Effect of Resveratrol on PI3K/Akt/GSK-3β Pathway and Metalloproteases in Differentiated and Aβ-Induced Alzheimer's Model Neuroblastoma Cells

Effect of Resveratrol on PI3K/Akt/GSK-3β Pathway and Metalloproteases in Differentiated and Aβ-Induced Alzheimer's Model Neuroblastoma Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect of Resveratrol on PI3K/Akt/GSK-3β Pathway and Metalloproteases in Differentiated and Aβ-Induced Alzheimer's Model Neuroblastoma Cells Lütfiye Özpak, Bakiye Göker Bağca This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4138036/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose To analyze the expressional changes in the PI3K/Akt/GSK-3β pathway and metalloprotease in the cellular AD model with the effect of antioxidant resveratrol. Methods We obtained neuron-like cells by a two-step method of neuronal differentiation by using a combination of retinoic acid (RA) and brain-derived factor (BDNF) exposure. Then, the application of the Aβ25–35 protein (10 µM) to the cell culture mimicked the environmental toxicity observed in Alzheimer's disease. Afterward, cell viability and apoptosis assays were performed to determine whether the resveratrol exerts a cytotoxic and apoptotic effect. Finally, we analyzed with Real-Time PCR, the expressional changes in genes in the cellular AD model with the effect of resveratrol. Results Apoptosis data findings were decreased by 1.5-fold and 2.5-fold respectively by differentiated + RES and RES when compared to control but no significant difference was observed between resveratrol and AD model groups. Real-time PCR analysis results revealed PI3K (3.38-fold), AKT (3.95-fold), and RELN (1.99-fold) expressions were significantly higher (p < 0.001), and also GSK-3β, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 gene expression levels were significantly downregulated (2.53-, 1.79-, 2.85-, 4.09-, and 6.62- fold, respectively) in the differentiated + Aβ + RES groups compared to the differentiated + Aβ group (p < 0.001). Conclusion Resveratrol has inhibited GSK-3β by activating the PI3K/Akt insulin pathway in a neurotoxic environment. In addition, TAU, RELN, metalloproteases, and their inhibitors associated with Alzheimer's pathology have been regulated supporting the neuroprotective effect of resveratrol. Alzheimer’s disease neurotoxicity resveratrol PI3K/Akt/GSK-3β pathway TAU ADAMTS Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Alzheimer's disease is a neurodegenerative disorder characterized by progressive cognitive function impairment which most common type of dementia. Due to being a multifactorial and polygenic disease, the pathophysiological process of the disease still harbors many puzzles. This situation complicates the development of preventive treatment methods and increases the global burden of the disease (Lane et al. 2018 ; Scheltens et al. 2021 ) Widespread extracellular plaques (amyloid β) and intracellular neurofibrillary tangles (hyperphosphorylated tau protein) are the hallmark features of the disease. Also, additional findings include a reactive microglial response, extensive loss of neurons, white matter, and synapses (Reitz&Mayeux 2014 ). In recent years, research has indicated the presence of common pathophysiological mechanisms, such as neuroinflammation, insulin resistance, oxidative stress, and mitochondrial dysfunction, in Alzheimer's disease and Type 2 diabetes. Impairment in brain insulin signaling and the progressive state of brain insulin resistance triggered by this is called type 3 diabetes by researchers (Michailidis et al. 2022 ). The PI3-Akt (phosphatidylinositol-4,5-bisphosphate 3-kinase/Akt) signaling pathway, which plays a crucial role in cellular homeostasis and memory processes, has been identified as a significant therapeutic target in the treatment of Alzheimer's disease by inhibiting neurotoxic processes (Kumar&Bansal 2022 ). Glycogen synthase kinase-3β (GSK3-β) is a kinase involved in tau phosphorylation and downstream molecules of the PI3K-Akt pathway. GSK3-β contributes to the pathology of Alzheimer's by not only tau hyperphosphorylation but also the formation of amyloid plaques (Sandhir&Gupta 2015 ). Reelin (RELN) is involved in neuronal functions related to memory and learning (Yu et al. 2016 ). A disintegrin and metalloproteinase with thrombospondin motifs-4 (ADAMTS-4), which can cleave the reelin polypeptide encoded by RELN, is associated with the formation of neurofibrillary tangles (Yamakage et al. 2019 ). ADAMTS-4 and ADAMTS-5 proteolytic activities are regulated by the endogenous tissue inhibitor of metalloproteases-3 (TIMP-3) (Turner et al. 2012 ). Resveratrol (trans-3, 4′, 5-trihydroxystilbene) is a type of polyphenol obtained from the seed of grapes and grapes products, possessing antioxidant properties. It has been demonstrated to provide neuroprotection against Alzheimer's disease, although its therapeutic potential is still under investigation (Rahman et al. 2020 ). There is no report of the action of resveratrol against Alzheimer's pathology via modulation of the PI3K/Akt/GSK3-β pathway. Hence, we aimed to evaluate the effect of resveratrol through the PI3K/Akt/GSK3-β pathway in the differentiated SH-SY5Y cell line as potential anti-Alzheimer drug candidates in AD therapy. We designed the two-step method of neuronal differentiation through a combination of retinoic acid (RA) with brain derivate factor (BDNF) exposure. Following that, the application of the Aβ25–35 protein to the cell culture mimicked the environmental toxicity observed in Alzheimer's disease. Afterward, we analyzed the expressional changes in PI3K, Akt, GSK-3β, RELN, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 genes in the cellular AD model with the effect of antioxidant resveratrol. Materials and Methods Chemicals and Reagents Resveratrol was obtained from thermo-scientific chemicals (Fisher Scientific, UK). β-Amyloid (25–35) was from Genscript Inc. RA was supplied by Sigma-Aldrich (St. Louis, MO). BDNF was purchased from MedChemExpress (Monmouth Junction, NJ, USA). Thiazolyl Blue Tetrazolium Bromide (MTT) was obtained from Goldbiotechnology. All other chemicals and kits were purchased from Sigma and Gibco. Culturing and Differentiating of SH-SY5Y Cells SH-SY5Y cells (neuroblastoma cell line) were obtained from Dr. Gizem Donmez Yalcın (Adnan Menderes University, Turkey) and were cultured in a passage lower than 100. Neuroblastoma cells were grown in DMEM including 10% FBS, 100 µg/ml penicillin/streptomycin, and 2mM L-glutamine at 37°C incubator with 5% CO 2 . After the cultures reached 80% confluence, the cells were detached from the flask’s surface using trypsin solution and then seeded to 6-wells of poly-L-lysine-coated plates at 10 4 cells/cm 2 density. SH-SY5Y cells, derived from neuroblastoma, are often induced to differentiate using all-trans RA to acquire more neuron-like properties, such as neurite outgrowth and morphological changes (Cheung et al 2009 ). RA (10 µM) was added to the media and incubated for 7 days to initiate neuronal differentiation. Subsequently, the cultures were enriched with BDNF (25 nM), and additional was incubated for 3 days to finalize cellular differentiation (Cheung et al. 2009 ; Turkez et al. 2020 ; Turkez et al. 2021 ; Arslan et al. 2021 ). The differentiated neuronal cells were determined using an inverted microscope. Preparation of β-Amyloid and Cell Treatment The Aβ25–35 is the C-terminal peptide of Aβ1–42, and it is frequently preferred in vitro experimental setups for Alzheimer's disease (Calan et. al. 2016 ). Aβ25–35 stock solution was prepared in ultra-pure water and stored at -20 o C. In the Aβ25–35 groups, Aβ25–35 with a final concentration of 20 µM was added to the six wells plates as described in the previous study. (Zhang et al. 2014 ). Because approximately 50% cell death was observed at 24 h and 20 µM dose. Non-treated differentiated cell culture was used for the negative control. All experiments were conducted with three replications. Treatment and Cell Viability Cells were plated in 96-well culture plates at a density of 1 × 10 4 cells/well for the MTT assay. The cells were then treated with varying concentrations of resveratrol (1, 5, 25, 50, 75, and 100 µM) for 24 hours to evaluate the impact of resveratrol dosage on cell viability. Following the 24-hour incubation period, the medium was aspirated from each well, and 10 µL of 5 mg/mL MTT solution was added to each well. The plate was then incubated for 4 hours at 37°C. Afterward, the MTT solution was discarded, and DMSO was added to each well for 15 minutes. The optical density was measured at 570 nm using a microplate reader. In the groups treated with resveratrol, a final concentration of 50 µM resveratrol was added to the wells of the six-well plates. FITC Annexin V Assay The apoptotic effects of resveratrol, Aβ, and the combination were detected using the FITC Annexin V kit (BD Biosciences) and BD Accuri C6 flow cytometer. Apoptotic effects of resveratrol on SH-SY5Y cells were analyzed by a commercial kit Annexin V according to the protocol of the manufacturer. The apoptotic status of SH-SY5Y cells treated with 50 µM of resveratrol was analyzed by flow cytometry. SH-SY5Y cells were plated at a concentration of 3 × 10 5 cells/3 ml per well in 6-well culture plates and incubated for 24 hours. Afterward, the cells were subjected to treatment with resveratrol and Aβ for an additional 24-hour period. Upon completion of the incubation, the culture medium was removed, and the cells were detached using trypsin, followed by centrifugation at 1500 rpm for 5 minutes. After removing the supernatant, the pellet was washed twice with PBS and then suspended in 500 µl of 1 × Annexin binding buffer. Subsequently, 5 µl each of PI and Annexin V-FITC solutions were added to every group. The percentages of apoptotic and living cells in all groups were assessed using the FL1 and FL2 channels of the BD Accuri C6 flow cytometer, along with its associated software. Gene Expression Analysis by Real-Time PCR The expression levels of PI3K/Akt/GSK3-β pathway and metalloproteinase as a role of neuronal function-related genes were determined by 50 µM doses of resveratrol treatment at the 24th hour on differentiated and Aβ exposed SH-SY5Y neuroblastoma cells and according to the control group. To evaluate the expression of PI3K, Akt, GSK3-β, RELN, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 real-time PCR was performed. Total RNA was isolated using a TRI reagent according to the manufacturer’s instructions. The isolated RNA was quantified using NanoDrop 8000 (Thermo Fisher, USA) at an absorbance wavelength of 260 nm to determine the concentration. The purity of the total RNA was assessed by measuring the absorbance ratios at 260/280 nm, with appropriate ratios around 2.0 and above 1.8, respectively. Random hexamer primers and the High-Capacity cDNA Reverse Transcription Kit were used to synthesize cDNA from extracted RNA samples. Quantitative SYBR green PCR was performed using 1 µl of cDNA, specific primers (Table 1 ), with Promega GoTaq® qPCR Master Mix (SYBR, catalog. no: A6001). For normalization, the endogenous control β-actin was utilized, and relative expression was calculated using the 2 −ΔΔCt method. Each sample underwent three replicates, and the experiment was repeated a minimum of three times. Table 1 The sequence of the primer pairs was used in this study. Forward Primer (5′ -3′ ) Reverse Primer (5′ -3′ ) PI3K AGCTGGTCTTCGTTTCCTGA GAAACTTTTTCCCACCACGA Akt ACTCATTCCAGACCCACGAC CCGGTACACCACGTTCTTCT GSK3-β CCGACTAACACCACTGGAAGCT AGGATGGTAGCCAGAGGTGGAT RELN GTCTACCTTCCACTCTCCACCA GTCCAGCATCACAAATCCCTCG TAU CCAAGTGTGGCTCATTAGGCA CCAATCTTCGACTGGACTCTGT ADAMTS-4 TCACTGACTTCCTGGACAATGGC GGTCAGCATCATAGTCCTTGCC ADAMTS-5 CCTGGTCCAAATGCACTTCAGC TCGTAGGTCTGTCCTGGGAGTT TIMP-3 TACCGAGGCTTCACCAAGATGC CATCTTGCCATCATAGACGCGAC β-actin AACTGGGACGACATGGAGAA GAAGGTCTCAAACATGATCTGG Data Analysis and Statistics The experiments were conducted independently at least three times, and the data collected from these replicates were analyzed using standard deviations. Statistical analysis was performed using Student's t-test (comparison between two groups) or one-way analysis of variance (comparison between more than two groups) with significance set at p < 0.05. GraphPad (Prism 9) software was employed for data analysis. Results All-Trans RA Leads SH-SY5Y Cell Differentiation We demonstrated that the extension of neurites, and neuron-like cells was observed 48h after the application of RA. Notable alterations in cell morphology were detected through microscopic examinations (Fig. 1 ). The observations revealed enhanced cell-to-cell contact and communication between cells. High doses of resveratrol induce differentiated SH-SY5Y cell proliferation Our findings revealed that after 24 hours of resveratrol treatment, higher doses (50 µM) exhibited proliferative effects, while lower doses (5 µM) resulted in inhibition of cell viability by less than 50% (Fig. 2 ). Resveratrol (50 µM dose and 24th hour) decreased Aβ 25‑35 induced neurotoxicity in differentiated SH‑SY5Y cells. Resveratrol may not reduce apoptotic SH-SY5Y cell percentages The alteration in apoptosis across all application groups was found to be statistically significant (p < 0.01) compared to the control. Specifically, in the resveratrol group, there was a 1.4-fold decrease in apoptosis relative to the control (p < 0.001), while the Differentiated + Resveratrol group exhibited a 1.5-fold increase (p < 0.001), and the Differentiated group showed a 2.5-fold increase in apoptosis (Fig. 3 B). Although Resveratrol application to the Differentiated group decreased the percentage of apoptotic cells by 1.6 times, this difference was not significant (p = 0.8716). However, no significant difference in apoptosis was observed between resveratrol and AB-induced neurotoxic model groups. Moreover, it was unexpectedly observed that the level of apoptosis was reduced in the untreated AB-induced neurotoxic model groups. In addition, between application groups, no more than a 2-fold change in the percentage of lived cells was detected (Data is not shown). B. (A) Histograms represent the distribution of Annexin V-stained live and apoptotic cells under various conditions: (a) Control, (b) Resveratrol, (c) Differentiated + Aβ + Resveratrol, (d) Differentiated, (e) Differentiated + Resveratrol, and (f) Differentiated + Aβ. (B) Bar graphs present the percentages of live and apoptotic cells. The data are depicted as mean values ± standard error of the mean (SEM) from three independent experiments. (**p < 0.01, ***p < 0.0001.) Resveratrol regulates PI3K/Akt/GSK3-β Pathway and Metalloproteinase related gene expression in SH-SY5Y cells The relative ratio of changes in PI3K, AKT, RELN, GSK-3β, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 mRNA expressions between the groups is shown in Fig. 4 . Our Real-Time PCR analysis results revealed decreased expression of PI3K, AKT, and RELN mRNAs and increased expression of GSK-3β, TAU, ADAMTS-4, ADAMTS-5, TIMP-3 mRNAs in the differentiated, and induced neurotoxicity with Aβ 25–35 of the SH-SY5Y cell. However, the same markers showed opposite results in the differentiated + Aβ + RES compared to the differentiated + Aβ group. PI3K (3.38- fold), AKT (3.95-fold), and RELN (1.99-fold) expressions were significantly higher in the differentiated + Aβ + RES groups compared to the differentiated + Aβ group (p < 0.001) (Fig. 4 a,b,d). It is known that molecules are the most closely associated with the pathology of Alzheimer's, GSK-3β, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 gene expression levels were significantly downregulated (2.53-, 1.79-, 2.85-, 4.09-, and 6.62- fold, respectively) in the differentiated + Aβ + RES groups compared to the differentiated + Aβ group (p < 0.001) (Fig. 4 c,e,f,g,h). Discussion Although there are studies about resveratrol of the effects of AD on the PI3K/Akt signaling pathway, there are not many studies in the literature yet on the effect of resveratrol on this pathway-related molecule. Studies have revealed that the PI3K/Akt pathway can control the activity of GSK-3β, which is associated with AD neurodegenerative mechanism. The hallmarks of AD pathogenesis are the hyperphosphorylation of tau protein and the generation of Aβ peptide. The crucial interplay between GSK-3β and tau protein contributes to these processes of AD pathology (Sayas&Ávila 2021 ). Resveratrol is a polyphenolic molecule known as a preventive and therapeutic modality in the struggle with metabolic disorders like insulin resistance and type 2 diabetes. Additionally, nowadays resveratrol's neuroprotective properties concerning cognitive dysfunction have been discovered (Yang et al. 2021 ). The following studies have focused on investigation of the neuroprotection effects of resveratrol. In 2018, Hou et al. determined the effects of resveratrol on cerebral ischemia/reperfusion injury in a rat model of middle cerebral artery occlusion and visually showed that by the induction of the activities of JAK2/STAT3 and PI3K/AKT/mTOR pathways, resveratrol can importantly inhibit neuronal apoptosis (Hou et al. 2018 ). Accordingly, our results showed that the IC 50 dose of resveratrol increased PI3K and AKT expression levels in resveratrol-treated AD model SH-SY5Y cells compared to the untreated AD model group (Differentiated + Aβ group). Wen et al. showed that the antioxidant and neuroprotective activity of resveratrol can by inhibition of Aβ-induced neurotoxicity in rat primary cortex neurons via the PI3K/Akt signaling pathway significantly decrease in intracellular ROS (Wen et al. 2018 ). Knowing that the PI3K/Akt signaling pathway has an ameliorating effect in the progression of AD and has an important role in the inhibition of Aβ and hyperphosphorylated Tau (Razani et al. 2021 ). Correspondingly, PI3K and AKT expression levels were increased 3.38- and 3.95-fold in the differentiated + Aβ + RES group compared to induced neurotoxicity with Aβ 25–35 of the differentiated AD model group, respectively, in this study. According to the study of Hui et al. found that resveratrol treatment on Aβ 1–42 induced cytotoxicity in PC12 cells causes upregulation of heme oxygenase-1 (HO-1) via the PI3K/AKT/Nrf2 intracellular signaling pathway. This study also reports a new perspective on the therapeutic effect of resveratrol against AD (Hui et al. 2018 ). In accordance with our study increased expression of PI3K and AKT was observed in the treatment of the resveratrol of the AD model group cells. Shati and colleagues examined whether resveratrol could safeguard against memory loss induced by cadmium chloride (CdCl2) and its impact on Tau protein hyperphosphorylation through modulation of the AMPK/PI3K/Akt signaling pathway in rats. Moreover, this study suggests that resveratrol used as a therapeutic agent against CdCl2 activated the PP2A, and PI3K/Akt pathways and stimulated the inactivation of phosphorylated Tau and GSK-3β (Shati&Alfaifi 2019 ). In parallel with resveratrol treatment downregulated GSK-3β, TAU gene expression levels 2.53- and 1.79-fold, respectively. A recent study has shown that resveratrol can play a protective role in the neural retina from alcohol exposure by activating the PI3K/AKT signaling pathway. Additionally, it was detected, that the expression levels of RELN, FGFR2, MET, and PIK3AP1 were upregulated with the treatment of RES in comparisons (Li et al. 2023 ). In our study, we found that RELN mRNA levels increased under resveratrol treatment. In conclusion, these studies supported that due to its neuroprotective and antioxidant potential resveratrol may be acceptable as an anti-alzheimer's drug. Studies with rodents showed that increase in ADAMTS-4 gene expression level with the Aβ stimulation. One of the metalloproteases, ADAMTS-4 is considered as a potential biomolecule for neurodegeneration in Alzheimer's disease (Jonesco et al. 2020 ). In 2023, Aswani et al. suggested that oxidized low-density lipoprotein is the upregulation of ADAMTS-4 in the monocyte/macrophages via the ROS/NF-κB/SIRT-1 pathway. According to do result of this study resveratrol treatment significantly reduces ADAMTS-4 expression by activating SIRT1 (Aswani et al. 2023 ). Another scientific study evaluating the effect of resveratrol on intervertebral disc degeneration repair reported that resveratrol treatment effectively inhibited oxidative stress and reduced ADAMTS-4 and matrix metalloproteinase (MMP)-13 mRNA levels (Li et al. 2008 ). In compliance with the result, resveratrol treatment downregulated ADAMTS-4 gene expression level 1.79-fold in resveratrol-treated AD model SH-SY5Y cells. Li et al. found that resveratrol suppressed MMP-3, MMP-13, and ADAMTS-4 mRNA/protein levels encoding catabolic enzymes in intervertebral disc degeneration. In this study, it was suggested that resveratrol may offer positive effects on cellular aging by partially reversing the effect of inflammatory cytokines (Li et al. 2019 ). However, up to date, no studies have reported the effect of resveratrol in AD model neuroblastoma cell lines especially on the enzymatic activity metalloproteases (ADAMTS-4 and ADAMTS-5) and metalloproteinase inhibitor (TIMP-3). In our study, we detected differences in Differentiated + Aβ + RES groups and demonstrated 1.79-fold, 4.09-, and 6.62-fold, respectively decreases in ADAMTS-4, ADAMTS-5, and TIMP-3 compared to Differentiated + Aβ groups. Conclusion Scientific studies outcomes demonstrated the potential role of resveratrol in neurodegenerative diseases. In summary, our data suggest that resveratrol was inhibiting GSK-3β by activating the PI3K/Akt insulin pathway in a neurotoxic environment. In addition, TAU, RELN, metalloproteases and their inhibitors associated with Alzheimer's pathology have been regulated supporting the neuroprotective effect of resveratrol. On the other hand, there are several limitations in our study. Although we proved the interaction between resveratrol and AD in SH-SY5Y neuroblastoma-differentiated cells, whether our findings can be extended to other in vitro and in vivo (the animal experimental model) and ingredients is yet to be verified. Moreover, given that other molecules can interact with PI3K/Akt/GSK-3β we cannot exclude the possibility that these potential molecules may affect the interaction between AD and resveratrol without more study. Additionally, our study only focused on a single dose of resveratrol, and the optimal dosage for therapeutic efficacy remains uncertain for in vivo. Finally, further research addressing these limitations is warranted to validate our findings and elucidate the potential benefits of resveratrol supplementation in Alzheimer's disease management. Declarations Competing interests The authors declare no competing interests. Conflict of interest The authors declare no conflict of interest. Funding This work was supported by Kahramanmaras Sutcu Imam University Department of Scientific Research Projects (grant number: 2021/1–29 M). Author Contribution L.Ö. conceived and designed research. L.Ö. and B.G.B. conducted experiments. L.Ö. and B.G.B. were involved in planning and supervising the work, processing the experimental data, performing the analysis, drafting the manuscript, and designing the figures. The first draft of the manuscript was written by L.Ö. and all authors commented on previous versions of the manuscript. All authors read and approved the manuscript. Data availability The data that support the findings of this study are available on request from the corresponding author. References Arslan ME, Türkez H, Mardinoğlu A (2021) In vitro neuroprotective effects of farnesene sesquiterpene on alzheimer's disease model of differentiated neuroblastoma cell line. Int J Neurosci 131(8):745–754. https://doi:10.1080/00207454.2020.1754211 Aswani SS, Mohan MS, Aparna NS, Boban PT, Saja K (2023) Oxidized LDL-mediated upregulation of ADAMTS-4 in monocytes/macrophages involves ROS-NF-κB-SIRT-1 pathway 110. 2173–190. https://doi:10.1556/2060.2023.00170 Cheung YT, Lau WKW, Yu MS, Lai CSW, Yeung SC, So KF, Chang RCC (2009) Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. Neurotoxicology 30(1):127–135. https://doi 10.1016/j.neuro.2008.11.001 Calan OG, Akan P, Cataler A, Dogan C, Kocturk S (2016) Amyloid Beta Peptides Affect Pregnenolone and Pregnenolone Sulfate Levels in PC-12 and SH-SY5Y Cells Depending on Cholesterol. Neurochem Res 41(7):1700–1712. https://doi:10.1007/s11064-016-1886-0 Hou Y, Wang K, Wan W, Cheng Y, Pu X, Ye X (2018) Resveratrol provides neuroprotection by regulating the JAK2/STAT3/PI3K/AKT/mTOR pathway after stroke in rats. Genes Dis 5(3):245–255. https://doi:10.1016/j.gendis.2018.06.001 Hui Y, Chengyong T, Cheng L, Haixia H, Yuanda Z, Weihua Y (2018) Resveratrol Attenuates the Cytotoxicity Induced by Amyloid-β1–42 in PC12 Cells by Upregulating Heme Oxygenase-1 via the PI3K/Akt/Nrf2 Pathway. 43(2):297–305. https://doi:10.1007/s11064-017-2421-7 Jonesco DT, Karsdal MA, Henriksen K (2020) The CNS-specific proteoglycan, brevican, and its ADAMTS4-cleaved fragment show differential serological levels in Alzheimer's disease, other types of dementia and non-demented controls: A cross-sectional study. 15(6):e0234632. https://doi:10.1371/journal.pone.0234632 Kumar M, Bansal N (2022) Implications of Phosphoinositide 3-Kinase-Akt (PI3K-Akt) Pathway in the Pathogenesis of Alzheimer's Disease. Mol Neurobiol 59(1):354–385. https://doi:10.1007/s12035-021-02611-7 Lane CA, Hardy J, Schott JM (2018) Alzheimer's disease. Eur J Neurol 25(1):59–70. https://doi:10.1111/ene.13439 Li H, Gao L, Ye Z, Du J, Li W, Liang L, Zeng Q, Xi J, Yue W, Li Z (2023) Protective effects of resveratrol on the ethanol-induced disruption of retinogenesis in pluripotent stem cell‐derived organoids. FEBS Open Bio 13(5):845–866. https://doi:10.1002/2211-5463.13601 Li X, Lin F, Wu Y, Liu N, Wang J, Chen R, Lu Z (2019) Resveratrol attenuates inflammation environment-induced nucleus pulposus cell senescence in vitro. Biosci Rep 39(5):BSR20190126. https://doi:10.1042/BSR20190126 Li X, Phillips FM, An HS, Ellman M, Thonar EJ, Wu W, Park D, Im HJ (2008) The action of resveratrol, a phytoestrogen found in grapes, on the intervertebral disc. Spine (Phila Pa 1976) 33(24):2586–2595. https://doi:10.1097/BRS.0b013e3181883883 Michailidis M, Moraitou D, Tata DA, Kalinderi K, Papamitsou T, Papaliagkas V (2022) Alzheimer’s Disease as Type 3 Diabetes: Common Pathophysiological Mechanisms between Alzheimer’s Disease and Type 2 Diabetes. Int J Mol Sci 23(5):2687. https://doi:10.3390/ijms23052687 Rahman H, Akter R, Bhattacharya T, Abdel-Daim MM, Alkahtani S, Arafah MW, Al-Johani NS et al (2020) Resveratrol and Neuroprotection: Impact and Its Therapeutic Potential in Alzheimer's Disease. Front Pharmacol 11:619024. https://doi:10.3389/fphar.2020.619024 Razani E, Pourbagheri-Sigaroodi A, Safaroghli-Azar A, Zoghi A, Shanaki-Bavarsad M, Bashash D (2021) The PI3K/Akt signaling axis in Alzheimer’s disease: a valuable target to stimulate or suppress? Cell Stress Chaperones 26(6):871–887. https://doi:10.1007/s12192-021-01231-3 Reitz C, Mayeux R (2014) Alzheimer disease: Epidemiology, Diagnostic Criteria, Risk Factors and Biomarkers. Biochem Pharmacol 88(4):640–651. https://doi:10.1016/j.bcp.2013.12.024 Sandhir R, Gupta S (2015) Molecular and biochemical trajectories from diabetes to Alzheimer's disease: A critical appraisal. World J Diabetes 6(12):1223–1242. https://doi:10.4239/wjd.v6.i12.1223 Sayas CL, Ávila J (2021) GSK-3 and Tau: A Key Duet in Alzheimer's Disease. Cells 10(4):721. https://doi:10.3390/cells10040721 Scheltens P, Strooper BD, Kivipelto M, Holstege H, Chételat G, Teunissen CE et al (2021) Alzheimer’s disease. Lancet 397(10284):1577–1590. https://doi:10.1016/S0140-6736(20)32205-4 Shati AA, Alfaifi MY (2019) Trans-resveratrol Inhibits Tau Phosphorylation in the Brains of Control and Cadmium Chloride-Treated Rats by Activating PP2A and PI3K/Akt Induced-Inhibition of GSK3β. Neurochem Res 44(2):357–373. https://doi:10.1007/s11064-018-2683-8 Turkez H, Cacciatore I, Arslan ME, Fornasari E, Marinelli L, Di Stefano A (2020) Histidyl-proline diketopiperazine isomers as multipotent anti-alzheimer drug candidates. Biomolecules 10:737. https://doi:10.3390/biom10050737 Turkez H, Cacciatore I, Marinelli L, Fornasari E, Aslan ME, Cadirci K et al (2021) Glycyl-L-Prolyl-L-Glutamate Pseudotripeptides for Treatment of Alzheimer's Disease. Biomolecules 11(1):126. https://doi:10.3390/biom11010126 Turner SL, Mangnall D, Bird NC, Bunning RA, Blair-Zajdel ME (2012) Expression of ADAMTS-1, ADAMTS-4, ADAMTS-5 and TIMP3 by hepatocellular carcinoma cell lines. Int J Oncol 41(3):1043–1049. https://doi:10.3892/ijo.2012.1525 Yamakage Y, Kato M, Hongo A, Ogino H, Ishii K, Ishizuka T et al (2019) A disintegrin and metalloproteinase with thrombospondin motifs 2 cleaves and inactivates Reelin in the postnatal cerebral cortex and hippocampus, but not in the cerebellum. Mol Cell Neurosci 100:103401. https://doi:10.1016/j.mcn.2019.103401 Yang AJT, Bagit A, MacPherson REK (2021) Resveratrol, Metabolic Dysregulation, and Alzheimer's Disease: Considerations for Neurogenerative Disease. Int J Mol Sci 22(9):4628. https://doi:10.3390/ijms22094628 Yu NN, Tan MS, Yu JT, Xie AM, Tan L (2016) The Role of Reelin Signaling in Alzheimer's Disease. Mol Neurobiol 53(8):5692–5700. https:// 10.1007/s12035-015-9459-9 Wen H, Fu Z, Wei Y et al (2018) Antioxidant activity and neuroprotective activity of stilbenoids in rat primary cortex neurons via the PI3K/Akt signalling pathway. Molecules 23(9):2328. https://doi:10.3390/molecules23092328 Zhang B, Bian X, He P, Fu X, Higuchi K, Yang X, Li D (2014) The toxicity mechanisms of action of Aβ25–35 in isolated rat cardiac myocytes. Molecules 19(8):12242–12257. https://doi:10.3390/molecules190812242 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4138036","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":284071460,"identity":"c4f93d71-c31a-43a6-b0fd-9c1f54504de5","order_by":0,"name":"Lütfiye Özpak","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYBACPiD+kABhMzN8AJJs7AS0sDEwM86AaWGcARJhJkYLlM3MzAOxjIAWifyDDQ/bbOTkZzc/Nrb5tU2ej5mB8cPHHHxakhkbEtvSjBnnHDNOzu27bdjGzMAsOXMbXi3sDxLbDic2SyQYH87tuc0I1MLGzItfC8iW/4ltEumfD1v23LYnVsuBxB6JHONkhh+3Ewlr4Xls2JBwLtlYQuZMsWFvw+3kNmbGZrx+4WdPfNj4o8wOGGLtmyV+/LltO7+9+eCHj3i0gAEjG5CQADHawNwGAupB4A9UC5gxCkbBKBgFowANAABUpEw/PBF27gAAAABJRU5ErkJggg==","orcid":"","institution":"Kahramanmaraş Sütçü İmam University","correspondingAuthor":true,"prefix":"","firstName":"Lütfiye","middleName":"","lastName":"Özpak","suffix":""},{"id":284071462,"identity":"9a1e2718-68dc-4518-87e2-016f14906605","order_by":1,"name":"Bakiye Göker Bağca","email":"","orcid":"","institution":"Adnan Menderes University","correspondingAuthor":false,"prefix":"","firstName":"Bakiye","middleName":"Göker","lastName":"Bağca","suffix":""}],"badges":[],"createdAt":"2024-03-20 14:54:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4138036/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4138036/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53775947,"identity":"6dbb880d-61b0-42c7-b143-775645ff154c","added_by":"auto","created_at":"2024-03-30 08:17:52","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":481265,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of all-trans RA exposure on human neuronal SH-SY5Y cells demonstrated through the invert microscope. A. SH-SY5Y cells were cultured in a complete medium (DMEM with 10% FBS) for 3 days without any additives. B. RA (10 μM) induced differentiation SH-SY5Y cells for 7 days.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4138036/v1/94da43dc744d83d8a220ae8f.png"},{"id":53775945,"identity":"e0e4555a-2458-40c8-9d85-f3a1d37e5955","added_by":"auto","created_at":"2024-03-30 08:17:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":87358,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different concentrations of resveratrol on the cell viability of SH-SY5Y. (*p \u0026lt; 0.05, **p \u0026lt; 0.01, ****p \u0026lt; 0.0001)\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4138036/v1/50500bcf070df366977c9c87.png"},{"id":53775946,"identity":"122c841b-dc68-48c6-a4bc-011a85c4656b","added_by":"auto","created_at":"2024-03-30 08:17:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":218508,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of resveratrol on the apoptotic, necrotic, and lived SH-SY5Y cell percentages.\u003c/p\u003e\n\u003cp\u003e(A) Histograms represent the distribution of Annexin V-stained live and apoptotic cells under various conditions: (a) Control, (b) Resveratrol, (c) Differentiated+Aβ+Resveratrol, (d) Differentiated, (e) Differentiated+Resveratrol, and (f) Differentiated+Aβ. (B) Bar graphs present the percentages of live and apoptotic cells. The data are depicted as mean values ± standard error of the mean (SEM) from three independent experiments. (**p \u0026lt; 0.01, ***p \u0026lt; 0.0001.)\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4138036/v1/d26d3320868e05a73251f79c.png"},{"id":53775948,"identity":"7341fa0c-c0a0-4293-90d8-2cf841bed455","added_by":"auto","created_at":"2024-03-30 08:17:52","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":206746,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of resveratrol on PI3K, Akt, GSK3-β, RELN, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3\u003cem\u003e \u003c/em\u003emRNA levels in the AD model of the SH-SY5Y (*p \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4138036/v1/4aaf8102a537e9bd12e61b70.png"},{"id":54027244,"identity":"a8d0fb35-911b-4e62-8db5-c9acd234efbd","added_by":"auto","created_at":"2024-04-03 15:07:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1472435,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4138036/v1/46bc1be7-4d05-432a-bd62-315238e3317d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effect of Resveratrol on PI3K/Akt/GSK-3β Pathway and Metalloproteases in Differentiated and Aβ-Induced Alzheimer's Model Neuroblastoma Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlzheimer's disease is a neurodegenerative disorder characterized by progressive cognitive function impairment which most common type of dementia. Due to being a multifactorial and polygenic disease, the pathophysiological process of the disease still harbors many puzzles. This situation complicates the development of preventive treatment methods and increases the global burden of the disease (Lane et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Scheltens et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) Widespread extracellular plaques (amyloid β) and intracellular neurofibrillary tangles (hyperphosphorylated tau protein) are the hallmark features of the disease. Also, additional findings include a reactive microglial response, extensive loss of neurons, white matter, and synapses (Reitz\u0026amp;Mayeux \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In recent years, research has indicated the presence of common pathophysiological mechanisms, such as neuroinflammation, insulin resistance, oxidative stress, and mitochondrial dysfunction, in Alzheimer's disease and Type 2 diabetes. Impairment in brain insulin signaling and the progressive state of brain insulin resistance triggered by this is called type 3 diabetes by researchers (Michailidis et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The PI3-Akt (phosphatidylinositol-4,5-bisphosphate 3-kinase/Akt) signaling pathway, which plays a crucial role in cellular homeostasis and memory processes, has been identified as a significant therapeutic target in the treatment of Alzheimer's disease by inhibiting neurotoxic processes (Kumar\u0026amp;Bansal \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Glycogen synthase kinase-3β (GSK3-β) is a kinase involved in tau phosphorylation and downstream molecules of the PI3K-Akt pathway. GSK3-β contributes to the pathology of Alzheimer's by not only tau hyperphosphorylation but also the formation of amyloid plaques (Sandhir\u0026amp;Gupta \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Reelin (RELN) is involved in neuronal functions related to memory and learning (Yu et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). A disintegrin and metalloproteinase with thrombospondin motifs-4 (ADAMTS-4), which can cleave the reelin polypeptide encoded by RELN, is associated with the formation of neurofibrillary tangles (Yamakage et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). ADAMTS-4 and ADAMTS-5 proteolytic activities are regulated by the endogenous tissue inhibitor of metalloproteases-3 (TIMP-3) (Turner et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Resveratrol (trans-3, 4\u0026prime;, 5-trihydroxystilbene) is a type of polyphenol obtained from the seed of grapes and grapes products, possessing antioxidant properties. It has been demonstrated to provide neuroprotection against Alzheimer's disease, although its therapeutic potential is still under investigation (Rahman et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThere is no report of the action of resveratrol against Alzheimer's pathology via modulation of the PI3K/Akt/GSK3-β pathway. Hence, we aimed to evaluate the effect of resveratrol through the PI3K/Akt/GSK3-β pathway in the differentiated SH-SY5Y cell line as potential anti-Alzheimer drug candidates in AD therapy. We designed the two-step method of neuronal differentiation through a combination of retinoic acid (RA) with brain derivate factor (BDNF) exposure. Following that, the application of the Aβ25\u0026ndash;35 protein to the cell culture mimicked the environmental toxicity observed in Alzheimer's disease. Afterward, we analyzed the expressional changes in PI3K, Akt, GSK-3β, RELN, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 genes in the cellular AD model with the effect of antioxidant resveratrol.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eChemicals and Reagents\u003c/h2\u003e \u003cp\u003eResveratrol was obtained from thermo-scientific chemicals (Fisher Scientific, UK). β-Amyloid (25\u0026ndash;35) was from Genscript Inc. RA was supplied by Sigma-Aldrich (St. Louis, MO). BDNF was purchased from MedChemExpress (Monmouth Junction, NJ, USA). Thiazolyl Blue Tetrazolium Bromide (MTT) was obtained from Goldbiotechnology. All other chemicals and kits were purchased from Sigma and Gibco.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCulturing and Differentiating of SH-SY5Y Cells\u003c/h2\u003e \u003cp\u003eSH-SY5Y cells (neuroblastoma cell line) were obtained from Dr. Gizem Donmez Yalcın (Adnan Menderes University, Turkey) and were cultured in a passage lower than 100. Neuroblastoma cells were grown in DMEM including 10% FBS, 100 \u0026micro;g/ml penicillin/streptomycin, and 2mM L-glutamine at 37\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. After the cultures reached 80% confluence, the cells were detached from the flask\u0026rsquo;s surface using trypsin solution and then seeded to 6-wells of poly-L-lysine-coated plates at 10\u003csup\u003e4\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e density. SH-SY5Y cells, derived from neuroblastoma, are often induced to differentiate using all-trans RA to acquire more neuron-like properties, such as neurite outgrowth and morphological changes (Cheung et al \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). RA (10 \u0026micro;M) was added to the media and incubated for 7 days to initiate neuronal differentiation. Subsequently, the cultures were enriched with BDNF (25 nM), and additional was incubated for 3 days to finalize cellular differentiation (Cheung et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Turkez et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Turkez et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Arslan et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The differentiated neuronal cells were determined using an inverted microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of β-Amyloid and Cell Treatment\u003c/h2\u003e \u003cp\u003eThe Aβ25\u0026ndash;35 is the C-terminal peptide of Aβ1\u0026ndash;42, and it is frequently preferred in vitro experimental setups for Alzheimer's disease (Calan et. al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Aβ25\u0026ndash;35 stock solution was prepared in ultra-pure water and stored at -20\u003csup\u003eo\u003c/sup\u003eC. In the Aβ25\u0026ndash;35 groups, Aβ25\u0026ndash;35 with a final concentration of 20 \u0026micro;M was added to the six wells plates as described in the previous study. (Zhang et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Because approximately 50% cell death was observed at 24 h and 20 \u0026micro;M dose. Non-treated differentiated cell culture was used for the negative control. All experiments were conducted with three replications.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTreatment and Cell Viability\u003c/h2\u003e \u003cp\u003eCells were plated in 96-well culture plates at a density of 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well for the MTT assay. The cells were then treated with varying concentrations of resveratrol (1, 5, 25, 50, 75, and 100 \u0026micro;M) for 24 hours to evaluate the impact of resveratrol dosage on cell viability. Following the 24-hour incubation period, the medium was aspirated from each well, and 10 \u0026micro;L of 5 mg/mL MTT solution was added to each well. The plate was then incubated for 4 hours at 37\u0026deg;C. Afterward, the MTT solution was discarded, and DMSO was added to each well for 15 minutes. The optical density was measured at 570 nm using a microplate reader. In the groups treated with resveratrol, a final concentration of 50 \u0026micro;M resveratrol was added to the wells of the six-well plates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eFITC Annexin V Assay\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe apoptotic effects of resveratrol, Aβ, and the combination were detected using the FITC Annexin V kit (BD Biosciences) and BD Accuri C6 flow cytometer. Apoptotic effects of resveratrol on SH-SY5Y cells were analyzed by a commercial kit Annexin V according to the protocol of the manufacturer. The apoptotic status of SH-SY5Y cells treated with 50 \u0026micro;M of resveratrol was analyzed by flow cytometry. SH-SY5Y cells were plated at a concentration of 3 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/3 ml per well in 6-well culture plates and incubated for 24 hours. Afterward, the cells were subjected to treatment with resveratrol and Aβ for an additional 24-hour period. Upon completion of the incubation, the culture medium was removed, and the cells were detached using trypsin, followed by centrifugation at 1500 rpm for 5 minutes. After removing the supernatant, the pellet was washed twice with PBS and then suspended in 500 \u0026micro;l of 1 \u0026times; Annexin binding buffer. Subsequently, 5 \u0026micro;l each of PI and Annexin V-FITC solutions were added to every group. The percentages of apoptotic and living cells in all groups were assessed using the FL1 and FL2 channels of the BD Accuri C6 flow cytometer, along with its associated software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGene Expression Analysis by Real-Time PCR\u003c/h2\u003e \u003cp\u003eThe expression levels of PI3K/Akt/GSK3-β pathway and metalloproteinase as a role of neuronal function-related genes were determined by 50 \u0026micro;M doses of resveratrol treatment at the 24th hour on differentiated and Aβ exposed SH-SY5Y neuroblastoma cells and according to the control group. To evaluate the expression of PI3K, Akt, GSK3-β, RELN, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 real-time PCR was performed. Total RNA was isolated using a TRI reagent according to the manufacturer\u0026rsquo;s instructions. The isolated RNA was quantified using NanoDrop 8000 (Thermo Fisher, USA) at an absorbance wavelength of 260 nm to determine the concentration. The purity of the total RNA was assessed by measuring the absorbance ratios at 260/280 nm, with appropriate ratios around 2.0 and above 1.8, respectively. Random hexamer primers and the High-Capacity cDNA Reverse Transcription Kit were used to synthesize cDNA from extracted RNA samples. Quantitative SYBR green PCR was performed using 1 \u0026micro;l of cDNA, specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), with Promega GoTaq\u0026reg; qPCR Master Mix (SYBR, catalog. no: A6001). For normalization, the endogenous control β-actin was utilized, and relative expression was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. Each sample underwent three replicates, and the experiment was repeated a minimum of three times.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequence of the primer pairs was used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026prime; -3\u0026prime; )\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5\u0026prime; -3\u0026prime; )\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePI3K\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTGGTCTTCGTTTCCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAACTTTTTCCCACCACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAkt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTCATTCCAGACCCACGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGGTACACCACGTTCTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSK3-β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGACTAACACCACTGGAAGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGATGGTAGCCAGAGGTGGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRELN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTACCTTCCACTCTCCACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCAGCATCACAAATCCCTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTAU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAAGTGTGGCTCATTAGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAATCTTCGACTGGACTCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADAMTS-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACTGACTTCCTGGACAATGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCAGCATCATAGTCCTTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADAMTS-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGGTCCAAATGCACTTCAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGTAGGTCTGTCCTGGGAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTIMP-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACCGAGGCTTCACCAAGATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCTTGCCATCATAGACGCGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACTGGGACGACATGGAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAGGTCTCAAACATGATCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eData Analysis and Statistics\u003c/h2\u003e \u003cp\u003eThe experiments were conducted independently at least three times, and the data collected from these replicates were analyzed using standard deviations. Statistical analysis was performed using Student's t-test (comparison between two groups) or one-way analysis of variance (comparison between more than two groups) with significance set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. GraphPad (Prism 9) software was employed for data analysis.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAll-Trans RA Leads SH-SY5Y Cell Differentiation\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eWe demonstrated that the extension of neurites, and neuron-like cells was observed 48h after the application of RA. Notable alterations in cell morphology were detected through microscopic examinations (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The observations revealed enhanced cell-to-cell contact and communication between cells.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHigh doses of resveratrol induce differentiated SH-SY5Y cell proliferation\u003c/h2\u003e \u003cp\u003eOur findings revealed that after 24 hours of resveratrol treatment, higher doses (50 \u0026micro;M) exhibited proliferative effects, while lower doses (5 \u0026micro;M) resulted in inhibition of cell viability by less than 50% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Resveratrol (50 \u0026micro;M dose and 24th hour) decreased Aβ 25‑35 induced neurotoxicity in differentiated SH‑SY5Y cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eResveratrol may not reduce apoptotic SH-SY5Y cell percentages\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe alteration in apoptosis across all application groups was found to be statistically significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared to the control. Specifically, in the resveratrol group, there was a 1.4-fold decrease in apoptosis relative to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while the Differentiated\u0026thinsp;+\u0026thinsp;Resveratrol group exhibited a 1.5-fold increase (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and the Differentiated group showed a 2.5-fold increase in apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Although Resveratrol application to the Differentiated group decreased the percentage of apoptotic cells by 1.6 times, this difference was not significant (p\u0026thinsp;=\u0026thinsp;0.8716). However, no significant difference in apoptosis was observed between resveratrol and AB-induced neurotoxic model groups. Moreover, it was unexpectedly observed that the level of apoptosis was reduced in the untreated AB-induced neurotoxic model groups. In addition, between application groups, no more than a 2-fold change in the percentage of lived cells was detected (Data is not shown).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003eB.\u003c/b\u003e \u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e(A) Histograms represent the distribution of Annexin V-stained live and apoptotic cells under various conditions: (a) Control, (b) Resveratrol, (c) Differentiated\u0026thinsp;+\u0026thinsp;Aβ\u0026thinsp;+\u0026thinsp;Resveratrol, (d) Differentiated, (e) Differentiated\u0026thinsp;+\u0026thinsp;Resveratrol, and (f) Differentiated\u0026thinsp;+\u0026thinsp;Aβ. (B) Bar graphs present the percentages of live and apoptotic cells. The data are depicted as mean values\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM) from three independent experiments. (**p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.)\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eResveratrol regulates PI3K/Akt/GSK3-β Pathway and Metalloproteinase related gene expression in SH-SY5Y cells\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe relative ratio of changes in PI3K, AKT, RELN, GSK-3β, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 mRNA expressions between the groups is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Our Real-Time PCR analysis results revealed decreased expression of PI3K, AKT, and RELN mRNAs and increased expression of GSK-3β, TAU, ADAMTS-4, ADAMTS-5, TIMP-3 mRNAs in the differentiated, and induced neurotoxicity with Aβ 25\u0026ndash;35 of the SH-SY5Y cell. However, the same markers showed opposite results in the differentiated\u0026thinsp;+\u0026thinsp;Aβ\u0026thinsp;+\u0026thinsp;RES compared to the differentiated\u0026thinsp;+\u0026thinsp;Aβ group. PI3K (3.38- fold), AKT (3.95-fold), and RELN (1.99-fold) expressions were significantly higher in the differentiated\u0026thinsp;+\u0026thinsp;Aβ\u0026thinsp;+\u0026thinsp;RES groups compared to the differentiated\u0026thinsp;+\u0026thinsp;Aβ group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea,b,d). It is known that molecules are the most closely associated with the pathology of Alzheimer's, GSK-3β, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 gene expression levels were significantly downregulated (2.53-, 1.79-, 2.85-, 4.09-, and 6.62- fold, respectively) in the differentiated\u0026thinsp;+\u0026thinsp;Aβ\u0026thinsp;+\u0026thinsp;RES groups compared to the differentiated\u0026thinsp;+\u0026thinsp;Aβ group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec,e,f,g,h).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAlthough there are studies about resveratrol of the effects of AD on the PI3K/Akt signaling pathway, there are not many studies in the literature yet on the effect of resveratrol on this pathway-related molecule. Studies have revealed that the PI3K/Akt pathway can control the activity of GSK-3β, which is associated with AD neurodegenerative mechanism. The hallmarks of AD pathogenesis are the hyperphosphorylation of tau protein and the generation of Aβ peptide. The crucial interplay between GSK-3β and tau protein contributes to these processes of AD pathology (Sayas\u0026amp;\u0026Aacute;vila \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Resveratrol is a polyphenolic molecule known as a preventive and therapeutic modality in the struggle with metabolic disorders like insulin resistance and type 2 diabetes. Additionally, nowadays resveratrol's neuroprotective properties concerning cognitive dysfunction have been discovered (Yang et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The following studies have focused on investigation of the neuroprotection effects of resveratrol. In 2018, Hou et al. determined the effects of resveratrol on cerebral ischemia/reperfusion injury in a rat model of middle cerebral artery occlusion and visually showed that by the induction of the activities of JAK2/STAT3 and PI3K/AKT/mTOR pathways, resveratrol can importantly inhibit neuronal apoptosis (Hou et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Accordingly, our results showed that the IC\u003csub\u003e50\u003c/sub\u003e dose of resveratrol increased PI3K and AKT expression levels in resveratrol-treated AD model SH-SY5Y cells compared to the untreated AD model group (Differentiated\u0026thinsp;+\u0026thinsp;Aβ group). Wen et al. showed that the antioxidant and neuroprotective activity of resveratrol can by inhibition of Aβ-induced neurotoxicity in rat primary cortex neurons via the PI3K/Akt signaling pathway significantly decrease in intracellular ROS (Wen et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Knowing that the PI3K/Akt signaling pathway has an ameliorating effect in the progression of AD and has an important role in the inhibition of Aβ and hyperphosphorylated Tau (Razani et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Correspondingly, PI3K and AKT expression levels were increased 3.38- and 3.95-fold in the differentiated\u0026thinsp;+\u0026thinsp;Aβ\u0026thinsp;+\u0026thinsp;RES group compared to induced neurotoxicity with Aβ 25\u0026ndash;35 of the differentiated AD model group, respectively, in this study. According to the study of Hui et al. found that resveratrol treatment on Aβ 1\u0026ndash;42 induced cytotoxicity in PC12 cells causes upregulation of heme oxygenase-1 (HO-1) via the PI3K/AKT/Nrf2 intracellular signaling pathway. This study also reports a new perspective on the therapeutic effect of resveratrol against AD (Hui et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In accordance with our study increased expression of PI3K and AKT was observed in the treatment of the resveratrol of the AD model group cells. Shati and colleagues examined whether resveratrol could safeguard against memory loss induced by cadmium chloride (CdCl2) and its impact on Tau protein hyperphosphorylation through modulation of the AMPK/PI3K/Akt signaling pathway in rats. Moreover, this study suggests that resveratrol used as a therapeutic agent against CdCl2 activated the PP2A, and PI3K/Akt pathways and stimulated the inactivation of phosphorylated Tau and GSK-3β (Shati\u0026amp;Alfaifi \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In parallel with resveratrol treatment downregulated GSK-3β, TAU gene expression levels 2.53- and 1.79-fold, respectively. A recent study has shown that resveratrol can play a protective role in the neural retina from alcohol exposure by activating the PI3K/AKT signaling pathway. Additionally, it was detected, that the expression levels of RELN, FGFR2, MET, and PIK3AP1 were upregulated with the treatment of RES in comparisons (Li et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In our study, we found that RELN mRNA levels increased under resveratrol treatment. In conclusion, these studies supported that due to its neuroprotective and antioxidant potential resveratrol may be acceptable as an anti-alzheimer's drug.\u003c/p\u003e \u003cp\u003eStudies with rodents showed that increase in ADAMTS-4 gene expression level with the Aβ stimulation. One of the metalloproteases, ADAMTS-4 is considered as a potential biomolecule for neurodegeneration in Alzheimer's disease (Jonesco et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In 2023, Aswani et al. suggested that oxidized low-density lipoprotein is the upregulation of ADAMTS-4 in the monocyte/macrophages via the ROS/NF-κB/SIRT-1 pathway. According to do result of this study resveratrol treatment significantly reduces ADAMTS-4 expression by activating SIRT1 (Aswani et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Another scientific study evaluating the effect of resveratrol on intervertebral disc degeneration repair reported that resveratrol treatment effectively inhibited oxidative stress and reduced ADAMTS-4 and matrix metalloproteinase (MMP)-13 mRNA levels (Li et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). In compliance with the result, resveratrol treatment downregulated ADAMTS-4 gene expression level 1.79-fold in resveratrol-treated AD model SH-SY5Y cells. Li et al. found that resveratrol suppressed MMP-3, MMP-13, and ADAMTS-4 mRNA/protein levels encoding catabolic enzymes in intervertebral disc degeneration. In this study, it was suggested that resveratrol may offer positive effects on cellular aging by partially reversing the effect of inflammatory cytokines (Li et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, up to date, no studies have reported the effect of resveratrol in AD model neuroblastoma cell lines especially on the enzymatic activity metalloproteases (ADAMTS-4 and ADAMTS-5) and metalloproteinase inhibitor (TIMP-3). In our study, we detected differences in Differentiated\u0026thinsp;+\u0026thinsp;Aβ\u0026thinsp;+\u0026thinsp;RES groups and demonstrated 1.79-fold, 4.09-, and 6.62-fold, respectively decreases in ADAMTS-4, ADAMTS-5, and TIMP-3 compared to Differentiated\u0026thinsp;+\u0026thinsp;Aβ groups.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eScientific studies outcomes demonstrated the potential role of resveratrol in neurodegenerative diseases. In summary, our data suggest that resveratrol was inhibiting GSK-3β by activating the PI3K/Akt insulin pathway in a neurotoxic environment. In addition, TAU, RELN, metalloproteases and their inhibitors associated with Alzheimer's pathology have been regulated supporting the neuroprotective effect of resveratrol. On the other hand, there are several limitations in our study. Although we proved the interaction between resveratrol and AD in SH-SY5Y neuroblastoma-differentiated cells, whether our findings can be extended to other in vitro and in vivo (the animal experimental model) and ingredients is yet to be verified. Moreover, given that other molecules can interact with PI3K/Akt/GSK-3β we cannot exclude the possibility that these potential molecules may affect the interaction between AD and resveratrol without more study. Additionally, our study only focused on a single dose of resveratrol, and the optimal dosage for therapeutic efficacy remains uncertain for in vivo. Finally, further research addressing these limitations is warranted to validate our findings and elucidate the potential benefits of resveratrol supplementation in Alzheimer's disease management.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConflict of interest\u003c/strong\u003e \u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by Kahramanmaras Sutcu Imam University Department of Scientific Research Projects (grant number: 2021/1\u0026ndash;29 M).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eL.\u0026Ouml;. conceived and designed research. L.\u0026Ouml;. and B.G.B. conducted experiments. L.\u0026Ouml;. and B.G.B. were involved in planning and supervising the work, processing the experimental data, performing the analysis, drafting the manuscript, and designing the figures. The first draft of the manuscript was written by L.\u0026Ouml;. and all authors commented on previous versions of the manuscript. All authors read and approved the manuscript.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data that support the findings of this study are available on request from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArslan ME, T\u0026uuml;rkez H, Mardinoğlu A (2021) In vitro neuroprotective effects of farnesene sesquiterpene on alzheimer's disease model of differentiated neuroblastoma cell line. Int J Neurosci 131(8):745\u0026ndash;754. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1080/00207454.2020.1754211\u003c/span\u003e\u003cspan address=\"https://doi:10.1080/00207454.2020.1754211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAswani SS, Mohan MS, Aparna NS, Boban PT, Saja K (2023) Oxidized LDL-mediated upregulation of ADAMTS-4 in monocytes/macrophages involves ROS-NF-κB-SIRT-1 pathway 110. 2173\u0026ndash;190. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1556/2060.2023.00170\u003c/span\u003e\u003cspan address=\"https://doi:10.1556/2060.2023.00170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheung YT, Lau WKW, Yu MS, Lai CSW, Yeung SC, So KF, Chang RCC (2009) Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. Neurotoxicology 30(1):127\u0026ndash;135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi\u003c/span\u003e\u003cspan address=\"https://doi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neuro.2008.11.001\u003c/span\u003e\u003cspan address=\"10.1016/j.neuro.2008.11.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalan OG, Akan P, Cataler A, Dogan C, Kocturk S (2016) Amyloid Beta Peptides Affect Pregnenolone and Pregnenolone Sulfate Levels in PC-12 and SH-SY5Y Cells Depending on Cholesterol. Neurochem Res 41(7):1700\u0026ndash;1712. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11064-016-1886-0\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11064-016-1886-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou Y, Wang K, Wan W, Cheng Y, Pu X, Ye X (2018) Resveratrol provides neuroprotection by regulating the JAK2/STAT3/PI3K/AKT/mTOR pathway after stroke in rats. Genes Dis 5(3):245\u0026ndash;255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.gendis.2018.06.001\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.gendis.2018.06.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHui Y, Chengyong T, Cheng L, Haixia H, Yuanda Z, Weihua Y (2018) Resveratrol Attenuates the Cytotoxicity Induced by Amyloid-β1\u0026ndash;42 in PC12 Cells by Upregulating Heme Oxygenase-1 via the PI3K/Akt/Nrf2 Pathway. 43(2):297\u0026ndash;305. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11064-017-2421-7\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11064-017-2421-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJonesco DT, Karsdal MA, Henriksen K (2020) The CNS-specific proteoglycan, brevican, and its ADAMTS4-cleaved fragment show differential serological levels in Alzheimer's disease, other types of dementia and non-demented controls: A cross-sectional study. 15(6):e0234632. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1371/journal.pone.0234632\u003c/span\u003e\u003cspan address=\"https://doi:10.1371/journal.pone.0234632\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar M, Bansal N (2022) Implications of Phosphoinositide 3-Kinase-Akt (PI3K-Akt) Pathway in the Pathogenesis of Alzheimer's Disease. Mol Neurobiol 59(1):354\u0026ndash;385. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s12035-021-02611-7\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s12035-021-02611-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLane CA, Hardy J, Schott JM (2018) Alzheimer's disease. Eur J Neurol 25(1):59\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1111/ene.13439\u003c/span\u003e\u003cspan address=\"https://doi:10.1111/ene.13439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Gao L, Ye Z, Du J, Li W, Liang L, Zeng Q, Xi J, Yue W, Li Z (2023) Protective effects of resveratrol on the ethanol-induced disruption of retinogenesis in pluripotent stem cell‐derived organoids. FEBS Open Bio 13(5):845\u0026ndash;866. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1002/2211-5463.13601\u003c/span\u003e\u003cspan address=\"https://doi:10.1002/2211-5463.13601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Lin F, Wu Y, Liu N, Wang J, Chen R, Lu Z (2019) Resveratrol attenuates inflammation environment-induced nucleus pulposus cell senescence in vitro. Biosci Rep 39(5):BSR20190126. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1042/BSR20190126\u003c/span\u003e\u003cspan address=\"https://doi:10.1042/BSR20190126\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Phillips FM, An HS, Ellman M, Thonar EJ, Wu W, Park D, Im HJ (2008) The action of resveratrol, a phytoestrogen found in grapes, on the intervertebral disc. Spine (Phila Pa 1976) 33(24):2586\u0026ndash;2595. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1097/BRS.0b013e3181883883\u003c/span\u003e\u003cspan address=\"https://doi:10.1097/BRS.0b013e3181883883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMichailidis M, Moraitou D, Tata DA, Kalinderi K, Papamitsou T, Papaliagkas V (2022) Alzheimer\u0026rsquo;s Disease as Type 3 Diabetes: Common Pathophysiological Mechanisms between Alzheimer\u0026rsquo;s Disease and Type 2 Diabetes. Int J Mol Sci 23(5):2687. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/ijms23052687\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/ijms23052687\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahman H, Akter R, Bhattacharya T, Abdel-Daim MM, Alkahtani S, Arafah MW, Al-Johani NS et al (2020) Resveratrol and Neuroprotection: Impact and Its Therapeutic Potential in Alzheimer's Disease. Front Pharmacol 11:619024. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3389/fphar.2020.619024\u003c/span\u003e\u003cspan address=\"https://doi:10.3389/fphar.2020.619024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRazani E, Pourbagheri-Sigaroodi A, Safaroghli-Azar A, Zoghi A, Shanaki-Bavarsad M, Bashash D (2021) The PI3K/Akt signaling axis in Alzheimer\u0026rsquo;s disease: a valuable target to stimulate or suppress? Cell Stress Chaperones 26(6):871\u0026ndash;887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s12192-021-01231-3\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s12192-021-01231-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReitz C, Mayeux R (2014) Alzheimer disease: Epidemiology, Diagnostic Criteria, Risk Factors and Biomarkers. Biochem Pharmacol 88(4):640\u0026ndash;651. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.bcp.2013.12.024\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.bcp.2013.12.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandhir R, Gupta S (2015) Molecular and biochemical trajectories from diabetes to Alzheimer's disease: A critical appraisal. World J Diabetes 6(12):1223\u0026ndash;1242. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.4239/wjd.v6.i12.1223\u003c/span\u003e\u003cspan address=\"https://doi:10.4239/wjd.v6.i12.1223\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSayas CL, \u0026Aacute;vila J (2021) GSK-3 and Tau: A Key Duet in Alzheimer's Disease. Cells 10(4):721. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/cells10040721\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/cells10040721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScheltens P, Strooper BD, Kivipelto M, Holstege H, Ch\u0026eacute;telat G, Teunissen CE et al (2021) Alzheimer\u0026rsquo;s disease. Lancet 397(10284):1577\u0026ndash;1590. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/S0140-6736(20)32205-4\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/S0140-6736(20)32205-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShati AA, Alfaifi MY (2019) Trans-resveratrol Inhibits Tau Phosphorylation in the Brains of Control and Cadmium Chloride-Treated Rats by Activating PP2A and PI3K/Akt Induced-Inhibition of GSK3β. Neurochem Res 44(2):357\u0026ndash;373. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11064-018-2683-8\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11064-018-2683-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurkez H, Cacciatore I, Arslan ME, Fornasari E, Marinelli L, Di Stefano A (2020) Histidyl-proline diketopiperazine isomers as multipotent anti-alzheimer drug candidates. Biomolecules 10:737. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/biom10050737\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/biom10050737\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurkez H, Cacciatore I, Marinelli L, Fornasari E, Aslan ME, Cadirci K et al (2021) Glycyl-L-Prolyl-L-Glutamate Pseudotripeptides for Treatment of Alzheimer's Disease. Biomolecules 11(1):126. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/biom11010126\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/biom11010126\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurner SL, Mangnall D, Bird NC, Bunning RA, Blair-Zajdel ME (2012) Expression of ADAMTS-1, ADAMTS-4, ADAMTS-5 and TIMP3 by hepatocellular carcinoma cell lines. Int J Oncol 41(3):1043\u0026ndash;1049. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3892/ijo.2012.1525\u003c/span\u003e\u003cspan address=\"https://doi:10.3892/ijo.2012.1525\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamakage Y, Kato M, Hongo A, Ogino H, Ishii K, Ishizuka T et al (2019) A disintegrin and metalloproteinase with thrombospondin motifs 2 cleaves and inactivates Reelin in the postnatal cerebral cortex and hippocampus, but not in the cerebellum. Mol Cell Neurosci 100:103401. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.mcn.2019.103401\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.mcn.2019.103401\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang AJT, Bagit A, MacPherson REK (2021) Resveratrol, Metabolic Dysregulation, and Alzheimer's Disease: Considerations for Neurogenerative Disease. Int J Mol Sci 22(9):4628. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/ijms22094628\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/ijms22094628\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu NN, Tan MS, Yu JT, Xie AM, Tan L (2016) The Role of Reelin Signaling in Alzheimer's Disease. Mol Neurobiol 53(8):5692\u0026ndash;5700. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12035-015-9459-9\u003c/span\u003e\u003cspan address=\"10.1007/s12035-015-9459-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen H, Fu Z, Wei Y et al (2018) Antioxidant activity and neuroprotective activity of stilbenoids in rat primary cortex neurons via the PI3K/Akt signalling pathway. Molecules 23(9):2328. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/molecules23092328\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/molecules23092328\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang B, Bian X, He P, Fu X, Higuchi K, Yang X, Li D (2014) The toxicity mechanisms of action of Aβ25\u0026ndash;35 in isolated rat cardiac myocytes. Molecules 19(8):12242\u0026ndash;12257. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/molecules190812242\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/molecules190812242\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Alzheimer’s disease, neurotoxicity, resveratrol, PI3K/Akt/GSK-3β pathway, TAU, ADAMTS","lastPublishedDoi":"10.21203/rs.3.rs-4138036/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4138036/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e \u003cp\u003eTo analyze the expressional changes in the PI3K/Akt/GSK-3β pathway and metalloprotease in the cellular AD model with the effect of antioxidant resveratrol.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe obtained neuron-like cells by a two-step method of neuronal differentiation by using a combination of retinoic acid (RA) and brain-derived factor (BDNF) exposure. Then, the application of the Aβ25\u0026ndash;35 protein (10 \u0026micro;M) to the cell culture mimicked the environmental toxicity observed in Alzheimer's disease. Afterward, cell viability and apoptosis assays were performed to determine whether the resveratrol exerts a cytotoxic and apoptotic effect. Finally, we analyzed with Real-Time PCR, the expressional changes in genes in the cellular AD model with the effect of resveratrol.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eApoptosis data findings were decreased by 1.5-fold and 2.5-fold respectively by differentiated\u0026thinsp;+\u0026thinsp;RES and RES when compared to control but no significant difference was observed between resveratrol and AD model groups. Real-time PCR analysis results revealed PI3K (3.38-fold), AKT (3.95-fold), and RELN (1.99-fold) expressions were significantly higher (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and also GSK-3β, TAU, ADAMTS-4, ADAMTS-5, and TIMP-3 gene expression levels were significantly downregulated (2.53-, 1.79-, 2.85-, 4.09-, and 6.62- fold, respectively) in the differentiated\u0026thinsp;+\u0026thinsp;Aβ\u0026thinsp;+\u0026thinsp;RES groups compared to the differentiated\u0026thinsp;+\u0026thinsp;Aβ group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eResveratrol has inhibited GSK-3β by activating the PI3K/Akt insulin pathway in a neurotoxic environment. In addition, TAU, RELN, metalloproteases, and their inhibitors associated with Alzheimer's pathology have been regulated supporting the neuroprotective effect of resveratrol.\u003c/p\u003e","manuscriptTitle":"Effect of Resveratrol on PI3K/Akt/GSK-3β Pathway and Metalloproteases in Differentiated and Aβ-Induced Alzheimer's Model Neuroblastoma Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-30 08:17:47","doi":"10.21203/rs.3.rs-4138036/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"aab9e2e4-2ef4-4806-96bd-7249882288c8","owner":[],"postedDate":"March 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-03T14:59:46+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-30 08:17:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4138036","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4138036","identity":"rs-4138036","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}