ei)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; High-resolution confocal images of the 3\u003csup\u003erd\u003c/sup\u003e PAA stained for endothelial cells (CD31, green) and vascular smooth muscle cells (αSMA, red) showing abnormal alignment of actin bundles with respect to the longest axis of endothelial cells in E12.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e embryos. Scale bars, 10 µm.\u003c/p\u003e\n\u003cp\u003ej)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Graphical representation of alignment analysis of vascular smooth muscle actin bundles with respect to endothelial cells’ longest axis in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eE12.5 embryos. In control the actin bundles (αSMA, blue) are preferentially perpendicular (±90\u003csup\u003eo\u003c/sup\u003e) to the endothelial cells (CD31, orange), which are mostly aligned in the same orientation (0\u003csup\u003eo\u003c/sup\u003e), this organization is lost in knockout embryos.\u003c/p\u003e\n\u003cp\u003ek)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of average relative angle between endothelial cells’ longest axis and smooth muscle actin bundles in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E12.5 embryos. Mean ± SEM, n=6. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003el)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of 3\u003csup\u003erd\u003c/sup\u003e PAA cross-sections stained for vascular smooth muscle cell (VSMC) markers (αSMA, red or SM22α, grey) and color-coded representation of their signal intensity in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E12.5 embryos. Panel on the right shows merged channels including staining for nuclei (DAPI, blue) and endothelial cells (CD31, green). Scale bars, 10 µm.\u003c/p\u003e\n\u003cp\u003em)\u0026nbsp;\u0026nbsp; Graphical representation of the intensity profile for αSMA and SM22α in cross sections of the third pharyngeal arch artery from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eE12.5 embryos. The hierarchical order observed in control samples (higher staining intensity in the smooth muscle cell layers proximal to the lumen) is lost in knockout embryos. The green dashed line indicates the position of the endothelial cell (EC). The black dashed line indicates the position of the first VSMC. Note ectopic expression of αSMA and SM22α\u003cem\u003e \u003c/em\u003ein \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eEC.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/7bb11ade2950d5bbdfc1fc51.png"},{"id":68154433,"identity":"a7b7a64a-67c2-418e-b2fd-51e2d566aa6c","added_by":"auto","created_at":"2024-11-04 07:44:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":510593,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003escRNA-seq analysis of the E12.5 cervical region\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea)\u0026nbsp;\u0026nbsp;\u0026nbsp; Uniform manifold approximation and projection (UMAP) plot of different cell types in the cervical region of E12.5 mouse embryos.\u003c/p\u003e\n\u003cp\u003eb)\u0026nbsp;\u0026nbsp;\u0026nbsp; Violin plot showing average expression level of \u003cem\u003eElmo2\u003c/em\u003e transcript in cells from the different samples analyzed.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ec)\u0026nbsp;\u0026nbsp;\u0026nbsp; Aggregate heatmaps showing the fraction of cells expressing \u003cem\u003eElmo2\u003c/em\u003e and the mean expression of \u003cem\u003eElmo2\u003c/em\u003e in the different cell types identified. Color represents scaled fraction or expression level.\u003c/p\u003e\n\u003cp\u003ed)\u0026nbsp;\u0026nbsp;\u0026nbsp; UMAP plot of the endothelial cell population in the cervical region of E12.5 mouse embryos. Colors represent different cell subclusters.\u003c/p\u003e\n\u003cp\u003ee)\u0026nbsp;\u0026nbsp;\u0026nbsp; UMAP plot of the endothelial cell population in the cervical region of E12.5 mouse embryos. Colors represent different samples (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e, blue; \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e, orange). The red arrowhead indicates a group of cells within the arterial population which is only present in the knockout embryos.\u003c/p\u003e\n\u003cp\u003ef)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Volcano plot of differentially expressed genes between endothelial cells from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E12.5 embryos. Blue dots, p-adjusted value \u0026lt;1\u003csup\u003e-10\u003c/sup\u003e; orange dots, p-adjusted value \u0026lt;1\u003csup\u003e-10\u003c/sup\u003e and log\u003csub\u003e2\u003c/sub\u003e fold change \u0026gt;2.0 or \u0026lt;-2.0.\u003c/p\u003e\n\u003cp\u003eg)\u0026nbsp;\u0026nbsp;\u0026nbsp; UMAP plots depicting the expression pattern of selected genes which appear upregulated in endothelial cells from \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e. Color represents scaled expression level.\u003c/p\u003e\n\u003cp\u003eh)\u0026nbsp;\u0026nbsp;\u0026nbsp; UMAP plot of the different cellular subclusters identified within the mesenchymal stromal cell (MSC) population.\u003c/p\u003e\n\u003cp\u003ei)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Color-coded UMAP plot of the MSC cluster comparing control (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/+\u003c/em\u003e\u003c/sup\u003e, blue) and knockout (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e, orange) cell populations.\u003c/p\u003e\n\u003cp\u003ej)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Volcano plot of differentially expressed genes between mesenchymal stromal cells from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e E12.5 embryos. Blue dots, p-adjusted value \u0026lt;1\u003csup\u003e-10\u003c/sup\u003e; orange dots, p-adjusted value \u0026lt;1\u003csup\u003e-10\u003c/sup\u003e and log\u003csub\u003e2\u003c/sub\u003e fold change \u0026gt;2.0 or \u0026lt;-2.0.\u003c/p\u003e\n\u003cp\u003ek)\u0026nbsp;\u0026nbsp;\u0026nbsp; Volcano plots showing differentially expressed genes in the indicated cell populations after comparison of control (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e) and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e E12.5 samples. Blue dots, p-adjusted value \u0026lt;1\u003csup\u003e-10\u003c/sup\u003e; orange dots, p-adjusted value \u0026lt;1\u003csup\u003e-10\u003c/sup\u003e and log\u003csub\u003e2\u003c/sub\u003e fold change \u0026gt;2.0 or \u0026lt;-2.0.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/554b0e7ee03ddbf92128da02.png"},{"id":68153516,"identity":"a495c5fd-418e-4233-8ba0-6d4a53157a34","added_by":"auto","created_at":"2024-11-04 07:36:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1033363,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDeletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElmo2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e using \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eTagln-Cre\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e leads to subtle carotid artery dilation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea)\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative images of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔSMC\u003c/sup\u003e\u003csup\u003e\u003cem\u003e \u003c/em\u003e\u003c/sup\u003eE13.5 embryos showing no macroscopic defects in vascular smooth muscle cell-specific knockout mice. Scale bars, 2 mm.\u003c/p\u003e\n\u003cp\u003eb)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal overview images of transverse sections from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔSMC\u003c/sup\u003e embryos stained for nuclei (DAPI, blue), blood vessels, (CD31, red) and vascular smooth muscle cells (SM22α, grey) showing mild dilation of the carotid artery (CA) in smooth muscle cell-specific knockout mice at E13.5 and E15.5. Scale bars, 200 µm.\u003c/p\u003e\n\u003cp\u003ec)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of area and perimeter of the carotid arteries in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔSMC\u003c/sup\u003e E13.5 and E15.5 embryos normalized to control (set as 1). Mean ± SEM, n=6. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ed)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of carotid arteries from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔSMC\u003c/sup\u003e E13.5 embryos stained for nuclei (DAPI, blue), endothelial cells (CD31, green), veins/capillaries (EMCN, magenta) and vascular smooth muscle cells (αSMA, red; SM22α, grey). Scale bars, 25 µm.\u003c/p\u003e\n\u003cp\u003ee)\u0026nbsp;\u0026nbsp;\u0026nbsp; Recombination analysis of \u003cem\u003eTagln-Cre; R26-mTmG\u003c/em\u003e E13.5 embryos. Representative confocal images of the carotid artery (CA, dashed box in overview image) stained for nuclei (DAPI, blue), recombined cells (GFP, green), endothelial cells (CD31, red) and vascular smooth muscle cells (SM22α, grey). Higher magnification images show GFP expression restricted to vascular smooth muscle and perivascular cells. Scale bars, 200 µm (overview) and 20 µm (higher magnification).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/ecee7dd87e6a8890098919e0.png"},{"id":68153315,"identity":"2f23faa7-4434-4705-9ee1-710d8efdd029","added_by":"auto","created_at":"2024-11-04 07:28:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1221053,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeural crest-specific deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElmo2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e phenocopies the global \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElmo2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e knockout\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea)\u0026nbsp;\u0026nbsp;\u0026nbsp; Recombination analysis of \u003cem\u003eWnt1-Cre2; R26-mTmG\u003c/em\u003e E13.5 embryos. Representative confocal images of the carotid artery (CA, dashed box in overview image) stained for nuclei (DAPI, blue), recombined cells (GFP, green), endothelial cells (CD31, red) and vascular smooth muscle cells (SM22α, grey). Higher magnification images of the CA show GFP expression restricted to vascular smooth muscle and perivascular cells. Scale bars, 200 µm (overview) or 25 µm (higher magnification).\u003c/p\u003e\n\u003cp\u003eb)\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative images of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e\u003csup\u003e\u003cem\u003e \u003c/em\u003e\u003c/sup\u003eE13.5 embryos showing hemorrhages in the cervical region and subcutaneous edema (white arrowheads) in the neural crest-specific knockout mice. Scale bars, 2 mm.\u003c/p\u003e\n\u003cp\u003ec)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal overview images of transverse sections from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e E13.5 embryos stained for nuclei (DAPI, blue), recombined cells (GFP, green), endothelial cells (CD31, red) and vascular smooth muscle cells (SM22α, grey) showing aneurysm formation in the carotid artery (CA) of neural crest-specific knockout mice. Scale bars, 500 µm.\u003c/p\u003e\n\u003cp\u003ed)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of area and perimeter of the carotid arteries in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e E13.5 embryos. Mean ± SEM, n=5. Mann-Whitney test.\u003c/p\u003e\n\u003cp\u003ee)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of the carotid artery from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e E13.5 embryos stained for vascular smooth muscle cells (SM22α, grey; αSMA, red) and color-coded representation of signal intensity (right panels). Scale bar, 10 µm.\u003c/p\u003e\n\u003cp\u003ef)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; High-resolution confocal images of carotid arteries stained for endothelial cells (CD31, green), vascular smooth muscle cells (αSMA, red) and nuclei (DAPI, blue) showing aberrant alignment of smooth muscle actin bundles with respect to the longest axis of endothelial cells in E13.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e embryos. Scale bars, 10 µm.\u003c/p\u003e\n\u003cp\u003eg)\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;Quantitation of average relative angle between endothelial cells’ longest axis and smooth muscle actin bundles in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e E13.5 embryos. Mean ± SEM, n=4. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eh)\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of carotid arteries (CA) stained for veins/capillaries (EMCN, green) and endothelial cells (CD31, red) showing persistent expression of vein markers in the CA (white arrowheads) of E13.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e embryos. Scale bars, 100 µm.\u003c/p\u003e\n\u003cp\u003ei)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Confocal images of carotid arteries stained for nuclei (DAPI, blue), endothelial cells (CD31, red), recombined cells (GFP, green) and vascular smooth muscle cells (SM22α, gray) showing abnormal expression of SM22α in endothelial cells (white arrowheads) and discontinuities in the endothelial lining (yellow arrowhead) of E13.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e embryos. Scale bars, 25 µm.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/11450eecc2636cb5aaba5e72.png"},{"id":68153318,"identity":"3784feaa-c612-45fc-8223-119b02c63efb","added_by":"auto","created_at":"2024-11-04 07:28:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":711165,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoss of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eELMO2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in human brain vascular smooth muscle cells impairs actin dynamics and contractility\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea) RT-qPCR analysis of \u003cem\u003eELMO2\u003c/em\u003e gene expression in \u003cem\u003esiControl\u003c/em\u003eand \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs at different timepoints after knockdown. Mean ± SEM, n=3. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eb) Western blot analysis for ELMO2 protein expression in \u003cem\u003esiControl\u003c/em\u003eand \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs at different timepoints after knockdown. Molecular weight marker (kDa) and collection time (in hours, h) are indicated.\u003c/p\u003e\n\u003cp\u003ec) Quantitation of the area covered by \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs attached to Collagen I-coated wells at different timepoints after seeding. Mean ± SEM, n=3. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ed) Representative images of cell attachment and spreading on Collagen I-coated wells at different timepoints. \u003cem\u003esiControl\u003c/em\u003e (green) and \u003cem\u003esiELMO2\u003c/em\u003e (red) cells are labeled with live-cell imaging reagents and stained for nuclei (DAPI, blue) and actin cytoskeleton (Phalloidin, grey). Scale bars, 50 µm.\u003c/p\u003e\n\u003cp\u003ee) High magnification images of \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs stained for nuclei (DAPI, blue) and actin cytoskeleton (Phalloidin, grey) showing membrane blebbing in ELMO2-deficient cells 10 min after seeding. Scale bars, 25 µm.\u003c/p\u003e\n\u003cp\u003ef) Representative images of HBVSMCs growing in a 3D fibrin gel. Cells are labeled with live-cell imaging reagents and treated with \u003cem\u003esiControl\u003c/em\u003e(green) and \u003cem\u003esiELMO2\u003c/em\u003e (red). Scale bars, 50 µm.\u003c/p\u003e\n\u003cp\u003eg) Average cell area of \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs growing in 3D fibrin gel. Mean ± SEM, n=3. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eh) Representative images of HBVSMCs before and after carbachol-induced contraction. Cells are labeled with live-cell imaging reagents and treated with \u003cem\u003esiControl\u003c/em\u003e (green) and \u003cem\u003esiELMO2\u003c/em\u003e (red). Scale bars, 25 µm.\u003c/p\u003e\n\u003cp\u003ei) Quantitation of contractility 15 min after carbachol stimulation in \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs. Mean ± SEM, n=3. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ej) Collagen gel contraction assay showing decreased contractility of \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs compared to \u003cem\u003esiControl\u003c/em\u003e cells 12 h after cell seeding. Scale bars, 5 mm.\u003c/p\u003e\n\u003cp\u003ek) Quantitation of contractility in collagen gel assay. Mean ± SEM, n=4. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003el) Western blot analysis of G-actin and F-actin relative abundance in \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs. ⍺-tubulin is included as housekeeping gene and control for density fractionation. Molecular weight marker (kDa) is indicated.\u003c/p\u003e\n\u003cp\u003em) Quantitation of G- to F-action ratio. Mean ± SEM, n=3. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003en) Differences in active RAC1 in \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs. Mean ± SEM, n=3. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eo) Representative images of \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs incubated with jasplakinolide (JAS) and stained for nuclei (DAPI, blue) and actin cytoskeleton (Phalloidin, grey) showing rescued capacity of filopodia formation during cell spreading (10 min after seeding) in ELMO2-deficient cells. Scale bars, 25 µm.\u003c/p\u003e\n\u003cp\u003ep) Quantitation of spreading area of control and knockdown cells after vehicle or jasplakinolide (JAS) treatment. Mean ± SEM, n=3. Ordinary one-way ANOVA.\u003c/p\u003e\n\u003cp\u003eq) Collagen gel contraction assay showing that treatment with jasplakinolide (JAS) is able to rescue the contractile ability in \u003cem\u003esiELMO2\u003c/em\u003e-treated HBVSMCs compared to \u003cem\u003esiControl\u003c/em\u003e. Scale bars, 5 mm.\u003c/p\u003e\n\u003cp\u003er) Quantitation of contractility for the collagen gel assay shown in (N). Mean ± SEM, n=3. Ordinary one-way ANOVA.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/e3865b20ef2fa536b5514225.png"},{"id":68153312,"identity":"722b3d0e-4e06-460f-9d4e-c1449e12cb3b","added_by":"auto","created_at":"2024-11-04 07:28:13","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1198786,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTiming of global \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElmo2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e deletion controls aneurysm formation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ea)\u0026nbsp;\u0026nbsp;\u0026nbsp; Scheme of 4-hydroxy-tamoxifen (4-OHT) injection (red arrowheads) and sample collection (analysis, black arrowhead) timepoints.\u003c/p\u003e\n\u003cp\u003eb)\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative overview confocal images from transverse sections of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E13.5 embryos stained for nuclei (DAPI, blue), recombined cells (GFP, green), endothelial cells, (CD31, red) and vascular smooth muscle cells (SM22α, grey) showing aneurysm formation and merging of carotid arteries (CA) in mutant embryos. Scale bars, 200 µm.\u003c/p\u003e\n\u003cp\u003ec)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of area and perimeter of carotid arteries from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E13.5 embryos after 4-OHT injection at E8.5-E9.5. Mean ± SEM, n=6. Mann-Whitney test.\u003c/p\u003e\n\u003cp\u003ed)\u0026nbsp;\u0026nbsp;\u0026nbsp; Western blot analysis of whole-tissue lysates from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E13.5 embryos after 4-OHT injection at E8.5-E9.5. Molecular weight marker (kDa) is indicated.\u003c/p\u003e\n\u003cp\u003ee)\u0026nbsp;\u0026nbsp;\u0026nbsp; Scheme of 4-hydroxy-tamoxifen (4-OHT) injection (red arrowheads) and sample collection (analysis, black arrowhead) timepoints.\u003c/p\u003e\n\u003cp\u003ef)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative overview confocal images from transverse sections of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E13.5 embryos stained for nuclei (DAPI, blue), recombined cells (GFP, green), endothelial cells, (CD31, red) and vascular smooth muscle cells (SM22α, grey) showing mild dilation of carotid arteries (CA) in mutant embryos. Scale bars, 200 µm.\u003c/p\u003e\n\u003cp\u003eg)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of area and perimeter of carotid arteries from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E13.5 embryos after 4-OHT injection at E10.5-E11.5. Mean ± SEM, n=5. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eh)\u0026nbsp;\u0026nbsp;\u0026nbsp; Western blot analysis of whole-tissue lysates from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E13.5 embryos after 4-OHT injection at E10.5-E11.5. Molecular weight marker (kDa) is indicated.\u003c/p\u003e\n\u003cp\u003ei)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Scheme of 4-hydroxy-tamoxifen (4-OHT) injection (red arrowheads) and sample collection (analysis, black arrowhead) timepoints.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ej)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative overview confocal images from transverse sections of control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E15.5 embryos stained for nuclei (DAPI, blue), recombined cells (GFP, green), endothelial cells, (CD31, red) and vascular smooth muscle cells (SM22α, grey) showing no obvious phenotypic changes in the carotid arteries (CA) of mutant embryos. Scale bars, 200 µm.\u003c/p\u003e\n\u003cp\u003ek)\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantitation of area and perimeter of carotid arteries from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E15.5 embryos after 4-OHT injection at E10.5-E11.5. Mean ± SEM, n=4. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003el)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Western blot analysis of whole-tissue lysates from control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eiko\u003c/em\u003e\u003c/sup\u003e E15.5 embryos after 4-OHT injection at E10.5-E11.5. Molecular weight marker (kDa) is indicated.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/7d9be8ef32c8e70c7ad6c1b8.png"},{"id":83812183,"identity":"9988a5ad-bf7a-4b9c-991b-32b7d1109991","added_by":"auto","created_at":"2025-06-03 07:09:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9140200,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/e83f9c0d-ec52-46f2-af17-87895957250b.pdf"},{"id":68153310,"identity":"105b8921-2482-4bd4-bfcc-51032514afa5","added_by":"auto","created_at":"2024-11-04 07:28:13","extension":"avi","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1870610,"visible":true,"origin":"","legend":"\u003cp\u003eMovie 1a\u003c/p\u003e","description":"","filename":"SureshMovie1asiControl.avi","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/7b7f0cd0548d3d6614953e5e.avi"},{"id":68153313,"identity":"548a3e51-4e6a-4a9a-9da4-b6a86edf2c2f","added_by":"auto","created_at":"2024-11-04 07:28:13","extension":"avi","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2265282,"visible":true,"origin":"","legend":"\u003cp\u003eMovie 1b\u003c/p\u003e","description":"","filename":"SureshMovie1bsiELMO2.avi","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/72c522ce774d9781211fe68c.avi"},{"id":69569449,"identity":"9a58d239-db43-4a6c-9ef4-337c25f36edf","added_by":"auto","created_at":"2024-11-21 18:35:01","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":66975458,"visible":true,"origin":"","legend":"","description":"","filename":"SureshSupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5362441/v1/bcea6a6ae79562e04a39399e.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"ELMO2 is an essential regulator of carotid artery development","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDefective regulation of blood vessel growth and patterning is the cause of numerous hereditary but also spontaneous human diseases, and recent insight into the underlying molecular defects has enabled targeted therapeutic approaches\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Intraosseous vascular malformation (VMOS) is a very rare and poorly understood autosomal-recessive disorder involving progressive overgrowth of the mandible, maxilla and other craniofacial bones in combination with vascular alterations inside the affected skeletal elements\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e and in the carotid arteries or vessels that branch off from them, which are found enlarged or affected by aneurysms\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The causal relationship between vascular and skeletal malformations in VMOS remains unknown, but it has been suggested that dilated blood vessels inside lesions are insufficiently covered by vascular smooth muscle cells (VSMCs)\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Similar VSMC defects are associated with dilation and aneurysm formation in the dorsal aorta\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe identification of loss-of-function mutations in the human gene \u003cem\u003eELMO2\u003c/em\u003e (Engulfment and cell motility 2) as a cause of VMOS was an important milestone for understanding the disease\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. ELMO2 is a cytoplasmic protein known to regulate cytoskeletal dynamics by Rho-Rac regulation\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. It belongs to the ELMO domain containing (ELMOD) family\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e and is conserved across different species\u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Mammalian ELMO proteins (ELMO1, 2, and 3) share multiple homology domains such as Ras binding domain (RBD), Armadillo repeats, ELMO domain, pleckstrin homology (PH) domain, and C\u0026rsquo; terminal proline-rich repeats\u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, which allow binding to Rho\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan additionalcitationids=\"CR11 CR12 CR13\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, integrin-linked kinase (ILK) \u003csup\u003e\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, dedicator of cytokinesis (DOCK)\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan additionalcitationids=\"CR11 CR12 CR13\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, and spectraplakin\u003csup\u003e\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. These interactions link ELMO proteins to Rac1 signaling and the control of cytoskeletal dynamics during cell adhesion, junction formation, polarity and cell migration\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan additionalcitationids=\"CR15 CR16 CR17\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eWhile all ELMO proteins show high sequence homology and partially redundant functions\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e, global deletion of \u003cem\u003eElmo1\u003c/em\u003e in mice only affects Sertoli cells in the male reproductive system\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, whereas \u003cem\u003eElmo2\u003c/em\u003e knockout mice die during embryonic gestation due to a yet uncharacterized phenotype\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The roles of \u003cem\u003eElmo2\u003c/em\u003e in the vascular and skeletal system remain unexplored although it is known that signaling defects in functionally-associated proteins such as integrins, Ilk and Rac1 are responsible for cardiovascular and craniofacial abnormalities\u003csup\u003e\u003cspan additionalcitationids=\"CR28 CR29 CR30 CR31\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eVascular malformations are non-neoplastic congenital anomalies affecting blood vessels. They result from errors in the development program of the vascular system due to somatic or germline prenatal mutations\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Most sporadic vascular malformations are caused by somatic mutations that activate the RAS/MAPK/ERK and/or the PI3K/AKT/mTOR signaling pathways. Familial malformations are caused by loss-of-function mutations in genes related to TGFβ signaling, RASA1, glomulin or CCMs (cerebral cavernous malformations)\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Interestingly, vascular anomalies frequently occur in the head and neck\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e, and usually involve defects in the control of endothelial or mural cells, which together form the vascular wall.\u003c/p\u003e \u003cp\u003eThe vasculature of the head and neck region derives mostly from the pharyngeal arch arteries (PAAs), which are a series of six paired arteries that sequentially emerge from embryonic day (E) 9.5 to E10.0 in mice and connect the aortic sac to the paired dorsal aortae\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. During development, the PAAs undergo complex remodeling to form the major arteries supplying the head, neck and upper thorax. The endothelial cells (ECs) of the PAAs are derived from \u003cem\u003eMesp1\u003c/em\u003e-lineage positive mesoderm\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, while the surrounding mural cells, namely pericytes and vascular smooth muscle cells (VSMCs), arise from the neural crest\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In addition, neural crest cells (NCCs) also give rise to most connective tissues in the head and neck region, including bone and cartilage.\u003c/p\u003e \u003cp\u003eHere, we have used mouse genetics, advanced confocal and light-sheet microscopy, single cell RNA-sequencing (scRNA-seq), \u003cem\u003ein vitro\u003c/em\u003e cell culture and biochemistry approaches to systematically investigate the functional role of Elmo2 during mouse embryonic development. We show that the gene product is indispensable for vascular morphogenesis of the 3rd PAA through the control of neural crest-derived VSMC contractile properties and highlight that vascular defects may be a primary cause of the lesions observed in VMOS patients.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eLoss of\u003c/b\u003e \u003cb\u003eElmo2\u003c/b\u003e \u003cb\u003eleads to carotid artery aneurysm and embryonic lethality\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn order to understand the \u003cem\u003ein vivo\u003c/em\u003e function of \u003cem\u003eElmo2\u003c/em\u003e, global knockout mice (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e), obtained after ubiquitous Cre-mediated recombination of a \u0026ldquo;knockout-first\u0026rdquo; allele (Supplementary Fig.\u0026nbsp;1a and b), were compared to control littermates (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e) at different embryonic stages. Efficient deletion of \u003cem\u003eElmo2\u003c/em\u003e-encoded transcripts and protein were confirmed by RT-qPCR and Western blot, respectively (Supplementary Fig.\u0026nbsp;1c and d). The first macroscopic evidence of deleterious phenotypic alterations (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea) was detected in E12.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e embryos, which show small vascular lesions in the head and neck region. These lesions worsened during the following days of development, giving rise to subcutaneous edema and severe hemorrhages in the cervical region by E13.5 and E14.5. No surviving embryos were obtained beyond E15/E15.5.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTaking advantage of β-galactosidase expression from the targeted allele, heterozygous (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e) embryos, which develop normally, were assessed by X-Gal staining at E12.5. This approach revealed expression of \u003cem\u003eElmo2\u003c/em\u003e in different structures including the dorsal aorta, laryngotracheal groove, vagus nerve, sympathetic chain ganglia, trachea, esophagus and pharyngeal arch arteries (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb and Supplementary Fig.\u0026nbsp;1e). In line with this expression pattern, the histological analysis of transverse sections from the cervical region of mutant embryos revealed a severe dilation of the third pharyngeal arch artery (3rd PAA) at E12.5 and of the carotid arteries at E13.5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec-e and Supplementary Fig.\u0026nbsp;1f).\u003c/p\u003e \u003cp\u003eThe complex and dynamic morphogenetic program that shapes hierarchical blood vessel organization in the trunk and cervical area (Supplementary Fig.\u0026nbsp;1g) prompted us to analyze the three-dimensional organization of the vascular tree in control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e embryos from E11.5 to E13.5 using whole-mount staining and light-sheet microscopy. This analysis showed that the first vascular defect in global knockout embryos, namely the dilation of the 3rd PAA, arises at E12.5. This vessel further remodels giving rise to the common carotid arteries\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e, which are severely dilated resulting in fusiform aneurysm formation in E13.5 mutants (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg). It is worth noting that these defects in vascular shape and diameter are rather specific to the 3rd PAA and only mildly affect other major vessels, including neighboring pharyngeal arch arteries (Supplementary Fig.\u0026nbsp;2a-e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eLoss of\u003c/b\u003e \u003cb\u003eElmo2\u003c/b\u003e \u003cb\u003eleads to alterations in endothelial and vascular smooth muscle cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo characterize the vascular defects in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e embryos in greater detail, the 3rd PAA and carotid arteries were analyzed by immunofluorescence staining and high-resolution confocal microscopy. This revealed discontinuities in the endothelial lining (Supplementary Fig.\u0026nbsp;3a) and significant changes in the size and morphology of ECs and their nuclei (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c) in mutant embryos relative to littermate controls. In addition, defects in the polarized expression of the luminal marker Podocalyxin were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed) as well as ectopic expression of the VSMC markers α-smooth muscle actin (αSMA) and SM22α in ECs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee and f). Despite normal and domain-specific expression of markers for lymphatic vessels (Prox1) and arteries (SOX17) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), clusters of ECs in the dilated carotid arteries of \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e embryos express detectable levels of Endomucin, a marker that is normally absent from the arterial endothelium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg and h).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eVSMC contractility is an important regulator of vascular tone in the adult organism but also in the embryo\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. We therefore analyzed VSMCs around the 3rd PAA and carotid arteries by immunostaining against proteins associated with the contractile phenotype. This revealed that the expression levels of SM22α, αSMA and Calponin1 are comparable between control and \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e embryos (Supplementary Fig.\u0026nbsp;3b-g), arguing against major defects in VSMC abundance and differentiation. Likewise, no overt differences were detected for Nestin (Supplementary Fig.\u0026nbsp;3f), whose expression has been associated to the synthetic phenotype of VSMCs\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. The staining intensity and distribution pattern of phospho-myosin light chain 2, a functional marker of VSMC contractility, also does not show obvious changes in the wall of mutant carotid arteries relative to littermate controls (Supplementary Fig.\u0026nbsp;3c).\u003c/p\u003e \u003cp\u003eAlthough the expression of VSMC identity and differentiation markers appears unaffected, super-resolution confocal microscopy revealed that the normal alignment of αSMA\u003csup\u003e+\u003c/sup\u003e bundles with respect to the longest axis of the underlying endothelium is severely compromised in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e embryos (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ei-k). Whereas αSMA\u003csup\u003e+\u003c/sup\u003e fibers are oriented perpendicular to elongated ECs and thereby to the direction of blood flow in the control E12.5 3rd PAA, both EC elongation and the orientation of αSMA\u003csup\u003e+\u003c/sup\u003e bundles are disorganized after loss of \u003cem\u003eElmo2\u003c/em\u003e. Furthermore, αSMA and SM22α immunosignals, which are strongly concentrated near the subendothelial basement membrane in VSMCs of control carotid arteries, have lost their normal polarization and multiple peaks of high staining intensity can be detected throughout the \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e vessel wall (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003el and m). The same analysis also confirmed the abnormal expression of VSMC markers in the \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e carotid artery endothelium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003em).\u003c/p\u003e \u003cp\u003eNext, we assessed whether significant changes in EC or VSMC proliferation are associated with the vessel enlargement in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants. To this end, we labelled mitotic cells \u003cem\u003ein vivo\u003c/em\u003e by injection of 4-Ethynyl-2\u0026rsquo;-deoxyuridine (EdU) into pregnant females. This approach revealed strong increases in the absolute number of EdU\u003csup\u003e+\u003c/sup\u003e ECs and VSMCs in the 3rd PAA of E12.5 mutant embryos. However, these increases are no longer statistically significant after normalization to vessel perimeter and may therefore reflect the dilation of \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e carotid arteries (Supplementary Fig.\u0026nbsp;4a-d). Altogether, these results establish that ELMO2 is required for the normal development of the 3rd PAA and common carotid artery during embryogenesis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTranscriptomic analysis of\u003c/b\u003e \u003cb\u003eElmo2\u003c/b\u003e \u003cb\u003emutants at single cell resolution\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo gain insight into the molecular changes resulting from the inactivation of \u003cem\u003eElmo2\u003c/em\u003e, we performed single cell RNA-sequencing (scRNA-seq) of the 3rd PAA and surrounding mesenchyme dissected from control (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e), heterozygous (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e) and mutant homozygous (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) E12.5 embryos. Integrated analysis of the transcriptome from these samples allowed identification of seven major cell populations with distinct expression signatures and enrichment of specific markers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and Supplementary Fig.\u0026nbsp;5a). The most abundant cell type is the mesenchymal stromal cell (MSC) population, which represents more than 70% of all cells. MSCs are followed by endothelial, immune and muscle cells, which are found in similar proportions and together represent\u0026thinsp;~\u0026thinsp;20% of total cells. The remaining cell types are mostly erythrocytes, neurons and epithelial cells (Supplementary Fig.\u0026nbsp;5b). As expected, \u003cem\u003eElmo2\u003c/em\u003e transcript expression is proportionally reduced in heterozygotes and is below the detection threshold in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Among the members of the Elmo family, \u003cem\u003eElmo2\u003c/em\u003e has the highest expression, followed by \u003cem\u003eElmo1\u003c/em\u003e and \u003cem\u003eElmo3\u003c/em\u003e (Supplementary Fig.\u0026nbsp;5c), which do not show significant compensatory upregulation upon deletion of \u003cem\u003eElmo2\u003c/em\u003e (Supplementary Fig.\u0026nbsp;5d). Furthermore, expression of \u003cem\u003eElmo2\u003c/em\u003e is rather homogeneous across the different cell clusters with the highest level found in neurons and the lowest in the erythroid lineage (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eConsidering that the phenotypic changes in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants affect mostly the vascular compartment, the control and homozygous mutant EC population in our scRNA-seq data was subclustered for deeper analysis. Three main subsets with distinct markers were identified in a two-dimensional (2D) Uniform Manifold Approximation and Projection (UMAP) representation, namely venous, arterial and lymphatic ECs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed and Supplementary Fig.\u0026nbsp;5e). Interestingly, color-labelling of cells corresponding to the control (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e) or knockout (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) samples within the subclustered EC dataset, highlighted an area characterized by overrepresentation of mutant cells in a specific 2D spatial location within the arterial subcluster (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). In addition, differential gene expression analysis (DEG) allowed the identification of de-regulated genes in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells relative to control. Interestingly, when a stringent selection criterion for highly statistically significant values is used (p-adjusted\u0026thinsp;\u0026lt;\u0026thinsp;1\u003csup\u003e\u0026minus;\u0026thinsp;10\u003c/sup\u003e), only a single gene (\u003cem\u003eElmo2\u003c/em\u003e) is downregulated. In contrast, 38 genes are upregulated, 9 of them with a log2 fold change above 2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef). Notably, all these upregulated genes are either exclusively or primordially expressed in the mutant cell hotspot within the arterial subcluster (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). Among the upregulated genes, \u003cem\u003eActa2\u003c/em\u003e and \u003cem\u003eTagln\u003c/em\u003e were previously identified during our histology analysis because of their ectopic expression in arterial ECs of mutant embryos (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee and Supplementary Fig.\u0026nbsp;3b).\u003c/p\u003e \u003cp\u003eNext, we followed a similar approach for the identification of subpopulations within the mesenchymal stromal cells (MSCs), which are a source of VSMCs during development\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Both the UMAP representation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh) and marker analysis (Supplementary Fig.\u0026nbsp;5f) indicate that the differences between the 8 identified MSC subtypes are less defined than those found during the EC subclustering, potentially reflecting ongoing differentiation and incomplete terminal phenotypic specification. Likewise, cellular distribution of control and \u003cem\u003eElmo2\u003c/em\u003e mutant cells within the MSC UMAP plot is rather homogeneous (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei) and only a few genes were found to be de-regulated (log2 fold change\u0026thinsp;\u0026gt;\u0026thinsp;2 or \u0026lt;-2) when a cut-off for highly statistically significant differences (p-adjusted\u0026thinsp;\u0026lt;\u0026thinsp;1\u003csup\u003e\u0026minus;\u0026thinsp;10\u003c/sup\u003e) is applied (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ej). Using this criteria, 4 downregulated (\u003cem\u003eElmo2\u003c/em\u003e, \u003cem\u003eHoxb6\u003c/em\u003e, \u003cem\u003eCar2\u003c/em\u003e and \u003cem\u003eCapn11\u003c/em\u003e) and 3 upregulated genes (\u003cem\u003eCnmd\u003c/em\u003e, \u003cem\u003eMatn1\u003c/em\u003e and \u003cem\u003eAcan\u003c/em\u003e) were identified, without clear functional relationships among them. A similar profile of very limited or non-significant changes in gene expression was found for the other cell populations in our scRNA-seq data (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ek).\u003c/p\u003e \u003cp\u003eWith the aim of gaining a broader understanding of biological processes potentially affected by gene expression changes in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e ECs and MSCs, a gene set enrichment analysis including all de-regulated genes with a (less stringent) p-adjusted cut-off value of 0.01 and a log2 fold change\u0026thinsp;\u0026gt;\u0026thinsp;0.5 or \u0026lt; -0.5 was performed. From the top gene ontology terms found (Supplementary Fig.\u0026nbsp;5g) there is no explicit relation to blood vessel development either in the ECs or MSCs population, yet different aspects related to extracellular matrix organization are highlighted for both cell types. Thus, unexpectedly, the analysis of the sc-RNAseq data reveals rather limited changes in gene expression and provides no clear explanation for the dramatic changes in the mutant common carotid arteries.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInactivation of\u003c/b\u003e \u003cb\u003eElmo2\u003c/b\u003e \u003cb\u003ein endothelial and smooth muscle cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFor cell type-specific loss-of-function experiments, a conditional (loxP-flanked) allele of \u003cem\u003eElmo2\u003c/em\u003e (Supplementary Fig.\u0026nbsp;1a) was established and validated by breeding it to homozygosity in a \u003cem\u003ePGK-Cre\u003c/em\u003e\u003csup\u003e+/T\u003c/sup\u003e background\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. As expected, ubiquitous expression of constitutively acting Cre led to widespread \u003cem\u003eElmo2\u003c/em\u003e inactivation and phenocopied the vascular defects seen \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e embryos generated with the \u0026ldquo;knockout-first\u0026rdquo; approach (Supplementary Fig.\u0026nbsp;6a-c). Next, we generated EC-specific mutants by interbreeding of mice carrying the floxed \u003cem\u003eElmo2\u003c/em\u003e allele and \u003cem\u003eTek-Cre\u003c/em\u003e transgenic animals\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Analysis with the \u003cem\u003eR26-mTmG\u003c/em\u003e Cre-reporter\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e confirmed successful \u003cem\u003eTek-Cre\u003c/em\u003e-mediated recombination in the embryonic endothelium (Supplementary Fig.\u0026nbsp;7a). However, EC-specific \u003cem\u003eElmo2\u003c/em\u003e mutants (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔEC\u003c/sup\u003e) showed no observable defects in vascular development (Supplementary Fig.\u0026nbsp;7b). In particular, the size and morphology of \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔEC\u003c/sup\u003e carotid arteries (Supplementary Fig.\u0026nbsp;7b-c) or the expression of known markers of EC or VSMC (Supplementary Fig.\u0026nbsp;7d) are indistinguishable from control littermates. These results argue that the vascular malformations observed in global \u003cem\u003eElmo2\u003c/em\u003e knockout embryos are not caused by cell-autonomous defects in the endothelium.\u003c/p\u003e \u003cp\u003eNext, we conducted genetic experiments to address whether \u003cem\u003eElmo2\u003c/em\u003e is required in VSMCs. To this end, a transgene expressing constitutive Cre under the transcriptional control of Transgelin (SM22α) (\u003cem\u003eTagln-Cre\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e) was introduced into the \u003cem\u003eElmo2\u003c/em\u003e conditional (floxed) background and embryos at specific developmental stages were collected. Unexpectedly, the resulting smooth muscle cell-specific knockout embryos (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔSMC\u003c/sup\u003e) were macroscopically indistinguishable from control littermates at E13.5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Immunostaining-assisted analysis of histological sections revealed subtle, yet statistically significant dilation of the carotid arteries at E13.5 and E15.5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb-c and Supplementary Fig.\u0026nbsp;8a). Despite carotid artery dilation, other relevant features of the global knockout phenotype were not reproduced after \u003cem\u003eTagln-Cre\u003c/em\u003e-mediated deletion of \u003cem\u003eElmo2\u003c/em\u003e. In particular, there were no signs of aneurysm formation, disorganized VSMC alignment, or altered endothelial morphology, polarity and gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed and Supplementary Fig.\u0026nbsp;8b).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo rule out that the failure to reproduce the global knockout phenotype is caused by suboptimal \u003cem\u003eElmo2\u003c/em\u003e deletion in VSMCs, the recombination efficiency of \u003cem\u003eTagln-Cre\u003c/em\u003e in E13.5 embryos was assessed with the \u003cem\u003eR26-mTmG\u003c/em\u003e Cre-reporter. Analysis of GFP expression as surrogate marker of recombination clearly showed that the vast majority of VSMCs and mesenchymal cells around the carotid arteries (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee) and neighboring vessels (Supplementary Fig.\u0026nbsp;8c) are efficiently targeted by the \u003cem\u003eTagln-Cre\u003c/em\u003e. In summary, these results argue that \u003cem\u003eElmo2\u003c/em\u003e deletion in VSMCs by means of a Transgelin-driven constitutive Cre-recombinase is not able to fully phenocopy the effects elicited upon global gene inactivation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eNeural crest-specific deletion of\u003c/b\u003e \u003cb\u003eElmo2\u003c/b\u003e \u003cb\u003ephenocopies the global\u003c/b\u003e \u003cb\u003eElmo2\u003c/b\u003e \u003cb\u003eKO\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNeural crest cells contribute to many craniofacial tissues and are an important source of mural cells in the 3rd PAA and thereby the common carotid arteries\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. We chose \u003cem\u003eWnt1-Cre2\u003c/em\u003e transgenic mice\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e to study NCCs and their progeny, which would also address potential roles early in mural cell differentiation, whereas \u003cem\u003eTagln-Cre\u003c/em\u003e targets more differentiated VSMCs.\u003c/p\u003e \u003cp\u003eIn order to assess whether \u003cem\u003eWnt1-Cre2\u003c/em\u003e allows targeting of neural crest-derived VSMCs progenitors and compare the recombination timing with that of \u003cem\u003eTagln-Cre\u003c/em\u003e, lineage tracing analysis using the \u003cem\u003eR26-mTmG\u003c/em\u003e reporter allele were carried out for both lines. Notably, \u003cem\u003eWnt1-Cre2\u003c/em\u003e-mediated labelling allows detection of a large number of GFP\u003csup\u003e+\u003c/sup\u003e cells that cluster around the vascular plexus giving rise to the 3rd PAA by E9.5, whereas \u003cem\u003eTagln\u003c/em\u003e-Cre-mediated recombination is restricted to the heart at the same stage (Supplementary Fig.\u0026nbsp;9a). In line with this result, expression of the VSMC markers αSMA and SM22α is limited to the heart and cannot be detected in mural cells around the blood vessels in the branchial arches (Supplementary Fig.\u0026nbsp;9b). Expression of SM22α in mural cells or the 3rd PAA is first detected at E10.5, which coincides with the emergence of \u003cem\u003eTagln-Cre\u003c/em\u003e-labelled GFP\u003csup\u003e+\u003c/sup\u003e cells in in this structure (Supplementary Fig.\u0026nbsp;9c). In contrast, at this timepoint, a much larger number of \u003cem\u003eWnt1-Cre2\u003c/em\u003e-traced cells wrap around the 3rd PAA forming a surrounding layer that consists of both SM22α\u003csup\u003e+\u003c/sup\u003e VSMCs and yet undifferentiated cells (Supplementary Fig.\u0026nbsp;9c). At E11.5, recombination with both Cre lines generates robust perivascular GFP labeling in the relevant region (Supplementary Fig.\u0026nbsp;9d).\u003c/p\u003e \u003cp\u003eWe further analyzed the recombination pattern elicited by \u003cem\u003eWnt1-Cre2\u003c/em\u003e in E13.5 embryos with special interest to the carotid arteries and neighboring vascular structures. \u003cem\u003eWnt1-Cre2\u003c/em\u003e-mediated recombination targeted VSMCs around the carotid arteries with high efficacy but, as expected, spared the mesoderm-derived smooth muscle surrounding the vertebral arteries, dorsal aorta, and jugular veins, as well as the endothelial lining of blood vessels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and Supplementary Fig.\u0026nbsp;10a-c). Taken together, these results prove that \u003cem\u003eWnt1-Cre2\u003c/em\u003e efficiently targets NCC-derived VSMCs and their progenitors in the early mouse embryo.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eRemarkably, neural crest-specific mutants (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e), generated by interbreeding of the \u003cem\u003eElmo2\u003c/em\u003e conditional line with \u003cem\u003eWnt1-Cre2\u003c/em\u003e, reproduce the vascular defects observed in the global knockout model. Macroscopic observation of E13.5 \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003eΔNCC\u003c/sup\u003e embryos revealed severe hemorrhaging in the cervical region and dorsal edema (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb) as well as massive dilation of the carotid arteries with aneurysm formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec and d). Moreover, the defects in the hierarchical expression pattern of αSMA and SM22α found in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e embryos are also present upon neural crest-specific deletion (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee), as well as the disorganized alignment of αSMA\u003csup\u003e+\u003c/sup\u003e actin bundles with respect to the ECs\u0026rsquo; longest axis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef and g).\u003c/p\u003e \u003cp\u003eStrikingly, phenotypic changes observed in the ECs of the global knockout, such as retained expression of Endomucin in arterial territories, discontinuous endothelial lining and ectopic expression of mesenchymal markers are also seen upon neural crest-specific \u003cem\u003eElmo2\u003c/em\u003e deletion (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh and i). Given that \u003cem\u003eWnt1-Cre2\u003c/em\u003e-driven recombination spares the endothelium, this result is further evidence that the EC defects in \u003cem\u003eElmo2\u003c/em\u003e mutants are secondary and probably a consequence of the severe vessel dilation.\u003c/p\u003e \u003cp\u003eSince neural crest cells give rise to parts of the autonomic nervous system and might therefore control vascular tone through VSMC innervation\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e, we bred the \u003cem\u003eElmo2\u003c/em\u003e conditional knockout mice with the \u003cem\u003eTH-IRES-Cre\u003c/em\u003e line\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e, which directs Cre recombination to catecholaminergic sympathetic neurons. Efficient and precise targeting of the paravertebral sympathetic ganglia is confirmed by GFP expression in the \u003cem\u003eR26-mTmG\u003c/em\u003e Cre reporter background (Supplementary Fig.\u0026nbsp;10d). Nevertheless, \u003cem\u003eElmo2\u003c/em\u003e deletion in these structures did not induce relevant phenotypic alterations and the resulting mutants survived to term and were obtained slightly above the expected ratio at birth (27.3% instead of 25%). Altogether, these results indicate that \u003cem\u003eElmo2\u003c/em\u003e is essential for vascular diameter control in the developing carotid artery by regulating the properties of NCC-derived VSMC progenitors.\u003c/p\u003e \u003cp\u003e \u003cb\u003eELMO2\u003c/b\u003e \u003cb\u003econtrols contractile ability and actin dynamics of human VSMCs\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo gain insight into the cellular function of ELMO2, we next conducted experiments in cultured VSMCs. We opted for human brain vascular smooth muscle cells (HBVSMCs) because these cells, just like those wrapping around the 3rd PAA and carotid artery, are of neural crest origin\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Moreover, HBVSMCs express\u0026thinsp;~\u0026thinsp;1000-fold higher levels of \u003cem\u003eELMO2\u003c/em\u003e compared to \u003cem\u003eELMO1\u003c/em\u003e (Supplementary Fig.\u0026nbsp;11a).\u003c/p\u003e \u003cp\u003eSilencing RNA (siRNA)-mediated knockdown (KD) of \u003cem\u003eELMO2\u003c/em\u003e in HBVSMCs significantly decreased transcript abundance already by 24h after treatment and this effect was maintained over several days (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). At the protein level, significant reduction of ELMO2 was obvious at 48h after siRNA treatment, with the highest depletion achieved at 72-96h (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb), suggesting a slow protein turnover rate. \u003cem\u003eIn vitro\u003c/em\u003e, \u003cem\u003esiELMO2\u003c/em\u003e-treatment induced a compensatory\u0026thinsp;~\u0026thinsp;2-fold increase in \u003cem\u003eELMO1\u003c/em\u003e transcription, which coincides with the timepoints of highest ELMO2 protein depletion (Supplementary Fig.\u0026nbsp;11b), yet this upregulation may be of limited functional significance given the much higher endogenous expression of \u003cem\u003eELMO2\u003c/em\u003e in HBVSMCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilar to our \u003cem\u003ein vivo\u003c/em\u003e observations, \u003cem\u003esiELMO2\u003c/em\u003e-treated cells did not show relevant changes in the expression of known VSMC markers relative to \u003cem\u003esiControl\u003c/em\u003e cells (Supplementary Fig.\u0026nbsp;11c-d). Likewise, the overall abundance of previously described ELMO2 interaction partners or downstream effectors relevant for cell adhesion, extracellular matrix binding and cell contractility were unchanged at the protein level (Supplementary Fig.\u0026nbsp;11e). The subcellular localization of integrin-linked kinase, a well described interactor of ELMO2, and the phosphorylation of myosin light chain 2, a key regulator of cell contractility, were comparable in KD and control cells (Supplementary Fig.\u0026nbsp;11d and f). On the contrary, analysis of F-actin by phalloidin staining (Supplementary Fig.\u0026nbsp;11d) revealed a slight reduction in the intensity and abundance of stress fibers in \u003cem\u003esiELMO2\u003c/em\u003e HBVSMCs, whereas cortical actin appeared unaffected.\u003c/p\u003e \u003cp\u003eNext, we analyzed the functional performance of \u003cem\u003esiELMO2\u003c/em\u003e HBVSMCs in assays requiring active remodeling of the cytoskeleton. Loss of ELMO2 reduced cell attachment and spreading in Collagen I-coated culture plates at early timepoints (10min to 2h) relative to \u003cem\u003esiControl\u003c/em\u003e cells. These defects were no longer detectable at 6h after seeding, when both the area and number of cells attached are indistinguishable between the KD and control conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec-d and Supplementary Fig.\u0026nbsp;11g). Time-lapse video recordings from live-imaging co-culture experiments confirmed the delayed adhesion of \u003cem\u003esiELMO2\u003c/em\u003e cells (Supplementary Fig.\u0026nbsp;11h-i). Contrary to control cells, which extend filopodia-like cytoplasmic projections, spherical protrusions (blebs) were continuously formed and retracted in the membrane of KD cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee and Supplementary Movie 1a and b). Moreover, culture of \u003cem\u003esiELMO2\u003c/em\u003e HBVSMCs in 3D fibrin hydrogels lead to a similar reduction in cell spreading and cellular area relative to \u003cem\u003esiControl\u003c/em\u003e cells, consistent with the results seen in 2D experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef and g).\u003c/p\u003e \u003cp\u003eIn order to test the contractile capacity of VSMCs \u003cem\u003ein vitro\u003c/em\u003e, we treated co-cultured control and KD cells with carbachol, a cholinergic agonist that increases cytoplasmic calcium levels and stimulates the RhoA/ROCK (Rho-associated kinase) pathway\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Live-imaging analysis showed significantly impaired contractility of \u003cem\u003eELMO2\u003c/em\u003e KD cells, which were not able to efficiently retract their cellular projections upon carbachol treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eh-i and Supplementary Fig.\u0026nbsp;11j). Further verifying this observation, 3D collagen gel contraction assays confirmed that \u003cem\u003esiELMO2\u003c/em\u003e-treatment drastically impaired the contractile capacity of HBVSMCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ej-k). These results point out to an important role for ELMO2 in the regulation of HBVSMC actin dynamics in the context of cell adhesion, spreading and contraction.\u003c/p\u003e \u003cp\u003eWith the aim of uncovering the reasons behind the deficient regulation of actin dynamics after \u003cem\u003eELMO2\u003c/em\u003e downregulation, the ratio of globular (G)-actin to filamentous (F)-actin was determined as a readout of actin polymerization. F-actin abundance was found to be significantly decreased in \u003cem\u003esiELMO2\u003c/em\u003e HBVSMCs relative to \u003cem\u003esiControl\u003c/em\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003el), which showed a higher F-actin to G-actin ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003em). These changes in the functional state of the actin cytoskeleton may be, at least in part, a consequence of reduced active Rac1 in \u003cem\u003eELMO2\u003c/em\u003e KD cells, as shown by a G-LISA-based activation assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003en).\u003c/p\u003e \u003cp\u003eThe reduced abundance of F-actin prompted us to test the impact of pharmacological actin filament stabilization. For this, \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e HBVSMCs were analyzed after treatment with jasplakinolide (JAS), a cyclic peptide known to bind and stabilize filamentous actin \u003cem\u003ein vitro\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Notably, JAS allowed efficient formation of filopodia-like structures and improved adhesion and spreading of \u003cem\u003esiELMO2\u003c/em\u003e cells to an extent that makes them undistinguishable from control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eo-p and Supplementary Fig.\u0026nbsp;11k). Likewise, \u003cem\u003esiELMO2\u003c/em\u003e cells recovered their contractile ability after JAS treatment in the collagen gel contraction assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eq-r). Altogether, these data indicate that promoting actin polymerization and stabilization restores functional features of ELMO2 deficient HBVSMCs.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTiming of global\u003c/b\u003e \u003cb\u003eElmo2\u003c/b\u003e \u003cb\u003edeletion is determinant for aneurysm formation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOur \u003cem\u003ein vitro\u003c/em\u003e data point out to contractility defects as the most likely cause for the vascular dilation phenotype \u003cem\u003ein vivo\u003c/em\u003e. Yet, the most severe phenotypic alterations are only triggered upon \u003cem\u003eElmo2\u003c/em\u003e deletion in neural crest derived progenitors (\u003cem\u003eWnt1-Cre2\u003c/em\u003e-mediated recombination) and do not reach the same extent when contractile VSMCs are targeted (through \u003cem\u003eTagln-Cre\u003c/em\u003e). In this regard, the early onset of \u003cem\u003eWnt1-Cre2\u003c/em\u003e-mediated recombination in the 3rd PAA (Supplementary Fig.\u0026nbsp;9) and the mild phenotype of \u003cem\u003eTagln-Cre\u003c/em\u003e-generated \u003cem\u003eElmo2\u003c/em\u003e mutants raise the possibility that the gene product is required during an early stage of vessel wall assembly.\u003c/p\u003e \u003cp\u003eIn order to directly assess this hypothesis, we bred the \u003cem\u003eElmo2\u003c/em\u003e conditional knockout model with mice expressing an inducible recombinase (CreERT2) under control of the ubiquitously expressed \u003cem\u003eRosa26\u003c/em\u003e locus (\u003cem\u003eR26-CreERT2\u003c/em\u003e \u003csup\u003e55\u003c/sup\u003e). Pregnant dams were treated with 4-hydroxytamoxifen (4-OHT) at defined stages of embryonic development in order to resemble the recombination timing achieved with \u003cem\u003eWnt1-\u003c/em\u003eCre2 and \u003cem\u003eTagln-Cre\u003c/em\u003e lines.\u003c/p\u003e \u003cp\u003e4-OHT treatment at E8.5 and E9.5, which coincides with the timing of \u003cem\u003eWnt1-Cre2\u003c/em\u003e activity, induced severe vascular defects including carotid artery aneurysm by E13.5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea-c). These defects are identical to those observed upon global or NCC-specific \u003cem\u003eElmo2\u003c/em\u003e inactivation and correspond to a complete depletion of ELMO2 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed). In contrast, 4-OHT administration from E10.5 to E11.5, mimicking the later recombination by \u003cem\u003eTagln-Cre\u003c/em\u003e, did not lead to aneurysm formation by E13.5 but induced a milder dilation of the carotid arteries (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ee-g). Given that the short time period between 4-OHT treatment and analysis in this treatment regime results in incomplete depletion of ELMO2 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eh), we tested whether a longer waiting interval could increase the severity of the resulting phenotype. Interestingly, 4-OHT administration from E10.5 to E11.5 with embryo collection at E15.5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ei-k) did not aggravate the arterial dilation despite efficient ELMO2 reduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003el).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese results indicate that ELMO2 function is essential in the 3rd PAA in the early embryo but no longer required for carotid artery development in the second half of gestation. The early emergence of these defects in global and NCC-specific mutants establishes that Elmo2 is directly involved in the regulation of vascular morphogenesis, which argues that vascular defects are probably not secondary to skeletal overgrowth in VMOS patients. Furthermore, it is striking that ELMO2 is specifically required in the vessels supplying the mandible and maxilla, which raises the possibility that the defects in these skeletal elements are a consequence of the vascular dilation.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eELMO family proteins and, in particular, the \u003cem\u003eC. elegans\u003c/em\u003e ortholog CED-12, were initially identified as regulators of phagocytosis and cell migration, which act in concert with Dock family guanine nucleotide exchange factors (GEFs) and the small GTPase Rac1 \u003csup\u003e14,56\u0026ndash;59\u003c/sup\u003e. Later studies have added integrin-linked kinase as an interaction partner of ELMO with relevance for processes such as endosome trafficking, actin remodeling, and the regulation of microtubule dynamics\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. While all three mammalian ELMO family members share a similar domain architecture and are established interaction partners of DOCK family members capable of regulating Rac1 activity\u003csup\u003e\u003cspan additionalcitationids=\"CR62\" citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u003c/sup\u003e, mice carrying a global deletion of \u003cem\u003eElmo1\u003c/em\u003e or \u003cem\u003eElmo3\u003c/em\u003e are viable, whereas the inactivation of \u003cem\u003eElmo2\u003c/em\u003e leads to lethality after midgestation\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The latter, as we show here, is a consequence of the essential role of ELMO2 in the 3rd PAA and common carotid artery development.\u003c/p\u003e \u003cp\u003eDespite of massive vessel dilation and endothelial defects that probably reflect overstretching of the \u003cem\u003eElmo2\u003c/em\u003e mutant arterial wall, alterations in gene expression, detected by scRNA-seq analysis, are unexpectedly minor. This applies to mutant ECs but also to MSCs, the largest cell cluster in our scRNA-seq data, which encompasses different populations of mural cells. The transcriptomic results are consistent with our phenotypic characterization of mutants, which shows that ELMO2 is not necessary for NCC migration into the pharyngeal arches nor for VSMC specification, as indicated by persisting expression of key markers in mutant cells. Accordingly, it should be considered whether the reported reduction or absence of VSMCs inside VMOS lesions\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e might be a consequence of vessel dilation and not a primary defect caused by ELMO2 loss-of-function mutations.\u003c/p\u003e \u003cp\u003eOur \u003cem\u003ein vitro\u003c/em\u003e experiments also support that ELMO2 is not controlling VSMC identity or survival but rather regulates cell contractility and spreading through Rac1 and the modulation of actin dynamics. In this context, it is worth noting that NCC-specific deletion of ILK and Rac1, two critical interaction partners of ELMO2 and well-established regulators of cytoskeletal dynamics, lead to impaired PAA development\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e. Neural crest cell migration, however, is not compromised in these mutants, similar to what we report for \u003cem\u003eElmo2\u003c/em\u003e deficient embryos. Interestingly, inactivation of \u003cem\u003eIlk\u003c/em\u003e in NCCs impairs VSMC differentiation inside branchial arches\u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e, which might reflect ELMO2-independent roles of ILK in cell adhesion and specification. On the other hand, NCC-specific deletion of Rac1 results in aberrant patterning of pharyngeal arch arteries, defective outflow tract septation and aneurysms in the vessels branching from the common arterial trunk, without impairing VSMC specification\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. These phenotypic similarities argue that ELMO2 might act in concert with Rac1 and ILK, consistent with previous reports\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGiven that ELMO2 function is critically required for the contractile and vessel-stabilizing function of NCC-derived smooth muscle cells surrounding the 3rd PAA, the absence of defects in other vascular structures is highly surprising. Strikingly, even the neighboring \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e PAAs remain normal or are affected to a very low degree. These differences cannot be explained by the ontogeny of the vascular components since both endothelial and mural cells of the PAAs are derived from the secondary heart field (SHF) \u003csup\u003e\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e and the neural crest\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e,\u003cspan additionalcitationids=\"CR67\" citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e\u003c/sup\u003e, respectively. Of particular interest, vessel dilation in VMOS patients directly affects the external carotid arteries, whereas bilateral ophthalmic internal carotid artery aneurysms have also been reported\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, suggesting that potentially overlapping mechanisms may be responsible for the increased susceptibility of these vessels in humans and the 3rd PAA derivates in mice. Redundant activity of other ELMO family members in unaffected vessels might be one explanation and future studies involving compound mutants might be able to address this question.\u003c/p\u003e \u003cp\u003eDuring embryonic development, the PAAs undergo large-scale asymmetric morphogenesis to form critical structures of the aorta-associated arterial network. The extensive transformation of the pharyngeal arch vessels occurs within a dynamic biomechanical environment that is fundamentally influenced by blood flow and hemodynamic forces. Quantitative analysis of blood flow, velocity and wall pressure in avian embryos has shown that the 3rd PAA receives the largest amount of flow during stages that are equivalent to E10.5-E11.5 of mouse development\u003csup\u003e\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e. In addition, it needs to be considered that 3rd PAAs persist and significantly contribute to the formation of the common carotid arteries, whereas the other PAAs partially or completely regress, which implies that their contribution to the adult vasculature is comparably minor\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. These may be important factors explaining the localized phenotypic alterations.\u003c/p\u003e \u003cp\u003eWith regard to VMOS, our work establishes that vascular malformations emerge before the development of the craniofacial skeleton and therefore independently from bone defects. This finding is important because osteoblast lineage cells are a source of vascular endothelial growth factor A (VEGF-A), a master regulator of blood vessel growth and patterning, which might trigger vessel dilation and increased permeability in settings of bone overgrowth\u003csup\u003e\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e,\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e\u003c/sup\u003e. Thus, while the analysis of VMOS patients is usually confined to subjects with fully established lesions, more attention should be given to the detection of vascular alterations during onset and early development of the disease. In addition, our findings raise the possibility that carotid artery defects, altered blood flow and increased vascular permeability may be potential underlying causes of craniofacial bone overgrowth. This might also explain the strong involvement of the mandible and maxilla, which are supplied by arteries, namely the maxillary and facial arteries, that branch off from the external carotid arteries.\u003c/p\u003e \u003cp\u003eThe embryonic lethality of global and NCC-specific \u003cem\u003eElmo2\u003c/em\u003e mutants currently precludes a direct investigation of the interplay between bone growth and the side branches of the carotid artery system. Moreover, there are limitations for experimental approaches involving inducible Cre recombinase systems because, as our results with \u003cem\u003eR26-CreERT2\u003c/em\u003e mice show, timing is critical and only early activation of Cre activity will induce the full range of defects in the 3rd PAA and common carotid artery.\u003c/p\u003e \u003cp\u003eHuman VMOS patients appear unaffected at birth and exhibit their first symptoms during childhood which progressively worsen during development to adulthood\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e. Future work should try to address whether mutations in human \u003cem\u003eELMO2\u003c/em\u003e could lead to partial lethality during embryonic development. It should be also considered whether the previously reported residual activity of mutated ELMO2 gene products\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e might facilitate fetal survival but cause milder vascular defects that can trigger bone overgrowth.\u003c/p\u003e \u003cp\u003eThe sum of our findings firmly establishes that ELMO2 is necessary for normal formation of the 3rd PAA and the common carotid arteries. Moreover, our results raise important new questions regarding the etiology of VMOS and the potential benefit of vessel-targeting therapies for the treatment of this devastating disease.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAnimals (Mouse)\u003c/h2\u003e \u003cp\u003eAnimals used in this study were housed in the animal house of the Max Planck Institute for Molecular Biomedicine, M\u0026uuml;nster. Animals were kept in a temperature-controlled room (22\u0026deg;C +/- 1.5\u0026deg;C) with a 14h light:10h dark cycle and received food and water \u003cem\u003ead libitum\u003c/em\u003e. All animal procedures were conducted in accordance with the guidelines of the Max Planck Institute and approved by the \u003cem\u003eLandesamt f\u0026uuml;r Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen\u003c/em\u003e (LANUV, Az. No. 81-02.04.2023.A383).\u003c/p\u003e \u003cp\u003eMouse lines were maintained in a C57BL/6J background. \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eLacZ\u003c/em\u003e\u003c/sup\u003e embryonic stem cells were obtained from the European Mouse Mutant Cell Repository (EMMCR- clone H08) and injected to blastocysts. Chimeras were selected based on coat color and genotype, and were further inbred to obtain \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eLacZ/+\u003c/em\u003e\u003c/sup\u003e animals. The \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eLacZ\u003c/em\u003e\u003c/sup\u003e allele has an internal ribosome entry site (IRES) sequence followed by the \u003cem\u003eLacZ\u003c/em\u003e reporter gene and a polyadenylation signal (pA) upstream of the \u003cem\u003eElmo2\u003c/em\u003e exon 7. To generate \u003cem\u003eElmo2\u003c/em\u003e global knockout mice, female \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eLacZ\u003c/em\u003e\u003c/sup\u003e heterozygotes were bred to \u003cem\u003ePGK-Cre\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e males. Offspring was backcrossed to wildtype animals and Cre-negative progeny carrying one copy of the \u003cem\u003eElmo2\u003c/em\u003e knockout allele (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/\u0026minus;\u003c/em\u003e\u003c/sup\u003e) was selected to maintain the line. For global deletion experiments, embryos were obtained by crossing heterozygous \u003cem\u003eElmo2\u003c/em\u003e knockout (\u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/\u0026minus;\u003c/em\u003e\u003c/sup\u003e) males and females. The \u003cem\u003eElmo2\u003c/em\u003e floxed allele was generated by Flp-mediated excision of FRT flanked sequences in \u003cem\u003eElmo2\u003c/em\u003e\u003csup\u003e\u003cem\u003eLacZ\u003c/em\u003e\u003c/sup\u003e resulting in loxP sites flanking exon 7. In order to drive conditional deletion of \u003cem\u003eElmo2\u003c/em\u003e, Cre-positive males from tissue-specific or tamoxifen-inducible mouse lines, bearing one copy of the Elmo2 floxed allele, were interbred with homozygous \u003cem\u003eElmo2\u003c/em\u003e floxed females. The following Cre lines were used for the conditional deletion of \u003cem\u003eElmo2\u003c/em\u003e in different cell types: \u003cem\u003eTek-Cre\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e for targeting the endothelium, \u003cem\u003eTagln-Cre\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e to induce recombination in committed VSMCs, \u003cem\u003eWnt1-Cre2\u003c/em\u003e \u003csup\u003e49\u003c/sup\u003e for deletion in neural crest cells and \u003cem\u003eTH-IRES-Cre\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e to drive recombination in neuronal subpopulations. For global tamoxifen-inducible recombination the \u003cem\u003eR26-CreERT\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e model was used and the \u003cem\u003eR26-mTmG\u003c/em\u003e reporter \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e was utilized to monitor the efficiency and specificity of the different Cre-drivers.\u003c/p\u003e \u003cp\u003eEmbryos at specific developmental stages were obtained from timed matings. The day in which the vaginal plug is detected is considered as embryonic day (E) 0.5. For sample collection, pregnant females were sacrificed by CO\u003csub\u003e2\u003c/sub\u003e, the whole uterus removed and transferred to ice-cold PBS. Each embryo was carefully dissected out from the amnion and kept in ice-cold PBS for macroscopic imaging (AxioObserver, Zeiss). For immunostaining approaches embryos were fixed in 2% PFA overnight at 4\u0026deg;C with gentle agitation after severing off the head. For biochemistry experiments embryos were flash frozen in liquid nitrogen.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eTamoxifen administration\u003c/h3\u003e\n\u003cp\u003e4-hydroxy tamoxifen (4OHT, Sigma, Cat#H7904) was dissolved in a 1:1 mixture of ethanol-Kolliphor EL and stored in 1mg aliquots at -20\u0026deg;C. On the day of administration, 1mg 4OHT was thawed at 37\u0026deg;C and diluted with 200\u0026micro;L of prewarmed PBS. 1mg of progesterone (Sigma, Cat#P3972) dissolved in 200\u0026micro;L of a 1:10 mixture of ethanol-peanut oil was mixed with the 4OHT and administered to pregnant females by oral gavage on the specified days.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence\u003c/h3\u003e\n\u003cp\u003e100\u0026ndash;200\u0026micro;m tissue sections were obtained using a vibratome. Permeabilization and blocking was achieved by a 48h-long incubation of the samples in 0.5% Triton-X-100, 1% BSA dissolved in PBS (blocking buffer) at 4\u0026deg;C. Blocking buffer was used for dilution of primary and secondary antibodies, which were incubated at 4\u0026deg;C for 48h with gentle agitation. Sections were mounted with Fluoromount-G (Southern Biotech, Cat#0100-01) between two 60mm coverslips separated by a 0.2mm spacer. Whole-mount staining of early-stage embryos (E9.5 to E11.5) was performed in the same manner. Image acquisition was carried out using a confocal microscope (Zeiss, LSM880). Details of the primary and secondary antibodies used in this study are provided below:\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibodies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIdentifier\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDilution\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChicken polyclonal anti-GFP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2BScientific Ltd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# GFP-1010 RRID:AB_2307313\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChicken polyclonal anti-GFP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# ab13970 RRID:AB_300798\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat polyclonal anti-CD31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u0026amp;D Systems\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# AF3628 RRID:AB_2161028\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat polyclonal anti-Podocalyxin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u0026amp;D Systems\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# AF1556 RRID:AB_354858\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat polyclonal anti-Sox17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u0026amp;D Systems\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# AF1924 RRID:AB_355060\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse monoclonal anti- Tubulin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSigma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# T5168 RRID:AB_477579\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse monoclonal anti-Alpha smooth muscle actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSigma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# A2547 RRID:AB_476701\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse monoclonal anti-Alpha smooth muscle actin-Cy3 conjugated\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSigma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# C6198 RRID:AB_476856\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse monoclonal anti-Alpha smooth muscle actin-FITC conjugated\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSigma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# F3777\u003c/p\u003e \u003cp\u003eRRID:AB_476977\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse monoclonal anti-Beta actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# AM4302 RRID:AB_2536382\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse monoclonal anti-Rac1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMillipore\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 05-389, RRID:AB_309712\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit monoclonal anti-Calponin1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 17819, RRID:AB_2798789\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit monoclonal anti-Elmo1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 14457 RRID:AB_2798484\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit monoclonal anti-ERG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# ab110639 RRID:AB_10864794\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit monoclonal anti-ILK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# ab76468, RRID:AB_2126930\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000 - WB\u003c/p\u003e \u003cp\u003e1:100 - ICC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti-FAK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 3285, RRID:AB_2269034\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti- phospho-FAK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 3283, RRID:AB_2173659\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti- Phospho-Myosin Light Chain 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 3671, RRID:AB_330248\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti-Elmo2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThermoFisher\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# PA5-28725 RRID:AB_2546201\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti-GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# #2118, RRID:AB_561053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti-Parvin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# ; #4026, RRID:AB_2158936\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti-Prox-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReliaTech\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 102-PA32AG RRID:AB_10013821\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti-SM22a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# ab14106 RRID:AB_443021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRabbit polyclonal anti-Vinculin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProteintech\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 26520-1-AP RRID:AB_2868558\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat monoclonal anti-Endomucin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# SC-65495 RRID:AB_2100037\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat monoclonal anti-Nestin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# sc-101541, RRID:AB_1126570\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat monoclonal anti-VE Cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBD Biosciences\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 555289 RRID:AB_395707\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-chicken Alexa flour 488\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJackson Laboratories\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 703-545-155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-goat-Alexa Fluor 488\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# A11055\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-goat-Alexa Fluor 546\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# A11056\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-goat-Alexa Fluor 647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# A21447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-rabbit-Alexa Fluor 488\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# A21206\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-rabbit-Alexa Fluor 647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# A31573\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-rat-Alexa Fluor 488\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# A21208\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDonkey anti-rat-Alexa Fluor Cy3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJackson Immuno Research\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 712-165-153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat anti rabbit IgG- HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# 7074\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSheep anti mouse IgG- HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmersham\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat# NA931\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eWhole-mount immunostaining and clearing of embryos from E11.5 to E13.5 was performed following the iDISCO protocol \u003csup\u003e\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u003c/sup\u003e and images were obtained using a light sheet microscope (M2Lasers, AURORA).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eProliferation assay\u003c/h2\u003e \u003cp\u003eFor labeling of proliferating cells, a 10mg/mL EdU solution was intraperitoneally injected to pregnant females (50mg/Kg body weight) 2h before sample collection. Embryos were fixed in 2% PFA and processed as previously described for immunostaining of vibratome sections. EdU\u003csup\u003e+\u003c/sup\u003e cells were detected using the Click-iT EdU Alexa-647 imaging kit (Invitrogen, cat. #C10340) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eX-gal staining\u003c/h3\u003e\n\u003cp\u003eEmbryos were fixed with X-gal fixative (1.5% paraformaldehyde, 0.2% glutaraldehyde, 5mM EGTA (pH 8.0), 2mM MgCl\u003csub\u003e2\u003c/sub\u003e, and 1X PBS, dissolved in water) for 90min at room temperature (RT) and washed 3 times with washing buffer (1X PBS, 2mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.001% sodium deoxycholate, 0.02% Nonidet P40 dissolved in water) for 30min. Samples were stained in prewarmed X-gal solution (1mg/mL X-gal (dissolved in dimethylformamide), 5mM K\u003csub\u003e3\u003c/sub\u003eFe(CN)\u003csub\u003e6\u003c/sub\u003e, 5mM K\u003csub\u003e4\u003c/sub\u003eFe(CN)\u003csub\u003e6\u003c/sub\u003e-3H\u003csub\u003e2\u003c/sub\u003eO, dissolved in washing buffer) and incubated at 37\u0026deg;C with gentle agitation. After overnight incubation, X-gal staining developed as visible blue signal. Samples were washed with PBS for 3 times at RT and counter stained with Eosin.\u003c/p\u003e\n\u003ch3\u003eSingle cell RNA sequencing\u003c/h3\u003e\n\u003cp\u003eThe 3rd PAA together with the surrounding mesenchyme was microdissected from freshly harvested E12.5 mouse embryos and immediately transferred to collection buffer (25mM HEPES in DMEM) in a 48-well plate. Once all samples were collected, they were transferred to 1.5mL tubes containing 100\u0026micro;L of pre-warmed digestion buffer (50mg/mL Liberase TM and 0.1mg/mL DNAse-1 in collection buffer) and incubated at 37\u0026deg;C for 15min with occasional mixing and cell disaggregation by pipetting with 200\u0026micro;L sterile filter tips. Enzymatic activity was stopped by adding 1mL of inactivation buffer (10% fetal calf serum in DMEM) per sample followed by filtering the cell suspension through a 40\u0026micro;m strainer. To increase the cell yield, the filter was further washed with 400\u0026micro;L of collection buffer and the flow through was collected. Samples were next centrifuged at 300g and RT for 7min. After careful aspiration of the supernatant, 100\u0026micro;L of red blood cell-lysis buffer were used to resuspend the pellet. After a 1min-RT incubation, 1.5mL of FACS buffer (0.22\u0026micro;m-filtered 2% heat inactivated fetal calf serum in PBS) was added and the samples were centrifuged (300g for 7min at 4\u0026deg;C) to pellet down the cells. Next, the supernatant was carefully aspirated and 100\u0026micro;L of FACS buffer were used to gently resuspend the cells. Cell yield was assessed with an automated cell counter (Logos biosystems, LUNA-II\u0026trade;) and single cells were further captured with the BD Rhapsody Express Single-Cell Analysis System (BD Biosciences). Library preparation was performed following manufacturer\u0026rsquo;s instructions (BD Rhapsody\u0026trade; system mRNA WTA library preparation protocol) and sequenced using Illumina NextSeq 500.\u003c/p\u003e \u003cp\u003eRaw FASTQ reads were quality and adapter trimmed using fastp (version 0.23.2 length cutoff 20, quality cutoff 15). The UMI and complex barcode were extracted and demultiplexed using custom scripts. The GRCm39 reference genome was merged with the reporter vector sequence to create a custom reference. STAR version 2.7.10a \u003csup\u003e\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u003c/sup\u003e was used to generate a reference genome index, with reporter features and Gencode annotations vM29, subset to lncRNA and protein-coding genes. FASTQ reads were mapped against the reference genome index using STAR with the settings \u0026ldquo;--soloType CB_UMI_Simple --soloCellFilter None --outSAMtype BAM SortedByCoordinate --soloFeatures GeneFull_Ex50pAS --soloCBstart 1 --soloCBlen 27 --soloUMIstart 28 --soloUMIlen 8 --soloCBwhitelist rhapsody_whitelist.txt --runRNGseed 1 --soloMultiMappers EM --readFilesCommand zcat\u0026rdquo;. Raw counts were imported as AnnData \u003csup\u003e\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e\u003c/sup\u003e objects. Low complexity barcodes were removed with the knee plot method, and cells with a mitochondrial mRNA content were further filtered out, as well as cells with unusually high total and gene counts, using manually determined cutoffs for each sample. Doublets were scored with Scrublet 0.2.3 \u003csup\u003e76\u003c/sup\u003e. Finally, each sample\u0026rsquo;s gene expression matrix was normalized using Scran 1.22.1 \u003csup\u003e77\u003c/sup\u003e) with Leiden clustering \u003csup\u003e\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e\u003c/sup\u003e input at resolution 0.5. G2M and S phase scores were assigned to each cell using gene lists from \u003csup\u003e\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u003c/sup\u003e and the Scanpy 1.9.1 \u003csup\u003e80\u003c/sup\u003e sc.tl.score_genes_cell_cycle function.\u003c/p\u003e \u003cp\u003eFor embedding, clustering and annotation, the normalized expression matrix was subset to the 3,000 most highly variable genes (HVG, sc.pp.highly_variable_genes, flavor \u0026ldquo;seurat\u0026rdquo;). The top 100 principal components (PCs) were calculated, and batch-corrected using Harmony 0.0.5 \u003csup\u003e81\u003c/sup\u003e. The PCs served as basis for k-nearest neighbor calculation (sc.pp.neighbors, n_neighbors\u0026thinsp;=\u0026thinsp;30), which were used as input for UMAP \u003csup\u003e\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e\u003c/sup\u003e layout (sc.tl.umap, min_dist\u0026thinsp;=\u0026thinsp;0.3). Cell populations were clustered using scanpy.tl.leiden, and a suitable resolution was chosen for main cell type annotation. Cluster marker genes were calculated using a pseudobulk approach, comparing aggregate counts with 2 pseudo-replicates for each cluster to all remaining cells (pyDeSEQ2 0.4.8). Finally, expression of select marker genes was plotted using Matplotlib 3.8.4 \u003csup\u003e83\u003c/sup\u003e (\u0026ldquo;imshow\u0026rdquo;) and clusters were annotated accordingly. The AnnData object was subset to MSCs and ECs, respectively, and the process detailed above for clustering and annotation was repeated, using the top 2000 HVGs and 50 PCs. Clusters were annotated at Leiden resolutions 0.05 and 0.3, for ECs and MSCs, respectively.\u003c/p\u003e \u003cp\u003eDifferentially expressed genes were calculated using a pseudobulk approach, comparing aggregate counts with 2 pseudoreplicates for WT and KO each (pyDeSEQ2 0.4.8). DE results were filtered for sex-specific genes due to the presence of cells from mixed-sex samples, and 7 genes were masked accordingly (Gm47283, Xist, Tmsb4x, Ddx3y, Eif2s3y, Uty, Kdm5d). Enrichr (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://maayanlab.cloud/Enrichr/\u003c/span\u003e\u003cspan address=\"https://maayanlab.cloud/Enrichr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to calculate gene set enrichment via the gseapy 0.10.8 \u0026ldquo;enrich\u0026rdquo; API. Up-, (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, log2FC\u0026thinsp;\u0026gt;\u0026thinsp;0.5), down- (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, log2FC \u0026lt; -0.5), and de-regulated (up or down) gene sets were tested separately.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eAll cell culture experiments were in compliance with S1 regulations. Cultured cells were maintained in 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. Human brain vascular smooth muscle cells (HBVSMCs, ScienCell, cat. #1100) were obtained as passage 0 (P0) and stored in liquid nitrogen. Cells were thawed and subcultured according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003eCells were expanded up to passage 2 (P2) and frozen at this stage (stock). Freezing media was the usual Smooth Muscle cell Complete Media (SMCM; ScienCell, cat. no. #1101) supplemented with 10% FCS and 10% DMSO. From each T75 plate, 4 stock vials were prepared and frozen. For all experiments, a P2 vial was thawed in a poly-lysine coated T75 plate and expanded with complete media. From P4 to the end of experiments, cells were cultured with smooth muscle cell differentiation media (SMCM supplemented with 2% FCS and 20ng/mL TGFβ-1). Passage 4 and 5 were used to increase the number of cells and to allow smooth muscle cell contractile differentiation. This was achieved by seeding 15000 cells/cm\u003csup\u003e2\u003c/sup\u003e in poly-lysine coated T75 dishes and culturing them until reaching confluency with smooth muscle cell differentiation media. Functional experiments were performed at P6-P7.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative RT-PCR (qPCR)\u003c/h2\u003e \u003cp\u003eWhole mouse embryos were flash frozen in liquid nitrogen, 400\u0026micro;L of lysis buffer were added to each sample before mechanical dissociation (Ultra-Turrax, IKA T25) and centrifugation (300g for 10min). The supernatant was collected for RNA isolation. For \u003cem\u003ein vitro\u003c/em\u003e samples, cells grown in multi-well 24 cell culture plates were washed twice with sterile PBS and 200\u0026micro;L of freshly prepared 1X RNA protection buffer per well were added. Cells were manually disrupted with a pipette tip, collected in 2mL round-bottom tubes and stored at -80\u0026deg;C until RNA isolation. RNA isolation was performed using the Monarch Total RNA Miniprep Kit (New England Biolabs, cat. #T2010S) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003eAfter RNA isolation, concentration of RNA was measured (NanoDrop 8000, ThermoFisher). cDNA was synthesized from 1\u0026micro;g of RNA by reverse transcription (LunaScript RT SuperMix kit, New England Biolabs, cat. #T2010S) reverse transcription. For gene expression analysis in HBVSMCs, the following Taqman probes were used: Human \u003cem\u003eGAPDH-VIC\u003c/em\u003e (ThermoFisher, 4326317E), Human \u003cem\u003eELMO2\u003c/em\u003e-FAM (ThermoFisher, Hs00223006_m1), Human \u003cem\u003eELMO1\u003c/em\u003e-FAM (ThermoFisher, Hs00404992_m1), Human \u003cem\u003eACTA2\u003c/em\u003e-FAM (ThermoFisher, Hs00426835_g1), Human \u003cem\u003eTAGLN\u003c/em\u003e- FAM (ThermoFisher, Hs01038777_g1), Human \u003cem\u003eNES\u003c/em\u003e-FAM (ThermoFisher, Hs04187831_g1), Human \u003cem\u003ePDGFRB\u003c/em\u003e-FAM (ThermoFisher, Hs01019589_m1).\u003c/p\u003e \u003cp\u003eTwo different pairs of custom-designed primers flanking exon 7 of \u003cem\u003eElmo2\u003c/em\u003e were used for SYBR Green-based analysis of gene expression in control and mutant mouse embryos. Primer 1 forward: CTGATGGAAAGGACCCAGTCA; reverse: AACTCCGTGGCGAAAGTCAC. Primer 2 forward: GAGAGTGGGACCAAGCTCCT; reverse: CTCTCTAGGATGGCCAGGGA. \u003cem\u003eGapdh\u003c/em\u003e was used as housekeeping gene. Forward primer: CCAATGTGTCCGTCGTGGAT; reverse primer: TGCCTGCTTCACCACCTTCT).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eProtein isolation\u003c/h2\u003e \u003cp\u003eWhole embryos were flash frozen in liquid nitrogen and stored at -80\u0026deg;C. Immediately before protein isolation, 400\u0026micro;L of lysis buffer (20mM Tris-HCl; pH 8.0, 150mM NaCl, 0.5% TritonX-100, 0.1% SDS, 0.1% Na-DOC, 2 mM EDTA, 0.1mg/mL DNase supplemented with protease and phosphatase inhibitors) were added to frozen samples and subjected to mechanical disruption with Ultra-Turrax (IKA T25) followed by incubation at 4\u0026deg;C for 30min in a rotating wheel. Samples were centrifuged at full speed for 15min to obtain the lysate. The supernatant was collected in a 2mL tube and 10\u0026micro;L of lysate were used for protein quantitation using ADV02 precision red advanced protein assay reagent (Cytoskeleton, cat. # ADV02). Equal protein concentrations were obtained by diluting the samples with lysis buffer. 3x Laemmli buffer (0.25M Tris base, 8%SDS, 40% glycerol, 20% beta-mercaptoethanol and 4mg/mL of bromophenol blue) was added to samples (1/3 volume of sample), mixed well, and boiled at 95\u0026deg;C for 5min. After allowing the samples to cool down for 5min, they were stored at -20\u0026deg;C until Western blotting.\u003c/p\u003e \u003cp\u003eFor \u003cem\u003ein vitro\u003c/em\u003e samples, cells were placed on ice and washed twice with ice-cold PBS followed by addition of lysis buffer and incubation at 4\u0026deg;C for 20min. For a multiwell-6 plate (mw6), 2mL of PBS per well were used for washing and 150\u0026micro;L of lysis buffer per well were used for lysis. Cells were scraped using a precooled cell scraper and lysates were collected in 1.5mL tubes. Lysates were sonicated with an amplitude of 80 with 10 pulses per sample followed by centrifugation at full speed for 10min at 4\u0026deg;C. Supernatant was collected in a 1.5mL tube. Quantitation and storage were performed as described above.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eFor Western blotting, upper stacking gel (1.5M Tris HCL, 0.4% SDS dissolved in water, pH 8.8) and lower resolving gel (0.5M Tris HCl, 0.4% SDS dissolved in water, pH 6.8) were prepared. 20 kDa to 124 kDa proteins were separated in 10% resolving gels, whereas 125 kDa to 250 kDa proteins were separated in 8% resolving gels. Equal amounts of protein sample were briefly heated at 95\u0026deg;C, cooled down at RT for 2min, spined down for 15sec and loaded into the wells of the gel. During the electrophoresis run along the stacking gel, the voltage was set to 80V and to 120V once the samples reached the resolving gel. After obtaining the required size separation, samples were transferred to an activated PVDF membrane (activated in methanol for 15sec) over 1.5h at 25V. The membrane was blocked with 1% skim milk for 1h at RT and probed with primary and HRP-conjugated secondary antibodies. ECL prime reagent was used for the detection of bands.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eGene knockdown\u003c/h2\u003e \u003cp\u003eSilencer select \u003cem\u003esiELMO2\u003c/em\u003e (ThermoFisher, cat. #Hs00223006_m1), which covers most of the \u003cem\u003eELMO2\u003c/em\u003e splice variants, was used for knockdown experiments by forward transfection. Cells were seeded at a density of 6000 cells/cm\u003csup\u003e2\u003c/sup\u003e and cultured overnight. The following day media was exchanged before transfection. A mixture of DMEM-diluted siRNA (24nM) and lipofectamine RNAiMax (Invitrogen, cat. #13778150) was added drop-wise to the cells and the plate was placed in the incubator overnight after proper mixing. The following day, media was refreshed and cells were kept in culture until the collection time with media changes every other day.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence for cell culture\u003c/h2\u003e \u003cp\u003eCells were washed twice with PBS (without Ca\u003csup\u003e2+\u003c/sup\u003e and Mg\u003csup\u003e2+\u003c/sup\u003e) and fixed with 2% PFA (filtered through 0.22\u0026micro;m syringe) at RT for 15min. Permeabilization was achieved by incubating cells with 2% Triton X-100 for 15min at RT. At the end of incubation cells were washed once with PBS and blocked with 1% BSA in PBS for 30min. Primary and secondary antibody incubations were done at 4\u0026deg;C overnight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eGel contraction assay\u003c/h2\u003e \u003cp\u003eControl and \u003cem\u003eELMO2\u003c/em\u003e knockdown cells were trypsinized 96h after siRNA treatment and counted. 5x10\u003csup\u003e05\u003c/sup\u003e cells from each sample were transferred to 1.5mL tubes placed on ice and the final volume was adjusted to 500\u0026micro;L with media. In a 2mL round-bottom tube placed on ice, 500\u0026micro;L of collagen-gel forming media (250\u0026micro;L of 8.69mg/mL Collagen I, 190\u0026micro;L of SMC- differentiation media, and 60\u0026micro;L of 0.1M NaOH) were prepared. Cells and collagen-gel forming media were mixed in a 1:1 ratio and 500\u0026micro;L of this mixture were immediately added to a well of a mw24 plate kept at RT. After 1h, solidified gels were dislodged from the walls of the wells and 500\u0026micro;L of media were added on top. Images of gels at t\u0026thinsp;=\u0026thinsp;0 were acquired with a stereo microscope. After a 12h incubation at 37\u0026deg;C, gel contraction was observed and the corresponding images acquired (t\u0026thinsp;=\u0026thinsp;12h).\u003c/p\u003e \u003cp\u003eFor the rescue experiment, 96h after knockdown, \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e cells were treated with 100nM Jasplakinolide (Sigma, cat. #J4580) for 1h. Subsequently cells were washed twice with PBS and cultured in normal media. After 2h cells were trypsinized and collected for gel contraction assay as described above.\u003c/p\u003e \u003cp\u003eArea of the gels at t\u0026thinsp;=\u0026thinsp;0 and t\u0026thinsp;=\u0026thinsp;12h was measured with Fiji and the percentage of gel contraction was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCarbachol-induced contraction\u003c/h2\u003e \u003cp\u003e \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e knockdown cells were labelled 48h after transfection with 1nM CellTracker-Green (Invitrogen, cat. #C7025) and CellTracker-Orange (Invitrogen, cat. #C34551), respectively. After a 24h-long incubation cells were trypsinized and counted. 6000 cells from each sample were mixed and added to a polylysine-coated Ibidi 8-well \u0026micro;-slide (Ibidi, cat. #80806) and allowed to attach. 96h after transfection, media was refreshed and the \u0026micro;-slide was transferred to a live-imaging microscope equipped with controlled temperature (37\u0026deg;C) and CO\u003csub\u003e2\u003c/sub\u003e levels (5%). Once the imaging positions and focal plane were defined, media supplemented with 1mM carbachol was added and the contraction response of the cells imaged during 15min. The area of individual cells before carbachol stimulation (t\u0026thinsp;=\u0026thinsp;0) and 15min after treatment (t\u0026thinsp;=\u0026thinsp;15min) was measured using Fiji to calculate the percentage of contraction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eSpreading and attachment assay (2D)\u003c/h2\u003e \u003cp\u003e \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e treated cells were labelled 48h post transfection with CellTracker reagents as described before. 96h after transfection, cells were trypsinized and counted. 6000 cells from each condition were mixed and added to an ibidi 8-well \u0026micro;-slide coated with 2% collagen. Attached cells were fixed at different time points (10min, 30min, 1h, 2h, and 6h) after seeding. For live-imaging experiments, 6000 cells treated with \u003cem\u003esiControl\u003c/em\u003e or \u003cem\u003esiELMO2\u003c/em\u003e siRNA were mixed and added to collagen-coated ibidi 8-well \u0026micro;-slide, which was imaged overnight under usual cell culture conditions (37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e).\u003c/p\u003e \u003cp\u003eFor the rescue experiment, 96h post transfection, \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e cells were treated with 100nM Jasplakinolide (Sigma, cat. #J4580) for 1h. Subsequently cells were washed twice with PBS and fresh media was provided. After 30min cells were trypsinized and collected for attachment assay. Cells were seeded into collagen-coated wells and, after 10min, attached cells were fixed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eMorphology analysis of cells in fibrin gels (3D)\u003c/h2\u003e \u003cp\u003e \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e treated cells were labelled 48h post transfection with CellTracker reagents as described before. Cells were trypsinized 96h after transfection and counted. 6000 cells from each condition were mixed and resuspended in 1mL of media. Fibrinogen (Sigma, cat. #F8630) was prepared at a final clottable concentration of 10mg/mL and sterilized by passing the solution through a 0.22\u0026micro;m syringe filter before further dilution to the final working concentration (2mg/mL in PBS). 968\u0026micro;L of fibrinogen were mixed with 32\u0026micro;L of aprotinin (Sigma, cat. #A1153, 4U/mL) and the whole volume (1mL) mixed with the cell suspension. 250\u0026micro;L of this mixture were added to each well of an ibidi 8-well \u0026micro;-slide which is pre-loaded with 2\u0026micro;L of thrombin (Sigma, cat. #T4648, 0.1U/\u0026micro;L). Gel polymerizes after a 30min incubation at RT. 100\u0026micro;L of media were added on top of the gels and the plates were incubated overnight at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Next day the gels were fixed with 2% PFA and imaged.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eRac1 activation assay\u003c/h2\u003e \u003cp\u003eFor the analysis of Rac1 activation, the luminescence-based G-LISA Rac-1 activation assay biochem kit (Cytoskeleton Inc., cat. #BK126) was used. Protein samples were collected from \u003cem\u003esiControl\u003c/em\u003e and \u003cem\u003esiELMO2\u003c/em\u003e treated cells and snap frozen in liquid nitrogen until the day of experiment. 10\u0026micro;L of protein lysate were used for assessing protein concentration using the AVD02 reagent or the reagent included in the kit. Protein sample preparation and G-LISA was performed according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of G-actin to F-actin ratio\u003c/h2\u003e \u003cp\u003eG-actin to F-actin ratio analysis was performed as previously described \u003csup\u003e\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e. Briefly, cells were lysed in an actin-stabilizing lysis buffer (50 mM PIPES, pH 6.9, 50 mM NaCl, 5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 5 mM EGTA, 0.2 mM dithiothreitol, 0.1% NP40, 0.1% Tween 20, 5% glycerol, 1 mM ATP and protease inhibitors). Lysates were subjected to ultracentrifugation (150,000g) at 4\u0026deg;C for 70min. The supernatant (G-actin fraction) was collected to pre-labelled tubes and stored at 4\u0026deg;C until protein quantitation. 200\u0026micro;L of actin depolymerizing buffer (50 mM PIPES, pH 6.9, 5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 10 mM CaCl\u003csub\u003e2\u003c/sub\u003e, 5 \u0026micro;M cytochalasin D) were added to the pellet (F-actin fraction) and this was solubilized by sonication. Equal amount of G-actin and F-actin fractions from control and knockdown cells were loaded to an SDS-PAGE gel, transferred to a PVDF membrane, and stained for β-actin to determine the amount of G-actin and F-actin.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eQuantification and statistical analysis\u003c/h2\u003e \u003cp\u003eQuantitative data is reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Statistical analyses were performed with Graphpad Prism10 v.10.2.1 (Perkin Elmer). Comparisons between groups were performed after analysis of distribution using the D\u0026rsquo;Agostino \u0026amp; Pearson omnibus test or the Shapiro-Wilk normality test, depending on sample size. Two-tailed unpaired t-test was used for groups with normal distribution and equal variance, whereas Welch\u0026rsquo;s t-test was used for groups with normal distribution and unequal variance. When the groups do not have a normal distribution, the Mann Whitney test was used. Comparisons among multiple groups were done with one-way ANOVA with specific post-hoc test. In the figure legends, n stands for the number of biological replicates. Statistical significance was assessed with a 95% confidence interval.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003ch2\u003eData availability \u003c/h2\u003e\n\u003cp\u003eThe single-cell RNA-seq data is deposited at GEO (record GSE278960,\u0026nbsp;https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE278960).\u0026nbsp;Access for reviewers is provided with the token \u0026ldquo;edknwueilnojlun\u0026rdquo;.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eCode availability \u003c/h2\u003e\n\u003cp\u003eCustom code for scRNA-seq analysis, based on existing packages and own contributions, is available at\u0026nbsp;https://keeper.mpdl.mpg.de/d/48ad2fd8170a459982c8/. Access for reviewers is provided with the token \u0026ldquo;HzMhkB46WBDlBeZG\u0026rdquo;.\u003c/p\u003e\n\u003cp\u003eThis study did not generate new unique reagents. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Prof. Dr. Ralf H. Adams ([email protected]).\u003c/p\u003e\n\u003ch2\u003eAcknowledgments\u003c/h2\u003e\n\u003cp\u003eWe are grateful to the following Service Units of the Max Planck Institute for Molecular Biomedicine (MPI-BM, M\u0026uuml;nster, Germany): Animal Facility, Flow Cytometry, BioOptic Service, Sequencing and Bioinformatics. We thank Dr. Stefan Volkery and Dr. Nils Kirschnick (MPI-BM) for their technical support during light sheet microscopy and Anja Michelbach from the group of Prof. Dr. Sara Wickstr\u0026ouml;m (MPI-BM) for the G-actin:F-actin assay protocol. We also thank Vinayak Sivaramakrishnan (Tissue Morphogenesis Department, MPI-BM) for illustration.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe study was supported by the Max Planck Society (R.H.A.), the European Research Council (AdG 101139772, PROTECT; R.H.A.), the DFG (CRC 1366, project no. 394046768; R.H.A.), and the Cells in Motion (CiM) graduate school (A.S.).\u003c/p\u003e\n\u003ch2\u003eAuthor Contributions\u003c/h2\u003e\n\u003cp\u003eA.S., R.D.H. and R.H.A. designed the study. A.S. performed the majority of the experiments. H.A. and R.D.H. performed some of the experiments. K.K performed the bioinformatic transcriptomic analysis and wrote the corresponding methods. R.D.H supervised A.S. during the study. A.S., R.D.H. and R.H.A. wrote the manuscript.\u003c/p\u003e\n\u003ch2\u003eDisclosures\u003c/h2\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCoulie J, Boon L, Vikkula M (2022) Molecular pathways and possible therapies for head and neck vascular anomalies. J Oral Pathol Med 51:878\u0026ndash;887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jop.13318\u003c/span\u003e\u003cspan address=\"10.1111/jop.13318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeront E, Hermans C, Boon LM, Vikkula M (2024) Targeted treatments for vascular malformations: current state of the art. J Thromb Haemost. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jtha.2024.07.013\u003c/span\u003e\u003cspan address=\"10.1016/j.jtha.2024.07.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCetinkaya A et al (2016) Loss-of-Function Mutations in ELMO2 Cause Intraosseous Vascular Malformation by Impeding RAC1 Signaling. Am J Hum Genet 99:299\u0026ndash;317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ajhg.2016.06.008\u003c/span\u003e\u003cspan address=\"10.1016/j.ajhg.2016.06.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargel I et al (2002) Hereditary intraosseous vascular malformation of the craniofacial region: an apparently novel disorder. Am J Med Genet 109:22\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ajmg.10282\u003c/span\u003e\u003cspan address=\"10.1002/ajmg.10282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargel I, Cil BE, Kiratli P, Akinci D, Erk Y (2004) Hereditary intraosseous vascular malformation of the craniofacial region: imaging findings. Br J Radiol 77:197\u0026ndash;203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1259/bjr/88438282\u003c/span\u003e\u003cspan address=\"10.1259/bjr/88438282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWerdich XQ, Jakobiec FA, Curtin HD, Fay A (2014) A clinical, radiologic, and immunopathologic study of five periorbital intraosseous cavernous vascular malformations. \u003cem\u003eAm J Ophthalmol\u003c/em\u003e 158, 816\u0026ndash;826 e811 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ajo.2014.07.004\u003c/span\u003e\u003cspan address=\"10.1016/j.ajo.2014.07.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu H et al (2021) Vascular Smooth Muscle Cells in Aortic Aneurysm: From Genetics to Mechanisms. J Am Heart Assoc 10:e023601. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/JAHA.121.023601\u003c/span\u003e\u003cspan address=\"10.1161/JAHA.121.023601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertino F, Trofimova AV, Gilyard SN, Hawkins CM (2021) Vascular anomalies of the head and neck: diagnosis and treatment. Pediatr Radiol 51:1162\u0026ndash;1184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00247-021-04968-2\u003c/span\u003e\u003cspan address=\"10.1007/s00247-021-04968-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePersky MS, Yoo HJ, Berenstein A (2003) Management of vascular malformations of the mandible and maxilla. Laryngoscope 113:1885\u0026ndash;1892. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/00005537-200311000-00005\u003c/span\u003e\u003cspan address=\"10.1097/00005537-200311000-00005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Jin T (2019) ELMO proteins transduce G protein-coupled receptor signal to control reorganization of actin cytoskeleton in chemotaxis of eukaryotic cells. Small GTPases 10:271\u0026ndash;279. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/21541248.2017.1318816\u003c/span\u003e\u003cspan address=\"10.1080/21541248.2017.1318816\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEast MP, Bowzard JB, Dacks JB, Kahn RA (2012) ELMO domains, evolutionary and functional characterization of a novel GTPase-activating protein (GAP) domain for Arf protein family GTPases. J Biol Chem 287:39538\u0026ndash;39553. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M112.417477\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M112.417477\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatel M et al (2010) An evolutionarily conserved autoinhibitory molecular switch in ELMO proteins regulates Rac signaling. Curr Biol 20:2021\u0026ndash;2027. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2010.10.028\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2010.10.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElliott MR et al (2010) Unexpected requirement for ELMO1 in clearance of apoptotic germ cells in vivo. Nature 467:333\u0026ndash;337. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature09356\u003c/span\u003e\u003cspan address=\"10.1038/nature09356\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGumienny TL et al (2001) CED-12/ELMO, a novel member of the CrkII/Dock180/Rac pathway, is required for phagocytosis and cell migration. Cell 107:27\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0092-8674(01)00520-7\u003c/span\u003e\u003cspan address=\"10.1016/s0092-8674(01)00520-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHo E, Dagnino L (2012) Emerging role of ILK and ELMO2 in the integration of adhesion and migration pathways. Cell Adh Migr 6:168\u0026ndash;172. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/cam.20399\u003c/span\u003e\u003cspan address=\"10.4161/cam.20399\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHo E et al (2009) Integrin-linked kinase interactions with ELMO2 modulate cell polarity. Mol Biol Cell 20:3033\u0026ndash;3043. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1091/mbc.e09-01-0050\u003c/span\u003e\u003cspan address=\"10.1091/mbc.e09-01-0050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJackson BC, Ivanova IA, Dagnino L (2015) An ELMO2-RhoG-ILK network modulates microtubule dynamics. Mol Biol Cell 26:2712\u0026ndash;2725. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1091/mbc.E14-10-1444\u003c/span\u003e\u003cspan address=\"10.1091/mbc.E14-10-1444\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbu-Thuraia A et al (2015) Axl phosphorylates Elmo scaffold proteins to promote Rac activation and cell invasion. Mol Cell Biol 35:76\u0026ndash;87. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/MCB.00764-14\u003c/span\u003e\u003cspan address=\"10.1128/MCB.00764-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran V et al (2022) Biasing the conformation of ELMO2 reveals that myoblast fusion can be exploited to improve muscle regeneration. Nat Commun 13:7077. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-022-34806-4\u003c/span\u003e\u003cspan address=\"10.1038/s41467-022-34806-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoland A, Cote JF, Barford D (2023) Structural biology of DOCK-family guanine nucleotide exchange factors. FEBS Lett 597:794\u0026ndash;810. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/1873-3468.14523\u003c/span\u003e\u003cspan address=\"10.1002/1873-3468.14523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen HJ et al (2006) The role of microtubule actin cross-linking factor 1 (MACF1) in the Wnt signaling pathway. Genes Dev 20:1933\u0026ndash;1945. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gad.1411206\u003c/span\u003e\u003cspan address=\"10.1101/gad.1411206\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalem D, Fecek RJ (2023) Role of microtubule actin crosslinking factor 1 (MACF1) in bipolar disorder pathophysiology and potential in lithium therapeutic mechanism. Transl Psychiatry 13:221. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41398-023-02483-6\u003c/span\u003e\u003cspan address=\"10.1038/s41398-023-02483-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHo E, Ivanova IA, Dagnino L (2016) Integrin-linked kinase and ELMO2 modulate recycling endosomes in keratinocytes. Biochim Biophys Acta 1863:2892\u0026ndash;2904. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbamcr.2016.09.007\u003c/span\u003e\u003cspan address=\"10.1016/j.bbamcr.2016.09.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMargaron Y, Fradet N, Cote JF (2013) ELMO recruits actin cross-linking family 7 (ACF7) at the cell membrane for microtubule capture and stabilization of cellular protrusions. J Biol Chem 288:1184\u0026ndash;1199. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M112.431825\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M112.431825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamoud N, Tran V, Croteau LP, Kania A, Cote J (2014) F. G-protein coupled receptor BAI3 promotes myoblast fusion in vertebrates. Proc Natl Acad Sci U S A 111:3745\u0026ndash;3750. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1313886111\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1313886111\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakihara S et al (2018) Polarized Dock Activity Drives Shh-Mediated Axon Guidance. \u003cem\u003eDev Cell\u003c/em\u003e 46, 410\u0026ndash;425 e417 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.devcel.2018.07.007\u003c/span\u003e\u003cspan address=\"10.1016/j.devcel.2018.07.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArnold TD, Zang K, Vallejo-Illarramendi A (2013) Deletion of integrin-linked kinase from neural crest cells in mice results in aortic aneurysms and embryonic lethality. Dis Model Mech 6:1205\u0026ndash;1212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dmm.011866\u003c/span\u003e\u003cspan address=\"10.1242/dmm.011866\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang D et al (2014) Mesodermal expression of integrin alpha5beta1 regulates neural crest development and cardiovascular morphogenesis. Dev Biol 395:232\u0026ndash;244. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ydbio.2014.09.014\u003c/span\u003e\u003cspan address=\"10.1016/j.ydbio.2014.09.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorioka T et al (2014) An important role of endothelial hairy-related transcription factors in mouse vascular development. Genesis 52:897\u0026ndash;906. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/dvg.22825\u003c/span\u003e\u003cspan address=\"10.1002/dvg.22825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen D et al (2011) Aortic aneurysm generation in mice with targeted deletion of integrin-linked kinase in vascular smooth muscle cells. Circ Res 109:616\u0026ndash;628. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCRESAHA.110.239343\u003c/span\u003e\u003cspan address=\"10.1161/CIRCRESAHA.110.239343\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas PS, Kim J, Nunez S, Glogauer M, Kaartinen V (2010) Neural crest cell-specific deletion of Rac1 results in defective cell-matrix interactions and severe craniofacial and cardiovascular malformations. Dev Biol 340:613\u0026ndash;625. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ydbio.2010.02.021\u003c/span\u003e\u003cspan address=\"10.1016/j.ydbio.2010.02.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurlo KA et al (2012) An essential requirement for beta1 integrin in the assembly of extracellular matrix proteins within the vascular wall. Dev Biol 365:23\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ydbio.2012.01.027\u003c/span\u003e\u003cspan address=\"10.1016/j.ydbio.2012.01.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Damme A, Seront E, Dekeuleneer V, Boon LM, Vikkula M (2020) New and Emerging Targeted Therapies for Vascular Malformations. Am J Clin Dermatol 21:657\u0026ndash;668. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s40257-020-00528-w\u003c/span\u003e\u003cspan address=\"10.1007/s40257-020-00528-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen HL, Boon LM, Vikkula M (2017) Vascular Anomalies Caused by Abnormal Signaling within Endothelial Cells: Targets for Novel Therapies. Semin Intervent Radiol 34:233\u0026ndash;238. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1055/s-0037-1604296\u003c/span\u003e\u003cspan address=\"10.1055/s-0037-1604296\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrahmbhatt AN, Skalski KA, Bhatt AA (2020) Vascular lesions of the head and neck: an update on classification and imaging review. Insights Imaging 11:19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13244-019-0818-3\u003c/span\u003e\u003cspan address=\"10.1186/s13244-019-0818-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiruma T, Nakajima Y, Nakamura H (2002) Development of pharyngeal arch arteries in early mouse embryo. J Anat 201:15\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1469-7580.2002.00071.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1469-7580.2002.00071.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEtchevers HC, Vincent C, Le Douarin NM, Couly GF (2001) The cephalic neural crest provides pericytes and smooth muscle cells to all blood vessels of the face and forebrain. Development 128:1059\u0026ndash;1068. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.128.7.1059\u003c/span\u003e\u003cspan address=\"10.1242/dev.128.7.1059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnderson RH, Bamforth SD (2022) Morphogenesis of the Mammalian Aortic Arch Arteries. Front Cell Dev Biol 10:892900. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2022.892900\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2022.892900\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArima Y et al (2012) Preotic neural crest cells contribute to coronary artery smooth muscle involving endothelin signalling. Nat Commun 3:1267. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ncomms2258\u003c/span\u003e\u003cspan address=\"10.1038/ncomms2258\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrozovich FV et al (2016) Mechanisms of Vascular Smooth Muscle Contraction and the Basis for Pharmacologic Treatment of Smooth Muscle Disorders. Pharmacol Rev 68:476\u0026ndash;532. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1124/pr.115.010652\u003c/span\u003e\u003cspan address=\"10.1124/pr.115.010652\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang YL et al (2008) Epidermal growth factor up-regulates the expression of nestin through the Ras-Raf-ERK signaling axis in rat vascular smooth muscle cells. Biochem Biophys Res Commun 377:361\u0026ndash;366. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2008.09.143\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2008.09.143\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDonadon M, Santoro MM (2021) The origin and mechanisms of smooth muscle cell development in vertebrates. Development 148. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.197384\u003c/span\u003e\u003cspan address=\"10.1242/dev.197384\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSinha S, Iyer D, Granata A (2014) Embryonic origins of human vascular smooth muscle cells: implications for in vitro modeling and clinical application. Cell Mol Life Sci 71:2271\u0026ndash;2288. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00018-013-1554-3\u003c/span\u003e\u003cspan address=\"10.1007/s00018-013-1554-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLallemand Y, Luria V, Haffner-Krausz R, Lonai P (1998) Maternally expressed PGK-Cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res 7:105\u0026ndash;112. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/a:1008868325009\u003c/span\u003e\u003cspan address=\"10.1023/a:1008868325009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoni PA et al (2001) Conditional vascular cell adhesion molecule 1 deletion in mice: impaired lymphocyte migration to bone marrow. J Exp Med 193:741\u0026ndash;754. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1084/jem.193.6.741\u003c/span\u003e\u003cspan address=\"10.1084/jem.193.6.741\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuzumdar MD, Tasic B, Miyamichi K, Li L, Luo L (2007) A global double-fluorescent Cre reporter mouse. Genesis 45:593\u0026ndash;605. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/dvg.20335\u003c/span\u003e\u003cspan address=\"10.1002/dvg.20335\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoltwick R et al (2002) Smooth muscle-selective deletion of guanylyl cyclase-A prevents the acute but not chronic effects of ANP on blood pressure. Proc Natl Acad Sci U S A 99:7142\u0026ndash;7147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.102650499\u003c/span\u003e\u003cspan address=\"10.1073/pnas.102650499\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM (2000) Fate of the mammalian cardiac neural crest. Development 127:1607\u0026ndash;1616. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.127.8.1607\u003c/span\u003e\u003cspan address=\"10.1242/dev.127.8.1607\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewis AE, Vasudevan HN, O'Neill AK, Soriano P, Bush JO (2013) The widely used Wnt1-Cre transgene causes developmental phenotypes by ectopic activation of Wnt signaling. Dev Biol 379:229\u0026ndash;234. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ydbio.2013.04.026\u003c/span\u003e\u003cspan address=\"10.1016/j.ydbio.2013.04.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruno RM et al (2012) Sympathetic regulation of vascular function in health and disease. Front Physiol 3:284. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2012.00284\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2012.00284\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLindeberg J et al (2004) Transgenic expression of Cre recombinase from the tyrosine hydroxylase locus. Genesis 40:67\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/gene.20065\u003c/span\u003e\u003cspan address=\"10.1002/gene.20065\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMajesky MW (2007) Developmental basis of vascular smooth muscle diversity. Arterioscler Thromb Vasc Biol 27:1248\u0026ndash;1258. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/ATVBAHA.107.141069\u003c/span\u003e\u003cspan address=\"10.1161/ATVBAHA.107.141069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinsen A, Dessy C, Morel N (2014) Regulation of calcium channels in smooth muscle: new insights into the role of myosin light chain kinase. Channels (Austin) 8:402\u0026ndash;413. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/19336950.2014.950537\u003c/span\u003e\u003cspan address=\"10.4161/19336950.2014.950537\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBubb MR, Senderowicz AMJ, Sausville EA, Duncan KLK, Korn ED (1994) Jasplakinolide, a Cytotoxic Natural Product, Induces Actin Polymerization and Competitively Inhibits the Binding of Phalloidin to F-Actin. J Biol Chem 269:14869\u0026ndash;14871\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVentura A et al (2007) Restoration of p53 function leads to tumour regression in vivo. Nature 445:661\u0026ndash;665. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature05541\u003c/span\u003e\u003cspan address=\"10.1038/nature05541\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrimsley CM et al (2004) Dock180 and ELMO1 proteins cooperate to promote evolutionarily conserved Rac-dependent cell migration. J Biol Chem 279:6087\u0026ndash;6097. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M307087200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M307087200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReddien PW, Horvitz HR (2000) CED-2/CrkII and CED-10/Rac control phagocytosis and cell migration in Caenorhabditis elegans. Nat Cell Biol 2:131\u0026ndash;136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/35004000\u003c/span\u003e\u003cspan address=\"10.1038/35004000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu YC, Tsai MC, Cheng LC, Chou CJ, Weng NY (2001) C. elegans CED-12 acts in the conserved crkII/DOCK180/Rac pathway to control cell migration and cell corpse engulfment. Dev Cell 1:491\u0026ndash;502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s1534-5807(01)00056-9\u003c/span\u003e\u003cspan address=\"10.1016/s1534-5807(01)00056-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Z, Caron E, Hartwieg E, Hall A, Horvitz HR (2001) The C. elegans PH domain protein CED-12 regulates cytoskeletal reorganization via a Rho/Rac GTPase signaling pathway. Dev Cell 1:477\u0026ndash;489. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s1534-5807(01)00058-2\u003c/span\u003e\u003cspan address=\"10.1016/s1534-5807(01)00058-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToret CP, Collins C, Nelson WJ (2014) An Elmo-Dock complex locally controls Rho GTPases and actin remodeling during cadherin-mediated adhesion. J Cell Biol 207:577\u0026ndash;587. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1083/jcb.201406135\u003c/span\u003e\u003cspan address=\"10.1083/jcb.201406135\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrugnera E et al (2002) Unconventional Rac-GEF activity is mediated through the Dock180-ELMO complex. Nat Cell Biol 4:574\u0026ndash;582. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ncb824\u003c/span\u003e\u003cspan address=\"10.1038/ncb824\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang L et al (2020) Structure of the DOCK2-ELMO1 complex provides insights into regulation of the auto-inhibited state. Nat Commun 11:3464. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-020-17271-9\u003c/span\u003e\u003cspan address=\"10.1038/s41467-020-17271-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRival CM et al (2019) Phosphatidylserine on viable sperm and phagocytic machinery in oocytes regulate mammalian fertilization. Nat Commun 10:4456. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-019-12406-z\u003c/span\u003e\u003cspan address=\"10.1038/s41467-019-12406-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai X et al (2013) Requirement for integrin-linked kinase in neural crest migration and differentiation and outflow tract morphogenesis. BMC Biol 11:107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1741-7007-11-107\u003c/span\u003e\u003cspan address=\"10.1186/1741-7007-11-107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X et al (2017) Endothelium in the pharyngeal arches 3, 4 and 6 is derived from the second heart field. Dev Biol 421:108\u0026ndash;117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ydbio.2016.12.010\u003c/span\u003e\u003cspan address=\"10.1016/j.ydbio.2016.12.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiao J et al (2016) Differentiation defect in neural crest-derived smooth muscle cells in patients with aortopathy associated with bicuspid aortic valves. EBioMedicine 10:282\u0026ndash;290. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ebiom.2016.06.045\u003c/span\u003e\u003cspan address=\"10.1016/j.ebiom.2016.06.045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J et al (2005) Myocardin-related transcription factor B is required in cardiac neural crest for smooth muscle differentiation and cardiovascular development. Proc Natl Acad Sci U S A 102:8916\u0026ndash;8921. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0503741102\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0503741102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie WB et al (2013) Smad2 and myocardin-related transcription factor B cooperatively regulate vascular smooth muscle differentiation from neural crest cells. Circ Res 113:e76\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCRESAHA.113.301921\u003c/span\u003e\u003cspan address=\"10.1161/CIRCRESAHA.113.301921\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLindsey SE, Butcher JT, Vignon-Clementel IE (2018) Cohort-based multiscale analysis of hemodynamic-driven growth and remodeling of the embryonic pharyngeal arch arteries. Development 145. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.162578\u003c/span\u003e\u003cspan address=\"10.1242/dev.162578\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrosso A et al (2023) VEGF dose controls the coupling of angiogenesis and osteogenesis in engineered bone. NPJ Regen Med 8:15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41536-023-00288-1\u003c/span\u003e\u003cspan address=\"10.1038/s41536-023-00288-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Olsen BR (2014) Distinct VEGF functions during bone development and homeostasis. Arch Immunol Ther Exp (Warsz) 62:363\u0026ndash;368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00005-014-0285-y\u003c/span\u003e\u003cspan address=\"10.1007/s00005-014-0285-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargel I, Calis M, Canter HI, Cil BE (2019) Clinical and Molecular Study of ELMO-2-Related Massive Intraosseous Vascular Malformations: Lessons Learned From 25 Years of Follow-up. Ann Plast Surg 83:293\u0026ndash;299. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/SAP.0000000000001786\u003c/span\u003e\u003cspan address=\"10.1097/SAP.0000000000001786\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenier N et al (2014) iDISCO: a simple, rapid method to immunolabel large tissue samples for volume imaging. Cell 159:896\u0026ndash;910. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2014.10.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2014.10.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDobin A et al (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29:15\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/bts635\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/bts635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVirshup I, Rybakov S, Theis FJ, Angerer P, Wolf FA (2024) anndata: Access and store annotated data matrices. J Open Source Softw 9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolock SL, Lopez R, Klein AM, Scrublet (2019) Computational Identification of Cell Doublets in Single-Cell Transcriptomic Data. \u003cem\u003eCell Syst\u003c/em\u003e 8, 281\u0026ndash;291 e289 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cels.2018.11.005\u003c/span\u003e\u003cspan address=\"10.1016/j.cels.2018.11.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLun AT, Bach K, Marioni JC (2016) Pooling across cells to normalize single-cell RNA sequencing data with many zero counts. Genome Biol 17:75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13059-016-0947-7\u003c/span\u003e\u003cspan address=\"10.1186/s13059-016-0947-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTraag VA, Waltman L, van Eck NJ (2019) From Louvain to Leiden: guaranteeing well-connected communities. Sci Rep 9:5233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-019-41695-z\u003c/span\u003e\u003cspan address=\"10.1038/s41598-019-41695-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTirosh I et al (2016) Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 352:189\u0026ndash;196. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aad0501\u003c/span\u003e\u003cspan address=\"10.1126/science.aad0501\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolf FA, Angerer P, Theis FJ (2018) SCANPY: large-scale single-cell gene expression data analysis. Genome Biol 19:15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13059-017-1382-0\u003c/span\u003e\u003cspan address=\"10.1186/s13059-017-1382-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorsunsky I et al (2019) Fast, sensitive and accurate integration of single-cell data with Harmony. Nat Methods 16:1289\u0026ndash;1296. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41592-019-0619-0\u003c/span\u003e\u003cspan address=\"10.1038/s41592-019-0619-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcInnes L, Healy J, Saul N, Gro\u0026szlig;berger L (2018) UMAP: Uniform Manifold Approximation and Projection. J Open Source Softw 3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHunter JD, Matplotlib (2007) A 2D Graphics Environment. Comput Sci Eng 9:90\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1109/MCSE.2007.55\u003c/span\u003e\u003cspan address=\"10.1109/MCSE.2007.55\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe HQ et al (2016) Mechanical regulation of transcription controls Polycomb-mediated gene silencing during lineage commitment. Nat Cell Biol 18:864\u0026ndash;875. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ncb3387\u003c/span\u003e\u003cspan address=\"10.1038/ncb3387\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"ELMO2, common carotid artery development, vascular malformations, embryonic lethality, rare human disease","lastPublishedDoi":"10.21203/rs.3.rs-5362441/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5362441/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEngulfment and cell motility 2 (ELMO2) is a cytoskeletal adaptor protein necessary for cell migration and apoptotic cell removal. Loss-of-function mutations in \u003cem\u003eELMO2\u003c/em\u003e cause intraosseous vascular malformation (VMOS), a human disease involving progressive expansion of craniofacial bones in combination with anomalies in blood vessels that emerge from the external carotid artery, as well as aneurysms in the internal carotid artery. Here we show that global inactivation of \u003cem\u003eElmo2\u003c/em\u003e in mice leads to midgestation embryonic lethality due to dilation of the 3rd pharyngeal arch arteries and aneurysm formation in the common carotids. These vascular malformations are associated to defects in vascular smooth muscle cell organization and are phenocopied upon neural crest-specific deletion. \u003cem\u003eIn vitro\u003c/em\u003e experiments further confirm that ELMO2 regulates vascular smooth muscle cell adhesion, spreading and contractility through Rac1 activation and modulation of actin dynamics. Our findings provide new insights into the biological function of ELMO2 with relevant implications for understanding VMOS pathogenesis and raise the possibility of vessel-targeted diagnostic and treatment strategies.\u003c/p\u003e","manuscriptTitle":"ELMO2 is an essential regulator of carotid artery development","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-04 07:28:08","doi":"10.21203/rs.3.rs-5362441/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"048969bd-40ad-4909-976a-338e2e512f52","owner":[],"postedDate":"November 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":39715227,"name":"Biological sciences/Developmental biology/Angiogenesis"},{"id":39715228,"name":"Biological sciences/Developmental biology/Embryogenesis"},{"id":39715229,"name":"Biological sciences/Developmental biology/Experimental organisms/Model vertebrates/Mouse"}],"tags":[],"updatedAt":"2025-06-03T07:09:25+00:00","versionOfRecord":{"articleIdentity":"rs-5362441","link":"https://doi.org/10.1038/s41467-025-60105-9","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2025-06-02 04:00:00","publishedOnDateReadable":"June 2nd, 2025"},"versionCreatedAt":"2024-11-04 07:28:08","video":"","vorDoi":"10.1038/s41467-025-60105-9","vorDoiUrl":"https://doi.org/10.1038/s41467-025-60105-9","workflowStages":[]},"version":"v1","identity":"rs-5362441","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5362441","identity":"rs-5362441","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}