A rapid multiplex PCR assay for the simultaneous detection of four major foodborne pathogens in camel milk: Development, validation and comparison of the assay with those of culture-based methods

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract National production of camel milk can lead to increased health and hygiene levels in communities due to its medicinal and therapeutic characteristics as well as high similarity to human milk. However, safety and microbiological quality of raw camel milk, particularly in regions where it is consumed without pasteurization that may lead to foodborne bacterial contamination, are majorly concerned. Regarding importance of the issue, it is also necessary to provide rapid and accurate diagnostic methods to minimize detection time. This study aimed to develop and validate a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous detection of four major foodborne pathogens of Staphylococcus aureus , Enterohemorrhagic Escherichia coli (EHEC), Salmonella enterica and Listeria monocytogenes in camel milk samples collected from Gonbad-Kavoos region of northern Iran and to compare results of this method with those of culture-based methods.Totally, 196 raw camel milk samples were collected from a traditional dairy shop in Gonbad Kavoos, Golestan, Iran, under sterile conditions and analyzed using traditional culture-based methods and the newly developed M-PCR. Species-specific MPCR targeting sea gene for S. aureus , inv A for Salmonella , stx -1 for EHEC and ABC transporter permease for L. monocytogenes were performed.Phenotypic and multiplex analyses revealed contamination rates for Staphylococcus aureus , EHEC, Salmonella enterica and Listeria monocytogenes as 29.6 and 19.9%, 0 and 4.2%, 14.8 and 14.8%, and 1 and 2.6%, respectively. The M-PCR assay successfully detected all four pathogens simultaneously within a short time, demonstrating high analytical sensitivity and specificity. When benchmarked against culture, M-PCR achieved sensitivity of 97% and specificity of 100%.This novel M-PCR method can be used as a rapid, accurate and reliable tool for the simultaneous identification of several pathogenic bacteria in dairy products such as camel milk with a sensitivity and specificity of respectively 97 and 100%. Furthermore, this method is more accurate and efficient than the classical culture method, enhancing public health surveillance and food safety control measures in camel-breeding communities.
Full text 126,360 characters · extracted from preprint-html · click to expand
A rapid multiplex PCR assay for the simultaneous detection of four major foodborne pathogens in camel milk: Development, validation and comparison of the assay with those of culture-based methods | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A rapid multiplex PCR assay for the simultaneous detection of four major foodborne pathogens in camel milk: Development, validation and comparison of the assay with those of culture-based methods Nikan Bahrameh, Ramin Mazaheri Nezhad Fard, Davoud Afshar, Milad Sadeghzadeh, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8063829/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract National production of camel milk can lead to increased health and hygiene levels in communities due to its medicinal and therapeutic characteristics as well as high similarity to human milk. However, safety and microbiological quality of raw camel milk, particularly in regions where it is consumed without pasteurization that may lead to foodborne bacterial contamination, are majorly concerned. Regarding importance of the issue, it is also necessary to provide rapid and accurate diagnostic methods to minimize detection time. This study aimed to develop and validate a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous detection of four major foodborne pathogens of Staphylococcus aureus , Enterohemorrhagic Escherichia coli (EHEC), Salmonella enterica and Listeria monocytogenes in camel milk samples collected from Gonbad-Kavoos region of northern Iran and to compare results of this method with those of culture-based methods. Totally, 196 raw camel milk samples were collected from a traditional dairy shop in Gonbad Kavoos, Golestan, Iran, under sterile conditions and analyzed using traditional culture-based methods and the newly developed M-PCR. Species-specific MPCR targeting sea gene for S. aureus , inv A for Salmonella , stx -1 for EHEC and ABC transporter permease for L. monocytogenes were performed. Phenotypic and multiplex analyses revealed contamination rates for Staphylococcus aureus , EHEC, Salmonella enterica and Listeria monocytogenes as 29.6 and 19.9%, 0 and 4.2%, 14.8 and 14.8%, and 1 and 2.6%, respectively. The M-PCR assay successfully detected all four pathogens simultaneously within a short time, demonstrating high analytical sensitivity and specificity. When benchmarked against culture, M-PCR achieved sensitivity of 97% and specificity of 100%. This novel M-PCR method can be used as a rapid, accurate and reliable tool for the simultaneous identification of several pathogenic bacteria in dairy products such as camel milk with a sensitivity and specificity of respectively 97 and 100%. Furthermore, this method is more accurate and efficient than the classical culture method, enhancing public health surveillance and food safety control measures in camel-breeding communities. Biological sciences/Biological techniques Biological sciences/Biotechnology Biological sciences/Microbiology Biological sciences/Molecular biology Staphylococcus aureus Enterohemorrhagic Escherichia coli Salmonella enterica Listeria monocytogenes camel milk Multiplex PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Camel milk and its fermented forms have long served as important sources of nutrition for nomadic population living in harsh environments such as desert. Owing to its medicinal and therapeutic properties and its close similarity to human milk, camel milk has increasingly been regarded as a healthier dietary option in developed countries in recent years ( 1 , 2 ). Its health benefits that have stimulated global interest in camel milk consumption include strengthening children's heart muscles and preventing several cancers, such as gastrointestinal cancers ( 3 ), improving type I diabetes due to its insulin-like substance and resistance to stomach acid ( 4 ), helping to treat jaundice, asthma, tuberculosis, autism and leishmaniasis ( 5 , 6 ). Furthermore, other beneficial health characteristics of the camel milk include its anti-allergic characteristics because of low β-lactoglobulin and rich alpha-lactalbumin contents ( 7 ). Additionally, camel milk includes a high content of lactate, which decreases sensitivity to milk and hence is beneficial for consumers with lactose intolerance. Due to its compositional similarity to human milk, special attentions have recently been paid to the preparation of infant formulas from camel milk ( 8 , 9 ). Camel milk is rich in vitamins such as vitamins B 1 , B 2 and C, making it an important part of the diet in arid regions that have a limited access to green foods. Bioactive peptides derived from various proteins of camel milk with antioxidant, antimicrobial and blood pressure decreasing capabilities include good therapeutic and biological characteristics. Regarding to the high mortality rate of cardiovascular diseases (CVD) worldwide, it is necessary to introduce natural compounds into the daily foods with characteristics of preventing high blood pressure ( 10 , 11 ). In recent years, significant activities have been carried out to produce and supply camel milk nationally. Golestan Province of Iran has started the hygienic supply of camel milk. However, a major problem in its production and industrialization process is camel milk is mostly consumed raw with no heat treatments and stored at high ambient temperatures with lack of cold storage facilities during milking and transportation. This conditions make the milk unsafe and cause foodborne diseases ( 12 , 13 ). From foodborne pathogens, Staphylococcus aureus , Enterohemorrhagic Escherichia coli (EHEC ) , Salmonella enterica and Listeria monocytogenes are further prevalent, which pose significant public health risks and are associated with severe foodborne illnesses, including gastroenteritis, hemolytic uremic syndrome (HUS) and listeriosis ( 14 , 15 ). Since these pathogens can pose a greater risk to human health, focusing on their diagnosis is critical to ensure healthy food supply and minimize the associated diseases. Traditional culture-based methods for detecting these pathogens are time-consuming, labor-intensive and may lack sensitivity, especially when pathogens are present in low concentrations or in viable but non-culturable (VBNC) state ( 16 , 17 ). To address these limitation, molecular diagnostic techniques, especially multiplex polymerase chain reaction (M-PCR) with ability of simultaneous amplification of multiple target genes in a single reaction, is useful for food safety assessment, where multiple pathogens must efficiently be screened ( 18 ). Previous studies have developed M-PCR assays for pathogen detection in cow milk and meat products ( 19 , 20 ). However, none of these assays have specifically targeted camel milk, presenting unique challenges due to its high fat and protein content ( 21 ). Therefore, the aim of this study was to design and validate a novel M-PCR assay for the simultaneous detection of S. aureus , EHEC, S. enterica and L. monocytogenes in raw camel milk samples collected from Gonbad Kavoos, Iran. The assay performance was compared with standard culture-based assay performance to assess its efficacy, sensitivity and applicability for routine food safety surveillance schemes. Novelty of the study is linked to its optimization for camel milk unique matrix and its potential to enhance microbial safety in a regionally significant food product, where camel milk is widely consumed. Results Isolation and identification of Staphylococcus aureus Totally, 196 camel milk samples were assessed for the presence of S. aureus . Initial screening was carried out by selective culture on Baird-Parker agar, where 85 samples produced colonies with typical S. aureus morphology. Gram staining of these colonies revealed Gram-positive cocci arranged in grape-like clusters. Catalase assay verified catalase production in the selected isolates. Coagulase-positive isolates, as shown by clot formation within 4–5 h, were verified as coagulase-producing S. aureus . Furthermore, DNase activity was detected in these isolates, indicated by clear zones around colonies on DNase agar. Further verification was achieved by culturing on MSA; where, positive isolates fermented mannitol and produced characteristic yellow color in the media. In total, 58 samples (29.6%) were verified as S. aureus based on their cultural, microscopic and biochemical characteristics. Isolation and identification of Salmonella enterica In this study, 196 camel milk samples were screened for the presence of S. enterica . Initial enrichment was carried out using RV broth, followed by selective plating on Hektoen enteric agar to isolate presumptive colonies. Out of the total samples, 29 samples (14.8%) were verified as contaminated samples with S. enterica . Presumptive colonies were further characterized using biochemical assays. Triple sugar iron (TSI) agar assay was carried out and positive samples were selected for further analysis. Citrate utilization assay verified ability of isolates to use citrate as sole carbon source. Indole production, motility and hydrogen sulfide (H₂S) generation were assessed using SIM media. Urease assessment was carried out to exclude urease-producing contaminants. Additionally, methyl red (MR) assay was carried out, where positive isolates demonstrated color change to red or orange within seconds after adding the indicator, verifying mixed acid fermentation. In summary, isolates showing expected morphological characteristics on selective media with confirmatory biochemical reactions were identified as S. enterica , accounting for 14.8% of the total milk samples. Isolation and identification of Enterohemorrhagic Escherichia coli The 196 camel milk samples were screened for the presence of EHEC. Selective plating was carried out on SMAC agar to identify presumptive colonies. No suspicious colonies were observed on the selective media, indicating absence of EHEC in all milk samples. These findings suggested that the milk samples in this study were free of EHEC contamination based on cultural and selective plating methods. Isolation and identification of Listeria monocytogenes In the present study, 196 camel milk samples were investigated for the presence of L. monocytogenes . Selective plating was carried out using PALCAM agar to detect presumptive colonies. From all samples, two camel milk samples (1%) were positive for L. monocytogenes . These results indicated a low prevalence rate of L. monocytogenes contamination in the analyzed milk samples. Qualitative assessment of DNAs extracted from the camel milks Generally, DNAs extracted using boiling method produced smeared and diffused bands on 1.5% agarose gels (Fig. 16). In contrast, DNAs extracted with the commercial kit resulted in sharp distinct bands with no visible contaminations (Fig. 16). Quantitative assessment of DNAs extracted from the camel milks Concentration and purity of DNAs extracted from camel milks were assessed using NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Gradient annealing temperature analysis of the polymerase chain reaction Briefly, PCR gradient temperature analysis was carried out to verify and optimize the annealing temperature for each primer. Then, PCR products were analyzed on 1.5% agarose gels (Fig. 18). Clear well-defined bands were generally observed at 57°C, which was therefore selected as the optimal annealing temperature for all primers. Optimization and specificity of the multiplex polymerase chain reaction In the current study, M-PCR produced distinct amplicons for each pathogen (Fig. 19). No cross-reactivity was observed with the non-target strains, verifying 100% specificity. The optimized annealing temperature (58°C) guaranteed clear band separation on agarose gels. Sensitivity and detection limit In general, M-PCR detected all four pathogens at 10² CFU ml − 1 in spiked camel milk samples after 6 h of enrichment (Fig. 20). Without enrichment, LOD was 10⁴ CFU ml − 1 , highlighting importance of the enrichment step in overcoming matrix inhibitors. Comparison of sensitivity and specificity of the multiplex polymerase chain reaction with those of the culture Sensitivity and specificity of M-PCR were assessed against the culture of gold standard, using comparative table. The M-PCR was carried out on DNA samples extracted from camel milk based on the established protocol. Positive and negative results for each sample were compared with results for the corresponding culture to assess performance. The M-PCR decreased the overall detection time to 24 h, compared to 4–7 d for culture methods. Sensitivity and of method were 100%, 100%, 67% and for S. enterica , L. monocytogenes and S. aureus , respectively. Specificity and of method were 100%, 98.4%, 100% and 95.9% for S. enterica , L. monocytogenes , S. aureus and EHEC, respectively. Analysis of the camel milk samples Of the 100 camel milk samples, M-PCR detected S. aureus in 18 samples, EHEC in eight samples, S. enterica in 12 samples and L. monocytogenes in 6 samples. Culture method identified S. aureus in 17 samples, EHEC in seven samples, S. enterica in 11 samples and L. monocytogenes in five samples. The concordance rate was 95% (Cohen’s kappa = 0.92, p < 0.001). Additionally, M-PCR identified one further positive sample for each pathogen, possibly due to its ability to detect VBNC cells. Discussion This investigation presents the inaugural development and validation of a multiplex polymerase chain reaction (M-PCR) assay specifically designed for the simultaneous detection of four major foodborne pathogens— Staphylococcus aureus , enterohemorrhagic Escherichia coli (EHEC), Salmonella enterica , and Listeria monocytogenes —in camel milk. The assay exhibited robust analytical performance, achieving a high sensitivity of 10 2 colony-forming units per milliliter (CFU mL − 1 ) and a specificity of 100%. These performance metrics are commensurate with those reported in previous M-PCR studies applied to diverse food matrices( 22 , 23 ). The incorporation of SEL broth as a universal enrichment medium was a critical methodological refinement. This step facilitated optimal pathogen recovery by mitigating the inhibitory effects of the camel milk's complex matrix, specifically its high fat and protein content, which often compromises direct PCR amplification( 24 ). Compared to conventional culture-based methodologies, the developed M-PCR assay offers substantial advantages in terms of detection speed and analytical sensitivity. While culture methods remain the gold standard for viability, their intrinsic limitation is the non-detectability of viable but non-culturable (VBNC) cells. The higher frequency of positive results observed with the M-PCR assay may, therefore, be attributable to the detection of these VBNC cells, a phenomenon previously noted in food microbiology research( 25 ). Furthermore, the assay's direct applicability to the complex camel milk matrix, sans the need for extensive sample purification, represents a significant differentiation from established PCR protocols that were optimized for less complex matrices, such as cow milk or meat products( 26 ). The observed prevalence rates of the target pathogens (ranging from to ) in camel milk samples sourced from Gonbad Kavoos, Iran, underscore an urgent need for the implementation of stringent hygiene and sanitation protocols within local production systems. Specifically, the high incidence of S. aureus , the most common contaminant, strongly correlates with suboptimal milking hygiene practices( 27 ).The less frequent but notable detection of EHEC and L. monocytogenes raises significant public health concerns due to their association with severe foodborne illness and low infectious doses. A recognized limitation of the current assay is the mandatory pre-enrichment step required to achieve the CFU mL − 1 threshold for optimal sensitivity. Additionally, the potential for false-negative results in samples with extremely low pathogen concentrations must be acknowledged. Future research should focus on enhancing the clinical utility of this assay. This could involve integrating real-time M-PCR for quantitative analysis or utilizing propidium monoazide (PMA)-M-PCR to effectively distinguish between viable and non-viable cells, thereby improving the assay's applicability for regulatory food safety screening( 28 ). Materials and Methods Standard strains Reference bacterial strains, including Staphylococcus aureus ATCC 25923, Escherichia coli O157:H7 NCTC 12900, Listeria monocytogenes ATCC 19117, and Salmonella enterica subsp. enterica serovar Enteritidis ATCC 4931, were sourced from the American Type Culture Collection (ATCC) and the National Collection of Type Cultures (NCTC). The identity of all isolates was rigorously confirmed using conventional biochemical assays, comparing the observed results against the established profiles of the reference strains. Samples collection A total of 196 raw camel milk samples were aseptically collected from various traditional dairy outlets in Gonbad Kavoos, Golestan Province, Iran, over a one-year period. Samples were immediately transferred in sterile containers under refrigerated conditions (4°C) to the Food Microbiology Laboratory, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran. All samples were processed and analyzed within 24 hours of collection to assess the presence of the target pathogens: S. aureus , EHEC, S. enterica , and L. monocytogenes . Bacterial enrichment and cultivation The isolation and identification protocols for each target bacterium strictly adhered to the relevant Iran National Standards Organization (INSO). 1- Staphylococcus aureus Isolation and identification followed INSO no. 6806-1. Samples were enriched using Giolitti-Cantoni broth supplemented with 0.2 mL potassium tellurite. Enriched cultures were subsequently streaked onto Baird-Parker Agar (BPA). Plates were incubated at 37°C for 24 to 48 hours. Jet-black colonies surrounded by a characteristic white halo were presumptively identified as S. aureus. 2 Enterohemorrhagic Escherichia coli (EHEC) The procedure followed INSO no. 2946. Initial enrichment was performed sequentially in Lauryl Sulfate Broth and EC Broth. Enriched samples were plated onto Sorbitol MacConkey (SMAC) Agar and incubated at 37°C for 24 hours. At least four morphologically typical colonies per plate, exhibiting a metallic sheen, were selected and transferred into Nutrient Broth for further confirmation. 3. Salmonella enterica Isolation adhered to INSO no. 1810-1. Samples were initially pre-enriched in Buffered Peptone Water (BPW). The pre-enriched mixture was then transferred to Rappaport-Vassiliadis (RV) Broth and incubated at 42°C for 24–48 hours. Enriched cultures were streaked onto Hektoen Enteric (HE) Agar and incubated at 37°C for 24 to 48 hours. 4. Listeria monocytogenes The isolation and identification protocol followed INSO no. 8035-1. Buffered Listeria Enrichment Broth (LEB) was utilized for the selective enrichment phase. Enriched samples were streaked onto Polymyxin Acriflavine Lithium Chloride Ceftazidime Esculin Mannitol (PALCAM) Agar and incubated at 35°C for 24–48 hours Colonies ranging from in diameter, displaying a grayish-green or olive-green color with a distinct black center and halo, were considered presumptive colonies. Biochemical and verification assays In general, 4–5 suspected colonies were selected from each selective agar plate and subcultured for confirmatory identification using Gram staining and standard biochemical assays. Identification of S. aureus was verified through Gram staining and various biochemical assays such as catalase, coagulase, mannitol salt agar (MSA) and DNase assays. Biochemical assays were carried out to verify presence of EHEC through Gram staining and catalase, indole, methyl red (MR), Voges-Proskauer, nitrate reduction, urease production, Simon citrate agar and sugar fermentation assays. Verification of S. enterica was carried out using Enterobacteriaceae gallery assays. Morphologically typical colonies of L. monocytogenes were recognized through Gram staining. Additional assays included catalase reaction, tumbling motility at 20–25°C, methyl red, Voges-Proskauer, nitrate reduction, sugar fermentation, CAMP and hemolysis on 5% sheep blood agar assays. Enrichment and spiking experiments Camel milk samples were spiked with 10¹ to 10⁶ CFU ml − 1 of each pathogen to investigate detection limits. Samples were enriched at 37°C for 6 hours before DNA extraction using universal pre-enrichment broth (SEL broth). Non-spiked samples served as negative controls. DNA extraction Briefly, DNA extraction from the camel milk samples and those contaminated with reference strains of the target bacteria was carried out using tissue genomic DNA extraction mini kit (cat. FATGK 00; Yekta-Tajhiz Azma, Iran) based on the manufacturer's instructions. The resulting supernatant with DNA content was used as template for M-PCR assay. Moreover, DNA quality was assessed using A 260 /A 280 ratios, ultraviolet spectrophotometer (Merinton SMA 1000; Beijing, China) and agarose gel electrophoresis. Extracted genomic DNAs (gDNA) from the highlighted strains were stored at -80°C until further use. Primers Oligonucleotide primers were designed using Primer3 software (Whitehead Institute, Cambridge, Massachusetts, USA) to target sea gene of S. aureus , stx -1 gene of EHEC, inv A gene of S. enterica and ABC transporter permease gene of L. monocytogenes . Primer specificity was assessed in silico using Primer-BLAST of NCBI ( https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ). Nucleotide sequences of the primers used for target foodborne pathogens are detailed in Table 1 . All primers were synthesized by Sinaclon Biotech, Tehran, Iran. Table 1 Primers used in the current study Bacteria Oligo sequence (5'-3') Tm ( O C) Amplicon (bp) Staphylococcus aureus seaF : CCTTTGGAAACGGTTAAAACG 57 127 seaR : TCTGAACCTTCCCATCAAAAAC 58 Escherichia coli O157:H7 STXF : TTGTTTGCAGTTGATGTCAGAGG 61 490 STXR : CAGGCAGGACACTACTCAACCTTC 67 Salmonella enterica SEF : GATCTGGGCGACAAGACCAT 60 105 SER : ATTGGCGGTATTTCGGTGGG 60 Listeria monocytogenes LMF : CACCAGCATCTCCGCCTG 61 151 LMR : CCTTTTCTTGGCGGCACATT 58 Polymerase chain reaction Optimization of the annealing temperatures Annealing temperatures for the primer sets were optimized using gradient PCR to ensure high specificity and clear amplification bands. Although designed primers demonstrated minimal variations in calculated melting temperatures, a temperature gradient of ± 5°C from the theoretical annealing temperature was used for verification. The PCR products were visualized on agarose gels to investigate the optimal annealing temperature for each target gene using gel documentation system. Gradient PCR was carried out using gDNA extracted from pure bacterial colonies and camel milk samples artificially inoculated with the reference strains. Four annealing temperatures were assessed for each target microorganism (Tables 2 and 3 ). Table 2 Gradient annealing temperatures for polymerase chain reaction using genomic DNA from bacterial colonies Bacteria Temp. Temp. Temp. Temp. Staphylococcus aureus 52°C 54°C 56°C 58°C Escherichia coli O 157 :H 7 57°C 61°C 63°C 65°C Salmonella enterica 55°C 57°C 59°C 61°C Listeria monocytogenes 55°C 57°C 62°C 64°C Table 3 Gradient annealing temperatures for polymerase chain reaction using DNA extracted from artificially contaminated camel milk Bacterial colony Temp. Temp. Temp. Temp. Staphylococcus aureus 52°C 54°C 56°C 58°C Escherichia coli O 157 :H 7 57°C 61°C 63°C 65°C Salmonella enterica 55°C 57°C 59°C 61°C Listeria monocytogenes 55°C 57°C 62°C 64°C Polymerase chain reaction protocols For the bacterial colony DNA and DNA extracted from artificially contaminated milk samples, PCR reactions were prepared in 0.2-ml autoclaved sterile microtubes. Each reaction mixture was prepared as described in Table 4 and then transferred into a thermal cycler programmed using the cycling conditions (Table 5 ). Table 4 Polymerase chain reaction components and final concentrations Reagent Volume Final conc. Master mix 12.5 µl 1× Forward primer 1 µl 0.4 µM Reverse primer 1 µl 0.4 µM Nuclease-free water 8.5 µl - Template DNA 2 µl 50–100 ng Final volume 25 µl 1× Table 5 Thermal cycling programs used in polymerase chain reactions Step Temp. Time Cycle Pre-denaturation 94°C 5 min 1 Denaturation 94°C 30 s 33 Annealing Grad. 30 s 33 Extension 72°C 30 s 33 Final extension 72°C 10 min 1 Sensitivity and specificity assessments of the polymerase chain reactions Sensitivity assessment To assess analytical sensitivity of the PCR using gene-specific primers, gDNA extracted from each target bacterial species (average concentration of 60 ng µl − 1 ) was serially diluted with nuclease-free distilled water (DW) to achieve final concentrations of 30, 15, 7.5, 3.75, 1.87 and 0.9 ng µl − 1 . Each dilution was used in PCR under the optimized conditions described previously to investigate the lowest detectable DNA concentration for each target gene. Specificity assessment The analytical specificity of each primer pair was assessed using non-target bacterial strains as negative controls. For the detection of sea gene ( S. aureus ), negative controls included S. enterica , L. monocytogenes and EHEC. For the detection of stx 1 gene (EHEC), negative controls included S. aureus , L. monocytogenes and S. enterica . For the detection of inv A gene ( S. enterica ), negative controls included S. aureus , L. monocytogenes and EHEC. For the detection of ABC transporter permease gene ( L. monocytogenes ), negative controls included S. aureus , EHEC and S. enterica . Amplification was expected in reactions containing DNA from the target species, verifying primer specificity. Multiplex polymerase chain reaction Preparation of the reaction mixture The M-PCR was used to simultaneously amplify SEA , stx -1, inv A and ABC transporter permease genes in a single reaction. Each 25-µl reaction contained 12.5 µl of the commercial PCR master mix, 1 µl of forward primer (0.4 µM), 1 µl of reverse primer (0.4 µM), 8.5 µl of sterile DW and 2 µl of template DNA (50–100 ng). Reactions were prepared in 0.2-ml sterile PCR microtubes. Table 6 Multiplex polymerase chain reaction reagents Reagent Volume Final conc. Master mix 12.5 µl 1× Forward primer 1 µl 0.4 µM Reverse primer 1 µl 0.4 µM Nuclease-free water 8.5 µl - Template DNA 2 µl 50–100 ng Final volume 25 µl 1× Polymerase chain reaction amplification Thermal cycling was carried out using the following conditions of pre-denaturation at 94°C for 5 min (one cycle) and then denaturation at 94°C for 30 s, annealing at 57°C for 30 s and extension at 72°C for 30 s (33 cycles), followed by final extension at 72°C for 10 min (one cycle). Table 7 Thermal cycling conditions for multiplex polymerase chain reaction Step Temp. Time Cycle Pre-denaturation 94 o C 5 min 1 Denaturation 94 o C 30 s 33 Annealing 57 o C 30 s 33 Extension 72 o C 30 s 33 Final extension 72 o C 10 min 1 Electrophoretic analysis Generally, PCR products were analyzed on 1.5% agarose gels prepared in 0.5× TBE buffer. Gels were stained with DNA Safe Stain (6 µl per 30 ml of gel), loaded with 6 µl of each PCR product and electrophoresed at 70 V for 105 min. Gel images were captured to verify presence and size of amplified fragments. Assessing specificity and sensitivity of the multiplex polymerase chain reaction Specificity assessment To assess specificity of the designed primers for the target bacteria, M-PCR assay was carried out on artificially contaminated milk samples with standard bacterial strains as well as unspiked milk samples. For S. aureus , DNA extracted from the bacteria was assessed using S. enterica, L. monocytogenes and EHEC as negative controls. Absence of amplification bands in non-target bacteria verified specificity of the primers for the SEA gene of S. aureus . For EHEC, DNA was extracted from the bacteria assessed using S. aureus , S. enterica and L. monocytogenes . Lack of amplification in non-target bacteria verified primer specificity for the stx -1 gene. For S. enterica , DNA from the bacteria was assessed using S. aureus , L. monocytogenes and EHEC as negative controls. No amplification in non-target species verified specificity of the inv A gene primers for S. enterica . For L. monocytogenes , DNA extracted from the bacteria was assessed using S. aureus , S. enterica and EHEC as negative controls. Absence of cross-amplification verified primer specificity for the ABC transporter permease gene. Sensitivity assessment To investigate limit of detection (LOD) for the assay, serial dilutions of the extracted DNA were prepared using sterile DW, starting from an initial concentration of 60 ng µl − 1 . Two-fold serial dilutions resulted in final concentrations of 30, 15, 7.5, 3.75, 1.87 and 0.9 ng µl − 1 . Each dilution was used in M-PCR under the conditions described previously. Comparison with culture method Diagnostic sensitivity and specificity of the M-PCR were calculated, compared to those of the culture method as the gold standard using the following formulas. Sensitivity = TP / TP + FN and specificity = TP / FP + TN. Statistical analysis Similarities between M-PCR and culture methods were assessed using Cohen’s kappa coefficient. Sensitivity, specificity and accuracy were calculated using MedCalc software. A p -value < 0.05 was considered as statistically significant value. Conclusion The developed M-PCR assay constitutes a rapid, highly sensitive, and specific diagnostic platform for the simultaneous detection of S. aureus , EHEC, S. enterica , and L. monocytogenes in camel milk. The demonstrated congruence in performance with established culture methods, coupled with a substantially reduced time-to-result, positions this M-PCR assay as a compelling, high-throughput alternative for routine food safety surveillance. Ultimately, this study significantly advances the microbial safety assessment of camel milk, supporting the integrity of its expanding global market and reinforcing public health protection in producing regions such as Gonbad Kavoos, Iran. Declarations Competing interests The authors declare no conflict of interest. Funding This study was supported by a grant from Tehran University of Medical Sciences (grant no. IR.TUMS.SPH.REC.1403.098) Author Contribution N.B. conceptualized the project, data analysis, and interpretation, and revise of the manuscript. M.A. conceptualized and supervised the project and contributed to data interpretation. R.M.Z.F. conceptualized and supervised the project and contributed to data interpretation. M.S. advised the project and contributed to data interpretation and the manuscript. D.A. advised the project and contributed to data interpretation and the manuscript. A.R.F. advised the project and contributed to data interpretation and the manuscript. Acknowledgments The authors thank University of Tehran for providing reference strains and farmers of Gonbad Kavoos for their helps in sample collection. Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. References Arain, M. A. et al. Nutritional significance and promising therapeutic/medicinal application of camel milk as a functional food in human and animals: A comprehensive review. Animal Biotechnol. 34 (6), 1988–2005 (2023). Gizachew, A., Teha, J., Birhanu, T. & Nekemte, E. Review on medicinal and nutritional values of camel milk. Nat. Sci. 12 (12), 35–41 (2014). Khan, M. Z. et al. Research development on anti-microbial and antioxidant properties of camel milk and its role as an anti-cancer and anti-hepatitis agent. Antioxidants 10 (5), 788 (2021). Mirmiran, P., Ejtahed, H-S., Angoorani, P., Eslami, F. & Azizi, F. Camel milk has beneficial effects on diabetes mellitus: A systematic review. Int. J. Endocrinol. metabolism . 15 (2), e42150 (2017). Abrhaley, A. & Leta, S. Medicinal value of camel milk and meat. J. Appl. Anim. Res. 46 (1), 552–558 (2018). Hussain, H. et al. Camel milk as an alternative treatment regimen for diabetes therapy. Food Sci. Nutr. 9 (3), 1347–1356 (2021). Badawy, A. A. et al. Camel milk extracellular vesicles/exosomes: a fascinating frontier in isolation and therapeutic potential. Food Funct. 16 (2), 344–365 (2025). Mudgil, P., Baba, W. N., Alneyadi, M., Redha, A. A. & Maqsood, S. Production, characterization, and bioactivity of novel camel milk-based infant formula in comparison to bovine and commercial sources. Lwt 154 , 112813 (2022). Abduku, H. & Eshetu, M. Camel Milk Product Processing Characteristics and Bioactive Based Infant Formula: A Review. International J. Food Sci. Agriculture ; 7 (2). (2023). Mullaicharam, A. A review on medicinal properties of camel milk. World J. Pharm. Sciences :237–242. (2014). Patel, D., Pinto, S. & Pal, M. A comprehensive review on the properties of camel milk and milk products. (2022). Konuspayeva, G. & Faye, B. Recent advances in camel milk processing. Animals 11 (4), 1045 (2021). Yirda, A., Eshetu, M. & Babege, K. Current status of camel dairy processing and technologies: a review. Open. J. Anim. Sci. 10 (3), 362–377 (2020). Singha, S., Thomas, R., Viswakarma, J. N. & Gupta, V. K. Foodborne illnesses of Escherichia coli O157origin and its control measures. J. Food Sci. Technol. 60 (4), 1274–1283 (2023). Bintsis, T. Foodborne pathogens. AIMS Microbiol. 3 (3), 529 (2017). Panwar, S. et al. Advanced diagnostic methods for identification of bacterial foodborne pathogens: Contemporary and upcoming challenges. Crit. Rev. Biotechnol. 43 (7), 982–1000 (2023). Nassarawa, S. S., Luo, Z. & Lu, Y. Conventional and emerging techniques for detection of foodborne pathogens in horticulture crops: A leap to food safety. Food Bioprocess Technol. 15 (6), 1248–1267 (2022). Tao, J. et al. A multiplex PCR assay with a common primer for the detection of eleven foodborne pathogens. J. Food Sci. 85 (3), 744–754 (2020). Kalin, R., Karahan, M., AÇIK, M., Tasdemir, B. & Cetinkaya, B. Development of a multiplex PCR method for direct detection of common mastitis pathogens in bovine milk samples. Kafkas Universitesi Veteriner Fakultesi Dergisi ; 23 (6). (2017). Balakrishna, K., Murali, H. & Batra, H. A novel multiplex polymerase chain reaction for simultaneous detection of Yersinia enterocolitica, Staphylococcus aureus, Aeromonas and Salmonella from chicken meat and milk samples. J. Food Saf. 30 (2), 263–275 (2010). Sarkar, D., Ranjan, R., Marwaha, S., Sahoo, A. & Naha, S. Multiplex PCR for detection of camel milk adulteration with cattle and goat milk. Int. Dairy J. 154 , 105922 (2024). Boukharouba, A., González, A., García-Ferrús, M., Ferrús, M. A. & Botella, S. Simultaneous detection of four main foodborne pathogens in ready-to-eat food by using a simple and rapid multiplex PCR (mPCR) assay. Int. J. Environ. Res. Public Health . 19 (3), 1031 (2022). Hodzic, E., Glavinic, A. & Wademan, C. A novel approach for simultaneous detection of the most common food-borne pathogens by multiplex qPCR. Biomolecules Biomed. 23 (4), 640 (2023). Freije, A. et al. Analysis of the nutritional composition of Bahraini breed camel (Camelus dromedarius) milk: fatty acid, mineral, phenolic, and antioxidant content. Arab. J. Basic. Appl. Sci. 31 (1), 604–613 (2024). Liu, J., Yang, L., Kjellerup, B. V. & Xu, Z. Viable but nonculturable (VBNC) state, an underestimated and controversial microbial survival strategy. Trends Microbiol. 31 (10), 1013–1023 (2023). Kotzekidou, P. Survey of Listeria monocytogenes, Salmonella spp. and Escherichia coli O157: H7 in raw ingredients and ready-to-eat products by commercial real-time PCR kits. Food Microbiol. 35 (2), 86–91 (2013). Ghahfarokhi, E. Y., Shakerian, A., Chaleshtori, R. S. & Rahimi, E. Investigation of the Abundance of Escherichia coli and Staphylococcus aureus (Including Virulence Gene Profiles) and Heavy Metal Contamination in Camel Milk. Veterinary Med. Sci. 11 (6), e70632 (2025). Kaur, S., Bran, L., Rudakov, G., Wang, J. & Verma, M. S. Propidium Monoazide is Unreliable for Quantitative Live–Dead Molecular Assays. Anal. Chem. 97 (5), 2914–2921 (2025). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8063829","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":552762327,"identity":"46c380d6-2c63-4df4-a77d-5acfbb4d9cfb","order_by":0,"name":"Nikan Bahrameh","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Nikan","middleName":"","lastName":"Bahrameh","suffix":""},{"id":552762328,"identity":"8ae4eb20-0fa9-4f0d-ba37-8745acbdb25c","order_by":1,"name":"Ramin Mazaheri Nezhad Fard","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ramin","middleName":"Mazaheri Nezhad","lastName":"Fard","suffix":""},{"id":552762331,"identity":"ea1b9b38-97cb-4429-99e2-d30f632a35fe","order_by":2,"name":"Davoud Afshar","email":"","orcid":"","institution":"Zanjan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Davoud","middleName":"","lastName":"Afshar","suffix":""},{"id":552762332,"identity":"cf5c874d-0d1a-4ed3-ae8e-d8fe54c63c0e","order_by":3,"name":"Milad Sadeghzadeh","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Milad","middleName":"","lastName":"Sadeghzadeh","suffix":""},{"id":552762333,"identity":"376f52a7-cd56-46f5-a991-e659d728c8dd","order_by":4,"name":"Abbas Rahimi Foroushani","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Abbas","middleName":"Rahimi","lastName":"Foroushani","suffix":""},{"id":552762340,"identity":"17fc8c06-6e77-43d5-afc4-4a2a76676b24","order_by":5,"name":"Masoomeh Amini","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIiWNgGAWjYFACxgaGBAYGOQZmFFEDwlqMIVoSiNICAYkNDCha8AD+aYfbHjxg2JY+v5334AfGH4ej5RuYH35gKLiHU4vE7cR2gwSG27kbDvMlSzAkHM7dcIDNWILBoBi3NbcT2yTAWph5DCBaGBjMgH7B7UR5qJZ0+WYe4x8gLfMb2L/h1WIA1ZLAcJjHDGxLwwEe/LYYgrUY3DbcANRikZCWDvQUTzFQBLcWudvpzyR/VNyWl+8/Y3zjg4117vz29o0fPvzBrQXqPCgNVsfMQFz8jIJRMApGwSjADQBh206/fRAzIAAAAABJRU5ErkJggg==","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Masoomeh","middleName":"","lastName":"Amini","suffix":""}],"badges":[],"createdAt":"2025-11-08 12:08:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8063829/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8063829/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97157519,"identity":"a3436b23-0495-482a-961b-881ab571cc6f","added_by":"auto","created_at":"2025-12-01 11:46:33","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1385040,"visible":true,"origin":"","legend":"","description":"","filename":"F5nikan.docx","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/1fca3b29a6478849e32ac99a.docx"},{"id":97157517,"identity":"5bf15682-3162-4fc0-afbe-ede97c39025d","added_by":"auto","created_at":"2025-12-01 11:46:32","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8544,"visible":true,"origin":"","legend":"","description":"","filename":"c083894d8fe64b74ab80507471f8823e.json","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/6cfcae8dbc10544de3f08211.json"},{"id":97157518,"identity":"b3a29cf6-73ff-4470-9275-764fa6f462d6","added_by":"auto","created_at":"2025-12-01 11:46:33","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102891,"visible":true,"origin":"","legend":"","description":"","filename":"c083894d8fe64b74ab80507471f8823e1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/d61f23e9267e2cb92f162f8a.xml"},{"id":97157513,"identity":"4e4d688c-3e6b-4d06-a729-4e3c2f793668","added_by":"auto","created_at":"2025-12-01 11:46:32","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":88659,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/da7758c29f6faddfb20ead4b.png"},{"id":97157516,"identity":"45cccea1-774b-45a4-968c-edff61ac900e","added_by":"auto","created_at":"2025-12-01 11:46:32","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92242,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/14e3ec58c1baaf890a83f5f9.png"},{"id":97157521,"identity":"8be26168-f2fa-4a53-b11c-070b4ba97768","added_by":"auto","created_at":"2025-12-01 11:46:33","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":40960,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/2bdb489165775b60ed00e20e.png"},{"id":97248483,"identity":"d841f6cf-404b-436f-a293-70f30a10bee7","added_by":"auto","created_at":"2025-12-02 13:00:27","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11416,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/a8b9de0217b50018002928da.png"},{"id":97157520,"identity":"6f929711-c3e5-4100-a7bb-c630e5660a3f","added_by":"auto","created_at":"2025-12-01 11:46:33","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101470,"visible":true,"origin":"","legend":"","description":"","filename":"c083894d8fe64b74ab80507471f8823e1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/b83edd630b9f1a12b9de5c52.xml"},{"id":97157522,"identity":"4f92d072-fbc5-4df9-aad3-be8a813bf899","added_by":"auto","created_at":"2025-12-01 11:46:33","extension":"html","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115356,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/6fcd8ede4fb8941f0b257e33.html"},{"id":97157510,"identity":"fd16d702-ae6c-4173-b4d8-f3190643a8cc","added_by":"auto","created_at":"2025-12-01 11:46:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":107294,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis (1.5%) of DNA extracted from camel milks. (A) Boiling method (Lane 1), (B) commercial extraction kit (Lane 2) and M, 100-bp DNA ladder\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/6654b1f13f2eef0afbcbc6a2.png"},{"id":97157514,"identity":"a69d9da6-8bd5-487b-b0ef-9a036b91f6d9","added_by":"auto","created_at":"2025-12-01 11:46:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":586475,"visible":true,"origin":"","legend":"\u003cp\u003ePolymerase chain reaction temperature gradient analysis. M, 100-bp DNA ladder; (A) gradient temperatures for Enterohemorrhagic\u003cem\u003e Escherichia coli\u003c/em\u003e; (B) gradient temperatures for \u003cem\u003eStaphylococcus aureus\u003c/em\u003e; (C) gradient temperatures for \u003cem\u003eSalmonella enterica\u003c/em\u003e and (D) gradient temperatures for \u003cem\u003eListeria monocytogenes\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/d2dc6bd8ccc3922dd4a091b7.png"},{"id":97249771,"identity":"55d0dffc-73fe-4a10-8dce-d4aae2d93119","added_by":"auto","created_at":"2025-12-02 13:13:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":330455,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of multiplex polymerase chain reaction products. Lane M, 100-bp DNA Ladder; Lane 1, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (159 bp); Lane 2, Enterohemorrhagic \u003cem\u003eEscherichia coli \u003c/em\u003e(193 bp); Lane 3, \u003cem\u003eSalmonella enterica \u003c/em\u003e(262 bp); Lane 4, \u003cem\u003eListeria monocytogenes\u003c/em\u003e (285 bp); Lane 5, mixed template (all four pathogens) and Lane 6, negative control\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/6ad878837320ecb8adc25a4a.png"},{"id":97157512,"identity":"6052489e-2439-492f-8bef-f3009b7a9410","added_by":"auto","created_at":"2025-12-01 11:46:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":196279,"visible":true,"origin":"","legend":"\u003cp\u003eSensitivity analysis of multiplex polymerase chain reaction using serial dilutions of genomic DNA. M, 100-bp DNA Ladder; Lane 1, 30 ng μl\u003csup\u003e-1\u003c/sup\u003e; Lane 2, 15 ng μl\u003csup\u003e-1\u003c/sup\u003e; Lane 3, 7.5 ng μl\u003csup\u003e-1\u003c/sup\u003e; Lane 4, 3.75 ng μl\u003csup\u003e-1\u003c/sup\u003e; Lane 5, 1.87 ng μl\u003csup\u003e-1\u003c/sup\u003e and Lane 6, 0.9 ng μl\u003csup\u003e-1\u003c/sup\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/93c8424777d026783a702d2e.png"},{"id":105326178,"identity":"40853b63-1ad5-4471-a43b-f84b467f6140","added_by":"auto","created_at":"2026-03-24 18:55:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2510127,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8063829/v1/e7c1651b-f6fc-4aac-9656-7cda1bfd2709.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A rapid multiplex PCR assay for the simultaneous detection of four major foodborne pathogens in camel milk: Development, validation and comparison of the assay with those of culture-based methods","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCamel milk and its fermented forms have long served as important sources of nutrition for nomadic population living in harsh environments such as desert. Owing to its medicinal and therapeutic properties and its close similarity to human milk, camel milk has increasingly been regarded as a healthier dietary option in developed countries in recent years (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Its health benefits that have stimulated global interest in camel milk consumption include strengthening children's heart muscles and preventing several cancers, such as gastrointestinal cancers (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e), improving type I diabetes due to its insulin-like substance and resistance to stomach acid (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e), helping to treat jaundice, asthma, tuberculosis, autism and leishmaniasis (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Furthermore, other beneficial health characteristics of the camel milk include its anti-allergic characteristics because of low β-lactoglobulin and rich alpha-lactalbumin contents (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Additionally, camel milk includes a high content of lactate, which decreases sensitivity to milk and hence is beneficial for consumers with lactose intolerance. Due to its compositional similarity to human milk, special attentions have recently been paid to the preparation of infant formulas from camel milk (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Camel milk is rich in vitamins such as vitamins B\u003csub\u003e1\u003c/sub\u003e, B\u003csub\u003e2\u003c/sub\u003e and C, making it an important part of the diet in arid regions that have a limited access to green foods. Bioactive peptides derived from various proteins of camel milk with antioxidant, antimicrobial and blood pressure decreasing capabilities include good therapeutic and biological characteristics. Regarding to the high mortality rate of cardiovascular diseases (CVD) worldwide, it is necessary to introduce natural compounds into the daily foods with characteristics of preventing high blood pressure (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn recent years, significant activities have been carried out to produce and supply camel milk nationally. Golestan Province of Iran has started the hygienic supply of camel milk. However, a major problem in its production and industrialization process is camel milk is mostly consumed raw with no heat treatments and stored at high ambient temperatures with lack of cold storage facilities during milking and transportation. This conditions make the milk unsafe and cause foodborne diseases (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). From foodborne pathogens, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, Enterohemorrhagic \u003cem\u003eEscherichia coli\u003c/em\u003e (EHEC\u003cem\u003e)\u003c/em\u003e, \u003cem\u003eSalmonella enterica\u003c/em\u003e and \u003cem\u003eListeria monocytogenes\u003c/em\u003e are further prevalent, which pose significant public health risks and are associated with severe foodborne illnesses, including gastroenteritis, hemolytic uremic syndrome (HUS) and listeriosis (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSince these pathogens can pose a greater risk to human health, focusing on their diagnosis is critical to ensure healthy food supply and minimize the associated diseases. Traditional culture-based methods for detecting these pathogens are time-consuming, labor-intensive and may lack sensitivity, especially when pathogens are present in low concentrations or in viable but non-culturable (VBNC) state (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). To address these limitation, molecular diagnostic techniques, especially multiplex polymerase chain reaction (M-PCR) with ability of simultaneous amplification of multiple target genes in a single reaction, is useful for food safety assessment, where multiple pathogens must efficiently be screened (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Previous studies have developed M-PCR assays for pathogen detection in cow milk and meat products (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). However, none of these assays have specifically targeted camel milk, presenting unique challenges due to its high fat and protein content (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Therefore, the aim of this study was to design and validate a novel M-PCR assay for the simultaneous detection of \u003cem\u003eS. aureus\u003c/em\u003e, EHEC, \u003cem\u003eS. enterica\u003c/em\u003e and \u003cem\u003eL. monocytogenes\u003c/em\u003e in raw camel milk samples collected from Gonbad Kavoos, Iran. The assay performance was compared with standard culture-based assay performance to assess its efficacy, sensitivity and applicability for routine food safety surveillance schemes. Novelty of the study is linked to its optimization for camel milk unique matrix and its potential to enhance microbial safety in a regionally significant food product, where camel milk is widely consumed.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eIsolation and identification of\u003c/b\u003e \u003cb\u003eStaphylococcus aureus\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotally, 196 camel milk samples were assessed for the presence of \u003cem\u003eS. aureus\u003c/em\u003e. Initial screening was carried out by selective culture on Baird-Parker agar, where 85 samples produced colonies with typical \u003cem\u003eS. aureus\u003c/em\u003e morphology. Gram staining of these colonies revealed Gram-positive cocci arranged in grape-like clusters. Catalase assay verified catalase production in the selected isolates. Coagulase-positive isolates, as shown by clot formation within 4\u0026ndash;5 h, were verified as coagulase-producing \u003cem\u003eS. aureus\u003c/em\u003e. Furthermore, DNase activity was detected in these isolates, indicated by clear zones around colonies on DNase agar. Further verification was achieved by culturing on MSA; where, positive isolates fermented mannitol and produced characteristic yellow color in the media. In total, 58 samples (29.6%) were verified as \u003cem\u003eS. aureus\u003c/em\u003e based on their cultural, microscopic and biochemical characteristics.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIsolation and identification of\u003c/b\u003e \u003cb\u003eSalmonella enterica\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn this study, 196 camel milk samples were screened for the presence of \u003cem\u003eS. enterica\u003c/em\u003e. Initial enrichment was carried out using RV broth, followed by selective plating on Hektoen enteric agar to isolate presumptive colonies. Out of the total samples, 29 samples (14.8%) were verified as contaminated samples with \u003cem\u003eS. enterica\u003c/em\u003e. Presumptive colonies were further characterized using biochemical assays. Triple sugar iron (TSI) agar assay was carried out and positive samples were selected for further analysis. Citrate utilization assay verified ability of isolates to use citrate as sole carbon source. Indole production, motility and hydrogen sulfide (H₂S) generation were assessed using SIM media. Urease assessment was carried out to exclude urease-producing contaminants. Additionally, methyl red (MR) assay was carried out, where positive isolates demonstrated color change to red or orange within seconds after adding the indicator, verifying mixed acid fermentation. In summary, isolates showing expected morphological characteristics on selective media with confirmatory biochemical reactions were identified as \u003cem\u003eS. enterica\u003c/em\u003e, accounting for 14.8% of the total milk samples.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIsolation and identification of Enterohemorrhagic\u003c/b\u003e \u003cb\u003eEscherichia coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe 196 camel milk samples were screened for the presence of EHEC. Selective plating was carried out on SMAC agar to identify presumptive colonies. No suspicious colonies were observed on the selective media, indicating absence of EHEC in all milk samples. These findings suggested that the milk samples in this study were free of EHEC contamination based on cultural and selective plating methods.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIsolation and identification of\u003c/b\u003e \u003cb\u003eListeria monocytogenes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn the present study, 196 camel milk samples were investigated for the presence of \u003cem\u003eL. monocytogenes\u003c/em\u003e. Selective plating was carried out using PALCAM agar to detect presumptive colonies. From all samples, two camel milk samples (1%) were positive for \u003cem\u003eL. monocytogenes\u003c/em\u003e. These results indicated a low prevalence rate of \u003cem\u003eL. monocytogenes\u003c/em\u003e contamination in the analyzed milk samples.\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eQualitative assessment of DNAs extracted from the camel milks\u003c/h2\u003e\u003cp\u003eGenerally, DNAs extracted using boiling method produced smeared and diffused bands on 1.5% agarose gels (Fig.\u0026nbsp;16). In contrast, DNAs extracted with the commercial kit resulted in sharp distinct bands with no visible contaminations (Fig.\u0026nbsp;16).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eQuantitative assessment of DNAs extracted from the camel milks\u003c/h3\u003e\n\u003cp\u003eConcentration and purity of DNAs extracted from camel milks were assessed using NanoDrop spectrophotometer (Thermo Fisher Scientific, USA).\u003c/p\u003e\n\u003ch3\u003eGradient annealing temperature analysis of the polymerase chain reaction\u003c/h3\u003e\n\u003cp\u003eBriefly, PCR gradient temperature analysis was carried out to verify and optimize the annealing temperature for each primer. Then, PCR products were analyzed on 1.5% agarose gels (Fig.\u0026nbsp;18). Clear well-defined bands were generally observed at 57\u0026deg;C, which was therefore selected as the optimal annealing temperature for all primers.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eOptimization and specificity of the multiplex polymerase chain reaction\u003c/h3\u003e\n\u003cp\u003eIn the current study, M-PCR produced distinct amplicons for each pathogen (Fig.\u0026nbsp;19). No cross-reactivity was observed with the non-target strains, verifying 100% specificity. The optimized annealing temperature (58\u0026deg;C) guaranteed clear band separation on agarose gels.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eSensitivity and detection limit\u003c/h3\u003e\n\u003cp\u003eIn general, M-PCR detected all four pathogens at 10\u0026sup2; CFU ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in spiked camel milk samples after 6 h of enrichment (Fig.\u0026nbsp;20). Without enrichment, LOD was 10⁴ CFU ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, highlighting importance of the enrichment step in overcoming matrix inhibitors.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eComparison of sensitivity and specificity of the multiplex polymerase chain reaction with those of the culture\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSensitivity and specificity of M-PCR were assessed against the culture of gold standard, using comparative table. The M-PCR was carried out on DNA samples extracted from camel milk based on the established protocol. Positive and negative results for each sample were compared with results for the corresponding culture to assess performance. The M-PCR decreased the overall detection time to 24 h, compared to 4\u0026ndash;7 d for culture methods. Sensitivity and of method were 100%, 100%, 67% and for \u003cem\u003eS. enterica\u003c/em\u003e, \u003cem\u003eL. monocytogenes\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e, respectively. Specificity and of method were 100%, 98.4%, 100% and 95.9% for \u003cem\u003eS. enterica\u003c/em\u003e, \u003cem\u003eL. monocytogenes\u003c/em\u003e, \u003cem\u003eS. aureus\u003c/em\u003e and EHEC, respectively.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eAnalysis of the camel milk samples\u003c/h2\u003e\u003cp\u003eOf the 100 camel milk samples, M-PCR detected \u003cem\u003eS. aureus\u003c/em\u003e in 18 samples, EHEC in eight samples, \u003cem\u003eS. enterica\u003c/em\u003e in 12 samples and \u003cem\u003eL. monocytogenes\u003c/em\u003e in 6 samples. Culture method identified \u003cem\u003eS. aureus\u003c/em\u003e in 17 samples, EHEC in seven samples, \u003cem\u003eS. enterica\u003c/em\u003e in 11 samples and \u003cem\u003eL. monocytogenes\u003c/em\u003e in five samples. The concordance rate was 95% (Cohen\u0026rsquo;s kappa\u0026thinsp;=\u0026thinsp;0.92, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Additionally, M-PCR identified one further positive sample for each pathogen, possibly due to its ability to detect VBNC cells.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis investigation presents the inaugural development and validation of a multiplex polymerase chain reaction (M-PCR) assay specifically designed for the simultaneous detection of four major foodborne pathogens\u0026mdash;\u003cem\u003eStaphylococcus aureus\u003c/em\u003e, enterohemorrhagic \u003cem\u003eEscherichia coli\u003c/em\u003e (EHEC), \u003cem\u003eSalmonella enterica\u003c/em\u003e, and \u003cem\u003eListeria monocytogenes\u003c/em\u003e\u0026mdash;in camel milk. The assay exhibited robust analytical performance, achieving a high sensitivity of 10\u003csup\u003e2\u003c/sup\u003e colony-forming units per milliliter (CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and a specificity of 100%. These performance metrics are commensurate with those reported in previous M-PCR studies applied to diverse food matrices(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe incorporation of SEL broth as a universal enrichment medium was a critical methodological refinement. This step facilitated optimal pathogen recovery by mitigating the inhibitory effects of the camel milk's complex matrix, specifically its high fat and protein content, which often compromises direct PCR amplification(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCompared to conventional culture-based methodologies, the developed M-PCR assay offers substantial advantages in terms of detection speed and analytical sensitivity. While culture methods remain the gold standard for viability, their intrinsic limitation is the non-detectability of viable but non-culturable (VBNC) cells. The higher frequency of positive results observed with the M-PCR assay may, therefore, be attributable to the detection of these VBNC cells, a phenomenon previously noted in food microbiology research(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFurthermore, the assay's direct applicability to the complex camel milk matrix, \u003cem\u003esans\u003c/em\u003e the need for extensive sample purification, represents a significant differentiation from established PCR protocols that were optimized for less complex matrices, such as cow milk or meat products(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe observed prevalence rates of the target pathogens (ranging from to ) in camel milk samples sourced from Gonbad Kavoos, Iran, underscore an urgent need for the implementation of stringent hygiene and sanitation protocols within local production systems. Specifically, the high incidence of \u003cem\u003eS. aureus\u003c/em\u003e, the most common contaminant, strongly correlates with suboptimal milking hygiene practices(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e).The less frequent but notable detection of EHEC and \u003cem\u003eL. monocytogenes\u003c/em\u003e raises significant public health concerns due to their association with severe foodborne illness and low infectious doses.\u003c/p\u003e\u003cp\u003eA recognized limitation of the current assay is the mandatory pre-enrichment step required to achieve the CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e threshold for optimal sensitivity. Additionally, the potential for false-negative results in samples with extremely low pathogen concentrations must be acknowledged. Future research should focus on enhancing the clinical utility of this assay. This could involve integrating real-time M-PCR for quantitative analysis or utilizing propidium monoazide (PMA)-M-PCR to effectively distinguish between viable and non-viable cells, thereby improving the assay's applicability for regulatory food safety screening(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e).\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eStandard strains\u003c/h2\u003e\u003cp\u003eReference bacterial strains, including \u003cem\u003eStaphylococcus aureus\u003c/em\u003e ATCC 25923, \u003cem\u003eEscherichia coli\u003c/em\u003e O157:H7 NCTC 12900, \u003cem\u003eListeria monocytogenes\u003c/em\u003e ATCC 19117, and \u003cem\u003eSalmonella enterica\u003c/em\u003e subsp. \u003cem\u003eenterica\u003c/em\u003e serovar Enteritidis ATCC 4931, were sourced from the American Type Culture Collection (ATCC) and the National Collection of Type Cultures (NCTC). The identity of all isolates was rigorously confirmed using conventional biochemical assays, comparing the observed results against the established profiles of the reference strains.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eSamples collection\u003c/h2\u003e\u003cp\u003eA total of 196 raw camel milk samples were aseptically collected from various traditional dairy outlets in Gonbad Kavoos, Golestan Province, Iran, over a one-year period. Samples were immediately transferred in sterile containers under refrigerated conditions (4\u0026deg;C) to the Food Microbiology Laboratory, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran. All samples were processed and analyzed within 24 hours of collection to assess the presence of the target pathogens: \u003cem\u003eS. aureus\u003c/em\u003e, EHEC, \u003cem\u003eS. enterica\u003c/em\u003e, and \u003cem\u003eL. monocytogenes\u003c/em\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eBacterial enrichment and cultivation\u003c/h2\u003e\u003cp\u003eThe isolation and identification protocols for each target bacterium strictly adhered to the relevant Iran National Standards Organization (INSO).\u003c/p\u003e\u003cp\u003e\u003cb\u003e1-\u003c/b\u003e \u003cb\u003eStaphylococcus aureus\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIsolation and identification followed INSO no. 6806-1.\u003c/p\u003e\u003cp\u003eSamples were enriched using Giolitti-Cantoni broth supplemented with 0.2 mL potassium tellurite. Enriched cultures were subsequently streaked onto Baird-Parker Agar (BPA). Plates were incubated at 37\u0026deg;C for 24 to 48 hours. Jet-black colonies surrounded by a characteristic white halo were presumptively identified as S. aureus.\u003c/p\u003e\u003cp\u003e\u003cb\u003e2 Enterohemorrhagic\u003c/b\u003e \u003cb\u003eEscherichia coli\u003c/b\u003e \u003cb\u003e(EHEC)\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe procedure followed INSO no. 2946.\u003c/p\u003e\u003cp\u003eInitial enrichment was performed sequentially in Lauryl Sulfate Broth and EC Broth. Enriched samples were plated onto Sorbitol MacConkey (SMAC) Agar and incubated at 37\u0026deg;C for 24 hours. At least four morphologically typical colonies per plate, exhibiting a metallic sheen, were selected and transferred into Nutrient Broth for further confirmation.\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.\u003c/b\u003e \u003cb\u003eSalmonella enterica\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIsolation adhered to INSO no. 1810-1.\u003c/p\u003e\u003cp\u003eSamples were initially pre-enriched in Buffered Peptone Water (BPW). The pre-enriched mixture was then transferred to Rappaport-Vassiliadis (RV) Broth and incubated at 42\u0026deg;C for 24\u0026ndash;48 hours. Enriched cultures were streaked onto Hektoen Enteric (HE) Agar and incubated at 37\u0026deg;C for 24 to 48 hours.\u003c/p\u003e\u003cp\u003e\u003cb\u003e4.\u003c/b\u003e \u003cb\u003eListeria monocytogenes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe isolation and identification protocol followed INSO no. 8035-1.\u003c/p\u003e\u003cp\u003eBuffered Listeria Enrichment Broth (LEB) was utilized for the selective enrichment phase.\u003c/p\u003e\u003cp\u003eEnriched samples were streaked onto Polymyxin Acriflavine Lithium Chloride Ceftazidime Esculin Mannitol (PALCAM) Agar and incubated at 35\u0026deg;C for 24\u0026ndash;48 hours\u003c/p\u003e\u003cp\u003eColonies ranging from in diameter, displaying a grayish-green or olive-green color with a distinct black center and halo, were considered presumptive colonies.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eBiochemical and verification assays\u003c/h2\u003e\u003cp\u003eIn general, 4\u0026ndash;5 suspected colonies were selected from each selective agar plate and subcultured for confirmatory identification using Gram staining and standard biochemical assays. Identification of \u003cem\u003eS. aureus\u003c/em\u003e was verified through Gram staining and various biochemical assays such as catalase, coagulase, mannitol salt agar (MSA) and DNase assays.\u003c/p\u003e\u003cp\u003eBiochemical assays were carried out to verify presence of EHEC through Gram staining and catalase, indole, methyl red (MR), Voges-Proskauer, nitrate reduction, urease production, Simon citrate agar and sugar fermentation assays. Verification of \u003cem\u003eS. enterica\u003c/em\u003e was carried out using Enterobacteriaceae gallery assays. Morphologically typical colonies of \u003cem\u003eL. monocytogenes\u003c/em\u003e were recognized through Gram staining. Additional assays included catalase reaction, tumbling motility at 20\u0026ndash;25\u0026deg;C, methyl red, Voges-Proskauer, nitrate reduction, sugar fermentation, CAMP and hemolysis on 5% sheep blood agar assays.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eEnrichment and spiking experiments\u003c/h2\u003e\u003cp\u003eCamel milk samples were spiked with 10\u0026sup1; to 10⁶ CFU ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e of each pathogen to investigate detection limits. Samples were enriched at 37\u0026deg;C for 6 hours before DNA extraction using universal pre-enrichment broth (SEL broth). Non-spiked samples served as negative controls.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eDNA extraction\u003c/h2\u003e\u003cp\u003eBriefly, DNA extraction from the camel milk samples and those contaminated with reference strains of the target bacteria was carried out using tissue genomic DNA extraction mini kit (cat. FATGK 00; Yekta-Tajhiz Azma, Iran) based on the manufacturer's instructions. The resulting supernatant with DNA content was used as template for M-PCR assay. Moreover, DNA quality was assessed using A\u003csub\u003e260\u003c/sub\u003e/A\u003csub\u003e280\u003c/sub\u003e ratios, ultraviolet spectrophotometer (Merinton SMA 1000; Beijing, China) and agarose gel electrophoresis. Extracted genomic DNAs (gDNA) from the highlighted strains were stored at -80\u0026deg;C until further use.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003ePrimers\u003c/h2\u003e\u003cp\u003eOligonucleotide primers were designed using Primer3 software (Whitehead Institute, Cambridge, Massachusetts, USA) to target \u003cem\u003esea\u003c/em\u003e gene of \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003estx\u003c/em\u003e-1 gene of EHEC, \u003cem\u003einv\u003c/em\u003eA gene of \u003cem\u003eS. enterica\u003c/em\u003e and ABC transporter permease gene of \u003cem\u003eL. monocytogenes\u003c/em\u003e. Primer specificity was assessed \u003cem\u003ein silico\u003c/em\u003e using Primer-BLAST of NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/tools/primer-blast/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/tools/primer-blast/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Nucleotide sequences of the primers used for target foodborne pathogens are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. All primers were synthesized by Sinaclon Biotech, Tehran, Iran.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used in the current study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBacteria\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eOligo sequence (5'-3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTm (\u003csup\u003eO\u003c/sup\u003eC)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAmplicon (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eseaF\u003c/em\u003e: CCTTTGGAAACGGTTAAAACG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e127\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eseaR\u003c/em\u003e: TCTGAACCTTCCCATCAAAAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e O157:H7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSTXF\u003c/em\u003e: TTGTTTGCAGTTGATGTCAGAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e490\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSTXR\u003c/em\u003e: CAGGCAGGACACTACTCAACCTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e67\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eSalmonella enterica\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSEF\u003c/em\u003e: GATCTGGGCGACAAGACCAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e105\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSER\u003c/em\u003e: ATTGGCGGTATTTCGGTGGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eListeria monocytogenes\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eLMF\u003c/em\u003e: CACCAGCATCTCCGCCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e151\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eLMR\u003c/em\u003e: CCTTTTCTTGGCGGCACATT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003ePolymerase chain reaction\u003c/h2\u003e\u003cdiv id=\"Sec19\" class=\"Section3\"\u003e\u003ch2\u003eOptimization of the annealing temperatures\u003c/h2\u003e\u003cp\u003eAnnealing temperatures for the primer sets were optimized using gradient PCR to ensure high specificity and clear amplification bands. Although designed primers demonstrated minimal variations in calculated melting temperatures, a temperature gradient of \u0026plusmn;\u0026thinsp;5\u0026deg;C from the theoretical annealing temperature was used for verification. The PCR products were visualized on agarose gels to investigate the optimal annealing temperature for each target gene using gel documentation system. Gradient PCR was carried out using gDNA extracted from pure bacterial colonies and camel milk samples artificially inoculated with the reference strains. Four annealing temperatures were assessed for each target microorganism (Tables\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eGradient annealing temperatures for polymerase chain reaction using genomic DNA from bacterial colonies\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBacteria\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e52\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e54\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e56\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e58\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e O\u003csub\u003e157\u003c/sub\u003e:H\u003csub\u003e7\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e57\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e61\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e63\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e65\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSalmonella enterica\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e55\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e57\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e59\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e61\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eListeria monocytogenes\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e55\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e57\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e62\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e64\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eGradient annealing temperatures for polymerase chain reaction using DNA extracted from artificially contaminated camel milk\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBacterial colony\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e52\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e54\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e56\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e58\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e O\u003csub\u003e157\u003c/sub\u003e:H\u003csub\u003e7\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e57\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e61\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e63\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e65\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSalmonella enterica\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e55\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e57\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e59\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e61\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eListeria monocytogenes\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e55\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e57\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e62\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e64\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003ePolymerase chain reaction protocols\u003c/h2\u003e\u003cp\u003eFor the bacterial colony DNA and DNA extracted from artificially contaminated milk samples, PCR reactions were prepared in 0.2-ml autoclaved sterile microtubes. Each reaction mixture was prepared as described in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and then transferred into a thermal cycler programmed using the cycling conditions (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePolymerase chain reaction components and final concentrations\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReagent\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVolume\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFinal conc.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMaster mix\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e12.5 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1\u0026times;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.4 \u0026micro;M\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.4 \u0026micro;M\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNuclease-free water\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e8.5 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTemplate DNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e50\u0026ndash;100 ng\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFinal volume\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e25 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1\u0026times;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThermal cycling programs used in polymerase chain reactions\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStep\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTime\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCycle\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePre-denaturation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDenaturation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAnnealing\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGrad.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eExtension\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e72\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFinal extension\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e72\u0026deg;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eSensitivity and specificity assessments of the polymerase chain reactions\u003c/h2\u003e\u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\u003ch2\u003eSensitivity assessment\u003c/h2\u003e\u003cp\u003eTo assess analytical sensitivity of the PCR using gene-specific primers, gDNA extracted from each target bacterial species (average concentration of 60 ng \u0026micro;l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was serially diluted with nuclease-free distilled water (DW) to achieve final concentrations of 30, 15, 7.5, 3.75, 1.87 and 0.9 ng \u0026micro;l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Each dilution was used in PCR under the optimized conditions described previously to investigate the lowest detectable DNA concentration for each target gene.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eSpecificity assessment\u003c/h2\u003e\u003cp\u003eThe analytical specificity of each primer pair was assessed using non-target bacterial strains as negative controls. For the detection of \u003cem\u003esea\u003c/em\u003e gene (\u003cem\u003eS. aureus\u003c/em\u003e), negative controls included \u003cem\u003eS. enterica\u003c/em\u003e, \u003cem\u003eL. monocytogenes\u003c/em\u003e and EHEC. For the detection of \u003cem\u003estx\u003c/em\u003e1 gene (EHEC), negative controls included \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003eL. monocytogenes\u003c/em\u003e and \u003cem\u003eS. enterica\u003c/em\u003e. For the detection of \u003cem\u003einv\u003c/em\u003eA gene (\u003cem\u003eS. enterica\u003c/em\u003e), negative controls included \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003eL. monocytogenes\u003c/em\u003e and EHEC. For the detection of ABC transporter permease gene (\u003cem\u003eL. monocytogenes\u003c/em\u003e), negative controls included \u003cem\u003eS. aureus\u003c/em\u003e, EHEC and \u003cem\u003eS. enterica\u003c/em\u003e. Amplification was expected in reactions containing DNA from the target species, verifying primer specificity.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eMultiplex polymerase chain reaction\u003c/h2\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003ePreparation of the reaction mixture\u003c/h2\u003e\u003cp\u003eThe M-PCR was used to simultaneously amplify \u003cem\u003eSEA\u003c/em\u003e, \u003cem\u003estx\u003c/em\u003e-1, \u003cem\u003einv\u003c/em\u003eA and ABC transporter permease genes in a single reaction. Each 25-\u0026micro;l reaction contained 12.5 \u0026micro;l of the commercial PCR master mix, 1 \u0026micro;l of forward primer (0.4 \u0026micro;M), 1 \u0026micro;l of reverse primer (0.4 \u0026micro;M), 8.5 \u0026micro;l of sterile DW and 2 \u0026micro;l of template DNA (50\u0026ndash;100 ng). Reactions were prepared in 0.2-ml sterile PCR microtubes.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eMultiplex polymerase chain reaction reagents\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReagent\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVolume\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFinal conc.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMaster mix\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e12.5 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1\u0026times;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eForward primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.4 \u0026micro;M\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.4 \u0026micro;M\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNuclease-free water\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e8.5 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTemplate DNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e50\u0026ndash;100 ng\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFinal volume\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e25 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1\u0026times;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\u003ch2\u003ePolymerase chain reaction amplification\u003c/h2\u003e\u003cp\u003eThermal cycling was carried out using the following conditions of pre-denaturation at 94\u0026deg;C for 5 min (one cycle) and then denaturation at 94\u0026deg;C for 30 s, annealing at 57\u0026deg;C for 30 s and extension at 72\u0026deg;C for 30 s (33 cycles), followed by final extension at 72\u0026deg;C for 10 min (one cycle).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThermal cycling conditions for multiplex polymerase chain reaction\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStep\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTemp.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTime\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCycle\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePre-denaturation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94 \u003csup\u003eo\u003c/sup\u003eC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDenaturation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94 \u003csup\u003eo\u003c/sup\u003eC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAnnealing\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e57 \u003csup\u003eo\u003c/sup\u003eC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eExtension\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e72 \u003csup\u003eo\u003c/sup\u003eC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30 s\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFinal extension\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e72 \u003csup\u003eo\u003c/sup\u003eC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10 min\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\u003ch2\u003eElectrophoretic analysis\u003c/h2\u003e\u003cp\u003eGenerally, PCR products were analyzed on 1.5% agarose gels prepared in 0.5\u0026times; TBE buffer. Gels were stained with DNA Safe Stain (6 \u0026micro;l per 30 ml of gel), loaded with 6 \u0026micro;l of each PCR product and electrophoresed at 70 V for 105 min. Gel images were captured to verify presence and size of amplified fragments.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003eAssessing specificity and sensitivity of the multiplex polymerase chain reaction\u003c/h2\u003e\u003cdiv id=\"Sec29\" class=\"Section3\"\u003e\u003ch2\u003eSpecificity assessment\u003c/h2\u003e\u003cp\u003eTo assess specificity of the designed primers for the target bacteria, M-PCR assay was carried out on artificially contaminated milk samples with standard bacterial strains as well as unspiked milk samples. For \u003cem\u003eS. aureus\u003c/em\u003e, DNA extracted from the bacteria was assessed using \u003cem\u003eS. enterica, L. monocytogenes\u003c/em\u003e and EHEC as negative controls. Absence of amplification bands in non-target bacteria verified specificity of the primers for the \u003cem\u003eSEA\u003c/em\u003e gene of \u003cem\u003eS. aureus\u003c/em\u003e. For EHEC, DNA was extracted from the bacteria assessed using \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003eS. enterica\u003c/em\u003e and \u003cem\u003eL. monocytogenes\u003c/em\u003e. Lack of amplification in non-target bacteria verified primer specificity for the \u003cem\u003estx\u003c/em\u003e-1 gene. For \u003cem\u003eS. enterica\u003c/em\u003e, DNA from the bacteria was assessed using \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003eL. monocytogenes\u003c/em\u003e and EHEC as negative controls. No amplification in non-target species verified specificity of the \u003cem\u003einv\u003c/em\u003eA gene primers for \u003cem\u003eS. enterica\u003c/em\u003e. For \u003cem\u003eL. monocytogenes\u003c/em\u003e, DNA extracted from the bacteria was assessed using \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003eS. enterica\u003c/em\u003e and EHEC as negative controls. Absence of cross-amplification verified primer specificity for the ABC transporter permease gene.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eSensitivity assessment\u003c/h3\u003e\n\u003cp\u003eTo investigate limit of detection (LOD) for the assay, serial dilutions of the extracted DNA were prepared using sterile DW, starting from an initial concentration of 60 ng \u0026micro;l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Two-fold serial dilutions resulted in final concentrations of 30, 15, 7.5, 3.75, 1.87 and 0.9 ng \u0026micro;l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Each dilution was used in M-PCR under the conditions described previously.\u003c/p\u003e\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\u003ch2\u003eComparison with culture method\u003c/h2\u003e\u003cp\u003eDiagnostic sensitivity and specificity of the M-PCR were calculated, compared to those of the culture method as the gold standard using the following formulas. Sensitivity\u0026thinsp;=\u0026thinsp;TP / TP\u0026thinsp;+\u0026thinsp;FN and specificity\u0026thinsp;=\u0026thinsp;TP / FP\u0026thinsp;+\u0026thinsp;TN.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec32\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eSimilarities between M-PCR and culture methods were assessed using Cohen\u0026rsquo;s kappa coefficient. Sensitivity, specificity and accuracy were calculated using MedCalc software. A \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered as statistically significant value.\u003c/p\u003e\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe developed M-PCR assay constitutes a rapid, highly sensitive, and specific diagnostic platform for the simultaneous detection of \u003cem\u003eS. aureus\u003c/em\u003e, EHEC, \u003cem\u003eS. enterica\u003c/em\u003e, and \u003cem\u003eL. monocytogenes\u003c/em\u003e in camel milk. The demonstrated congruence in performance with established culture methods, coupled with a substantially reduced time-to-result, positions this M-PCR assay as a compelling, high-throughput alternative for routine food safety surveillance. Ultimately, this study significantly advances the microbial safety assessment of camel milk, supporting the integrity of its expanding global market and reinforcing public health protection in producing regions such as Gonbad Kavoos, Iran.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eCompeting interests\u003c/h2\u003e\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis study was supported by a grant from Tehran University of Medical Sciences (grant no. IR.TUMS.SPH.REC.1403.098)\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eN.B. conceptualized the project, data analysis, and interpretation, and revise of the manuscript. M.A. conceptualized and supervised the project and contributed to data interpretation. R.M.Z.F. conceptualized and supervised the project and contributed to data interpretation. M.S. advised the project and contributed to data interpretation and the manuscript. D.A. advised the project and contributed to data interpretation and the manuscript. A.R.F. advised the project and contributed to data interpretation and the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eThe authors thank University of Tehran for providing reference strains and farmers of Gonbad Kavoos for their helps in sample collection.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArain, M. A. et al. Nutritional significance and promising therapeutic/medicinal application of camel milk as a functional food in human and animals: A comprehensive review. \u003cem\u003eAnimal Biotechnol.\u003c/em\u003e \u003cb\u003e34\u003c/b\u003e (6), 1988\u0026ndash;2005 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGizachew, A., Teha, J., Birhanu, T. \u0026amp; Nekemte, E. Review on medicinal and nutritional values of camel milk. \u003cem\u003eNat. Sci.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (12), 35\u0026ndash;41 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhan, M. Z. et al. Research development on anti-microbial and antioxidant properties of camel milk and its role as an anti-cancer and anti-hepatitis agent. \u003cem\u003eAntioxidants\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (5), 788 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMirmiran, P., Ejtahed, H-S., Angoorani, P., Eslami, F. \u0026amp; Azizi, F. Camel milk has beneficial effects on diabetes mellitus: A systematic review. \u003cem\u003eInt. J. Endocrinol. metabolism\u003c/em\u003e. \u003cb\u003e15\u003c/b\u003e (2), e42150 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbrhaley, A. \u0026amp; Leta, S. Medicinal value of camel milk and meat. \u003cem\u003eJ. Appl. Anim. Res.\u003c/em\u003e \u003cb\u003e46\u003c/b\u003e (1), 552\u0026ndash;558 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHussain, H. et al. Camel milk as an alternative treatment regimen for diabetes therapy. \u003cem\u003eFood Sci. Nutr.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (3), 1347\u0026ndash;1356 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBadawy, A. A. et al. Camel milk extracellular vesicles/exosomes: a fascinating frontier in isolation and therapeutic potential. \u003cem\u003eFood Funct.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e (2), 344\u0026ndash;365 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMudgil, P., Baba, W. N., Alneyadi, M., Redha, A. A. \u0026amp; Maqsood, S. Production, characterization, and bioactivity of novel camel milk-based infant formula in comparison to bovine and commercial sources. \u003cem\u003eLwt\u003c/em\u003e \u003cb\u003e154\u003c/b\u003e, 112813 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbduku, H. \u0026amp; Eshetu, M. Camel Milk Product Processing Characteristics and Bioactive Based Infant Formula: A Review. \u003cem\u003eInternational J. Food Sci. Agriculture\u003c/em\u003e ;\u003cb\u003e7\u003c/b\u003e(2). (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMullaicharam, A. A review on medicinal properties of camel milk. \u003cem\u003eWorld J. Pharm. Sciences\u003c/em\u003e :237\u0026ndash;242. (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePatel, D., Pinto, S. \u0026amp; Pal, M. A comprehensive review on the properties of camel milk and milk products. (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKonuspayeva, G. \u0026amp; Faye, B. Recent advances in camel milk processing. \u003cem\u003eAnimals\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (4), 1045 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYirda, A., Eshetu, M. \u0026amp; Babege, K. Current status of camel dairy processing and technologies: a review. \u003cem\u003eOpen. J. Anim. Sci.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (3), 362\u0026ndash;377 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingha, S., Thomas, R., Viswakarma, J. N. \u0026amp; Gupta, V. K. Foodborne illnesses of Escherichia coli O157origin and its control measures. \u003cem\u003eJ. Food Sci. Technol.\u003c/em\u003e \u003cb\u003e60\u003c/b\u003e (4), 1274\u0026ndash;1283 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBintsis, T. Foodborne pathogens. \u003cem\u003eAIMS Microbiol.\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e (3), 529 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePanwar, S. et al. Advanced diagnostic methods for identification of bacterial foodborne pathogens: Contemporary and upcoming challenges. \u003cem\u003eCrit. Rev. Biotechnol.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e (7), 982\u0026ndash;1000 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNassarawa, S. S., Luo, Z. \u0026amp; Lu, Y. Conventional and emerging techniques for detection of foodborne pathogens in horticulture crops: A leap to food safety. \u003cem\u003eFood Bioprocess Technol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (6), 1248\u0026ndash;1267 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao, J. et al. A multiplex PCR assay with a common primer for the detection of eleven foodborne pathogens. \u003cem\u003eJ. Food Sci.\u003c/em\u003e \u003cb\u003e85\u003c/b\u003e (3), 744\u0026ndash;754 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKalin, R., Karahan, M., A\u0026Ccedil;IK, M., Tasdemir, B. \u0026amp; Cetinkaya, B. Development of a multiplex PCR method for direct detection of common mastitis pathogens in bovine milk samples. \u003cem\u003eKafkas Universitesi Veteriner Fakultesi Dergisi\u003c/em\u003e ;\u003cb\u003e23\u003c/b\u003e(6). (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBalakrishna, K., Murali, H. \u0026amp; Batra, H. A novel multiplex polymerase chain reaction for simultaneous detection of Yersinia enterocolitica, Staphylococcus aureus, Aeromonas and Salmonella from chicken meat and milk samples. \u003cem\u003eJ. Food Saf.\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e (2), 263\u0026ndash;275 (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSarkar, D., Ranjan, R., Marwaha, S., Sahoo, A. \u0026amp; Naha, S. Multiplex PCR for detection of camel milk adulteration with cattle and goat milk. \u003cem\u003eInt. Dairy J.\u003c/em\u003e \u003cb\u003e154\u003c/b\u003e, 105922 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoukharouba, A., Gonz\u0026aacute;lez, A., Garc\u0026iacute;a-Ferr\u0026uacute;s, M., Ferr\u0026uacute;s, M. A. \u0026amp; Botella, S. Simultaneous detection of four main foodborne pathogens in ready-to-eat food by using a simple and rapid multiplex PCR (mPCR) assay. \u003cem\u003eInt. J. Environ. Res. Public Health\u003c/em\u003e. \u003cb\u003e19\u003c/b\u003e (3), 1031 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHodzic, E., Glavinic, A. \u0026amp; Wademan, C. A novel approach for simultaneous detection of the most common food-borne pathogens by multiplex qPCR. \u003cem\u003eBiomolecules Biomed.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (4), 640 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFreije, A. et al. Analysis of the nutritional composition of Bahraini breed camel (Camelus dromedarius) milk: fatty acid, mineral, phenolic, and antioxidant content. \u003cem\u003eArab. J. Basic. Appl. Sci.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e (1), 604\u0026ndash;613 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, J., Yang, L., Kjellerup, B. V. \u0026amp; Xu, Z. Viable but nonculturable (VBNC) state, an underestimated and controversial microbial survival strategy. \u003cem\u003eTrends Microbiol.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e (10), 1013\u0026ndash;1023 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKotzekidou, P. Survey of Listeria monocytogenes, Salmonella spp. and Escherichia coli O157: H7 in raw ingredients and ready-to-eat products by commercial real-time PCR kits. \u003cem\u003eFood Microbiol.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e (2), 86\u0026ndash;91 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhahfarokhi, E. Y., Shakerian, A., Chaleshtori, R. S. \u0026amp; Rahimi, E. Investigation of the Abundance of Escherichia coli and Staphylococcus aureus (Including Virulence Gene Profiles) and Heavy Metal Contamination in Camel Milk. \u003cem\u003eVeterinary Med. Sci.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (6), e70632 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKaur, S., Bran, L., Rudakov, G., Wang, J. \u0026amp; Verma, M. S. Propidium Monoazide is Unreliable for Quantitative Live\u0026ndash;Dead Molecular Assays. \u003cem\u003eAnal. Chem.\u003c/em\u003e \u003cb\u003e97\u003c/b\u003e (5), 2914\u0026ndash;2921 (2025).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Staphylococcus aureus, Enterohemorrhagic Escherichia coli, Salmonella enterica, Listeria monocytogenes, camel milk, Multiplex PCR","lastPublishedDoi":"10.21203/rs.3.rs-8063829/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8063829/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNational production of camel milk can lead to increased health and hygiene levels in communities due to its medicinal and therapeutic characteristics as well as high similarity to human milk. However, safety and microbiological quality of raw camel milk, particularly in regions where it is consumed without pasteurization that may lead to foodborne bacterial contamination, are majorly concerned. Regarding importance of the issue, it is also necessary to provide rapid and accurate diagnostic methods to minimize detection time. This study aimed to develop and validate a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous detection of four major foodborne pathogens of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, Enterohemorrhagic \u003cem\u003eEscherichia coli\u003c/em\u003e (EHEC), \u003cem\u003eSalmonella enterica\u003c/em\u003e and \u003cem\u003eListeria monocytogenes\u003c/em\u003e in camel milk samples collected from Gonbad-Kavoos region of northern Iran and to compare results of this method with those of culture-based methods.\u003c/p\u003e\u003cp\u003eTotally, 196 raw camel milk samples were collected from a traditional dairy shop in Gonbad Kavoos, Golestan, Iran, under sterile conditions and analyzed using traditional culture-based methods and the newly developed M-PCR. Species-specific MPCR targeting \u003cem\u003esea\u003c/em\u003e gene for \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003einv\u003c/em\u003eA for \u003cem\u003eSalmonella\u003c/em\u003e, \u003cem\u003estx\u003c/em\u003e-1 for EHEC and ABC transporter permease for \u003cem\u003eL. monocytogenes\u003c/em\u003e were performed.\u003c/p\u003e\u003cp\u003ePhenotypic and multiplex analyses revealed contamination rates for \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, EHEC, \u003cem\u003eSalmonella enterica\u003c/em\u003e and \u003cem\u003eListeria monocytogenes\u003c/em\u003e as 29.6 and 19.9%, 0 and 4.2%, 14.8 and 14.8%, and 1 and 2.6%, respectively. The M-PCR assay successfully detected all four pathogens simultaneously within a short time, demonstrating high analytical sensitivity and specificity. When benchmarked against culture, M-PCR achieved sensitivity of 97% and specificity of 100%.\u003c/p\u003e\u003cp\u003eThis novel M-PCR method can be used as a rapid, accurate and reliable tool for the simultaneous identification of several pathogenic bacteria in dairy products such as camel milk with a sensitivity and specificity of respectively 97 and 100%. Furthermore, this method is more accurate and efficient than the classical culture method, enhancing public health surveillance and food safety control measures in camel-breeding communities.\u003c/p\u003e","manuscriptTitle":"A rapid multiplex PCR assay for the simultaneous detection of four major foodborne pathogens in camel milk: Development, validation and comparison of the assay with those of culture-based methods","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-01 11:46:28","doi":"10.21203/rs.3.rs-8063829/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7482a933-4752-46fd-b0ab-215291e82e2c","owner":[],"postedDate":"December 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":58824894,"name":"Biological sciences/Biological techniques"},{"id":58824895,"name":"Biological sciences/Biotechnology"},{"id":58824896,"name":"Biological sciences/Microbiology"},{"id":58824897,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-03-24T18:53:54+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-01 11:46:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8063829","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8063829","identity":"rs-8063829","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-02T02:00:03.124865+00:00
License: CC-BY-4.0