Bifidobacterium animalis sup F1-7 and Lactobacillus plantarum FWDG alleviate the malnutrition of mice via ghrelin-GHSR/PKC pathway

Bifidobacterium animalis sup F1-7 and Lactobacillus plantarum FWDG alleviate the malnutrition of mice via ghrelin-GHSR/PKC pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Bifidobacterium animalis sup F1-7 and Lactobacillus plantarum FWDG alleviate the malnutrition of mice via ghrelin-GHSR/PKC pathway Youyou Lu, Ruiqi Wang, Yeting Wu, Qingyu Cui, Xiaoying Tian, Zhe Zhang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2020767/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose : Intestinal microecology was closely related to malnutrition, but the related mechanism was still unclear. This study aimed to reveal how microorganisms alleviated malnutrition via ghrelin-GHSR/PKC-SCFAs pathway. Methods and results : Melanoma cells B16F10-induced malnourished mice of lung cancer. Strains Bif. animalis F1-7 and L. plantarum FWDG alleviated the malnutrition of mice to some extent by increasing the dietary intake level of mice, but the effect of Bif. animalis F1-7 was more prominent. This process was through increasing the expression level of GHSR and PKC, reducing the expression level of IP3, and finally regulating the secretion level of ghrelin and improving the anorexia of mice. Meanwhile, Bif. animalis F1-7 also reduced the expression levels of GLUT2, SGLT1 and PEPT1 genes and proteins, promoted the increase of acetic acid, butyric acid, isovaleric acid and total acid levels, regulated the nutritional transport process of intestinal energy, and finally improved the nutritional status of tumor mice via ghrelin-GHSR/PKC-SCFAs pathway. Conclusion : Our study provided a data support for the application of potentially beneficial microorganisms of Bif.animalis F1-7 could acts as an auxiliary component to alleviate malnutrition. malnutrition Bifidobacterium animalis sup F1-7 Lactobacillus plantarum FWDG ghrelin GHSR/PKC pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1 Introduction Tumor induced malnutrition was a disease caused by systemic inflammation caused by cancer [ 1 ] . Inflammation led to anorexia and tissue destruction, leading to malnutrition [ 2 ] , weight loss, changes in body composition and physical decline [ 1 ] . Malnutrition in cancer patients could also lead to increase postoperative complications [ 3 , 4 ] ,more toxic and side effects [ 5 , 6 ] ,poor response to antitumor treatment, higher mortality [ 3 ] and worse quality of life [ 7 ] . From the perspective of malnutrition, there were two possible causes of malnutrition in tumor patients: the first one was insufficient nutritional intake, which mainly referred to anorexia and loss of appetite. The second was the lack of nutrient absorption, including the obstacle of patients' nutrient transporters to nutrients absorption, and the effect of metabolites formed by food digestion, such as short chain fatty acids (SCFAs) and other energy nutrients on the absorption of intestinal cells[8]. Cancer related anorexia was the main factor causing tumor malnutrition, 50–80% of advanced cancer patients had anorexia cachexia syndrome, and the incidence of lung cancer and gastrointestinal cancer was the highest. However, there were many pathogeneses of anorexia, including cytokines, gastrointestinal peptides, appetite hormones and so on, but the factors that play a role in cancer anorexia were not clear[9]. Melanoma was a skin tumor caused by abnormal melanocyte hyperplasia, it had the characteristics of high degree of malignancy and high mortality. The annual incidence rate of melanoma was 3%-5%. It was one of the fastest growing malignant tumors. Many newly diagnosed patients had reached the middle and advanced stage. The tumor cells had been spread to the liver and lung through blood vessels or lymphatic vessels, resulting in poor therapeutic effect [10]. In some studies, strains intervention could promote the secretion of Ghrelin, regulate the secretion of GLP-1 and PYY, and down regulate the level of inflammatory factors, which could affect the food intake behavior to a certain extent [11]. However, it was worth exploring whether strains play an important role in improving malnutrition in tumor patients due to the above reasons. In addition to anorexia, intestinal nutrient absorption was also closely related to nutrient transporters (GLUT2, SGLT1, FABP1, PEPT1) and intestinal epithelial nutrient source SCFAs [12, 13]. However, relevant studies, especially the correlation between the above processes and intestinal microorganism, had not been reported so far. The purpose of this study was to evaluate the probiotics Lactobacillus plantarum FWDG ( L. plantarum FWDG) and Bifidobacterium animalis sup F1-7 ( Bif. animalis F1-7) the alleviate effect, and analyze the potential mechanism to alleviate the malnutrition of lung cancer mice, so as to provide a theoretical basis for the application of the beneficial microorganisms in improving tumor malnutrition. 2 Materials And Methods 2.1 Experimental strains and culture L . plantarum FWDG (CCTCC M 2020828) and Bif. animalis F1-7 (CCTCC M 2020833) were stored in the Functional Dairy and Strains Engineering Laboratory of the Ocean University of China. All strains were cultured in a De Man, Rogosa, and Sharpe agar (MRS) medium at 37°C for 48 h prior to use. The fermentation broth was centrifuged at 8000× g for 5 min at 4°C (Eppendorf Centrifuge 5804, Eppendorf Co., Ltd, China). The bacteria precipitates were collected, washed twice with sterile phosphate-buffered saline (PBS), and resuspended. The final concentration of each strain was 1×10 8 CFU mL − 1 , which were stored at 4°C for ≤ 24 h prior to use (unless specified otherwise). 2.2 Melanoma B16-F10 cell and culture Mus musculus (Mouse) Melanoma B16-F10 cell (Cell line name: B16-F10, RRID: CVCL_0159), Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) was obtained from Procell Life Science & Technology Co, Ltd (China). All experiments were performed with mycoplasma-free cells. B16-F10 cells were cultured in DMEM medium supplemented with 10% FBS with 100 units mL − 1 penicillin and 100 µg mL − 1 streptomycin at 37°C in a 5% CO 2 incubator. When B16-F10 cells in logarithmic growth phase were digested with 0.25% trypsin, the culture medium was resuspended to collect the cells. The cells were washed with sterile normal saline once, centrifuged, suspended with an appropriate amount of normal saline and the cells density was adjusted to 5×10 6 mL − 1 . 2.3 Animal feeding and model construction Overall, 4-week-old female BALB/c mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (license number was SCXK2016-0006), and the indoor temperature was controlled at 25 ± 2°C, and the relative humidity was 50 ± 5%, with a 12-h light/dark cycle. Standard commercial mouse feed was fed ad libitum. Criteria used for including and excluding animals. All experiments were conducted in accordance with the EU guidelines for experimental animals (directive 2010/63/EU) and international standards-3R principle of animal welfare, in accordance with the guidelines for the care and use of laboratory animals established by the Ocean University of China. All experiments were approved by the animal ethics committee of Ocean University of China and ethical number was SPXY20210101115. The tail skin of mice was disinfected with 75% ethanol, and the above-mentioned cell suspension was inoculated into the vena cava of mice one time (0.2 mL). After inoculation, one mouse was randomly selected every two days to observe the lung tumorigenesis. When the plaque was visible, the modeling was successful. 2.4 Animal experiment design and serum/intestinal tissues samples collection There were 5 groups in total, 1 normal control group was set up (normal healthy mice of the same age + normal feeding). 48 BALB/c mice of successful lung cancer were randomly divided into 4 groups (n = 12 mice in each group): lung cancer model group, lung cancer model + positive drug (Cyclophosphamide,CTX, Shengdi Pharmaceutical Co., Ltd, Jiangsu,China), and two intervention groups of the different strains(lung cancer model + strains). The composition and dosage of gavage were showed in Table S1( Supplementary material ). The serum samples and intestinal tissues were collected, and stored at -80℃ for standby. 2.5 Determination of body weights and food intake of mice The experimental intervention period was 35 days. The body weights and food intake of all experiment mice were measured every 7 days. 2.6 Detection of serum PYY, ghrelin, leptin and intestinal ghrelin levels ELISA kits (Invitrogen, CA) were used to detect the changes of the levels of PYY, ghrelin and leptin in serum and ghrelin in intestine of mice. 2.7 Determination of key genes expression by qRT-PCR A total of 0.1 g of colon tissue was weighed accurately. Then, TRIzol reagent was used to extract total RNA from the colon tissue samples (Invitrogen, CA), and a High-Throughput Kit (Toyobo, Japan) was used for cDNA reversal. The forward and reverse primer sequences of β -actin, GHSR, PKC, IP3, GLUT2, SGLT1, FABP-1 and PEPT1 were presented in Table 1 . Quantitative real-time polymerase chain reaction (q-RTPCR) was performed on a LightCycler 96 system thermal cycler (Roche Inc., CA) using PowerUp SYBR Green Master Mix (Applied Biosystems, CA). The relative contents of each target gene were calculated by normalising the relative value of β -actin mRNA. The relative expression levels were calculated using the 2 −ΔΔCt method. Table 1 Forward and reverse primer sequences Gene name Forward (5′-3′) Reverse (5′-3′) β -actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA GHSR TTTTGTGCAAGACTGGTGCC ACACATTGTGACAAGAACGC PKC ATGCATCATCTGGACCAGGG TGAGCCCAGCTTGTTGAACT IP3 CACTCGGCTTTCGCATTGAG GCTCTCGGCTTCGTGTAGTT GLUT2 GCCTAAAACCGAGGAACCGA TACTCCTGGGTGTAGTCGCA SGLT1 CCTGTGGTACTGGTGTACGG TCACCATGAGGAACATGGGC FABP-1 TGTGGTCAGCTGTGGAAAGG GTCCTCGGGCAGACCTATTG PEPT1 CCTTAGAAGGCCAACTCCGT GGACCATCAAAGCACCAAGC 2.8 Determination of GLUT2, SGLT1, FABP-1 and PEPT1 protein expression of experiment mice 0.1 g of tissue was washed with PBS, and the mixed lysate (1 mL RIPA strong lysate, containing 1% PMSF and 1% PI) was added into each 500-mL well. After homogenization, it was centrifuged for 30 min at 15000 ×g at 4°C, and the transparent liquid in the middle layer was collected. The concentration of the extracted protein samples was determined using the BCA protein concentration assay kit (Beijing Solarbio Science & Technology Co., Ltd.). The primary antibody was GLUT2, SGLT1, FABP-1 and PEPT1 antibody (Abcam), and the internal parameter was β -actin antibody (diluted 1:1000, Abcam). The secondary antibody (diluted 1:7500, Cell Signaling Technology) was incubated at 37°C for 30 min. Bio-Spectrum Imaging Detection System (Bio-Rad, USA) was used for capturing images of the protein bands, and ImageJ software was used for quantitative grayscale analysis. 2.9 Determination of short-chain fatty acids (SCFAs) of nutrient absorption Fecal samples of mice were collected for three consecutive days and stored in an − 80°C freezer before the mice were sacrificed. Pretreatment of the fecal samples was performed according to Tao et al[14]. Diethyl butyric acid was added to the samples as an internal standard for gas chromatography analysis (Agilent, US) and was calculated according to formula (1). SCFA (µM/g) = \(\frac{\text{S}\text{C}\text{F}\text{A} \text{p}\text{e}\text{a}\text{k} \text{a}\text{r}\text{e}\text{a} }{\text{I}\text{n}\text{t}\text{e}\text{r}\text{n}\text{a}\text{l} \text{s}\text{t}\text{a}\text{n}\text{d}\text{a}\text{r}\text{d} \text{p}\text{e}\text{a}\text{k} \text{a}\text{r}\text{e}\text{a}}\) × \(\frac{\text{I}\text{n}\text{t}\text{e}\text{r}\text{n}\text{a}\text{l} \text{s}\text{t}\text{a}\text{n}\text{d}\text{a}\text{r}\text{d} \text{c}\text{o}\text{n}\text{c}\text{e}\text{n}\text{t}\text{r}\text{a}\text{t}\text{i}\text{o}\text{n} }{\text{S}\text{C}\text{F}\text{A} \text{m}\text{o}\text{l}\text{a}\text{r} \text{m}\text{a}\text{s}\text{s}}\) × \(\frac{1000000 }{\text{S}\text{a}\text{m}\text{p}\text{l}\text{e} \text{q}\text{u}\text{a}\text{l}\text{i}\text{t}\text{y}}\) (1) 2.10 Data analysis The results are expressed as the mean ± standard deviation (SD). One-way analysis of variance was used for statistical analysis using SPSS 20.0 software. Differences of p < 0.05 were considered significant. GraphPad Prism 8.0 software was used to create graphs. 3 Results 3.1 Effect of L.plantarum FWDG and Bif.animalis F1-7 on body weight and dietary intake of experiment mice The effect level of L . plantarum FWDG and Bif . animalis F1-7 gavage intervention on the body weight of mice was showed in Fig. 1. It could be seen from Fig. 1 that after 7 days, there were differences between the tumor model group and the blank control group, which proved that the formation of tumor will lead to significant weight loss of mice. With the extension of feeding time, the weight growth rate of the blank control group was significantly higher than that of the other groups. Group P is anti-tumor positive drug group, which could be seen from the figure that anti-tumor positive drugs could alleviate weight loss, but the effect was not obvious. Although the two strains intervention group could not return to the normal weight of mice, they both effectively improved the weight loss of mice at the same time. The effect level of L . plantarum FWDG and Bif . animalis F1-7 gavage intervention of the dietary intake of mice was showed in Fig. 2. It could be found from Fig. 2 that there were differences in dietary intake between the tumor model group and the blank control group, which proved that the formation of tumor will significantly reduce the dietary intake ability of mice. With the prolongation of feeding time, even if the weight of mice increased further, the change of food intake was still small. Compared with the tumor model group, the dietary intake of mice treated with positive drugs increased, but the effect was still weaker than that of the two strains intervention groups, of which Bif . animalis F1-7 group was slightly better than L . plantarum FWDG group. 3.2 Effect of L.plantarum FWDG and Bif.animalis F1-7 on serum PYY, ghrelin and leptin levels in experiment mice The serum levels of PYY, ghrelin and leptin in mice were showed in Fig. 3. As could be seen from Fig. 3A, the PYY level of the blank control group was significantly higher than that of the tumor model group, positive drug group and Bif . animalis F1-7 group. There was no significant difference in serum PYY level between the two strains. As could be seen from Fig. 3B, the Ghrelin level of the tumor model group was significantly lower than that of each group, but the Ghrelin level of the blank control group was significantly higher than that of the tumor model group and L . plantarum FWDG group, there was no significant difference in Ghrelin levels between the two strains. Figure 3C showed that the leptin level of the tumor model group was significantly lower than that of all groups, but there was no significant difference between the leptin level of the blank control group and that of other groups. 3.3 Effect of L.plantarum FWDG and Bif.animalis F1-7 on Ghrelin level in experiment mice intestine The level of Ghrelin in mouse intestine was further measured as showed in Fig. 4. In Fig. 4, it was found that the intestinal Ghrelin level in the model group and the control group was consistent with the trend in serum. The intestinal Ghrelin secretion in the model group was significantly lower than that in the control group. There was no difference between the positive drug group and the model group. The intervention of L . plantarum FWDG and Bif . animalis F1-7 strains could promote the intestinal Ghrelin secretion. 3.4 Effect of L.plantarum FWDG and Bif.animalis F1-7 on Ghrelin signaling pathway gene expression of experiment mice The relative expression of Ghrelin pathway gene of colon tissues was showed in Fig. 5. As could be seen from Fig. 5A, compared with the tumor model group, the GHSR gene of mice colon tissues in the blank control group were significantly higher than that in the tumor model group, while there was no significant difference between the positive drug group and the tumor model group. At the same time, the GHSR gene of strain L . plantarum FWDG and strain Bif . animalis F1-7 was significantly higher than that of model group, but the expression level of Bif . animalis F1-7 group was higher than that of L . plantarum FWDG group. As could be seen from Fig. 5B, compared with the tumor model group, the expression level of PKC gene in other groups was significantly higher, the order was positive drug group > blank control group > Bif . animalis F1-7 group > L . plantarum FWDG group. As could be seen from Fig. 5C, compared with the tumor model group, the expression level of IP3 gene in other groups decreased significantly, in which the order was Bif . animalis F1-7 group > blank control group > L . plantarum FWDG group > positive drug group. 3.5 Effect of L.plantarum FWDG and Bif.animalis F1-7 on potential intestinal nutrition absorption transporters of experiment mice 3.5.1 Level of the mRNA expression of GLUT2, SGLT1, FABP-1 and PEPT1 The mRNA expression levels of GLUT2, SGLT1, FABP-1 and PEPT1 were showed in Fig. 6. As could be seen from Fig. 6A, compared with the blank control group, the GLUT2 gene in the tumor model group was significantly increased, and the expression of GLUT2 was significantly reduced by positive drugs and two strains. As could be seen from Fig. 6B, compared with the blank control group, the SGLT1 gene in the tumor model group was significantly increased, and the positive drug and two strains significantly reduced the expression of SGLT1. As could be seen from Fig. 6C, compared with the blank control group, there was no significant difference, indicating that there was no correlation between FABP1 gene and intestinal nutrient absorption in mice. As could be seen from Fig. 6D, compared with the blank control group, the PEPT1 gene in the tumor model group was significantly increased, and the positive drug and two strains significantly reduced the expression of PEPT1. 3.5.2 Level of the protein expressions of GLUT2, SGLT1, FABP-1 and PEPT1 Figure 7 was obtained by Western blot on mouse intestine, and Fig. 8 was obtained by semi quantitative analysis. As could be seen from Fig. 8A, compared with the blank control group, the GLUT2 protein in the tumor model group was significantly increased, and the expression of GLUT2 protein was significantly reduced by positive drugs and two strains. As could be seen from Fig. 8B, compared with the blank control group, the SGLT1 protein in the tumor model group was significantly increased, and the expression of SGLT1 protein was significantly reduced by strain Bif . animalis F1-7. As could be seen from Fig. 8C, compared with the blank control group, there was no significant difference in FABP1 protein, indicating that there was no correlation between FABP1 protein and intestinal nutrient absorption in mice. As could be seen from Fig. 8D, compared with the blank control group, the PEPT1 protein in the tumor model group was significantly increased, and the positive drug and the two strains reduced the expression of PEPT1 protein to a certain extent. 3.6 Effect of L.plantarum FWDG and Bif.animalis F1-7 on SCFAs in experiment mice feces SCFAs in mice feces were determined and Fig. 9 was obtained. As could be seen from Fig. 9A, compared with the blank control group, the acetic acid content in the tumor model group decreased significantly, the positive drug and two strains significantly promoted the increase of acetic acid content, and the effect of Bif . animalis F1-7 was the most prominent. As could be seen from Fig. 9B, compared with the blank control group, the propionic acid content in the tumor model group decreased significantly, but the positive drugs and two strains did not promote the increase of propionic acid content. As could be seen from Fig. 9C, compared with the blank control group, the butyric acid content in the tumor model group decreased significantly, and the two strains significantly promoted the increase of butyric acid content, but there was no significant difference between the two strains. As could be seen from Fig. 9D, compared with the blank control group, the isovaleric acid content in the tumor model group decreased significantly, the positive drugs and two strains significantly promoted the increase of isovaleric acid content, and the effect of Bif . animalis F1-7 was the most prominent. As can be seen from Fig. 9E, compared with the blank control group, the content of valeric acid in the tumor model group increased significantly, and the positive drugs and two strains significantly inhibited the content of valeric acid. As could be seen from Fig. 9F, compared with the blank control group, the total acid content in the tumor model group decreased significantly, the positive drugs and two strains significantly promoted the increase of total acid content, but the effect of Bif . animalis F1-7 was the most prominent. 4 Discussion It could be seen from Fig. 1 and Fig. 2 that although the dietary intake of mice increased under the intervention of the two strains, the change range was weaker. At the same time, the weight gain of mice was obvious, so the strain may not only improve the dietary intake ability, but also improve the nutritional status of mice through other factors. Intestinal microbiota mainly participates in the sensing mechanism of intestinal nutrients through intestinal enteroendocrine cells (EECs). EEC signal was a key regulator of nutrition sensing mechanism related to intestinal brain axis [ 15 ] . EEC mainly secreted polypeptide YY (PYY) in response to food intake [ 16 ] . PYY was a gastrointestinal peptide, which could participate in appetite regulation through peripheral and central pathways, reduce intestinal motility, regulate glucose homeostasis and energy consumption, inhibit appetite and food intake [ 17 – 20 ] . PYY could not only enter the circulation and play a role in an endocrine way, but also show their role in a paracrine way by stimulating the afferent neurons innervating the intestinal wall [ 21 ] . PYY as an anorexic peptide, which increase will inhibit appetite, which was manifested in the decrease of food intake in mice. This study (Fig. 3 A) found that the PYY level of the tumor model group was lower than that of the other groups, but the dietary intake ability was not optimistic. Therefore, PYY may not be a factor leading to tumor anorexia. However, the intervention of L . plantarum FWDG group significantly increased the level of PYY, which may provide a research idea for people to improve excessive nutritional intake by PYY. In addition, the intestinal microbiota may also affect the host's appetite and metabolism through its relationship with appetite regulating hormones. Ghrelin could stimulate gastric emptying, appetite sensation and glucagon secretion, and inhibit insulin secretion and heat production [ 22 ] . The small intestine was partly involved in Ghrelin production, and food stimulated plasma Ghrelin inhibition requires postgastric feedback [ 16 , 23 , 24 ] . Some studies believed that the level of serum Ghrelin was negatively correlated with Bifidobacterium and Lactobacillus , and positively correlated with Prevotella [ 25 ] , other studies found that in the rat model, the total number of Bacteroides and bacteria was positively correlated with the level of Ghrelin after taking prebiotic fiber [ 26 ] . However, the findings in this study were different from the above, after oral administration of strains, the level of Ghrelin in mouse serum increased significantly (Fig. 3 B). Therefore, Ghrelin may be an important factor for strains to improve poor dietary intake in tumor mice. Leptin and Ghrelin were two appetite regulating hormones with opposite functions. Leptin acted on the leptin receptor of the central nervous system, affected the secretion of NPY in hypothalamus, inhibited appetite and increased energy consumption. In rats, Bifidobacterium and Lactobacillus were positively correlated with serum leptin levels, while Clostridium and Prevotella were negatively correlated [ 25 ] . Leptin could inhibit appetite and reduce dietary intake. In this study, it was found that the leptin level of the tumor model group was significantly lower than that of all groups (except the positive drug group), but there was no significant difference between the leptin level of the blank control group and that of other groups. It could be inferred that leptin may not contribute much to tumor anorexia (Fig. 3 C). Combined with the results of Fig. 4 , it was speculated that both strains may affect the content of Ghrelin in serum mainly by affecting the secretion of Ghrelin in the intestine. Ghrelin promoted appetite by acting on growth hormone secretagogue receptor (GHSR) to activate AMPK signaling pathway and regulate the function of NPY/AgRP neurons. Protein kinase C (PKC) and inositol 3-phosphate (IP3) were two important proteins in AMPK signaling pathway. It could be seen from Fig. 5 that strains intervention increased the expression level of GHSR and PKC, decreased the expression level of IP3, regulated the secretion level of Ghrelin and improved the dietary intake ability of mice. Most of the nutrients in the intestine enter the cells and transfer to the blood through various transporters. The malnutrition of tumor patients may be related to these transporters. D-glucose was the main energy substance of the body, it mainly depends on two kinds of transporters of intestinal mucosal epithelial cells: sodium/glucose transporter (SGLT) family and glucose transporter (GLUT) family [ 27 ] . A large number of literatures had confirmed that glucose transporters were key proteins in the process of glucose transport, mainly including SGLT1 and GLUT2 [ 28 ] . When the concentration of glucose in the intestinal cavity was low, the absorption of glucose mainly depends on the active transport of SGLT1. When the intestinal glucose concentration increases, the number of SGLT1 carriers tends to be saturated. At this time, the absorption of glucose was completed by the assisted diffusion of GLUT2 [ 29 ] . Two different types of FABP-intestinal fatty acid binding protein (I-FABP) and liver fatty acid binding protein (L-FABP) were expressed in small intestinal epithelial cells.I/L-FABP was significantly expressed in the small intestine, and the two proteins were abundant in the epithelial cells of the proximal small intestine (duodenum and jejunum) [ 30 ] . I-FABP and L-FABP were important carriers for the transport of long-chain fatty acids in small intestinal epithelial cells. However, in vivo and in vitro studies found that dietary fatty acids did not affect the expression of I-FABP gene and protein in animal small intestine [ 31 – 33 ] , these results suggested that animal small intestinal epithelial cells may be L-FABP regulating the transport of dietary fat. The protein was digested into small peptides and amino acids, which were absorbed by intestinal transporters. The small peptide transporter mainly expressed in the small intestine is PEPT1, which was a key transmembrane transporter for the absorption of small peptides. In the small intestinal epithelial cell membrane, PEPT1 transported small peptides and H + to the cytoplasm, and then combined with the Na + /H + exchange system in the cell membrane to pump H + out of the cell and replaced Na + into the cell, so as to provide the proton gradient driving force of the cell membrane. At the same time, the Na + / K + -ATPase exchange system in the basement membrane pumps Na + out of the cell to maintain the Na + gradient from outside the cell to inside the cell [ 34 ] . Carbohydrates, fats and proteins need to be digested into small molecules in the body, which were then transported to cells by the appropriate transporters for use. Different beneficial microbial interventions had been studied to improve the expression of transporters in small intestinal epithelial cells, but it was not clear whether they could improve malnutrition in tumor patients. It was found that Lactobacillus casei combined with Bifidobacterium significantly increased the mRNA expression of SGLT1 in mice [ 35 ] . Lactic acid bacteria could significantly up-regulate the mRNA expression of alkaline amino acid transporter in duodenum and jejunum of pigs. Han-tsung's supplemented with Saccharomyces cerevisiae increased PEPTl expression in jejunum, suggesting that the supplementation increased peptide and amino acid uptake [ 36 ] . Other studies had shown that Lactobacillus plantarum could improve PEPT1-mediated absorption of amino acids and increase the transport activity of PEPT1 [ 37 ] . The mRNA and protein expression levels of the above key genes in this study confirmed (Fig. 6 – 8 ) that strains down-regulated the expression levels of GLUT2, SGLT1 and PEPT1 genes and proteins, but there was no significant correlation with FABP1 protein. Therefore, we speculated that the early stage of tumor mice was due to insufficient nutritional supply due to low dietary intake, so the compensatory activity of various transporters was increased. With the addition of strains, the dietary intake of mice changed to some extent, which caused down-regulation of GLUT2, SGLT1 and PEPT1 genes and proteins. SCFAs were generated in the intestine and produced by a large number of microorganisms in the intestine. Therefore, intestinal microorganisms were important "microbial organs" of human body, which were closely related to immune and nutritional physiological functions. As the largest and most complex micro ecosystem of human body, the metabolites of intestinal microorganisms could not only regulate human health, but also play an important role as a bridge between diet and host SCFAs [38]. Short chain fatty acids were important organic acid anions in the colon cavity, they were absorbed by the colonic mucosa through ionic or non-ionic forms. They were the main energy supply material for the epithelial cells of the colon and small intestine [39]. This study found that Bif . animalis F1-7 promoted the increase of acetic acid, butyric acid, isovaleric acid and total acid levels (Fig. 9 ), regulated the transport process of intestinal energy nutrition, and was of great significance to the improvement of nutritional status of mice. 5 Conclusion Strains Bif . animalis F1-7 and L . plantarum FWDG alleviated the malnutrition of mice to some extent by increasing the dietary intake level of mice, but the effect of Bif . animalis F1-7 was more prominent. This process was through increasing the expression level of GHSR and PKC, reducing the expression level of IP3, and finally regulating the secretion level of Ghrelin and improving the anorexia of mice. Meanwhile, Bif . animalis F1-7 also reduced the expression levels of GLUT2, SGLT1 and PEPT1 genes and proteins, promoted the increase of acetic acid, butyric acid, isovaleric acid and total acid levels, regulated the nutritional transport process of intestinal energy, and finally improved the nutritional status of lung cancer mice. Abbreviations SCFAs, short chain fatty acids; GLP-1, glucagon-like peptide-1; PYY, peptide YY; GLUT-2, glucose transporter-2; SGLT1, sodium/glucose transporter-1; FABP-1, fatty acid binding protein-1; PEPT-1, peptide transporter-1; GHSR, growth hormone secretagogue receptor; PKC, protein kinase C; IP3, inositol 3-phosphate; I-FABP, intestinal fatty acid binding protein Declarations Conflict of Interest The authors declare no competing interests. Acknowledgements: Thanks to Dr. Yeting Wu for the technical guidance. Funding: This work was financially supported by the Project of Taishan Industry Leading Talent of Shandong Province [grant number LJNY202101], and the National Key R & D of China [grant number 2018YFC1604300]. Data availability statement: My manuscript has data included as electronic supplementary material. Authors' contributions: Youyou Lu and Ruiqi Wang wrote the main manuscript,Yeting Wu,Qingyu Cui and Xiaoying Tian prepared figures 1-8,Zhe Zhang and Tongjie Liu prepared figures 9,Huaxi Yi prepared supplementary material,Pimin Gong and Lanwei Zhang re-edited the main mauscript.All authors reviewed the manuscript. References Cederholm T, Barazzoni R, Austin P, et al.(2017) ESPEN guidelines on definitions and terminology of clinical nutrition. Clin Nutr 36(1): 49-64. https://doi.org/10.1016/j.clnu.2016.09.004 Sutton LM, Demark-Wahnefried W, Clipp EC(2003) Management of terminal cancer in elderly patients. Lancet Oncol 4(3): 149-157. https://doi.org/10.1016/s1470-2045(03)01019-2 Pressoir M, Desne S, Berchery D, et al.(2010) Prevalence, risk factors and clinical implications of malnutrition in French Comprehensive Cancer Centres. Br J Cancer 102(6): 966-971. https://doi.org/10.1038/sj.bjc.6605578 Fukuda Y, Yamamoto K, Hirao M, et al.(2015) Prevalence of Malnutrition Among Gastric Cancer Patients Undergoing Gastrectomy and Optimal Preoperative Nutritional Support for Preventing Surgical Site Infections. Ann Surg Oncol 22: S778-S785. https://doi.org/10.1245/s10434-015-4820-9 Aaldriks AA, Van Der Geest LGM, Giltay EJ, et al.(2013) Frailty and malnutrition predictive of mortality risk in older patients with advanced colorectal cancer receiving chemotherapy. J Geriatr Oncol 4(3): 218-226. https://doi.org/10.1016/j.jgo.2013.04.001 Seo SH, Kim SE, Kang YK, et al.(2016) Association of nutritional status-related indices and chemotherapy-induced adverse events in gastric cancer patients. Bmc Cancer 16. https://doi.org/10.1186/s12885-016-2934-5 Gellrich NC, Handschel J, Holtmann H, et al.(2015) Oral cancer malnutrition impacts weight and quality of life. Nutrients 7(4): 2145-2160. https://doi.org/10.3390/nu7042145 Barki N, Bolognini D, Borjesson U, et al.(2022) Chemogenetics defines a short-chain fatty acid receptor gut-brain axis. Elife 11. https://doi.org/10.7554/eLife.73777 Borner T, Shaulson ED, Ghidewon MY, et al.(2020) GDF15 Induces Anorexia through Nausea and Emesis. Cell Metab 31(2): 351-362. https://doi.org/10.1016/j.cmet.2019.12.004 Zakharia Y, Mcwilliams RR, Rixe O, et al.(2021) Phase II trial of the IDO pathway inhibitor indoximod plus pembrolizumab for the treatment of patients with advanced melanoma. J Immunother Cancer 9(6). https://doi.org/10.1136/jitc-2020-002057 Tacad DKM, Tovar AP, Richardson CE, et al.(2022) Satiety Associated with Calorie Restriction and Time-restricted Feeding: Peripheral Hormones. Adv Nutr. https://doi.org/10.1093/advances/nmac014 He Q, Zhang Y, Ma D, et al.(2022) Lactobacillus casei Zhang exerts anti-obesity effect to obese glut1 and gut-specific-glut1 knockout mice via gut microbiota modulation mediated different metagenomic pathways. Eur J Nutr. https://doi.org/10.1007/s00394-021-02764-0 Bell KJ, Saad S, Tillett BJ, et al.(2022) Metabolite-based dietary supplementation in human type 1 diabetes is associated with microbiota and immune modulation. Microbiome 10(1). https://doi.org/10.1186/s40168-021-01193-9 Tao JH, Duan JA, Jiang S, et al.(2016) Simultaneous determination of six short-chain fatty acids in colonic contents of colitis mice after oral administration of polysaccharides from Chrysanthemum morifolium Ramat by gas chromatography with flame ionization detector. J Chromatogr B 1029: 88-94. https://doi.org/10.1016/j.jchromb.2016.07.002 Duca FA, Lam TK(2014) Gut microbiota, nutrient sensing and energy balance. Diabetes Obes Metab 16 Suppl 1: 68-76. https://doi.org/10.1111/dom.12340 Latorre R, Sternini C, De Giorgio R, et al.(2016) Enteroendocrine cells: a review of their role in brain-gut communication. Neurogastroent Motil 28(5): 620-630. https://doi.org/10.1111/nmo.12754 Bauer PV, Hamr SC, Duca FA(2016) Regulation of energy balance by a gut-brain axis and involvement of the gut microbiota. Cell Mol Life Sci 73(4): 737-755. https://doi.org/10.1007/s00018-015-2083-z Drucker DJ, Nauck MA(2006) The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet 368(9548): 1696-1705. https://doi.org/Doi 10.1016/S0140-6736(06)69705-5 Holst JJ(2013) Incretin hormones and the satiation signal. Int J Obesity 37(9): 1161-1168. https://doi.org/10.1038/ijo.2012.208 Field BCT, Chaudhri OB, Bloom SR(2010) Bowels control brain: gut hormones and obesity. Nat Rev Endocrinol 6(8): 444-453. https://doi.org/10.1038/nrendo.2010.93 Furness JB(2016) Integrated Neural and Endocrine Control of Gastrointestinal Function. Adv Exp Med Biol 891: 159-173. https://doi.org/10.1007/978-3-319-27592-5_16 Engelstoft MS, Schwartz TW(2016) Opposite Regulation of Ghrelin and Glucagon-like Peptide-1 by Metabolite G-Protein-Coupled Receptors. Trends Endocrin Met 27(9): 665-675. https://doi.org/10.1016/j.tem.2016.07.001 Castaneda TR, Tong J, Datta R, et al.(2010) Ghrelin in the regulation of body weight and metabolism. Front Neuroendocrinol 31(1): 44-60. https://doi.org/10.1016/j.yfrne.2009.10.008 Williams DL, Cummings DE, Grill HJ, et al.(2003) Meal-related ghrelin suppression requires postgastric feedback. Endocrinology 144(7): 2765-2767. https://doi.org/10.1210/en.2003-0381 Queipo-Ortuno MI, Seoane LM, Murri M, et al.(2013) Gut microbiota composition in male rat models under different nutritional status and physical activity and its association with serum leptin and ghrelin levels. Plos One 8(5): e65465. https://doi.org/10.1371/journal.pone.0065465 Parnell JA, Reimer RA(2012) Prebiotic fibres dose-dependently increase satiety hormones and alter Bacteroidetes and Firmicutes in lean and obese JCR:LA-cp rats. Br J Nutr 107(4): 601-613. https://doi.org/10.1017/S0007114511003163 Scheepers A, Joost HG, Schurmann A(2004) The glucose transporter families SGLT and GLUT: Molecular basis of normal and aberrant function. Jpen-Parenter Enter 28(5): 364-371. https://doi.org/Doi 10.1177/0148607104028005364 Dai L, Hu WW, Xia L, et al.(2016) Transmissible Gastroenteritis Virus Infection Enhances SGLT1 and GLUT2 Expression to Increase Glucose Uptake. Plos One 11(11). https://doi.org/10.1371/journal.pone.0165585 Lapuerta P, Rosenstock J, Zambrowicz B, et al.(2013) Study design and rationale of a dose-ranging trial of LX4211, a dual inhibitor of SGLT1 and SGLT2, in type 2 diabetes inadequately controlled on metformin monotherapy. Clin Cardiol 36(7): 367-371. https://doi.org/10.1002/clc.22125 Gordon JI, Lowe JB(1985) Analyzing the structures, functions and evolution of two abundant gastrointestinal fatty acid binding proteins with recombinant DNA and computational techniques. Chem Phys Lipids 38(1-2): 137-158. https://doi.org/10.1016/0009-3084(85)90063-5 Hallden G, Holehouse EL, Dong X, et al.(1994) Expression of intestinal fatty acid binding protein in intestinal epithelial cell lines, hBRIE 380 cells. Am J Physiol 267(4 Pt 1): G730-743. https://doi.org/10.1152/ajpgi.1994.267.4.G730 Le Beyec J, Delers F, Jourdant F, et al.(1997) A complete epithelial organization of Caco-2 cells induces I-FABP and potentializes apolipoprotein gene expression. Exp Cell Res 236(1): 311-320. https://doi.org/10.1006/excr.1997.3734 Poirier H, Niot I, Degrace P, et al.(1997) Fatty acid regulation of fatty acid-binding protein expression in the small intestine. Am J Physiol 273(2 Pt 1): G289-295. https://doi.org/10.1152/ajpgi.1997.273.2.G289 Ganapathy L, F H.(1985) Is intestinal transport energized by a proton gradient? . Am J Physiol 249: 6153-6160. Florencio M, Elena U, Jauregui P, et al.(2008) Effects of diets supplemented with sphingomyelin and Lactobacillus casei and Bifidobacterium bifidum on colon cancer development. Faseb J 22. Wang HT, Yu C, Hsieh YH, et al.(2011) Effects of albusin B (a bacteriocin) of Ruminococcus albus 7 expressed by yeast on growth performance and intestinal absorption of broiler chickens - its potential role as an alternative to feed antibiotics. J Sci Food Agr 91(13): 2338-2343. https://doi.org/10.1002/jsfa.4463 Chen HQ, Shen TY, Zhou YK, et al.(2010) Lactobacillus plantarum consumption increases PepT1-mediated amino acid absorption by enhancing protein kinase C activity in spontaneously colitic mice. J Nutr 140(12): 2201-2206. https://doi.org/10.3945/jn.110.123265 Ge L, Qi J, Shao B, et al.(2022) Microbial hydrogen economy alleviates colitis by reprogramming colonocyte metabolism and reinforcing intestinal barrier. Gut Microbes 14(1). https://doi.org/10.1080/19490976.2021.2013764 Yuan X, Tang H, Wu R, et al.(2021) Short-Chain Fatty Acids Calibrate RARalpha Activity Regulating Food Sensitization. Front Immunol 12: 737658. https://doi.org/10.3389/fimmu.2021.737658 Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2020767","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":134126744,"identity":"a6ccccfa-c1d9-448e-bb6f-c957c5372a5a","order_by":0,"name":"Youyou Lu","email":"","orcid":"","institution":"Huazhong Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Youyou","middleName":"","lastName":"Lu","suffix":""},{"id":134126745,"identity":"935bc758-2619-49be-a413-a28e4bfbc87f","order_by":1,"name":"Ruiqi Wang","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ruiqi","middleName":"","lastName":"Wang","suffix":""},{"id":134126747,"identity":"9078c902-b4b0-4215-8c64-0fb38a25d6c0","order_by":2,"name":"Yeting Wu","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yeting","middleName":"","lastName":"Wu","suffix":""},{"id":134126750,"identity":"3802d649-7e6c-4031-8101-1571eeb33ef8","order_by":3,"name":"Qingyu Cui","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qingyu","middleName":"","lastName":"Cui","suffix":""},{"id":134126751,"identity":"e24dd9a4-7bad-45b8-ba43-193ead4173e2","order_by":4,"name":"Xiaoying Tian","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoying","middleName":"","lastName":"Tian","suffix":""},{"id":134126752,"identity":"5ab9bf42-4476-4ed6-ae6a-2b66d6dcbf47","order_by":5,"name":"Zhe Zhang","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhe","middleName":"","lastName":"Zhang","suffix":""},{"id":134126754,"identity":"e19e177c-d8bc-4e9e-ab99-7bf5861417b4","order_by":6,"name":"Huaxi Yi","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Huaxi","middleName":"","lastName":"Yi","suffix":""},{"id":134126756,"identity":"802d0c3c-23ef-47bd-9e95-bbc224b62afb","order_by":7,"name":"Tongjie Liu","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tongjie","middleName":"","lastName":"Liu","suffix":""},{"id":134126757,"identity":"ffab197c-dea5-4d0c-a26b-3f67a2d16e3b","order_by":8,"name":"Pimin Gong","email":"","orcid":"","institution":"Ocean University of China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pimin","middleName":"","lastName":"Gong","suffix":""},{"id":134126758,"identity":"351a1ea6-bee8-46e4-ae8c-dea955b70cb2","order_by":9,"name":"Lanwei Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYDACCRBRACIYGx9AhBKI0WIA1tJsQKoWBjYJorTIz25+9vCLgV2ewfHmtoqPbXYM/Ow5Bgw/d+DWwjjnmLmxjEFyscGZg203Z7YlM0j2vDFg7D2DWwuzRIKZtIQBc+K2G4ltt3nbDjAY3MgxYGZsw62FTSL9G1BLfeK2+w/bikFa7Alp4ZHIMZP8YHAYaAtjGzPYFgkCWiQkcsqkGQyOJ+4/k9gsOeNcMo/EmWcFB3vxaJGfkb5N8kdFdeLM9uMPP3wos5Pjb0/e+OAnHi3gIOBBdimIOIBfAzCgfxBSMQpGwSgYBSMbAAARU077dkjGjQAAAABJRU5ErkJggg==","orcid":"","institution":"Ocean University of China","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Lanwei","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2022-09-01 08:14:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2020767/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2020767/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":26221227,"identity":"b5521a69-1fd9-472e-afd9-cb07ae831fc8","added_by":"auto","created_at":"2022-09-08 17:40:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":74747,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003eF1-7 on body weight of experiment mice.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/126f7a894f23b43a02ca394e.png"},{"id":26220911,"identity":"8c0b253c-9550-4127-8b2f-da5c493e6b79","added_by":"auto","created_at":"2022-09-08 17:35:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":63824,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003eF1-7 on dietary intake of experiment mice.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/a9f13ab80e4b4704e42ba1ef.png"},{"id":26220919,"identity":"a4cefdee-228f-413c-b949-ded075582d20","added_by":"auto","created_at":"2022-09-08 17:35:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":85625,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis \u003c/em\u003eF1-7 on the levels of serum PYY, Ghrelin and leptin in experiment mice.\u003c/p\u003e\n\u003cp\u003eNote:(A) Level of serum PYY. (B) Level of serum Ghrelin. (C)Level of serum LEP.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/64abc77b42cca485c3a12e06.png"},{"id":26220913,"identity":"c45f8e57-6a6d-4d40-9285-d3437cc7ef72","added_by":"auto","created_at":"2022-09-08 17:35:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":26123,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003eF1-7 on Ghrelin level in experiment mice intestine.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/b4da20fa78cd470761061b33.png"},{"id":26220917,"identity":"7a8b5ea5-ce78-4b33-baea-f3a7b81d93ad","added_by":"auto","created_at":"2022-09-08 17:35:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":77739,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003e F1-7 on Ghrelin signaling pathway gene expression of experiment mice colon tissues.\u003c/p\u003e\n\u003cp\u003eNote:(A) mRNA expression level of GHSR. (B) mRNA expression level of PKC. (C) mRNA expression level of IP3.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/06e8b0a56ae3e3bfbb720b41.png"},{"id":26220920,"identity":"c9d80900-933b-4e5e-a97e-389a43e75398","added_by":"auto","created_at":"2022-09-08 17:35:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":112737,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003e F1-7 on intestinal nutrition absorption transporters of experiment mice.\u003c/p\u003e\n\u003cp\u003eNote:(A) mRNA expression level of GLUT2. (B) mRNA expression level of SGLT1. (C) mRNA expression level of FABP1. (D) mRNA expression level of PEPT1.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/e118384bdf47946285d959b4.png"},{"id":26221827,"identity":"5cd9cfc8-4097-47d4-8331-a8e6b3a6b2e9","added_by":"auto","created_at":"2022-09-08 17:45:47","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":256471,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot of transporters protein in intestine of experiment mice.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/859f8a2201e32101d84522a3.png"},{"id":26221826,"identity":"cdc52785-93dd-4047-baf5-55bda64bd5b5","added_by":"auto","created_at":"2022-09-08 17:45:47","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":97342,"visible":true,"origin":"","legend":"\u003cp\u003eSemi quantitative analysis of transporters protein in intestine of experiment mice.\u003c/p\u003e\n\u003cp\u003eNote:(A) Protein expression level of GLUT2. (B) Protein expression level of SGLT1. (C) Protein expression level of FABP1. (D) Protein expression level of PEPT1.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/57b2e386ad6379e5548ae29e.png"},{"id":26220918,"identity":"09a58359-fbae-451d-9ada-c534fc65e177","added_by":"auto","created_at":"2022-09-08 17:35:47","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":198122,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003e F1-7 on SCFAs in experiment mice feces.\u003c/p\u003e\n\u003cp\u003eNote:(A) Level of acetic acid. (B) Level of propionic acid. (C) Level of butyric acid. (D) Level of isovaleric acid. (E) Level of valeric acid. (F) Level of total acid.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/ff065ee9f7f52700432e1f01.png"},{"id":26464249,"identity":"9b908d7e-79f0-4332-8c25-e5d8b30b9e3d","added_by":"auto","created_at":"2022-09-14 18:59:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1713817,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/582ec076-90b1-4276-9540-39041564c2be.pdf"},{"id":26221230,"identity":"aaa3b5c9-22f2-4a30-934b-d9e276ee331c","added_by":"auto","created_at":"2022-09-08 17:40:47","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15725,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-2020767/v1/4f04fcbd0ee5a383868a14ca.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Bifidobacterium animalis sup F1-7 and Lactobacillus plantarum FWDG alleviate the malnutrition of mice via ghrelin-GHSR/PKC pathway","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eTumor induced malnutrition was a disease caused by systemic inflammation caused by cancer\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Inflammation led to anorexia and tissue destruction, leading to malnutrition\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e, weight loss, changes in body composition and physical decline\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Malnutrition in cancer patients could also lead to increase postoperative complications\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e,more toxic and side effects\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e,poor response to antitumor treatment, higher mortality\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e and worse quality of life \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFrom the perspective of malnutrition, there were two possible causes of malnutrition in tumor patients: the first one was insufficient nutritional intake, which mainly referred to anorexia and loss of appetite. The second was the lack of nutrient absorption, including the obstacle of patients' nutrient transporters to nutrients absorption, and the effect of metabolites formed by food digestion, such as short chain fatty acids (SCFAs) and other energy nutrients on the absorption of intestinal cells[8]. Cancer related anorexia was the main factor causing tumor malnutrition, 50\u0026ndash;80% of advanced cancer patients had anorexia cachexia syndrome, and the incidence of lung cancer and gastrointestinal cancer was the highest. However, there were many pathogeneses of anorexia, including cytokines, gastrointestinal peptides, appetite hormones and so on, but the factors that play a role in cancer anorexia were not clear[9]. Melanoma was a skin tumor caused by abnormal melanocyte hyperplasia, it had the characteristics of high degree of malignancy and high mortality. The annual incidence rate of melanoma was 3%-5%. It was one of the fastest growing malignant tumors. Many newly diagnosed patients had reached the middle and advanced stage. The tumor cells had been spread to the liver and lung through blood vessels or lymphatic vessels, resulting in poor therapeutic effect [10]. In some studies, strains intervention could promote the secretion of Ghrelin, regulate the secretion of GLP-1 and PYY, and down regulate the level of inflammatory factors, which could affect the food intake behavior to a certain extent [11]. However, it was worth exploring whether strains play an important role in improving malnutrition in tumor patients due to the above reasons. In addition to anorexia, intestinal nutrient absorption was also closely related to nutrient transporters (GLUT2, SGLT1, FABP1, PEPT1) and intestinal epithelial nutrient source SCFAs [12, 13]. However, relevant studies, especially the correlation between the above processes and intestinal microorganism, had not been reported so far.\u003c/p\u003e \u003cp\u003eThe purpose of this study was to evaluate the probiotics \u003cem\u003eLactobacillus plantarum\u003c/em\u003e FWDG (\u003cem\u003eL. plantarum\u003c/em\u003e FWDG) and \u003cem\u003eBifidobacterium animalis\u003c/em\u003e sup F1-7 (\u003cem\u003eBif. animalis\u003c/em\u003e F1-7) the alleviate effect, and analyze the potential mechanism to alleviate the malnutrition of lung cancer mice, so as to provide a theoretical basis for the application of the beneficial microorganisms in improving tumor malnutrition.\u003c/p\u003e"},{"header":"2 Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Experimental strains and culture\u003c/h2\u003e \u003cp\u003e \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG (CCTCC M 2020828) and \u003cem\u003eBif. animalis\u003c/em\u003e F1-7 (CCTCC M 2020833) were stored in the Functional Dairy and Strains Engineering Laboratory of the Ocean University of China. All strains were cultured in a De Man, Rogosa, and Sharpe agar (MRS) medium at 37\u0026deg;C for 48 h prior to use. The fermentation broth was centrifuged at 8000\u0026times;\u003cem\u003eg\u003c/em\u003e for 5 min at 4\u0026deg;C (Eppendorf Centrifuge 5804, Eppendorf Co., Ltd, China). The bacteria precipitates were collected, washed twice with sterile phosphate-buffered saline (PBS), and resuspended. The final concentration of each strain was 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, which were stored at 4\u0026deg;C for \u0026le;\u0026thinsp;24 h prior to use (unless specified otherwise).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Melanoma B16-F10 cell and culture\u003c/h2\u003e \u003cp\u003eMus musculus (Mouse) Melanoma B16-F10 cell (Cell line name: B16-F10, RRID: CVCL_0159), Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) and fetal bovine serum (FBS) was obtained from Procell Life Science \u0026amp; Technology Co, Ltd (China). All experiments were performed with mycoplasma-free cells. B16-F10 cells were cultured in DMEM medium supplemented with 10% FBS with 100 units mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e penicillin and 100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e streptomycin at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. When B16-F10 cells in logarithmic growth phase were digested with 0.25% trypsin, the culture medium was resuspended to collect the cells. The cells were washed with sterile normal saline once, centrifuged, suspended with an appropriate amount of normal saline and the cells density was adjusted to 5\u0026times;10\u003csup\u003e6\u003c/sup\u003e mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Animal feeding and model construction\u003c/h2\u003e \u003cp\u003eOverall, 4-week-old female BALB/c mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (license number was SCXK2016-0006), and the indoor temperature was controlled at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, and the relative humidity was 50\u0026thinsp;\u0026plusmn;\u0026thinsp;5%, with a 12-h light/dark cycle. Standard commercial mouse feed was fed ad libitum. Criteria used for including and excluding animals. All experiments were conducted in accordance with the EU guidelines for experimental animals (directive 2010/63/EU) and international standards-3R principle of animal welfare, in accordance with the guidelines for the care and use of laboratory animals established by the Ocean University of China. All experiments were approved by the animal ethics committee of Ocean University of China and ethical number was SPXY20210101115. The tail skin of mice was disinfected with 75% ethanol, and the above-mentioned cell suspension was inoculated into the vena cava of mice one time (0.2 mL). After inoculation, one mouse was randomly selected every two days to observe the lung tumorigenesis. When the plaque was visible, the modeling was successful.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Animal experiment design and serum/intestinal tissues samples collection\u003c/h2\u003e \u003cp\u003eThere were 5 groups in total, 1 normal control group was set up (normal healthy mice of the same age\u0026thinsp;+\u0026thinsp;normal feeding). 48 BALB/c mice of successful lung cancer were randomly divided into 4 groups (n\u0026thinsp;=\u0026thinsp;12 mice in each group): lung cancer model group, lung cancer model\u0026thinsp;+\u0026thinsp;positive drug (Cyclophosphamide,CTX, Shengdi Pharmaceutical Co., Ltd, Jiangsu,China), and two intervention groups of the different strains(lung cancer model\u0026thinsp;+\u0026thinsp;strains). The composition and dosage of gavage were showed in \u003cb\u003eTable S1(\u003c/b\u003eSupplementary material\u003cb\u003e).\u003c/b\u003eThe serum samples and intestinal tissues were collected, and stored at -80℃ for standby.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Determination of body weights and food intake of mice\u003c/h2\u003e \u003cp\u003eThe experimental intervention period was 35 days. The body weights and food intake of all experiment mice were measured every 7 days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Detection of serum PYY, ghrelin, leptin and intestinal ghrelin levels\u003c/h2\u003e \u003cp\u003eELISA kits (Invitrogen, CA) were used to detect the changes of the levels of PYY, ghrelin and leptin in serum and ghrelin in intestine of mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Determination of key genes expression by qRT-PCR\u003c/h2\u003e \u003cp\u003eA total of 0.1 g of colon tissue was weighed accurately. Then, TRIzol reagent was used to extract total RNA from the colon tissue samples (Invitrogen, CA), and a High-Throughput Kit (Toyobo, Japan) was used for cDNA reversal. The forward and reverse primer sequences of \u003cem\u003eβ\u003c/em\u003e-actin, GHSR, PKC, IP3, GLUT2, SGLT1, FABP-1 and PEPT1 were presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Quantitative real-time polymerase chain reaction (q-RTPCR) was performed on a LightCycler 96 system thermal cycler (Roche Inc., CA) using PowerUp SYBR Green Master Mix (Applied Biosystems, CA). The relative contents of each target gene were calculated by normalising the relative value of \u003cem\u003eβ\u003c/em\u003e-actin mRNA. The relative expression levels were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eForward and reverse primer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ\u003c/em\u003e-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCCACCTTCCAGCAGATGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCTCAGTAACAGTCCGCCTAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGHSR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTTGTGCAAGACTGGTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACATTGTGACAAGAACGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePKC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCATCATCTGGACCAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGCCCAGCTTGTTGAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACTCGGCTTTCGCATTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCTCGGCTTCGTGTAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGLUT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTAAAACCGAGGAACCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACTCCTGGGTGTAGTCGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSGLT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGTGGTACTGGTGTACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCACCATGAGGAACATGGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFABP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTGGTCAGCTGTGGAAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCTCGGGCAGACCTATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePEPT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTAGAAGGCCAACTCCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGACCATCAAAGCACCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Determination of GLUT2, SGLT1, FABP-1 and PEPT1 protein expression of experiment mice\u003c/h2\u003e \u003cp\u003e0.1 g of tissue was washed with PBS, and the mixed lysate (1 mL RIPA strong lysate, containing 1% PMSF and 1% PI) was added into each 500-mL well. After homogenization, it was centrifuged for 30 min at 15000\u003cem\u003e\u0026times;g\u003c/em\u003e at 4\u0026deg;C, and the transparent liquid in the middle layer was collected. The concentration of the extracted protein samples was determined using the BCA protein concentration assay kit (Beijing Solarbio Science \u0026amp; Technology Co., Ltd.). The primary antibody was GLUT2, SGLT1, FABP-1 and PEPT1 antibody (Abcam), and the internal parameter was \u003cem\u003eβ\u003c/em\u003e-actin antibody (diluted 1:1000, Abcam). The secondary antibody (diluted 1:7500, Cell Signaling Technology) was incubated at 37\u0026deg;C for 30 min. Bio-Spectrum Imaging Detection System (Bio-Rad, USA) was used for capturing images of the protein bands, and ImageJ software was used for quantitative grayscale analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Determination of short-chain fatty acids (SCFAs) of nutrient absorption\u003c/h2\u003e \u003cp\u003eFecal samples of mice were collected for three consecutive days and stored in an \u0026minus;\u0026thinsp;80\u0026deg;C freezer before the mice were sacrificed. Pretreatment of the fecal samples was performed according to Tao et al[14]. Diethyl butyric acid was added to the samples as an internal standard for gas chromatography analysis (Agilent, US) and was calculated according to formula (1).\u003c/p\u003e \u003cp\u003eSCFA (\u0026micro;M/g) = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\frac{\\text{S}\\text{C}\\text{F}\\text{A} \\text{p}\\text{e}\\text{a}\\text{k} \\text{a}\\text{r}\\text{e}\\text{a} }{\\text{I}\\text{n}\\text{t}\\text{e}\\text{r}\\text{n}\\text{a}\\text{l} \\text{s}\\text{t}\\text{a}\\text{n}\\text{d}\\text{a}\\text{r}\\text{d} \\text{p}\\text{e}\\text{a}\\text{k} \\text{a}\\text{r}\\text{e}\\text{a}}\\)\u003c/span\u003e\u003c/span\u003e\u0026times;\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\frac{\\text{I}\\text{n}\\text{t}\\text{e}\\text{r}\\text{n}\\text{a}\\text{l} \\text{s}\\text{t}\\text{a}\\text{n}\\text{d}\\text{a}\\text{r}\\text{d} \\text{c}\\text{o}\\text{n}\\text{c}\\text{e}\\text{n}\\text{t}\\text{r}\\text{a}\\text{t}\\text{i}\\text{o}\\text{n} }{\\text{S}\\text{C}\\text{F}\\text{A} \\text{m}\\text{o}\\text{l}\\text{a}\\text{r} \\text{m}\\text{a}\\text{s}\\text{s}}\\)\u003c/span\u003e\u003c/span\u003e\u0026times;\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\frac{1000000 }{\\text{S}\\text{a}\\text{m}\\text{p}\\text{l}\\text{e} \\text{q}\\text{u}\\text{a}\\text{l}\\text{i}\\text{t}\\text{y}}\\)\u003c/span\u003e\u003c/span\u003e (1)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Data analysis\u003c/h2\u003e \u003cp\u003eThe results are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). One-way analysis of variance was used for statistical analysis using SPSS 20.0 software. Differences of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significant. GraphPad Prism 8.0 software was used to create graphs.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003ch2\u003e3.1 Effect of L.plantarum FWDG and Bif.animalis F1-7 on body weight and dietary intake of experiment mice\u003c/h2\u003e\n\u003cp\u003eThe effect level of \u003cem\u003eL\u003c/em\u003e.\u003cem\u003eplantarum\u003c/em\u003e FWDG and \u003cem\u003eBif\u003c/em\u003e.\u003cem\u003eanimalis\u003c/em\u003e F1-7 gavage intervention on the body weight of mice was showed in Fig. 1.\u003c/p\u003e\n\u003cp\u003eIt could be seen from Fig. 1 that after 7 days, there were differences between the tumor model group and the blank control group, which proved that the formation of tumor will lead to significant weight loss of mice. With the extension of feeding time, the weight growth rate of the blank control group was significantly higher than that of the other groups. Group P is anti-tumor positive drug group, which could be seen from the figure that anti-tumor positive drugs could alleviate weight loss, but the effect was not obvious. Although the two strains intervention group could not return to the normal weight of mice, they both effectively improved the weight loss of mice at the same time.\u003c/p\u003e\n\u003cp\u003eThe effect level of \u003cem\u003eL\u003c/em\u003e.\u003cem\u003eplantarum\u003c/em\u003e FWDG and \u003cem\u003eBif\u003c/em\u003e.\u003cem\u003eanimalis\u003c/em\u003e F1-7 gavage intervention of the dietary intake of mice was showed in Fig. 2.\u003c/p\u003e\n\u003cp\u003eIt could be found from Fig. 2 that there were differences in dietary intake between the tumor model group and the blank control group, which proved that the formation of tumor will significantly reduce the dietary intake ability of mice. With the prolongation of feeding time, even if the weight of mice increased further, the change of food intake was still small. Compared with the tumor model group, the dietary intake of mice treated with positive drugs increased, but the effect was still weaker than that of the two strains intervention groups, of which \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 group was slightly better than \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG group.\u003c/p\u003e\n\u003ch2\u003e3.2 Effect of L.plantarum FWDG and Bif.animalis F1-7 on serum PYY, ghrelin and leptin levels in experiment mice\u003c/h2\u003e\n\u003cp\u003eThe serum levels of PYY, ghrelin and leptin in mice were showed in Fig. 3.\u003c/p\u003e\n\u003cp\u003eAs could be seen from Fig. 3A, the PYY level of the blank control group was significantly higher than that of the tumor model group, positive drug group and \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 group. There was no significant difference in serum PYY level between the two strains. As could be seen from Fig. 3B, the Ghrelin level of the tumor model group was significantly lower than that of each group, but the Ghrelin level of the blank control group was significantly higher than that of the tumor model group and \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG group, there was no significant difference in Ghrelin levels between the two strains. Figure 3C showed that the leptin level of the tumor model group was significantly lower than that of all groups, but there was no significant difference between the leptin level of the blank control group and that of other groups.\u003c/p\u003e\n\u003cdiv\u003e\n \u003ch2\u003e3.3 Effect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003e F1-7 on Ghrelin level in experiment mice intestine\u003c/h2\u003e\n \u003cp\u003eThe level of Ghrelin in mouse intestine was further measured as showed in Fig. 4.\u003c/p\u003e\n \u003cp\u003eIn Fig. 4, it was found that the intestinal Ghrelin level in the model group and the control group was consistent with the trend in serum. The intestinal Ghrelin secretion in the model group was significantly lower than that in the control group. There was no difference between the positive drug group and the model group. The intervention of \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG and \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 strains could promote the intestinal Ghrelin secretion.\u003c/p\u003e\n \u003ch2\u003e3.4 Effect of L.plantarum FWDG and Bif.animalis F1-7 on Ghrelin signaling pathway gene expression of experiment mice\u003c/h2\u003e\n \u003cp\u003eThe relative expression of Ghrelin pathway gene of colon tissues was showed in Fig. 5.\u003c/p\u003e\n \u003cp\u003eAs could be seen from Fig. 5A, compared with the tumor model group, the GHSR gene of mice colon tissues in the blank control group were significantly higher than that in the tumor model group, while there was no significant difference between the positive drug group and the tumor model group. At the same time, the GHSR gene of strain \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG and strain \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 was significantly higher than that of model group, but the expression level of \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 group was higher than that of \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG group. As could be seen from Fig. 5B, compared with the tumor model group, the expression level of PKC gene in other groups was significantly higher, the order was positive drug group\u0026thinsp;\u0026gt;\u0026thinsp;blank control group\u0026thinsp;\u0026gt;\u0026thinsp;\u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 group\u0026thinsp;\u0026gt;\u0026thinsp;\u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG group. As could be seen from Fig. 5C, compared with the tumor model group, the expression level of IP3 gene in other groups decreased significantly, in which the order was \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 group\u0026thinsp;\u0026gt;\u0026thinsp;blank control group\u0026thinsp;\u0026gt;\u0026thinsp;\u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG group\u0026thinsp;\u0026gt;\u0026thinsp;positive drug group.\u003c/p\u003e\n \u003ch2\u003e3.5 Effect of L.plantarum FWDG and Bif.animalis F1-7 on potential intestinal nutrition absorption transporters of experiment mice\u003c/h2\u003e\n \u003cdiv\u003e\n \u003ch2\u003e3.5.1 Level of the mRNA expression of GLUT2, SGLT1, FABP-1 and PEPT1\u003c/h2\u003e\n \u003cp\u003eThe mRNA expression levels of GLUT2, SGLT1, FABP-1 and PEPT1 were showed in Fig. 6.\u003c/p\u003e\n \u003cp\u003eAs could be seen from Fig. 6A, compared with the blank control group, the GLUT2 gene in the tumor model group was significantly increased, and the expression of GLUT2 was significantly reduced by positive drugs and two strains. As could be seen from Fig. 6B, compared with the blank control group, the SGLT1 gene in the tumor model group was significantly increased, and the positive drug and two strains significantly reduced the expression of SGLT1. As could be seen from Fig. 6C, compared with the blank control group, there was no significant difference, indicating that there was no correlation between FABP1 gene and intestinal nutrient absorption in mice. As could be seen from Fig. 6D, compared with the blank control group, the PEPT1 gene in the tumor model group was significantly increased, and the positive drug and two strains significantly reduced the expression of PEPT1.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv\u003e\n \u003ch2\u003e3.5.2 Level of the protein expressions of GLUT2, SGLT1, FABP-1 and PEPT1\u003c/h2\u003e\n \u003cp\u003eFigure 7 was obtained by Western blot on mouse intestine, and Fig. 8 was obtained by semi quantitative analysis.\u003c/p\u003e\n \u003cp\u003eAs could be seen from Fig. 8A, compared with the blank control group, the GLUT2 protein in the tumor model group was significantly increased, and the expression of GLUT2 protein was significantly reduced by positive drugs and two strains. As could be seen from Fig. 8B, compared with the blank control group, the SGLT1 protein in the tumor model group was significantly increased, and the expression of SGLT1 protein was significantly reduced by strain \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7. As could be seen from Fig. 8C, compared with the blank control group, there was no significant difference in FABP1 protein, indicating that there was no correlation between FABP1 protein and intestinal nutrient absorption in mice. As could be seen from Fig. 8D, compared with the blank control group, the PEPT1 protein in the tumor model group was significantly increased, and the positive drug and the two strains reduced the expression of PEPT1 protein to a certain extent.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n \u003ch2\u003e3.6 Effect of \u003cem\u003eL.plantarum\u003c/em\u003e FWDG and \u003cem\u003eBif.animalis\u003c/em\u003e F1-7 on SCFAs in experiment mice feces\u003c/h2\u003e\n \u003cp\u003eSCFAs in mice feces were determined and Fig. 9 was obtained.\u003c/p\u003e\n \u003cp\u003eAs could be seen from Fig. 9A, compared with the blank control group, the acetic acid content in the tumor model group decreased significantly, the positive drug and two strains significantly promoted the increase of acetic acid content, and the effect of \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 was the most prominent. As could be seen from Fig. 9B, compared with the blank control group, the propionic acid content in the tumor model group decreased significantly, but the positive drugs and two strains did not promote the increase of propionic acid content. As could be seen from Fig. 9C, compared with the blank control group, the butyric acid content in the tumor model group decreased significantly, and the two strains significantly promoted the increase of butyric acid content, but there was no significant difference between the two strains. As could be seen from Fig. 9D, compared with the blank control group, the isovaleric acid content in the tumor model group decreased significantly, the positive drugs and two strains significantly promoted the increase of isovaleric acid content, and the effect of \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 was the most prominent. As can be seen from Fig. 9E, compared with the blank control group, the content of valeric acid in the tumor model group increased significantly, and the positive drugs and two strains significantly inhibited the content of valeric acid. As could be seen from Fig. 9F, compared with the blank control group, the total acid content in the tumor model group decreased significantly, the positive drugs and two strains significantly promoted the increase of total acid content, but the effect of \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 was the most prominent.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eIt could be seen from Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e that although the dietary intake of mice increased under the intervention of the two strains, the change range was weaker. At the same time, the weight gain of mice was obvious, so the strain may not only improve the dietary intake ability, but also improve the nutritional status of mice through other factors.\u003c/p\u003e \u003cp\u003eIntestinal microbiota mainly participates in the sensing mechanism of intestinal nutrients through intestinal enteroendocrine cells (EECs). EEC signal was a key regulator of nutrition sensing mechanism related to intestinal brain axis \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. EEC mainly secreted polypeptide YY (PYY) in response to food intake \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. PYY was a gastrointestinal peptide, which could participate in appetite regulation through peripheral and central pathways, reduce intestinal motility, regulate glucose homeostasis and energy consumption, inhibit appetite and food intake \u003csup\u003e[\u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. PYY could not only enter the circulation and play a role in an endocrine way, but also show their role in a paracrine way by stimulating the afferent neurons innervating the intestinal wall \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. PYY as an anorexic peptide, which increase will inhibit appetite, which was manifested in the decrease of food intake in mice. This study (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) found that the PYY level of the tumor model group was lower than that of the other groups, but the dietary intake ability was not optimistic. Therefore, PYY may not be a factor leading to tumor anorexia. However, the intervention of \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG group significantly increased the level of PYY, which may provide a research idea for people to improve excessive nutritional intake by PYY.\u003c/p\u003e \u003cp\u003eIn addition, the intestinal microbiota may also affect the host's appetite and metabolism through its relationship with appetite regulating hormones. Ghrelin could stimulate gastric emptying, appetite sensation and glucagon secretion, and inhibit insulin secretion and heat production \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. The small intestine was partly involved in Ghrelin production, and food stimulated plasma Ghrelin inhibition requires postgastric feedback \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Some studies believed that the level of serum Ghrelin was negatively correlated with \u003cem\u003eBifidobacterium\u003c/em\u003e and \u003cem\u003eLactobacillus\u003c/em\u003e, and positively correlated with \u003cem\u003ePrevotella\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e, other studies found that in the rat model, the total number of \u003cem\u003eBacteroides\u003c/em\u003e and bacteria was positively correlated with the level of Ghrelin after taking prebiotic fiber \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. However, the findings in this study were different from the above, after oral administration of strains, the level of Ghrelin in mouse serum increased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Therefore, Ghrelin may be an important factor for strains to improve poor dietary intake in tumor mice.\u003c/p\u003e \u003cp\u003eLeptin and Ghrelin were two appetite regulating hormones with opposite functions. Leptin acted on the leptin receptor of the central nervous system, affected the secretion of NPY in hypothalamus, inhibited appetite and increased energy consumption. In rats, \u003cem\u003eBifidobacterium\u003c/em\u003e and \u003cem\u003eLactobacillus\u003c/em\u003e were positively correlated with serum leptin levels, while \u003cem\u003eClostridium\u003c/em\u003e and \u003cem\u003ePrevotella\u003c/em\u003e were negatively correlated \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Leptin could inhibit appetite and reduce dietary intake. In this study, it was found that the leptin level of the tumor model group was significantly lower than that of all groups (except the positive drug group), but there was no significant difference between the leptin level of the blank control group and that of other groups. It could be inferred that leptin may not contribute much to tumor anorexia (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eCombined with the results of Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e, it was speculated that both strains may affect the content of Ghrelin in serum mainly by affecting the secretion of Ghrelin in the intestine. Ghrelin promoted appetite by acting on growth hormone secretagogue receptor (GHSR) to activate AMPK signaling pathway and regulate the function of NPY/AgRP neurons. Protein kinase C (PKC) and inositol 3-phosphate (IP3) were two important proteins in AMPK signaling pathway. It could be seen from Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e that strains intervention increased the expression level of GHSR and PKC, decreased the expression level of IP3, regulated the secretion level of Ghrelin and improved the dietary intake ability of mice.\u003c/p\u003e \u003cp\u003eMost of the nutrients in the intestine enter the cells and transfer to the blood through various transporters. The malnutrition of tumor patients may be related to these transporters. D-glucose was the main energy substance of the body, it mainly depends on two kinds of transporters of intestinal mucosal epithelial cells: sodium/glucose transporter (SGLT) family and glucose transporter (GLUT) family \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. A large number of literatures had confirmed that glucose transporters were key proteins in the process of glucose transport, mainly including SGLT1 and GLUT2 \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. When the concentration of glucose in the intestinal cavity was low, the absorption of glucose mainly depends on the active transport of SGLT1. When the intestinal glucose concentration increases, the number of SGLT1 carriers tends to be saturated. At this time, the absorption of glucose was completed by the assisted diffusion of GLUT2 \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Two different types of FABP-intestinal fatty acid binding protein (I-FABP) and liver fatty acid binding protein (L-FABP) were expressed in small intestinal epithelial cells.I/L-FABP was significantly expressed in the small intestine, and the two proteins were abundant in the epithelial cells of the proximal small intestine (duodenum and jejunum) \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. I-FABP and L-FABP were important carriers for the transport of long-chain fatty acids in small intestinal epithelial cells. However, \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e studies found that dietary fatty acids did not affect the expression of I-FABP gene and protein in animal small intestine \u003csup\u003e[\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e, these results suggested that animal small intestinal epithelial cells may be L-FABP regulating the transport of dietary fat. The protein was digested into small peptides and amino acids, which were absorbed by intestinal transporters. The small peptide transporter mainly expressed in the small intestine is PEPT1, which was a key transmembrane transporter for the absorption of small peptides. In the small intestinal epithelial cell membrane, PEPT1 transported small peptides and H\u003csup\u003e+\u003c/sup\u003e to the cytoplasm, and then combined with the Na\u003csup\u003e+\u003c/sup\u003e/H\u003csup\u003e+\u003c/sup\u003e exchange system in the cell membrane to pump H\u003csup\u003e+\u003c/sup\u003e out of the cell and replaced Na\u003csup\u003e+\u003c/sup\u003e into the cell, so as to provide the proton gradient driving force of the cell membrane. At the same time, the Na\u003csup\u003e+\u003c/sup\u003e/ K\u003csup\u003e+\u003c/sup\u003e-ATPase exchange system in the basement membrane pumps Na\u003csup\u003e+\u003c/sup\u003e out of the cell to maintain the Na\u003csup\u003e+\u003c/sup\u003e gradient from outside the cell to inside the cell \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Carbohydrates, fats and proteins need to be digested into small molecules in the body, which were then transported to cells by the appropriate transporters for use. Different beneficial microbial interventions had been studied to improve the expression of transporters in small intestinal epithelial cells, but it was not clear whether they could improve malnutrition in tumor patients. It was found that \u003cem\u003eLactobacillus casei\u003c/em\u003e combined with \u003cem\u003eBifidobacterium\u003c/em\u003e significantly increased the mRNA expression of SGLT1 in mice \u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Lactic acid bacteria could significantly up-regulate the mRNA expression of alkaline amino acid transporter in duodenum and jejunum of pigs. Han-tsung's supplemented with \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e increased PEPTl expression in jejunum, suggesting that the supplementation increased peptide and amino acid uptake \u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Other studies had shown that \u003cem\u003eLactobacillus plantarum\u003c/em\u003e could improve PEPT1-mediated absorption of amino acids and increase the transport activity of PEPT1 \u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. The mRNA and protein expression levels of the above key genes in this study confirmed (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e8\u003c/span\u003e) that strains down-regulated the expression levels of GLUT2, SGLT1 and PEPT1 genes and proteins, but there was no significant correlation with FABP1 protein. Therefore, we speculated that the early stage of tumor mice was due to insufficient nutritional supply due to low dietary intake, so the compensatory activity of various transporters was increased. With the addition of strains, the dietary intake of mice changed to some extent, which caused down-regulation of GLUT2, SGLT1 and PEPT1 genes and proteins.\u003c/p\u003e \u003cp\u003eSCFAs were generated in the intestine and produced by a large number of microorganisms in the intestine. Therefore, intestinal microorganisms were important \"microbial organs\" of human body, which were closely related to immune and nutritional physiological functions. As the largest and most complex micro ecosystem of human body, the metabolites of intestinal microorganisms could not only regulate human health, but also play an important role as a bridge between diet and host SCFAs [38]. Short chain fatty acids were important organic acid anions in the colon cavity, they were absorbed by the colonic mucosa through ionic or non-ionic forms. They were the main energy supply material for the epithelial cells of the colon and small intestine [39]. This study found that \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 promoted the increase of acetic acid, butyric acid, isovaleric acid and total acid levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e9\u003c/span\u003e), regulated the transport process of intestinal energy nutrition, and was of great significance to the improvement of nutritional status of mice.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eStrains \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 and \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eplantarum\u003c/em\u003e FWDG alleviated the malnutrition of mice to some extent by increasing the dietary intake level of mice, but the effect of \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 was more prominent. This process was through increasing the expression level of GHSR and PKC, reducing the expression level of IP3, and finally regulating the secretion level of Ghrelin and improving the anorexia of mice. Meanwhile, \u003cem\u003eBif\u003c/em\u003e. \u003cem\u003eanimalis\u003c/em\u003e F1-7 also reduced the expression levels of GLUT2, SGLT1 and PEPT1 genes and proteins, promoted the increase of acetic acid, butyric acid, isovaleric acid and total acid levels, regulated the nutritional transport process of intestinal energy, and finally improved the nutritional status of lung cancer mice.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eSCFAs, short chain fatty acids; GLP-1, glucagon-like peptide-1; PYY, peptide YY; GLUT-2, glucose transporter-2; SGLT1, sodium/glucose transporter-1; FABP-1, fatty acid binding protein-1; PEPT-1, peptide transporter-1; GHSR, growth hormone secretagogue receptor; PKC, protein kinase C; IP3, inositol 3-phosphate; I-FABP, intestinal fatty acid binding protein\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of Interest\u0026nbsp;\u003c/strong\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u0026nbsp;\u003c/strong\u003eThanks to Dr. Yeting Wu for the technical guidance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was financially supported by the Project of Taishan Industry Leading Talent of Shandong Province [grant number LJNY202101], and the National Key R \u0026amp; D of China [grant number 2018YFC1604300].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement:\u0026nbsp;\u003c/strong\u003eMy manuscript has data included as electronic supplementary material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions:\u003c/strong\u003e Youyou Lu and Ruiqi Wang wrote the main manuscript,Yeting Wu,Qingyu Cui and Xiaoying Tian prepared figures 1-8,Zhe Zhang and Tongjie Liu prepared figures 9,Huaxi Yi \u0026nbsp;prepared supplementary material,Pimin Gong and Lanwei Zhang re-edited the main mauscript.All authors reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCederholm T, Barazzoni R, Austin P, et al.(2017) ESPEN guidelines on definitions and terminology of clinical nutrition. Clin Nutr 36(1): 49-64. https://doi.org/10.1016/j.clnu.2016.09.004\u003c/li\u003e\n\u003cli\u003eSutton LM, Demark-Wahnefried W, Clipp EC(2003) Management of terminal cancer in elderly patients. Lancet Oncol 4(3): 149-157. https://doi.org/10.1016/s1470-2045(03)01019-2\u003c/li\u003e\n\u003cli\u003ePressoir M, Desne S, Berchery D, et al.(2010) Prevalence, risk factors and clinical implications of malnutrition in French Comprehensive Cancer Centres. Br J Cancer 102(6): 966-971. https://doi.org/10.1038/sj.bjc.6605578\u003c/li\u003e\n\u003cli\u003eFukuda Y, Yamamoto K, Hirao M, et al.(2015) Prevalence of Malnutrition Among Gastric Cancer Patients Undergoing Gastrectomy and Optimal Preoperative Nutritional Support for Preventing Surgical Site Infections. Ann Surg Oncol 22: S778-S785. https://doi.org/10.1245/s10434-015-4820-9\u003c/li\u003e\n\u003cli\u003eAaldriks AA, Van Der Geest LGM, Giltay EJ, et al.(2013) Frailty and malnutrition predictive of mortality risk in older patients with advanced colorectal cancer receiving chemotherapy. J Geriatr Oncol 4(3): 218-226. https://doi.org/10.1016/j.jgo.2013.04.001\u003c/li\u003e\n\u003cli\u003eSeo SH, Kim SE, Kang YK, et al.(2016) Association of nutritional status-related indices and chemotherapy-induced adverse events in gastric cancer patients. Bmc Cancer 16. https://doi.org/10.1186/s12885-016-2934-5\u003c/li\u003e\n\u003cli\u003eGellrich NC, Handschel J, Holtmann H, et al.(2015) Oral cancer malnutrition impacts weight and quality of life. Nutrients 7(4): 2145-2160. https://doi.org/10.3390/nu7042145\u003c/li\u003e\n\u003cli\u003eBarki N, Bolognini D, Borjesson U, et al.(2022) Chemogenetics defines a short-chain fatty acid receptor gut-brain axis. Elife 11. https://doi.org/10.7554/eLife.73777\u003c/li\u003e\n\u003cli\u003eBorner T, Shaulson ED, Ghidewon MY, et al.(2020) GDF15 Induces Anorexia through Nausea and Emesis. Cell Metab 31(2): 351-362. https://doi.org/10.1016/j.cmet.2019.12.004\u003c/li\u003e\n\u003cli\u003eZakharia Y, Mcwilliams RR, Rixe O, et al.(2021) Phase II trial of the IDO pathway inhibitor indoximod plus pembrolizumab for the treatment of patients with advanced melanoma. J Immunother Cancer 9(6). https://doi.org/10.1136/jitc-2020-002057\u003c/li\u003e\n\u003cli\u003eTacad DKM, Tovar AP, Richardson CE, et al.(2022) Satiety Associated with Calorie Restriction and Time-restricted Feeding: Peripheral Hormones. Adv Nutr. https://doi.org/10.1093/advances/nmac014\u003c/li\u003e\n\u003cli\u003eHe Q, Zhang Y, Ma D, et al.(2022) Lactobacillus casei Zhang exerts anti-obesity effect to obese glut1 and gut-specific-glut1 knockout mice via gut microbiota modulation mediated different metagenomic pathways. Eur J Nutr. https://doi.org/10.1007/s00394-021-02764-0\u003c/li\u003e\n\u003cli\u003eBell KJ, Saad S, Tillett BJ, et al.(2022) Metabolite-based dietary supplementation in human type 1 diabetes is associated with microbiota and immune modulation. Microbiome 10(1). https://doi.org/10.1186/s40168-021-01193-9\u003c/li\u003e\n\u003cli\u003eTao JH, Duan JA, Jiang S, et al.(2016) Simultaneous determination of six short-chain fatty acids in colonic contents of colitis mice after oral administration of polysaccharides from Chrysanthemum morifolium Ramat by gas chromatography with flame ionization detector. J Chromatogr B 1029: 88-94. https://doi.org/10.1016/j.jchromb.2016.07.002\u003c/li\u003e\n\u003cli\u003eDuca FA, Lam TK(2014) Gut microbiota, nutrient sensing and energy balance. Diabetes Obes Metab 16 Suppl 1: 68-76. https://doi.org/10.1111/dom.12340\u003c/li\u003e\n\u003cli\u003eLatorre R, Sternini C, De Giorgio R, et al.(2016) Enteroendocrine cells: a review of their role in brain-gut communication. Neurogastroent Motil 28(5): 620-630. https://doi.org/10.1111/nmo.12754\u003c/li\u003e\n\u003cli\u003eBauer PV, Hamr SC, Duca FA(2016) Regulation of energy balance by a gut-brain axis and involvement of the gut microbiota. Cell Mol Life Sci 73(4): 737-755. https://doi.org/10.1007/s00018-015-2083-z\u003c/li\u003e\n\u003cli\u003eDrucker DJ, Nauck MA(2006) The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet 368(9548): 1696-1705. https://doi.org/Doi 10.1016/S0140-6736(06)69705-5\u003c/li\u003e\n\u003cli\u003eHolst JJ(2013) Incretin hormones and the satiation signal. Int J Obesity 37(9): 1161-1168. https://doi.org/10.1038/ijo.2012.208\u003c/li\u003e\n\u003cli\u003eField BCT, Chaudhri OB, Bloom SR(2010) Bowels control brain: gut hormones and obesity. Nat Rev Endocrinol 6(8): 444-453. https://doi.org/10.1038/nrendo.2010.93\u003c/li\u003e\n\u003cli\u003eFurness JB(2016) Integrated Neural and Endocrine Control of Gastrointestinal Function. Adv Exp Med Biol 891: 159-173. https://doi.org/10.1007/978-3-319-27592-5_16\u003c/li\u003e\n\u003cli\u003eEngelstoft MS, Schwartz TW(2016) Opposite Regulation of Ghrelin and Glucagon-like Peptide-1 by Metabolite G-Protein-Coupled Receptors. Trends Endocrin Met 27(9): 665-675. https://doi.org/10.1016/j.tem.2016.07.001\u003c/li\u003e\n\u003cli\u003eCastaneda TR, Tong J, Datta R, et al.(2010) Ghrelin in the regulation of body weight and metabolism. Front Neuroendocrinol 31(1): 44-60. https://doi.org/10.1016/j.yfrne.2009.10.008\u003c/li\u003e\n\u003cli\u003eWilliams DL, Cummings DE, Grill HJ, et al.(2003) Meal-related ghrelin suppression requires postgastric feedback. Endocrinology 144(7): 2765-2767. https://doi.org/10.1210/en.2003-0381\u003c/li\u003e\n\u003cli\u003eQueipo-Ortuno MI, Seoane LM, Murri M, et al.(2013) Gut microbiota composition in male rat models under different nutritional status and physical activity and its association with serum leptin and ghrelin levels. Plos One 8(5): e65465. https://doi.org/10.1371/journal.pone.0065465\u003c/li\u003e\n\u003cli\u003eParnell JA, Reimer RA(2012) Prebiotic fibres dose-dependently increase satiety hormones and alter Bacteroidetes and Firmicutes in lean and obese JCR:LA-cp rats. Br J Nutr 107(4): 601-613. https://doi.org/10.1017/S0007114511003163\u003c/li\u003e\n\u003cli\u003eScheepers A, Joost HG, Schurmann A(2004) The glucose transporter families SGLT and GLUT: Molecular basis of normal and aberrant function. Jpen-Parenter Enter 28(5): 364-371. https://doi.org/Doi 10.1177/0148607104028005364\u003c/li\u003e\n\u003cli\u003eDai L, Hu WW, Xia L, et al.(2016) Transmissible Gastroenteritis Virus Infection Enhances SGLT1 and GLUT2 Expression to Increase Glucose Uptake. Plos One 11(11). https://doi.org/10.1371/journal.pone.0165585\u003c/li\u003e\n\u003cli\u003eLapuerta P, Rosenstock J, Zambrowicz B, et al.(2013) Study design and rationale of a dose-ranging trial of LX4211, a dual inhibitor of SGLT1 and SGLT2, in type 2 diabetes inadequately controlled on metformin monotherapy. Clin Cardiol 36(7): 367-371. https://doi.org/10.1002/clc.22125\u003c/li\u003e\n\u003cli\u003eGordon JI, Lowe JB(1985) Analyzing the structures, functions and evolution of two abundant gastrointestinal fatty acid binding proteins with recombinant DNA and computational techniques. Chem Phys Lipids 38(1-2): 137-158. https://doi.org/10.1016/0009-3084(85)90063-5\u003c/li\u003e\n\u003cli\u003eHallden G, Holehouse EL, Dong X, et al.(1994) Expression of intestinal fatty acid binding protein in intestinal epithelial cell lines, hBRIE 380 cells. Am J Physiol 267(4 Pt 1): G730-743. https://doi.org/10.1152/ajpgi.1994.267.4.G730\u003c/li\u003e\n\u003cli\u003eLe Beyec J, Delers F, Jourdant F, et al.(1997) A complete epithelial organization of Caco-2 cells induces I-FABP and potentializes apolipoprotein gene expression. Exp Cell Res 236(1): 311-320. https://doi.org/10.1006/excr.1997.3734\u003c/li\u003e\n\u003cli\u003ePoirier H, Niot I, Degrace P, et al.(1997) Fatty acid regulation of fatty acid-binding protein expression in the small intestine. Am J Physiol 273(2 Pt 1): G289-295. https://doi.org/10.1152/ajpgi.1997.273.2.G289\u003c/li\u003e\n\u003cli\u003eGanapathy L, F H.(1985) Is intestinal transport energized by a proton gradient? . Am J Physiol 249: 6153-6160. \u003c/li\u003e\n\u003cli\u003eFlorencio M, Elena U, Jauregui P, et al.(2008) Effects of diets supplemented with sphingomyelin and Lactobacillus casei and Bifidobacterium bifidum on colon cancer development. Faseb J 22. \u003c/li\u003e\n\u003cli\u003eWang HT, Yu C, Hsieh YH, et al.(2011) Effects of albusin B (a bacteriocin) of Ruminococcus albus 7 expressed by yeast on growth performance and intestinal absorption of broiler chickens - its potential role as an alternative to feed antibiotics. J Sci Food Agr 91(13): 2338-2343. https://doi.org/10.1002/jsfa.4463\u003c/li\u003e\n\u003cli\u003eChen HQ, Shen TY, Zhou YK, et al.(2010) Lactobacillus plantarum consumption increases PepT1-mediated amino acid absorption by enhancing protein kinase C activity in spontaneously colitic mice. J Nutr 140(12): 2201-2206. https://doi.org/10.3945/jn.110.123265\u003c/li\u003e\n\u003cli\u003eGe L, Qi J, Shao B, et al.(2022) Microbial hydrogen economy alleviates colitis by reprogramming colonocyte metabolism and reinforcing intestinal barrier. Gut Microbes 14(1). https://doi.org/10.1080/19490976.2021.2013764\u003c/li\u003e\n\u003cli\u003eYuan X, Tang H, Wu R, et al.(2021) Short-Chain Fatty Acids Calibrate RARalpha Activity Regulating Food Sensitization. Front Immunol 12: 737658. https://doi.org/10.3389/fimmu.2021.737658\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"malnutrition, Bifidobacterium animalis sup F1-7, Lactobacillus plantarum FWDG, ghrelin, GHSR/PKC pathway","lastPublishedDoi":"10.21203/rs.3.rs-2020767/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2020767/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003e\u003cstrong\u003ePurpose\u003c/strong\u003e: Intestinal microecology was closely related to malnutrition, but the related mechanism was still unclear. This study aimed to reveal how microorganisms alleviated malnutrition \u003cem\u003evia\u003c/em\u003e ghrelin-GHSR/PKC-SCFAs pathway.\u0026nbsp;\u003c/h2\u003e\n\u003ch2\u003e\u003cstrong\u003eMethods and results\u003c/strong\u003e: Melanoma cells B16F10-induced malnourished mice of lung cancer. Strains \u003cem\u003eBif. animalis\u003c/em\u003e F1-7 and \u003cem\u003eL. plantarum\u003c/em\u003e FWDG alleviated the malnutrition of mice to some extent by increasing the dietary intake level of mice, but the effect of \u003cem\u003eBif. animalis\u003c/em\u003e F1-7 was more prominent. This process was through increasing the expression level of GHSR and PKC, reducing the expression level of IP3, and finally regulating the secretion level of ghrelin and improving the anorexia of mice. Meanwhile, \u003cem\u003eBif. animalis\u003c/em\u003e F1-7 also reduced the expression levels of GLUT2, SGLT1 and PEPT1 genes and proteins, promoted the increase of acetic acid, butyric acid, isovaleric acid and total acid levels, regulated the nutritional transport process of intestinal energy, and finally improved the nutritional status of tumor mice \u003cem\u003evia\u003c/em\u003e ghrelin-GHSR/PKC-SCFAs pathway.\u0026nbsp;\u003c/h2\u003e\n\u003ch2\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Our study provided a data support for the application of potentially beneficial microorganisms of \u003cem\u003eBif.animalis\u003c/em\u003e F1-7 could acts as an auxiliary component to alleviate malnutrition.\u003c/h2\u003e","manuscriptTitle":"Bifidobacterium animalis sup F1-7 and Lactobacillus plantarum FWDG alleviate the malnutrition of mice via ghrelin-GHSR/PKC pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-09-08 17:35:45","doi":"10.21203/rs.3.rs-2020767/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0f482ff7-b27d-4ca6-8085-4b6a2cf554e2","owner":[],"postedDate":"September 8th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-09-14T18:59:27+00:00","versionOfRecord":[],"versionCreatedAt":"2022-09-08 17:35:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2020767","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2020767","identity":"rs-2020767","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}