Survival, Adhesion and Migration of Metastatic Breast Tumor Cells: Roles of Parvins (PARVA and PARVB)

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Changes in cell-ECM interaction can lead to the anchorage-independent proliferation, resistance to apoptosis, and improved motility that characterize breast metastatic cells. The parvin, alpha (Parva) and parvin, beta (Parvb) localizes to focal adhesions and play a part in cell attachment, migration, and persistence. The assumption of our work is that parvins contribute to the capacity of tumor cells to spread. Following the extraction of primary (4T1T) and metastatic (4T1B and 4T1L) breast tumor cells from mouse metastatic breast cancer model, MTT assay and scratch test were utilized to determine the vitality and motility of the cells. qPCR was performed to examine the expression of parvins. Tumor cells did not show any difference in cellular viability in 2- or 3-dimensional cell culture. Our research illustrated that metastatic tumor cells have a higher capacity of migration. Molecular analysis revealed that parvins expression was significantly increased in metastatic breast carcinoma cells. These findings revealed new information about a major change in parvins expression in metastatic breast carcinoma cells. A targeted therapeutic approach against breast cancer metastasis could be developed using examination of the genetic characteristics of metastatic tumor cells.
Full text 53,066 characters · extracted from preprint-html · click to expand
Survival, Adhesion and Migration of Metastatic Breast Tumor Cells: Roles of Parvins (PARVA and PARVB) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Survival, Adhesion and Migration of Metastatic Breast Tumor Cells: Roles of Parvins (PARVA and PARVB) Sadegh Dylami, Mohammad Kamalabadi Farahani, Vahid Kia, Amir Atashi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4306067/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Changes in cell-ECM interaction can lead to the anchorage-independent proliferation, resistance to apoptosis, and improved motility that characterize breast metastatic cells. The parvin, alpha (Parva) and parvin, beta (Parvb) localizes to focal adhesions and play a part in cell attachment, migration, and persistence. The assumption of our work is that parvins contribute to the capacity of tumor cells to spread. Following the extraction of primary (4T1T) and metastatic (4T1B and 4T1L) breast tumor cells from mouse metastatic breast cancer model, MTT assay and scratch test were utilized to determine the vitality and motility of the cells. qPCR was performed to examine the expression of parvins. Tumor cells did not show any difference in cellular viability in 2- or 3-dimensional cell culture. Our research illustrated that metastatic tumor cells have a higher capacity of migration. Molecular analysis revealed that parvins expression was significantly increased in metastatic breast carcinoma cells. These findings revealed new information about a major change in parvins expression in metastatic breast carcinoma cells. A targeted therapeutic approach against breast cancer metastasis could be developed using examination of the genetic characteristics of metastatic tumor cells. Breast Cancer Metastasis Parvins Adhesion Migration Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction The bulk of cancer-related deaths worldwide among women are caused by the most prevalent malignancy in women, breast cancer (1, 2). The migration of malignant cells to other organs, particularly the lungs and brain, is the main reason for breast cancer deaths (3). The majority of breast cancer patients' mortality are result from metastases, a challenging procedure (4). Through a number of processes, including dissociation from extracellular matrix, intravasation, circulation in the bloodstream, extravasation, and colonization, the metastasis mediates biological and physical alterations (5). Following the molecular pathways underlying the progression of tumor cells rely on the finding the proteins that boost the spread and tumorigenesis of breast tumor cells (6). The preeminent signaling pathways underling breast cancer metastasis provide by integrins, a significant group of heterodimeric cell surface receptors (7, 8). One of major roles of integrins is cell-cell and cell-matrix adhesion. Multiple signals are sent when integrins interact with their ligands to attract kinase proteins to the cell membrane (9, 10). Kinase-lacking integrins associate with other kinases and adaptor molecules with signaling capabilities, such as integrin linked kinase (ILK), focal adhesion kinase (FAK), Parvins (Parva and Parvb), as a crucial component of the integrin signaling pathway (11, 12). Parva (a-parvin) a member of the adaptor protein family with widespread expression and was first detected by its communication with ILK (13). The modification of tumor cell shape, migration, invasion, and survival signaling has recently been shown to be mediated by a-parvin in cultured cells (14, 15). A focal adhesion protein known as Parvb (b-parvin) has been linked to integrin-mediated cell adherence through its interaction with the ILK (16). Despite the fact that there are several research about their function in breast cancer, the roles of b-parvin and a-parvin in cell survival and migration of breast cancer metastatic tumor cells have not been specifically revealed. Here, we evaluated the cellular viability and motility of metastatic breast cancer cells(4T1B,4T1L) in comparison to the primary breast cancer cells(4T1T). Furthermore, we examined the expression level of Parva and Parvb in in these tumor cells. Materials and Methods Cell Culture The primary and metastatic(lung (4T1L) and brain(4T1B)) tumor cells were isolated and characterized according to our former study (17). NIH-3T3 mouse embryo fibroblastic cell line was attained from the Pasteur Institute of Iran. Cells were seeded in DMEM (10% FBS, 100 U/ml Penicillin, and 100 ug/ml Streptomycin) (Gibco, USA). Preparation of 2D and 3D Culture of Tumor Cells The steps of suspension cancer cells: 1- To receive 2D culture, tumor cells were cultured in concentration of 1× 10 4 cells/well in 96-well plates and cultured in DMEM media in 5% CO2 at 37°C. 2- For 3D spheroids, tumor cells were seeded at a density of 1× 10 4 cells/well in an UAM plate (Ultra-Low-Attachment Microplate, 96-well) and cultured in spheroid forming medium (0.5% FBS ,2% Pen-Strep) in 5% CO2 at 37°C for 6 days. MTT assay For viability assessment MTT assay was done in different time points. Former medium was eliminated and 50ul (microliter) of MTT mixture with 5 mg/ml (Sigma) was putted in the cultures. Then, 150ul of DMSO was added and incubation prolonged for more than 4-h period, Finally, dissolved formed formazon crystals for 30 min, analyzing of OD was performed at 570 nm. This technique was conducted in triplicate. Invasion Analysis and Wound Healing Primary (4T1T) and metastatic (4T1B,4T1L) tumor cells were seeded in 12 well plates and cultured for 24 h. Cells were sustained in culture medium without FBS for 16–24 h. The cell monolayer was engraved with a 200-µl pipette tip to generate a wound, which was washed twice by PBS to eliminate the suspended cells. The cells were sustained overnight (24h) in serum-including medium, and cells migrating from the leading edge were monitored at 0 and 24 h through a CK40 inverted microscope (Olympus, Tokyo, Japan). Quantitative Real Time PCR (RT-qPCR) 4T1T and 4T1B, 4T1L tumor cells (1×10 4 ) were seeded in a 24-well plate. Whole RNA extraction, cDNA synthesis and q-PCR procedure were conducted according to our former study. RNA extraction was performed by (Kit belong to- parstous institute). The quality of RNA was analyzed through nanodrop and electrophoresis. The cDNA synthesis was carried out utilizing parstous Kit. RT-qPCR was performed with 1ul cDNA in total target conforming to the companies’ manual, (SYBR Green Real-time PCR Master Mix) (Amplicon A/S, Denmark) by BioRad System. The PCR temperature cycling profile was as follows: 1 cycle of 95°C for 15 min, 40 cycles of 95°C for 30 sec, 56.7C for 30 sec, and 72°C for 30 sec. Each target was measured in triplicate. Expression level of any sample was evaluated by the 1/ΔCT method (GAPDH regarded as normalization controls). ΔCT calculation: (CT of parvins (PARV A or PARV B)) − (CT of GAPDH). Primer Design Oligonucleotides were designed through AlleleID version 6 software Genes Accession number FW (5' − 3) Rev (5' − 3) Parvin-B NM_133167.3 GTG TAC CTA GTT CTACTTCTGG AAG TTC ACC ACA TCTTCAGG Parvin-A NM_020606.6 CAT CAA CCT GCC TCTTAGC ATG TCT CAG TCC TGTCTATATG GAPDH NM_001289726.2 CCTGGAGAAACCTGCCAAGTA GGCATCGAAGGTGGAAGAGT Statistical analysis Results are indicated as the mean ± standard deviation. Data were analyzed using GraphPad Prism statistical software 9.0 (GraphPad Software, La Jolla, CA, USA). One way ANOVA was used. P < 0.05 was considered statistically significant. Results 2D and 3D Culture of Metastatic(4T1B,4T1L) and Primary(4T1T) Tumor Cells The primary and highly metastatic tumor cells were isolated from cancerous mice tissues. Since the high rate of growth and proliferation, the tumor cells in these colonies are purified after 3 passages. The primary tumor cells (4T1T) and metastatic counterpart (4T1B,4T1L) have been cultured in 2D cell culture condition (Fig. 1 ). For 3D spheroid formation among the tumor cells, we utilized non-adherent 96 well plates. As indicated in Fig. 1 , after six days, the spheroids formed in the well. Viability of Tumor Cells in 2D and 3D Spheroids Cell viability was measured through MTT technique to discover the viability of breast cancer cells both in 2D and 3D. As shown in Fig. 2 , that cell viability was not differ between 2D and 3D. Higher Cells Migration Ability of Metastatic Tumor Cells The next stage was an analysis on migration ability of tumor cells in 2D cell culture. This was evaluated by wound healing, which is the sophisticate, dynamic process of movement and renewal of missing cells. Inspection of live cells’ motility is a powerful method to measure the rate of migration into the space generated by the original wound. The optimal situation is when the wound closes as little as possible, so the gap area value over the area of the original wound remains as great as possible, preferably for a prolonged period. Compared with other group, in 4T1B group, cell migration was very dynamic, achieving a value of 40% after only 24 h. As seen, after 48 h there was narrow signs of the wound (Fig. 3 ). Up-Regulation of PARVB, PARVA in 4T1B, 4T1L As shown in Fig. 4 , results revealed that, the level of Parvb and Parva was significantly increased in metastatic breast cancer cells (4T1B, 4T1L) compare to primary breast cancer cells(4T1T). To examine the expression level of Parvb and Parvb in control samples, we used mouse fibroblastic cell line (3T3 cell line) as a control sample. Interestingly, the results showed that compared with the 3T3 cell line, level of Parvb, and Parva were higher in metastatic tumor cells but lower in primary breast cancer. Discussion The fundamental mechanism of cell movement, the integrin signaling pathway, is involved in practically every stage of cancer progression, from the creation of the original tumor to migration, metastasis, and invasion. Here, our research has demonstrated that breast metastatic carcinoma cells have a higher propensity for migration. In our findings, a considerable up-regulation of Parvb and Parva associated with promotion of invasion, metastasis and breast cancer progressions have been revealed. Recent evidences demonstrate that the overexpression of Parva encourages the spread and progression of breast cancer (2). In 2004 Wataru Mishima et al. demonstrated that over-expression of b-parvin facilitated cell spreading and migration in the MDCK(Madin-Darby canine kidney) cell line (18). Ay-Huey Huang and colleagues reported in 2014 that overexpression of Parva boosted invasion, colony-forming capacity, and vascular mimicry in metastatic lung cancer (15). According to Jeanine Pignatelli et al. (2012), invasive breast cancer cell line MDA-MB-231 has higher levels of phosphorylation of α-Parvin than normal breast epithelial MCF10A cells (19). One of the crucial components for comprehending cell migration and metastasis in breast cancer is the interaction between integrin signaling and actin cytoskeletal dynamics (18). In metastatic tumor cells, ILK conducted the phosphorylation of FAK in response to growth factors or chemokine ligands, and this event ultimately results in the activation of downstream integrins signaling proteins(20). Therefore, in various cancer model systems, overexpression of integrin binding proteins such parvins and other downstream proteins results in invasive, migrating, and metastatic phenotype. In present study, a higher potential of breast metastatic tumor cells was correlated to up-regulation of Parvb and Parva in these cells. We also measured the level of Parvb and Parva in fibroblastic cell line (3T3 cell line) to confirm if the increased expression level of parvins is related to metastasis in breast cancer. We found that these genes were downregulated in primary breast cancer cells compared to fibroblastic cell lines, but upregulated in metastatic counterparts. This result is a crucial piece of evidence supporting the link between parvins and metastasis. Conclusion In order to obtain reliable results, we analyzed newly extracted primary and metastatic breast cancer cells from the primary tumor mass, lung, and brain of carcinogenic mice model. First time, we showed a significant change in Parvb and Parva expression in metastatic tumor cells relative to primary tumor cells. Understanding the primary function of these genes in integrin signaling requires further research. To further understand the involvement of these genes in the promotion of tumorigenesis and metastasis from breast cancer, proteomic study of these genes and siRNA-mediated silencing could be appropriate. Our finding of the metastasis and carcinogenesis processes in breast cancer may be improved by further research into integrin signaling. Additionally, these genes may be a key target for the development of an efficient therapeutic for the treatment of breast cancer. Declarations Acknowledgements We would like to thank the research assistant of Shahroud University of Medical Sciences and all the participants who helped us in this project. Funding This study was supported by Grant No. 140089 from Shahroud University of Medical Sciences (SHMU). Authors' Contributions Sadegh Dylami: Performing the Experiments, Writing-Original draft preparation; Mohammad Kamalabadi Farahani: Conceptualization, Methodology, Performing the Experiments (Animal Study, Cell Culture), Supervised the Experimentators; Vahid Kia Performing the Experiments (Real Time PCR); Amir Atashi: Performing the Experiments (Primer design and Real Time PCR); All authors read and approved the final version of the manuscript. Ethics approval and consent to participate The Ethics Committee of Shahroud University of Medical Sciences approved this study for ethics in animal research (registration number: IR.SHMU.REC.1400.89). All studies were carried out in compliance with the ARRIVE guidelines (https:// arrive guidelines. org) for the reporting of animal experiments. All methods were performed in accordance with the relevant guidelines and regulations. Consent to publication Not applicable. Competing interests The author declares that they have no competing interests. Availability of data and materials The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request. Author details 1. Student Research Committee, School of Medicine, Shahroud University of Medical Sciences, Shahroud, Iran. 2. Department of Tissue Engineering, School of Medicine, Shahroud University of Medical Sciences, Shahroud, Iran . 3. Department of Medical Biotechnology, School of Medicine, Shahroud University of Medical Sciences, Shahroud, Iran . 4. Department of Medical Laboratory Sciences, School of Allied Medical Sciences, Shahroud University of Medical Sciences, Shahroud, Iran. References Tsirtsaki K, Gkretsi V. The focal adhesion protein Integrin-Linked Kinase (ILK) as an important player in breast cancer pathogenesis. Cell Adhesion & Migration. 2020;14(1):204–13. Arzanova E, Mayrovitz HN. The Epidemiology of Breast Cancer. Exon Publications. 2022:1-19. Sun Y, Ding Y, Guo C, Liu C, Ma P, Ma S, et al. α-Parvin promotes breast cancer progression and metastasis through interaction with G3BP2 and regulation of TWIST1 signaling. Oncogene. 2019;38(24):4856–74. Tayyeb B, Parvin M. Pathogenesis of breast cancer metastasis to brain: a comprehensive approach to the signaling network. Molecular neurobiology. 2016;53:446-54. Scully OJ, Bay B-H, Yip G, Yu Y. Breast cancer metastasis. Cancer genomics & proteomics. 2012;9(5):311–20. Qu Y, Hao C, Xu J, Cheng Z, Wang W, Liu H. ILK promotes cell proliferation in breast cancer cells by activating the PI3K/Akt pathway. Molecular Medicine Reports. 2017;16(4):5036–42. Lahlou H, Muller WJ. β1-integrins signaling and mammary tumor progression in transgenic mouse models: implications for human breast cancer. Breast Cancer Research. 2011;13(6):1–10. Barczyk M, Carracedo S, Gullberg D. Integrins. Cell and tissue research. 2010;339:269-80. Guan J-L. Integrin signaling through FAK in the regulation of mammary stem cells and breast cancer. IUBMB life. 2010;62(4):268–76. Hehlgans S, Haase M, Cordes N. Signalling via integrins: implications for cell survival and anticancer strategies. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer. 2007;1775(1):163–80. Felding-Habermann B, O'Toole TE, Smith JW, Fransvea E, Ruggeri ZM, Ginsberg MH, et al. Integrin activation controls metastasis in human breast cancer. Proceedings of the National Academy of Sciences. 2001;98(4):1853–8. Guan JL. Integrin signaling through FAK in the regulation of mammary stem cells and breast cancer. IUBMB life. 2010;62(4):268-76. Mongroo PS, Johnstone CN, Naruszewicz I, Leung-Hagesteijn C, Sung RK, Carnio L, et al. β-parvin inhibits integrin-linked kinase signaling and is downregulated in breast cancer. Oncogene. 2004;23(55):8959–70. Mongroo PS. The adapter protein ParvB inhibits ILK oncogenic signaling and potentiates PPARG1 activation in breast cancer cells2007 2007. Huang A-H, Pan S-H, Chang W-H, Hong Q-S, Chen JJ, Yu S-L. PARVA promotes metastasis by modulating ILK signalling pathway in lung adenocarcinoma. PLoS One. 2015;10(3):e0118530. Yamaji S, Suzuki A, Sugiyama Y, Koide Y-i, Yoshida M, Kanamori H, et al. A novel integrin-linked Kinase–Binding protein, affixin, is involved in the early stage of Cell–Substrate interaction. The Journal of cell biology. 2001;153(6):1251-64. Kamalabadi-Farahani M, Karimi R, Atashi A. High percentage of Cancer Stem cells in metastatic locations: Upregulation of cicBIRC6 in highly metastatic breast Cancer Subline. Molecular Biology Reports. 2023;50(2):1303-9. Mishima W, Suzuki A, Yamaji S, Yoshimi R, Ueda A, Kaneko T, et al. The first CH domain of affixin activates Cdc42 and Rac1 through αPIX, a Cdc42/Rac1‐specific guanine nucleotide exchanging factor. Genes to Cells. 2004;9(3):193-204. Pignatelli J, LaLonde SE, LaLonde DP, Clarke D, Turner CE. Actopaxin (α-parvin) phosphorylation is required for matrix degradation and cancer cell invasion. Journal of Biological Chemistry. 2012;287(44):37309-20. Hinton CV, Avraham S, Avraham HK. Contributions of integrin-linked kinase to breast cancer metastasis and tumourigenesis. Journal of cellular and molecular medicine. 2008;12(5a):1517–26. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4306067","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":299156490,"identity":"da6167cc-33f2-49ac-ab0b-81906d849fa2","order_by":0,"name":"Sadegh Dylami","email":"","orcid":"","institution":"Shahroud University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Sadegh","middleName":"","lastName":"Dylami","suffix":""},{"id":299156493,"identity":"e132fa53-325c-4321-80b0-65d0069a8414","order_by":1,"name":"Mohammad Kamalabadi Farahani","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIie3OIQvCQBTA8TcGS6erJ4PtK2gRQcSvcofB4oLNYDBpM7tvMRgsnzzQ4MC6sCAINmEyEJN4E7QoN2yG+4cXHu8HD0Cn+8NoOQ4gANAU5msrKgl7Eov9SgRpmqrLd43Fjudsmnn1LSmK8QjBXggDJwriED+ibHNqBViLnSBGoAmDdaIgLvghZRYaoSRmTRJIAdYzFbHP0Y3dsR8iORYl8aqIQ/2Y8jlyScApSbOKNFbnuMOXp0GAVluSIWklfKYkdO9HaX7Ness9lo91XXeLeFGRjwiA8RPQ6XQ63ZceVbtXNk8DndkAAAAASUVORK5CYII=","orcid":"","institution":"Shahroud University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Mohammad","middleName":"Kamalabadi","lastName":"Farahani","suffix":""},{"id":299156497,"identity":"3bd6d2d9-f989-4764-9bd9-0c90658c9c1c","order_by":2,"name":"Vahid Kia","email":"","orcid":"","institution":"Shahroud University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Vahid","middleName":"","lastName":"Kia","suffix":""},{"id":299156500,"identity":"e8f1d364-62f3-4ea0-98aa-aae7bb947273","order_by":3,"name":"Amir Atashi","email":"","orcid":"","institution":"Shahroud University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Amir","middleName":"","lastName":"Atashi","suffix":""}],"badges":[],"createdAt":"2024-04-22 13:08:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4306067/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4306067/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56246036,"identity":"76fd8f10-454c-4c0e-856d-55978f24c148","added_by":"auto","created_at":"2024-05-10 11:08:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":980750,"visible":true,"origin":"","legend":"\u003cp\u003e2D and 3D Culture of Primary and Metastatic Tumor Cells. The primary tumor cells (4T1T) and metastatic counterpart (4T1B,4T1L) have been cultured in 2D cell culture condition. 3Dspheroids formed after 6 days culture in spheroids forming media.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4306067/v1/374396f3f800a59e13bd0c3c.png"},{"id":56246013,"identity":"2b7588b7-2c49-4176-98cd-57a0126dcfdf","added_by":"auto","created_at":"2024-05-10 11:08:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":144253,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCell Viability Assessment with MTT:\u003c/strong\u003e The cellular viability in normal condition was not differ among tumor cells in 2D and 3D culture\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4306067/v1/6a73c71568a2a6d13b89af48.png"},{"id":56246077,"identity":"0fd462cd-bffa-436e-bcaa-ae1b4888ef42","added_by":"auto","created_at":"2024-05-10 11:09:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1217918,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWound Scratch Assay:\u003c/strong\u003eCompared with other group, in brain metastatic tumor cells (4T1B), cell migration was very dynamic. In these cells, the wound achieving a value of 40% after only 24 h and after 48 h there was narrow signs of the wound.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4306067/v1/6805457e4f9de276ff40a8d5.png"},{"id":56246079,"identity":"e309a6a5-bb9d-4a01-a602-b4e75668e14b","added_by":"auto","created_at":"2024-05-10 11:09:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":98887,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUp-Regulation of PARVB and PARVA in metastatic breast cancer cells.\u003c/strong\u003e Compared to primary breast cancer cells (4T1T) and fibroblastic cell line (3T3 cell line) as control sample, PARVB and PARVA were significantly upregulated in metastatic breast cancer cells.\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4306067/v1/b6ff5d898a1f51e00c01a0b3.png"},{"id":60807713,"identity":"0b8a4485-a796-4590-990a-6c1d3b136291","added_by":"auto","created_at":"2024-07-22 10:20:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3192717,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4306067/v1/704609a8-2964-45ee-abfa-c6da661b41a3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Survival, Adhesion and Migration of Metastatic Breast Tumor Cells: Roles of Parvins (PARVA and PARVB)","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe bulk of cancer-related deaths worldwide among women are caused by the most prevalent malignancy in women, breast cancer (1, 2). The migration of malignant cells to other organs, particularly the lungs and brain, is the main reason for breast cancer deaths (3). The majority of breast cancer patients' mortality are result from metastases, a challenging procedure (4). Through a number of processes, including dissociation from extracellular matrix, intravasation, circulation in the bloodstream, extravasation, and colonization, the metastasis mediates biological and physical alterations (5). Following the molecular pathways underlying the progression of tumor cells rely on the finding the proteins that boost the spread and tumorigenesis of breast tumor cells (6).\u003c/p\u003e \u003cp\u003eThe preeminent signaling pathways underling breast cancer metastasis provide by integrins, a significant group of heterodimeric cell surface receptors (7, 8). One of major roles of integrins is cell-cell and cell-matrix adhesion. Multiple signals are sent when integrins interact with their ligands to attract kinase proteins to the cell membrane (9, 10). Kinase-lacking integrins associate with other kinases and adaptor molecules with signaling capabilities, such as integrin linked kinase (ILK), focal adhesion kinase (FAK), Parvins (Parva and Parvb), as a crucial component of the integrin signaling pathway (11, 12).\u003c/p\u003e \u003cp\u003eParva (a-parvin) a member of the adaptor protein family with widespread expression and was first detected by its communication with ILK (13). The modification of tumor cell shape, migration, invasion, and survival signaling has recently been shown to be mediated by a-parvin in cultured cells (14, 15). A focal adhesion protein known as Parvb (b-parvin) has been linked to integrin-mediated cell adherence through its interaction with the ILK (16).\u003c/p\u003e \u003cp\u003eDespite the fact that there are several research about their function in breast cancer, the roles of b-parvin and a-parvin in cell survival and migration of breast cancer metastatic tumor cells have not been specifically revealed. Here, we evaluated the cellular viability and motility of metastatic breast cancer cells(4T1B,4T1L) in comparison to the primary breast cancer cells(4T1T). Furthermore, we examined the expression level of Parva and Parvb in in these tumor cells.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture\u003c/h2\u003e \u003cp\u003eThe primary and metastatic(lung (4T1L) and brain(4T1B)) tumor cells were isolated and characterized according to our former study (17). NIH-3T3 mouse embryo fibroblastic cell line was attained from the Pasteur Institute of Iran. Cells were seeded in DMEM (10% FBS, 100 U/ml Penicillin, and 100 ug/ml Streptomycin) (Gibco, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of 2D and 3D Culture of Tumor Cells\u003c/h2\u003e \u003cp\u003eThe steps of suspension cancer cells:\u003c/p\u003e \u003cp\u003e1- To receive 2D culture, tumor cells were cultured in concentration of 1\u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well in 96-well plates and cultured in DMEM media in 5% CO2 at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003e2- For 3D spheroids, tumor cells were seeded at a density of 1\u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well in an UAM plate (Ultra-Low-Attachment Microplate, 96-well) and cultured in spheroid forming medium (0.5% FBS ,2% Pen-Strep) in 5% CO2 at 37\u0026deg;C for 6 days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMTT assay\u003c/h2\u003e \u003cp\u003eFor viability assessment MTT assay was done in different time points. Former medium was eliminated and 50ul (microliter) of MTT mixture with 5 mg/ml (Sigma) was putted in the cultures. Then, 150ul of DMSO was added and incubation prolonged for more than 4-h period, Finally, dissolved formed formazon crystals for 30 min, analyzing of OD was performed at 570 nm. This technique was conducted in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eInvasion Analysis and Wound Healing\u003c/h2\u003e \u003cp\u003ePrimary (4T1T) and metastatic (4T1B,4T1L) tumor cells were seeded in 12 well plates and cultured for 24 h. Cells were sustained in culture medium without FBS for 16\u0026ndash;24 h. The cell monolayer was engraved with a 200-\u0026micro;l pipette tip to generate a wound, which was washed twice by PBS to eliminate the suspended cells. The cells were sustained overnight (24h) in serum-including medium, and cells migrating from the leading edge were monitored at 0 and 24 h through a CK40 inverted microscope (Olympus, Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative Real Time PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003e4T1T and 4T1B, 4T1L tumor cells (1\u0026times;10\u003csup\u003e4\u003c/sup\u003e) were seeded in a 24-well plate. Whole RNA extraction, cDNA synthesis and q-PCR procedure were conducted according to our former study. RNA extraction was performed by (Kit belong to- parstous institute). The quality of RNA was analyzed through nanodrop and electrophoresis. The cDNA synthesis was carried out utilizing parstous Kit. RT-qPCR was performed with 1ul cDNA in total target conforming to the companies\u0026rsquo; manual, (SYBR Green Real-time PCR Master Mix) (Amplicon A/S, Denmark) by BioRad System. The PCR temperature cycling profile was as follows: 1 cycle of 95\u0026deg;C for 15 min, 40 cycles of 95\u0026deg;C for 30 sec, 56.7C for 30 sec, and 72\u0026deg;C for 30 sec. Each target was measured in triplicate. Expression level of any sample was evaluated by the 1/ΔCT method (GAPDH regarded as normalization controls). ΔCT calculation: (CT of parvins (PARV A or PARV B)) \u0026minus; (CT of GAPDH).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePrimer Design\u003c/h2\u003e \u003cp\u003eOligonucleotides were designed through AlleleID version 6 software\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW (5' \u0026minus;\u0026thinsp;3)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRev (5' \u0026minus;\u0026thinsp;3)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParvin-B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_133167.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTG TAC CTA GTT CTACTTCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAG TTC ACC ACA TCTTCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParvin-A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_020606.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAT CAA CCT GCC TCTTAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATG TCT CAG TCC TGTCTATATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001289726.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGGAGAAACCTGCCAAGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCATCGAAGGTGGAAGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eResults are indicated as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Data were analyzed using GraphPad Prism statistical software 9.0 (GraphPad Software, La Jolla, CA, USA). One way ANOVA was used. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2D and 3D Culture of Metastatic(4T1B,4T1L) and Primary(4T1T) Tumor Cells\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe primary and highly metastatic tumor cells were isolated from cancerous mice tissues. Since the high rate of growth and proliferation, the tumor cells in these colonies are purified after 3 passages. The primary tumor cells (4T1T) and metastatic counterpart (4T1B,4T1L) have been cultured in 2D cell culture condition (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). For 3D spheroid formation among the tumor cells, we utilized non-adherent 96 well plates. As indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, after six days, the spheroids formed in the well.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eViability of Tumor Cells in 2D and 3D Spheroids\u003c/h2\u003e \u003cp\u003eCell viability was measured through MTT technique to discover the viability of breast cancer cells both in 2D and 3D. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, that cell viability was not differ between 2D and 3D.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eHigher Cells Migration Ability of Metastatic Tumor Cells\u003c/h2\u003e \u003cp\u003eThe next stage was an analysis on migration ability of tumor cells in 2D cell culture. This was evaluated by wound healing, which is the sophisticate, dynamic process of movement and renewal of missing cells. Inspection of live cells\u0026rsquo; motility is a powerful method to measure the rate of migration into the space generated by the original wound. The optimal situation is when the wound closes as little as possible, so the gap area value over the area of the original wound remains as great as possible, preferably for a prolonged period. Compared with other group, in 4T1B group, cell migration was very dynamic, achieving a value of 40% after only 24 h. As seen, after 48 h there was narrow signs of the wound (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eUp-Regulation of PARVB, PARVA in 4T1B, 4T1L\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, results revealed that, the level of Parvb and Parva was significantly increased in metastatic breast cancer cells (4T1B, 4T1L) compare to primary breast cancer cells(4T1T). To examine the expression level of Parvb and Parvb in control samples, we used mouse fibroblastic cell line (3T3 cell line) as a control sample. Interestingly, the results showed that compared with the 3T3 cell line, level of Parvb, and Parva were higher in metastatic tumor cells but lower in primary breast cancer.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe fundamental mechanism of cell movement, the integrin signaling pathway, is involved in practically every stage of cancer progression, from the creation of the original tumor to migration, metastasis, and invasion. Here, our research has demonstrated that breast metastatic carcinoma cells have a higher propensity for migration. In our findings, a considerable up-regulation of Parvb and Parva associated with promotion of invasion, metastasis and breast cancer progressions have been revealed.\u003c/p\u003e \u003cp\u003eRecent evidences demonstrate that the overexpression of Parva encourages the spread and progression of breast cancer (2). In 2004 Wataru Mishima et al. demonstrated that over-expression of b-parvin facilitated cell spreading and migration in the MDCK(Madin-Darby canine kidney) cell line (18). Ay-Huey Huang and colleagues reported in 2014 that overexpression of Parva boosted invasion, colony-forming capacity, and vascular mimicry in metastatic lung cancer (15). According to Jeanine Pignatelli et al. (2012), invasive breast cancer cell line MDA-MB-231 has higher levels of phosphorylation of α-Parvin than normal breast epithelial MCF10A cells (19).\u003c/p\u003e \u003cp\u003eOne of the crucial components for comprehending cell migration and metastasis in breast cancer is the interaction between integrin signaling and actin cytoskeletal dynamics (18). In metastatic tumor cells, ILK conducted the phosphorylation of FAK in response to growth factors or chemokine ligands, and this event ultimately results in the activation of downstream integrins signaling proteins(20). Therefore, in various cancer model systems, overexpression of integrin binding proteins such parvins and other downstream proteins results in invasive, migrating, and metastatic phenotype. In present study, a higher potential of breast metastatic tumor cells was correlated to up-regulation of Parvb and Parva in these cells.\u003c/p\u003e \u003cp\u003eWe also measured the level of Parvb and Parva in fibroblastic cell line (3T3 cell line) to confirm if the increased expression level of parvins is related to metastasis in breast cancer. We found that these genes were downregulated in primary breast cancer cells compared to fibroblastic cell lines, but upregulated in metastatic counterparts. This result is a crucial piece of evidence supporting the link between parvins and metastasis.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn order to obtain reliable results, we analyzed newly extracted primary and metastatic breast cancer cells from the primary tumor mass, lung, and brain of carcinogenic mice model. First time, we showed a significant change in Parvb and Parva expression in metastatic tumor cells relative to primary tumor cells. Understanding the primary function of these genes in integrin signaling requires further research. To further understand the involvement of these genes in the promotion of tumorigenesis and metastasis from breast cancer, proteomic study of these genes and siRNA-mediated silencing could be appropriate.\u003c/p\u003e \u003cp\u003eOur finding of the metastasis and carcinogenesis processes in breast cancer may be improved by further research into integrin signaling. Additionally, these genes may be a key target for the development of an efficient therapeutic for the treatment of breast cancer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the research assistant of Shahroud University of Medical\u003c/p\u003e\n\u003cp\u003eSciences and all the participants who helped us in this project.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Grant No. 140089 from Shahroud University of Medical Sciences (SHMU).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Authors\u0026apos; Contributions\u003c/p\u003e\n\u003cp\u003eSadegh Dylami: Performing the Experiments, Writing-Original draft preparation; Mohammad Kamalabadi Farahani: Conceptualization, Methodology, Performing the Experiments (Animal Study, Cell Culture), Supervised the Experimentators; Vahid Kia Performing the Experiments (Real Time PCR); Amir Atashi: Performing the Experiments (Primer design and Real Time PCR); All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee of Shahroud University of Medical Sciences approved this study for ethics in animal research (registration number: IR.SHMU.REC.1400.89). All studies were carried out in compliance with the ARRIVE guidelines (https:// arrive guidelines. org) for the reporting of animal experiments.\u003c/p\u003e\n\u003cp\u003eAll methods were performed in accordance with the relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author declares that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1. Student Research Committee, School of Medicine, Shahroud University of Medical Sciences, Shahroud, Iran. 2. Department of Tissue Engineering, School of Medicine, Shahroud University of Medical Sciences,\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eShahroud, Iran\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e3. Department of Medical Biotechnology, School of Medicine, Shahroud University of Medical Sciences,\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eShahroud, Iran\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e4. Department of Medical Laboratory Sciences, School of Allied Medical Sciences, Shahroud University of Medical Sciences, Shahroud, Iran.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTsirtsaki K, Gkretsi V. The focal adhesion protein Integrin-Linked Kinase (ILK) as an important player in breast cancer pathogenesis. Cell Adhesion \u0026amp; Migration. 2020;14(1):204\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eArzanova E, Mayrovitz HN. The Epidemiology of Breast Cancer. Exon Publications. 2022:1-19.\u003c/li\u003e\n\u003cli\u003eSun Y, Ding Y, Guo C, Liu C, Ma P, Ma S, et al. \u0026alpha;-Parvin promotes breast cancer progression and metastasis through interaction with G3BP2 and regulation of TWIST1 signaling. Oncogene. 2019;38(24):4856\u0026ndash;74.\u003c/li\u003e\n\u003cli\u003eTayyeb B, Parvin M. Pathogenesis of breast cancer metastasis to brain: a comprehensive approach to the signaling network. Molecular neurobiology. 2016;53:446-54.\u003c/li\u003e\n\u003cli\u003eScully OJ, Bay B-H, Yip G, Yu Y. Breast cancer metastasis. Cancer genomics \u0026amp; proteomics. 2012;9(5):311\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eQu Y, Hao C, Xu J, Cheng Z, Wang W, Liu H. ILK promotes cell proliferation in breast cancer cells by activating the PI3K/Akt pathway. Molecular Medicine Reports. 2017;16(4):5036\u0026ndash;42.\u003c/li\u003e\n\u003cli\u003eLahlou H, Muller WJ. \u0026beta;1-integrins signaling and mammary tumor progression in transgenic mouse models: implications for human breast cancer. Breast Cancer Research. 2011;13(6):1\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eBarczyk M, Carracedo S, Gullberg D. Integrins. Cell and tissue research. 2010;339:269-80.\u003c/li\u003e\n\u003cli\u003eGuan J-L. Integrin signaling through FAK in the regulation of mammary stem cells and breast cancer. IUBMB life. 2010;62(4):268\u0026ndash;76.\u003c/li\u003e\n\u003cli\u003eHehlgans S, Haase M, Cordes N. Signalling via integrins: implications for cell survival and anticancer strategies. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer. 2007;1775(1):163\u0026ndash;80.\u003c/li\u003e\n\u003cli\u003eFelding-Habermann B, O\u0026apos;Toole TE, Smith JW, Fransvea E, Ruggeri ZM, Ginsberg MH, et al. Integrin activation controls metastasis in human breast cancer. Proceedings of the National Academy of Sciences. 2001;98(4):1853\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eGuan JL. Integrin signaling through FAK in the regulation of mammary stem cells and breast cancer. IUBMB life. 2010;62(4):268-76.\u003c/li\u003e\n\u003cli\u003eMongroo PS, Johnstone CN, Naruszewicz I, Leung-Hagesteijn C, Sung RK, Carnio L, et al. \u0026beta;-parvin inhibits integrin-linked kinase signaling and is downregulated in breast cancer. Oncogene. 2004;23(55):8959\u0026ndash;70.\u003c/li\u003e\n\u003cli\u003eMongroo PS. The adapter protein ParvB inhibits ILK oncogenic signaling and potentiates PPARG1 activation in breast cancer cells2007 2007.\u003c/li\u003e\n\u003cli\u003eHuang A-H, Pan S-H, Chang W-H, Hong Q-S, Chen JJ, Yu S-L. PARVA promotes metastasis by modulating ILK signalling pathway in lung adenocarcinoma. PLoS One. 2015;10(3):e0118530.\u003c/li\u003e\n\u003cli\u003eYamaji S, Suzuki A, Sugiyama Y, Koide Y-i, Yoshida M, Kanamori H, et al. A novel integrin-linked Kinase\u0026ndash;Binding protein, affixin, is involved in the early stage of Cell\u0026ndash;Substrate interaction. The Journal of cell biology. 2001;153(6):1251-64.\u003c/li\u003e\n\u003cli\u003eKamalabadi-Farahani M, Karimi R, Atashi A. High percentage of Cancer Stem cells in metastatic locations: Upregulation of cicBIRC6 in highly metastatic breast Cancer Subline. Molecular Biology Reports. 2023;50(2):1303-9.\u003c/li\u003e\n\u003cli\u003eMishima W, Suzuki A, Yamaji S, Yoshimi R, Ueda A, Kaneko T, et al. The first CH domain of affixin activates Cdc42 and Rac1 through \u0026alpha;PIX, a Cdc42/Rac1‐specific guanine nucleotide exchanging factor. Genes to Cells. 2004;9(3):193-204.\u003c/li\u003e\n\u003cli\u003ePignatelli J, LaLonde SE, LaLonde DP, Clarke D, Turner CE. Actopaxin (\u0026alpha;-parvin) phosphorylation is required for matrix degradation and cancer cell invasion. Journal of Biological Chemistry. 2012;287(44):37309-20.\u003c/li\u003e\n\u003cli\u003eHinton CV, Avraham S, Avraham HK. Contributions of integrin-linked kinase to breast cancer metastasis and tumourigenesis. Journal of cellular and molecular medicine. 2008;12(5a):1517\u0026ndash;26.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Breast Cancer, Metastasis, Parvins, Adhesion, Migration","lastPublishedDoi":"10.21203/rs.3.rs-4306067/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4306067/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eChanges in cell-ECM interaction can lead to the anchorage-independent proliferation, resistance to apoptosis, and improved motility that characterize breast metastatic cells. The parvin, alpha (Parva) and parvin, beta (Parvb) localizes to focal adhesions and play a part in cell attachment, migration, and persistence. The assumption of our work is that parvins contribute to the capacity of tumor cells to spread.\u003c/p\u003e \u003cp\u003eFollowing the extraction of primary (4T1T) and metastatic (4T1B and 4T1L) breast tumor cells from mouse metastatic breast cancer model, MTT assay and scratch test were utilized to determine the vitality and motility of the cells. qPCR was performed to examine the expression of parvins.\u003c/p\u003e \u003cp\u003eTumor cells did not show any difference in cellular viability in 2- or 3-dimensional cell culture.\u003c/p\u003e \u003cp\u003eOur research illustrated that metastatic tumor cells have a higher capacity of migration. Molecular analysis revealed that parvins expression was significantly increased in metastatic breast carcinoma cells.\u003c/p\u003e \u003cp\u003eThese findings revealed new information about a major change in parvins expression in metastatic breast carcinoma cells. A targeted therapeutic approach against breast cancer metastasis could be developed using examination of the genetic characteristics of metastatic tumor cells.\u003c/p\u003e","manuscriptTitle":"Survival, Adhesion and Migration of Metastatic Breast Tumor Cells: Roles of Parvins (PARVA and PARVB)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-10 11:05:58","doi":"10.21203/rs.3.rs-4306067/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9a556e1c-c84b-487c-b72a-8901190acbba","owner":[],"postedDate":"May 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-22T10:12:17+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-10 11:05:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4306067","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4306067","identity":"rs-4306067","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-02T02:00:03.124865+00:00
License: CC-BY-4.0