β-Sitosterol Preconditioning Enhances the Resistance of BMSCs and Chondrocyte to Oxidative Stress and Promotes Cartilage Repair in Osteoarthritis

β-Sitosterol Preconditioning Enhances the Resistance of BMSCs and Chondrocyte to Oxidative Stress and Promotes Cartilage Repair in Osteoarthritis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article β-Sitosterol Preconditioning Enhances the Resistance of BMSCs and Chondrocyte to Oxidative Stress and Promotes Cartilage Repair in Osteoarthritis Chengyin Liu, Xiaoman Wang, Yanyan Zhang, Hongfan Ge, Qi Chang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6426541/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Aug, 2025 Read the published version in Stem Cell Research & Therapy → Version 1 posted 4 You are reading this latest preprint version Abstract I. Background: Osteoarthritis (OA) is a joint disorder that severely affects patients' mobility, overall health, and ability to perform daily activities. Despite advancements in therapeutic strategies, stem cell-based therapies for OA still face challenges, particularly in enhancing the antioxidative capacity of stem cells to improve therapeutic outcomes. Therefore, this study aimed to explore the potential of β-sitosterol in this context. II. Methods: This study evaluated the protective effects of β-sitosterol on bone marrow-derived mesenchymal stem cells (BMSCs) and chondrocytes under oxidative stress conditions and assessed its potential in promoting cartilage repair in a rabbit OA model. Cell viability, gene expression, oxidative stress markers, and mitochondrial function were examined. In vivo therapeutic effects were evaluated through histological and immunohistochemical analyses. III. Results: The results revealed that β-sitosterol significantly enhanced BMSC viability, upregulated the expression of Col2a1 and aggrecan, while inhibiting MMP13 expression. Furthermore, β-sitosterol effectively alleviated oxidative stress and preserved mitochondrial function in BMSCs. Notably, BMSCs pretreated with β-Sitosterol exhibited a higher potential for facilitating cartilage regeneration in the OA model, as evidence by histopathological analysis. IV. Conclusions: These findings suggest that β-sitosterol possesses significant antioxidative and chondroprotective properties, which enhance the therapeutic efficacy of BMSCs in addressing OA-related cartilage damage. β-sitosterol Osteoarthritis Oxidative stress BMSCs Cartilage repair Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Osteoarthritis ( OA ) is one of the most prevalent skeletal disorders and a leading cause of mobility impairment among the aging population. Despite extensive studies, with no effective cure for OA is currently available( 1 – 3 ). OA is characterized primarily by the progressive degradation of articular cartilage. Conventional therapeutic approaches, including hyaluronic acid injections, joint replacement, and non-steroidal anti-inflammatory drugs, are primarily palliative, offering symptomatic relief but failing to promote cartilage regeneration or halt disease progression. Moreover, these treatments are often associated with notable adverse effects, particularly with long-term use( 2 , 4 , 5 ). Thus, there is an urgent need to develop new regenerative strategies capable of addressing the underlying pathology of OA and facilitating cartilage repair, which holds considerable promise for improving clinical outcomes. Recently, BMSCs have emerged as a promising therapeutic approach for cartilage repair in OA, attributed to their pluripotent differentiation potential and immunoregulatory properties( 6 , 7 ). Significant progress has been achieved in preclinical studies using animal models, with some BMSC-based therapies already demonstrating promising results( 8 , 9 ). For instance, intra-articular injection of BMSCs has demonstrated efficacy in mitigating pathological symptoms of mild to moderate OA by alleviating cartilage degradation and subchondral bone damage( 10 , 11 ). Nonetheless, the oxidative stress microenvironment in OA lesions posed a major challenge, significantly impairing the survival, engraftment, and treatment efficacy of transplanted BMSCs. β-Sitosterol, a natural bioactive ingredient, has been broadly utilized in the medical and health food industries( 12 , 13 ). Previous studies have demonstrated that β-sitosterol significantly ameliorates tissue damage in cardiovascular and neurodegenerative diseases by inhibiting reactive oxygen species ( ROS ) production( 14 , 15 ). Furthermore, network pharmacology analysis has identified 13 shared targets between β-sitosterol and OA, including key proteins like Bcl2, CASP3, and CASP8, suggesting its potential value in OA management( 16 ). To date, the effects of β-sitosterol on OA treatment, particularly its role in modulating antioxidative stress in BMSCs and chondrocytes, remain largely unexplored. In this work, we investigated, for the first time, the potential of β-sitosterol pretreatment to enhance the antioxidative stress capacity of BMSCs and chondrocytes, as well as its therapeutic effects in a rabbit OA model. Our study focused on evaluating the effects of β-sitosterol on enhancing cell viability under oxidative stress and its ability to alleviate OA-related cartilage damage. The present study provides novel insights and a scientific basis for optimizing BMSC-based therapies, offering a promising strategy to enhance their clinical application in OA treatment. MATERIALS AND METHODS Chemicals, Reagents, and Antibodies. β-sitosterol (purity > 98%, HY-N0171A) was obtained from MedChemExpress (Monmouth Junction, NJ, USA). All antibodies were provided by Proteintech Group, Inc (Wuhan, China). Glutathione Peroxidase ( GSH-Px ) Assay Kit, Total Superoxide Dismutase ( SOD ) Activity Assay Kit, Catalase ( CAT ) Assay Kit, Reactive Oxygen Species Assay Kit, and JC-1 dye were obtained from Beyotime Biotechnology (Shanghai, China). Primary Culture of Rabbit BMSCs. New Zealand White rabbits (one month old) were humanely euthanized with an overdose of sodium pentobarbital (150 mg/kg) administered via intravenous injection, in accordance with institutional ethical guidelines. The epiphyses of the femur and tibia were removed to expose the marrow cavity, which was washed with DMEM/F12 medium containing 1% penicillin-streptomycin until the epiphyses turned white. The flushing solution was passed through a 70 µm sieve, spun and resuspended in the complete medium as shown in Scheme 1 . We seeded cells at 1×10⁵/mL in a 25 cm² flask, with the first medium change after 48 h. ( 17 ). Primary Culture of Rabbit Chondrocyte. New Zealand White rabbits (one month old) were euthanized with sodium pentobarbital, and articular cartilage was aseptically isolated from the knee joints. T The cartilage was finely chopped, washed and incubated with 0.1% hyaluronidase and 0.2% collagenase II (Biosharp Biotechnology Co., Ltd., Hefei, China) for 16–24 hours at 37°C. Following digestion, the suspension was spun down, and the collected pellet was redispersed in the same culture medium and conditions as those used for culturing BMSCs. ( 18 ). Cell Viability. BMSCs and chondrocytes were plated into 96-well plates and subjected to the designated treatments as shown in Scheme 1 . In short, cells were pretreated with β-sitosterol at concentrations of 0 and 50 µmol/L for 24 hours, followed by induction with H₂O₂ for another 24 hours. Cell Counting Kit-8 ( CCK-8 , Biosharp, Hefei, China) assay was used to assess cell viability and OD values were taken at 450 nm. Quantitative Real-Time Polymerase Chain Reaction (qPCR). Total RNA was collected by TRIzol reagent, then transcribed into cDNA with the HiScript II QRT SuperMix (Vazyme Biotech, Nanjing, China) using an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA). Primer sequences can be found in Table 1 . The mRNA primers were supplied by Shanghai Generay Biotech Co., Ltd. (Shanghai, China). We used 2 −ΔΔCt method to quantify the targeted mRNAs, with Glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) as the reference gene. Table 1 Primer sequences Gene Primer sequences (5′ − 3′) SOD3 Forward: ATGCTGGCGTTGGTGTGCTC Reverse: GGATCTGCTCCACCGTGTCTGA CAT Forward: ATCCAGCCAGCGACCAGATGA Reverse: GCCCTGCCGTGATGATGTTCAG GSH-Px Forward: GCTGCCCAGTCTGTGTACTCCT Reverse: CTCAGAGCGACGCCACATTCTC Col2a1 Forward: CCACCGTGCCCAAGAAGAACTG Reverse: GAAGCCGCCATTGATGGTCTCC Aggrecan Forward: GCACGCCTGAGACCATTGATGT Reverse: TCCACTTGGTGAGCCACTGACT MMP13 Forward: TCTGGTCTTCTGGCTCACGCTT Reverse: TGGGCAGCAACGAGAAACAAGT Bcl2 Forward: TGGGATGCCTTCGTGGAACTGT Reverse: CCGAGGGTGATGCAAGCTCCTA Caspase3 Forward: AGCCACGGTGATGAAGGAGTCA Reverse: TGTGCCTCGGCAAGCCTGAA Caspase9 Forward: GCTGCGTGGTTGTCATCCTGTC Reverse: GGGTATCCGTCCGTGCCATAGA GAPDH Forward: GAAGGTGGTGAAGCAGGCATCC Reverse: GGCACTGTTGAAGTCGCAGGAG Western Blotting. The total protein was separated on 10% SDSPAGE gel (Yazyme Bio Co., Ltd., Shanghai, China) and transferred to polyvinylidene difluoride ( PVDF ) membranes with a pore size of 0.45 µm. All antibodies were diluted at a ratio of 1:1,000. ImageLab software was used to observe and analyze the target strip. Flow Cytometry Mitochondrial membrane potential and intracellular ROS levels were measured using JC-1 dye and DCFH-DA, respectively. Following treatment, primary rabbit BMSCs and chondrocytes were stained with the corresponding dyes for 20 minutes at 37°C, rinsed, and analyzed using a BD FACSVerse flow cytometer (BD Biosciences, USA). ROS levels and JC-1 red-to-green fluorescence ratios were quantified using FlowJo software. Fluorescence Microscopy The cell treatment in fluorescence microscopy was consistent with the method described above for flow cytometry. We took the images with a Nikon Upright Microscope (Nikon Corporation, Tokyo, Japan). Oxidative Stress-related Enzyme Activity The activities of SOD, CAT, and GSH-Px were measured using enzyme activity assay kits from Beyotime Biotechnology (S0101S, S0051, S0056, Beyotime Biotechnology, Shanghai, China). We recorded absorbance at 520 nm, 520 nm and 340 nm, respectively. Animal Model The methods and the use of New Zealand White rabbits (12 weeks old, 2.5–3.0 kg, male) in this study were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University. (Permit No: 20230920142). The work has been reported in line with the ARRIVE guidelines 2.0. We assigned 30 rabbits to five groups in a random manner: Sham group (normal knee joint), OA group (untreated defect), the β-sitosterol treatment group, the BMSC treatment group, and the β-sitosterol-pretreated BMSC treatment group, with six rabbits in each group. The experimental unit was a single rabbit. In short, the rabbits were administered pentobarbital sodium (30 mg/kg) via intraperitoneal injection for anesthesia and maintained under 3% isoflurane. The surgical approach was established and the trochlea was exposed using a previously reported method as presented in Scheme 1 . ( 19 ). The β-sitosterol treatment group, BMSC injection treatment group, and β-sitosterol-pretreated BMSC injection treatment group were administered intra-articular injections of 0.2 mL β-sitosterol (50 µmol/L), BMSCs (5×10⁶ cells/mL), or β-sitosterol-pretreated BMSCs (5×10⁶ cells/mL), respectively, on postoperative days 1, 3, 5, and 7. The OA group received the same quantity of PBS. Six weeks after surgery, the rabbits were euthanized with an overdose of sodium pentobarbital (150 mg/kg) administered via intravenous injection, and the knee joints were subjected to gross observation and photographed. Cartilage tissue samples from the knee joints were collected, and the specimens were fixed in 4% paraformaldehyde. Histological and immunohistochemical analysis The samples were dehydrated, embedded in paraffin, sliced into sections, then subjected to haematoxylin and eosin ( H&E ) staining and safranin O ( S–O ) staining. During immunohistochemical processing, the slide sections were incubated overnight in a humidified chamber with primary antibodies, including anti-Col2a1 and anti-aggrecan, following the manufacturer's guidelines. Measurement of Osteometric Parameters, Bone Mineral Density and Bone Strength The femur and tibia were weighed after the removal of muscles. We measured the bones' length and vertical external diameter with a precision vernier caliper. Bone mineral content ( BMC ) and bone mineral density ( BMD ) were analyzed with a dual-energy X-ray absorptiometry (Medikors, Inc., Gyeonggi-do, Korea). The InAlyzer 1.0 image processing system was utilized to evaluate the BMC and BMD of the entire bone regions. Following this, a universal materials testing machine (LR10K PLUS, Lloyd Instruments Ltd., Hampshire, UK) was employed to perform three-point bending tests and assess the mechanical properties of the bones. Statistical Analysis Statistical analysis of the data was conducted using SPSS version 26.0 software. Data are presented as mean ± standard error of the mean ( SEM ). Statistical analyses were performed by one-way analysis of variance ( ANOVA ). Osteoarthritis Research Society International ( OARSI )scores were analyzed by the Kruskal–Wallis H test. RESULTS Protective Effects of β-Sitosterol on H₂O₂-Induced Damage in Primary Rabbit BMSCs and Chondrocytes We isolated primary BMSCs and chondrocytes from rabbits as to examine the effects of β-sitosterol on BMSCs and chondrocytes in vitro. Differentiation assays confirmed the osteogenic, adipogenic, and chondrogenic potential of BMSCs (Fig. 1 A). β-Sitosterol treatment at 50 µM significantly enhanced BMSC viability to 115.4%, marking it as the optimal experimental concentration (Fig. 1 C). H₂O₂ exposure significantly reduced BMSC viability (68.3%), while β-sitosterol pretreatment restored it to 98.5% (P < 0.05, Fig. 1 D). Similarly, in chondrocytes, β-sitosterol pretreatment improved viability from 43.1% (H₂O₂-treated) to 85.3% (P < 0.05, Fig. 2 D). At the molecular level, H₂O₂ significantly decreased Col2a1 and aggrecan expression while increasing MMP13, contributing to ECM degradation (P < 0.05, Fig. 1 E and 2 E). β-Sitosterol pretreatment effectively upregulated Col2a1 while reducing MMP13 expression. Additionally, H₂O₂ treatment disrupted apoptotic balance by decreasing Bcl2 and increasing Caspase 9, while β-sitosterol restored Bcl2 expression (P < 0.05, Fig. 1 E and 2 E). Protein expression analysis confirmed these protective effects, with β-sitosterol reversing H₂O₂-induced reductions in ECM-related proteins. Notably, β-sitosterol alone did not significantly alter mRNA or protein expression levels (P > 0.05), indicating its effects were specific to oxidative stress conditions. β-Sitosterol Inhibited H₂O₂-Induced Oxidative Stress in Primary Rabbit BMSCs and Chondrocytes To evaluate β-sitosterol's antioxidant properties, ROS production and mitochondrial function were analyzed. Flow cytometry results demonstrated that H₂O₂ stimulation significantly increased ROS levels (504.1%, P < 0.05, Fig. 3 A and C), while β-sitosterol pretreatment effectively reduced ROS accumulation to 206.9% in BMSCs (P < 0.05, Fig. 3 A and C). In primary chondrocytes, a similar trend was observed, with H₂O₂ significantly increasing ROS levels, which were restored following β-sitosterol pretreatment (P < 0.05, Fig. 4 A, C and G). Mitochondrial membrane potential (ΔΨm) was markedly disrupted by H₂O₂, decreasing it to 33.4% of the control level in BMSCs (P < 0.05, Fig. 3 B and D). β-Sitosterol pretreatment significantly restored mitochondrial membrane potential to 57.9% of the control group (P < 0.05, Fig. 3 B and D). Likewise, in chondrocytes, H₂O₂ exposure significantly impaired mitochondrial function, while β-sitosterol pretreatment partially restored ΔΨm, as demonstrated by fluorescence imaging and flow cytometry(P < 0.05, Fig. 4 B, D and F). The expression of SOD, CAT, and GSH-Px was significantly downregulated by H₂O₂ in both BMSCs and chondrocytes (P < 0.05, Fig. 3 E and 4 E). However, β-sitosterol pretreatment significantly upregulated SOD and GSH-Px expression compared to the H₂O₂ group (P < 0.05, Fig. 3 E and 4 E). Further enzymatic activity assays confirmed these findings, showing that β-sitosterol pretreatment partly restored H₂O₂-induced reductions in SOD and GSH-Px activities in both BMSCs and chondrocytes (P > 0.05, Fig. 3 F and H; Fig. 4 H and J) while significantly enhancing CAT activity in chondrocytes (P < 0.05, Fig. 4 I). Intra-articular Injection of β-sitosterol-pretreated BMSCs Ameliorated OA Progression in The Rabbit OA Model A surgical OA model was established in New Zealand white rabbits to evaluate the effects of intra-articular injections of β-sitosterol and β-sitosterol-pretreated BMSCs. Injections were given on postoperative days 1, 3, 5, and 7, and samples were harvested for analysis after 6 weeks. Surface examination of the joints showed better cartilage restoration in the medicated groups than in the OA model group, with the β-sitosterol-pretreated BMSCs injection group exhibiting the best results. The repaired cartilage was smooth and uniform, with defect areas filled by newly formed tissue, closely resembling the Sham group (Fig. 5 A). These findings were further supported by ICRS scores (Fig. 5 D). Analysis at the molecular level revealed significantly decreased mRNA expression of SOD, CAT, GSH-Px, Col2a1, and aggrecan in the cartilage of the OA group, with a corresponding significant increase in Casp3 expression (P < 0.05, Fig. 5 C). In the β-sitosterol-pretreated BMSCs injection group, those decreased mRNA in OA group along with Bcl2 were significantly increased, whereas MMP13, Casp3, and Casp9 expression levels were attenuated. (P > 0.05, Fig. 5 C). While the β-sitosterol-alone and BMSCs injection groups displayed some degree of improvement, their outcomes were slightly less favorable than those of the β-sitosterol-pretreated BMSCs group. Histological analysis (H&E, S-O) indicated that the cartilage in the Sham group was smooth and structurally intact, whereas the OA group showed rough cartilage surfaces and disorganized subchondral bone. Among the treatment groups, the β-sitosterol-pretreated BMSCs injection group had the best repair outcome, with clearly defined cartilage and subchondral bone boundaries. Immunohistochemistry results further supported the above findings, showing higher Col2a1 and aggrecan expression in the β-sitosterol-pretreated BMSCs injection group, with the morphology of the repaired tissue cells resembling normal cartilage (Fig. 5 B). Additionally, oxidative stress-related enzyme activity were significantly reduced in OA model (P < 0.05, Fig. 5 E, F, and G). All treatment groups partially restored antioxidant enzyme activities, with the β-sitosterol-pretreated BMSCs injection group achieving the best recovery. Effects of β-Sitosterol and Its Pretreated BMSCs on Bone Architecture and Mechanical Properties The diameters and weights of the femur and tibia showed no significant statistical differences across the Sham, OA, β-sitosterol, BMSCs, and β-sitosterol-pretreated BMSCs groups (P > 0.05, Fig. 6 B and C), suggesting consistent skeletal architecture among the experimental rabbits. Femoral and tibial lengths were slightly longer in the β-sitosterol group contrasted with the Sham as well as OA groups, yet the overall changes were marginal. (P 0.05, Fig. 6 K and L). The tibia displayed a significantly higher difference in bone strength compared to the femur. The β-sitosterol treatment group exhibited significantly greater tibial maximum load and bending stress than the OA group (P < 0.05, Fig. 6 D and E). Tibial stiffness, Young's modulus, and bending rigidity were significantly reduced in the OA group (P < 0.05, Fig. 6 F, G, and H). All treatment groups showed varying degrees of improvement, with the β-sitosterol group nearly restoring these measures to Sham group levels. Additionally, the trends for maximum bending strain and the work from preload to maximum load in both the femur and tibia were similar, with the values in the femoral BMSCs injection group notably higher than those injected PBS (P < 0.05, Fig. 6 I and J). DISCUSSION Osteoarthritis is a highly prevalent disorder that significantly impairs patients’ quality of life( 20 ). Both BMSCs and chondrocytes play crucial roles in the pathogenesis and treatment of OA, with the therapeutic potential of exogenous BMSCs being well-documented in numerous studies( 21 – 23 ). Oxidative stress microenvironment at OA lesion sites significantly compromises the survival and reparative functions of BMSCs, acting as a critical limitation to their treatment efficacy( 24 ). Antioxidant interventions aimed at reducing oxidative stress may enhance the therapeutic performance of BMSCs. As a major oxidative stress metabolite, H₂O₂ is frequently used in vitro to simulate oxidative stress-induced cellular damage and evaluate potential protective treatments( 25 ). H₂O₂ accelerates OA progression by suppressing ECM synthesis in chondrocytes and inducing apoptotic cell death( 26 ). As a natural active compound, β-sitosterol exhibits a range of biological activities, such as anti-inflammatory, antioxidant, and immunomodulatory effects( 27 ). Earlier bioinformatics analyses have identified 13 shared targets between β-sitosterol and OA( 16 ). Moreover, β-sitosterol has been shown to improve hepatotoxicity and diabetes in mouse models by boosting the mitochondrial glutathione redox system and lowering ROS levels ( 28 , 29 ). To this day, no studies have specifically investigated the effects of β-sitosterol on OA or its functional role in modulating oxidative stress in BMSCs and chondrocytes. By evaluating the antioxidative effects of β-sitosterol pretreatment on BMSCs and chondrocytes and validating its cartilage repair potential in a rabbit OA model, this study provides foundational experimental evidence for the development of novel treatment for OA. Through in vitro studies, this study demonstrated the antioxidative and protective effects of β-sitosterol against H₂O₂-induced damage in BMSCs and chondrocytes. A significant reduction in cell viability was observed in both BMSC and chondrocyte following H₂O₂ treatment, consistent with the prior findings reported by Mathy-Hartert et al( 30 ). The findings further showed that H₂O₂-induced oxidative stress markedly downregulated the expressions of Col2a1, aggrecan and Bcl2 while upregulated the expression of MMP13 in both cell types. β-sitosterol pretreatment significantly enhanced cell viability, the mRNA expression of Col2a1 and aggrecan, and effectively suppressed the upregulation of MMP13. These findings confirm that β-sitosterol preserves ECM integrity by inhibiting the overexpression of matrix-degrading enzyme ( 31 ). This study also explored the effects of β-sitosterol pretreatment on oxidative stress induced by H₂O₂ in BMSCs and chondrocytes, with a particular focus on ROS generation, mitochondrial membrane potential, and the expression and activity of key antioxidant enzymes. In both BMSCs and chondrocytes, β-sitosterol pretreatment significantly lowered intracellular ROS levels. Additionally, the restoration of mitochondrial membrane potential in BMSCs was evident and further verified by flow cytometry analysis of ROS and JC-1 staining, as well as immunofluorescence imaging in chondrocytes. MMP recovery signifies the preservation of mitochondrial function. Further analysis revealed that β-sitosterol pretreatment markedly upregulated the mRNA expression of SOD and GSH-Px, while also significantly enhanced GSH-Px activity. A significant improvement in CAT activity was observed in chondrocytes ( 32 , 33 ). Collectively, these results demonstrate that β-sitosterol mitigates oxidative damage by augmenting the antioxidant enzyme system. This study evaluated the therapeutic potential of β-sitosterol and β-sitosterol-preconditioned BMSCs administered via intra-articular injection in a rabbit OA model. The OA group exhibited a rough cartilage surface and incomplete regeneration of cartilage tissue in the defect area. Histological analysis revealed disorganization of the subchondral bone and an unclear interface between the cartilage and subchondral bone, consistent with Zhou et al.'s findings( 25 ). Compared to the β-sitosterol or BMSCs group, the β-sitosterol-pretreated BMSCs group exhibited markedly improved cartilage repair, recovery of antioxidant enzyme activity, and improved gene regulation. These outcomes are likely attributable to the synergistic antioxidative and anti-apoptotic mechanisms of β-sitosterol-preconditioned BMSCs. Prior findings suggest that BMSCs function in both repair processes and inflammation control, and β-sitosterol may enhance these functions through its antioxidative and anti-inflammatory properties( 34 ). Specifically, the β-sitosterol-pretreated BMSCs group exhibited the best cartilage repair outcomes, as evidenced by both macroscopic observations and histological staining. ICRS evaluation confirmed these results, highlighting a substantial improvement in tissue repair performance. Regan et al. found the significant downregulation of antioxidant enzymes in OA joints at the molecular level( 35 ). Sharmila and Yin et al. reported that β-sitosterol mitigates oxidative stress by activating NRF2, boosting phase II enzymes (HO-1, NQO1, GST), and upregulating SOD, CAT, and GSH-Px( 33 , 36 ). In the present study, we observed that β-sitosterol alleviates CAT and GSH-Px downregulation in OA model. Among the treatment groups, the β-sitosterol-pretreated BMSCs group exhibited the strongest recovery of antioxidant enzyme activity, emphasizing its potent antioxidative properties. Furthermore, immunohistochemistry revealed enhanced expression of Col2a1 and aggrecan, providing additional evidence of the therapeutic benefits of β-sitosterol-pretreated BMSCs in promoting cartilage repair. Further analysis of the femur and tibia in the rabbit OA model showed no significant differences in basic skeletal parameters (diameter, weight, BMC, BMD) across groups, ensuring uniformity. Interestingly, the β-sitosterol group exhibited the most substantial improvement in tibial mechanical properties, including maximum load, stiffness, and Young’s modulus, surpassing the stem cell injection group and approaching levels comparable to the Sham group. It has shown that β-sitosterol increases the expression of osteoclast differentiation factor and osteoprotegerin in osteoblasts, while simultaneously inhibiting osteoclastic activity, thereby contributing to the regulation of skeletal metabolic balance( 37 , 38 ). Our data indicate a potential role for β-sitosterol in enhancing bone strength and quality in the treatment of bone-related disorders. CONCLUSION In summary, this study assessed the therapeutic potential of β-sitosterol in the treatment of OA model. The findings support the potential of β-sitosterol as a novel antioxidant for OA management and suggest a new direction for combined therapies with BMSCs. However, several limitations remain, including the untested long-term safety profile of β-sitosterol and the need to further elucidate its underlying regulatory mechanisms crucial for optimizing its efficacy. Declarations Availability of data and materials All data generated or analyzed during this study are included in this published article and its supplementary information files. Additional raw data are available from the corresponding author upon reasonable request. Full-length Western blot images and the completed ARRIVE checklist have been provided as supplementary materials. Ethical Approval and Consent to participate All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University. (Permit No: 20230920142). The approved project was titled “Protective effects of β-sitosterol on stem cells and cartilage repair in a rabbit model of osteoarthritis”. The approval date was September 20, 2023. Consent for publication Not applicable. Availability of supporting data All data generated or analyzed during this study are included in this published article and its supplementary information files. Additional raw data are available from the corresponding author upon reasonable request. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the National Natural Science Foundation of China (grant number 32273080) and the Key Project of the 2023 Luoyang City Public Welfare Industry Research Program (grant number 2302005A). Authors' contributions Chengyin Liu, Zhenlei Zhou and Qi Chang designed the study. Chengyin Liu, Xiaoman Wang, Yanyan Zhang and Hongfan Ge performed the experiments. Chengyin Liu analyzed the data. Chengyin Liu and Zhenlei Zhou wrote the manuscript. All authors read and approved the final manuscript. ACKNOWLEDGMENTS The authors would like to express their sincere gratitude to the College of Veterinary Medicine, Nanjing Agricultural University, and the Department of Orthopaedics, The 989 Hospital of the People's Liberation Army Joint Service Support Force, for their valuable support and assistance throughout this study. The authors declare that they have not used AI-generated work in this manuscript. References Perruccio AV, Young JJ, Wilfong JM, Denise Power J, Canizares M, Badley EM. Osteoarthritis year in review 2023: Epidemiology & therapy. Osteoarthritis Cartilage. 2024;32(2):159-65. Liu Y, Zhang Z, Li T, Xu H, Zhang H. Senescence in osteoarthritis: from mechanism to potential treatment. Arthritis Res Ther. 2022;24(1):174. Scheuing WJ, Reginato AM, Deeb M, Acer Kasman S. The burden of osteoarthritis: Is it a rising problem? Best Pract Res Clin Rheumatol. 2023;37(2):101836. Yao Q, Wu X, Tao C, Gong W, Chen M, Qu M, et al. Osteoarthritis: pathogenic signaling pathways and therapeutic targets. Signal Transduct Target Ther. 2023;8(1):56. Tsokanos A, Livieratou E, Billis E, Tsekoura M, Tatsios P, Tsepis E, et al. The Efficacy of Manual Therapy in Patients with Knee Osteoarthritis: A Systematic Review. Medicina (Kaunas). 2021;57(7). Jang S, Lee K, Ju JH. Recent Updates of Diagnosis, Pathophysiology, and Treatment on Osteoarthritis of the Knee. Int J Mol Sci. 2021;22(5). Maumus M, Guerit D, Toupet K, Jorgensen C, Noel D. Mesenchymal stem cell-based therapies in regenerative medicine: applications in rheumatology. Stem Cell Res Ther. 2011;2(2):14. Zhou Y, He X, Zhang W, Zhang W, Zhao H, Zhou X, et al. Cell-recruited microspheres for OA treatment by dual-modulating inflammatory and chondrocyte metabolism. Mater Today Bio. 2024;27:101127. He L, He T, Xing J, Zhou Q, Fan L, Liu C, et al. Bone marrow mesenchymal stem cell-derived exosomes protect cartilage damage and relieve knee osteoarthritis pain in a rat model of osteoarthritis. Stem Cell Res Ther. 2020;11(1):276. Murphy JM, Fink DJ, Hunziker EB, Barry FP. Stem cell therapy in a caprine model of osteoarthritis. Arthritis Rheum. 2003;48(12):3464-74. Centeno CJ, Busse D, Kisiday J, Keohan C, Freeman M, Karli D. Increased knee cartilage volume in degenerative joint disease using percutaneously implanted, autologous mesenchymal stem cells. Pain Physician. 2008;11(3):343-53. Babu S, Jayaraman S. An update on beta-sitosterol: A potential herbal nutraceutical for diabetic management. Biomed Pharmacother. 2020;131:110702. Macoska JA. The use of beta-sitosterol for the treatment of prostate cancer and benign prostatic hyperplasia. Am J Clin Exp Urol. 2023;11(6):467-80. Khan Z, Nath N, Rauf A, Emran TB, Mitra S, Islam F, et al. Multifunctional roles and pharmacological potential of beta-sitosterol: Emerging evidence toward clinical applications. Chem Biol Interact. 2022;365:110117. Gupta R, Sharma AK, Dobhal MP, Sharma MC, Gupta RS. Antidiabetic and antioxidant potential of beta-sitosterol in streptozotocin-induced experimental hyperglycemia. J Diabetes. 2011;3(1):29-37. Liu C, Yu L, Jiang Y, Gu S, Li C, Yin W, et al. The Possibility of Polygonum cuspidatum against Osteoarthritis based on Network Pharmacology. Curr Comput Aided Drug Des. 2024;20(2):121-33. Zhang W, Zhang F, Shi H, Tan R, Han S, Ye G, et al. Comparisons of rabbit bone marrow mesenchymal stem cell isolation and culture methods in vitro. PLoS One. 2014;9(2):e88794. Yu Y, Jiang Y, Ge H, Fan X, Gao H, Zhou Z. HIF-1alpha in cartilage homeostasis, apoptosis, and glycolysis in mice with steroid-induced osteonecrosis of the femoral head. J Cell Physiol. 2024;239(5):e31224. Chen Z, Zhang Q, Li H, Wei Q, Zhao X, Chen F. Elastin-like polypeptide modified silk fibroin porous scaffold promotes osteochondral repair. Bioact Mater. 2021;6(3):589-601. Hawker GA. Osteoarthritis is a serious disease. Clin Exp Rheumatol. 2019;37 Suppl 120(5):3-6. Rim YA, Nam Y, Ju JH. The Role of Chondrocyte Hypertrophy and Senescence in Osteoarthritis Initiation and Progression. Int J Mol Sci. 2020;21(7). Zhang M, Yang H, Lu L, Wan X, Zhang J, Zhang H, et al. Matrix replenishing by BMSCs is beneficial for osteoarthritic temporomandibular joint cartilage. Osteoarthritis Cartilage. 2017;25(9):1551-62. Liu Y, Peng L, Li L, Huang C, Shi K, Meng X, et al. 3D-bioprinted BMSC-laden biomimetic multiphasic scaffolds for efficient repair of osteochondral defects in an osteoarthritic rat model. Biomaterials. 2021;279:121216. Ansari MY, Ahmad N, Haqqi TM. Oxidative stress and inflammation in osteoarthritis pathogenesis: Role of polyphenols. Biomed Pharmacother. 2020;129:110452. Zhou Z, Zhang L, Liu Y, Huang C, Xia W, Zhou H, et al. Luteolin Protects Chondrocytes from H(2)O(2)-Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling. Oxid Med Cell Longev. 2022;2022:5635797. Lee DY, Park YJ, Song MG, Kim DR, Zada S, Kim DH. Cytoprotective Effects of Delphinidin for Human Chondrocytes against Oxidative Stress through Activation of Autophagy. Antioxidants (Basel). 2020;9(1). Wang H, Wang Z, Zhang Z, Liu J, Hong L. beta-Sitosterol as a Promising Anticancer Agent for Chemoprevention and Chemotherapy: Mechanisms of Action and Future Prospects. Adv Nutr. 2023;14(5):1085-110. Wong HS, Chen JH, Leong PK, Leung HY, Chan WM, Ko KM. beta-sitosterol protects against carbon tetrachloride hepatotoxicity but not gentamicin nephrotoxicity in rats via the induction of mitochondrial glutathione redox cycling. Molecules. 2014;19(11):17649-62. Rahimifard M, Manayi A, Baeeri M, Gholami M, Saeidnia S, Abdollahi M. Investigation of beta-Sitosterol and Prangol Extracted from Achillea Tenoifolia Along with Whole Root Extract on Isolated Rat Pancreatic Islets. Iran J Pharm Res. 2018;17(1):317-25. Mathy-Hartert M, Deby-Dupont GP, Reginster JY, Ayache N, Pujol JP, Henrotin YE. Regulation by reactive oxygen species of interleukin-1beta, nitric oxide and prostaglandin E(2) production by human chondrocytes. Osteoarthritis Cartilage. 2002;10(7):547-55. Hui W, Young DA, Rowan AD, Xu X, Cawston TE, Proctor CJ. Oxidative changes and signalling pathways are pivotal in initiating age-related changes in articular cartilage. Ann Rheum Dis. 2016;75(2):449-58. Vivancos M, Moreno JJ. beta-Sitosterol modulates antioxidant enzyme response in RAW 264.7 macrophages. Free Radic Biol Med. 2005;39(1):91-7. Yin Y, Liu X, Liu J, Cai E, Zhu H, Li H, et al. Beta-sitosterol and its derivatives repress lipopolysaccharide/d-galactosamine-induced acute hepatic injury by inhibiting the oxidation and inflammation in mice. Bioorg Med Chem Lett. 2018;28(9):1525-33. Ding N, Li E, Ouyang X, Guo J, Wei B. The Therapeutic Potential of Bone Marrow Mesenchymal Stem Cells for Articular Cartilage Regeneration in Osteoarthritis. Curr Stem Cell Res Ther. 2021;16(7):840-7. Regan E, Flannelly J, Bowler R, Tran K, Nicks M, Carbone BD, et al. Extracellular superoxide dismutase and oxidant damage in osteoarthritis. Arthritis Rheum. 2005;52(11):3479-91. Sharmila R, Sindhu G. Modulation of Angiogenesis, Proliferative Response and Apoptosis by beta-Sitosterol in Rat Model of Renal Carcinogenesis. Indian J Clin Biochem. 2017;32(2):142-52. Malini T, Vanithakumari G. Comparative study of the effects of beta-sitosterol, estradiol and progesterone on selected biochemical parameters of the uterus of ovariectomised rats. J Ethnopharmacol. 1992;36(1):51-5. Wang T, Li S, Yi C, Wang X, Han X. Protective Role of beta-Sitosterol in Glucocorticoid-Induced Osteoporosis in Rats Via the RANKL/OPG Pathway. Altern Ther Health Med. 2022;28(7):18-25. Scheme 1 Scheme 1 is available in the Supplementary Files section. Supplementary Files Scheme1.jpeg Scheme 1 Experimental framework for investigating β-sitosterol’s effects on oxidative stress and OA progression ARRIVEchecklist.pdf renamedcd30c.docx Cite Share Download PDF Status: Published Journal Publication published 26 Aug, 2025 Read the published version in Stem Cell Research & Therapy → Version 1 posted Reviewers agreed at journal 19 May, 2025 Reviewers invited by journal 13 May, 2025 Editor assigned by journal 16 Apr, 2025 First submitted to journal 16 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6426541","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":456211978,"identity":"246d1270-5689-45ca-9d5e-900a0a8e8d52","order_by":0,"name":"Chengyin Liu","email":"","orcid":"","institution":"Nanjing Agricultural University College of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chengyin","middleName":"","lastName":"Liu","suffix":""},{"id":456211979,"identity":"9857e6d4-1636-42f8-af6e-8b61a793311d","order_by":1,"name":"Xiaoman Wang","email":"","orcid":"","institution":"Nanjing Agricultural University College of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiaoman","middleName":"","lastName":"Wang","suffix":""},{"id":456211980,"identity":"c6e8139b-600e-431b-8528-52eee5cad25a","order_by":2,"name":"Yanyan Zhang","email":"","orcid":"","institution":"Nanjing Agricultural University College of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yanyan","middleName":"","lastName":"Zhang","suffix":""},{"id":456211981,"identity":"30b10a10-7b6d-4ad0-9b10-a168298132ce","order_by":3,"name":"Hongfan Ge","email":"","orcid":"","institution":"Nanjing Agricultural University College of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hongfan","middleName":"","lastName":"Ge","suffix":""},{"id":456211982,"identity":"24664df5-9a6d-45f8-99d4-ef2532369bc2","order_by":4,"name":"Qi Chang","email":"","orcid":"","institution":"989th Hospital of PLA","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Chang","suffix":""},{"id":456211983,"identity":"001234de-0263-4f73-886f-ec564dc12c50","order_by":5,"name":"Zhenlei Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYDACCRBRYMPA2ABisBGtxSCNdC2HoTxitMjPbj4m+cPgfB5z+xkDhg9lhxn4Zzfg18I451iahITB7WLGnhwDxhnnDjNI3DmAXwuzRI6ZhIHB7cTGhhwDZt62wwwGEgn4tbCBtCQYnEts7H9jwPyXGC08IC0HDA4kNs4A2sJIjBYJibRkywaDZKCWZwUHe86l80jcIKBFfkbywZs/KuwSN/Ynb3zwo8xajn8GAS1wYNjAwHAA5FIi1YOsI17pKBgFo2AUjDQAAPcnPxoH1mOQAAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing Agricultural University College of Veterinary Medicine","correspondingAuthor":true,"prefix":"","firstName":"Zhenlei","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2025-04-11 08:42:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6426541/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6426541/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13287-025-04613-x","type":"published","date":"2025-08-26T15:57:48+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82899043,"identity":"e40ef343-49b5-4c13-ada2-249f962658ad","added_by":"auto","created_at":"2025-05-16 13:14:07","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1040685,"visible":true,"origin":"","legend":"\u003cp\u003eβ-Sitosterol inhibited H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced damage in primary rabbit BMSCs and ameliorated ECM degradation. (A)Representative staining images showing the differentiation of BMSCs at 7, 14, and 21 days. Alizarin Red staining for mineralization, Toluidine Blue staining for proteoglycans, and Oil Red O staining for lipid droplets are displayed. Scale bar, 100 μm. Cell viability of BMSCs treated with varying concentrations of (B) H₂O₂ (C) β-sitosterol for 24 hours. (D) Cell viability of BMSCs treated with β-sitosterol (50 μM) for 24 hours, followed by H₂O₂ (700 μM) treatment for an additional 24 hours. n = 5 per group. The mRNA(E) and protein (F, G, H) expressions of the indicated proteins in total cell lysates are presented. Gene and protein expression levels were normalized to GAPDH and presented as relative expression. Full-length blots are presented in Supplementary Figure 1. n = 3 per group. The data were presented as the mean ± SEM. Statistical significance was indicated as *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 vs. Control; #P \u0026lt; 0.05, ##P \u0026lt; 0.01, ###P \u0026lt; 0.001 vs. H₂O₂ group.\u003c/p\u003e","description":"","filename":"figure1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/7855f04878190968518b24dd.jpg"},{"id":82899044,"identity":"cf82ace0-b194-4c5f-b647-4769585f1a4d","added_by":"auto","created_at":"2025-05-16 13:14:07","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":884350,"visible":true,"origin":"","legend":"\u003cp\u003eβ-Sitosterol inhibited H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced damage in primary rabbit chondrocytes and ameliorated ECM degradation. (A)Alcian blue and Toluidine bule staining of chondrocytes. Scale bar: 100 µm. Cell viability of chondrocytes treated with varying concentrations of (B) H₂O₂ (C) β-sitosterol for 24 hours. (D) Cell viability of chondrocytes treated with β-sitosterol (50 μM) for 24 hours, followed by H₂O₂ (800 μM) treatment for an additional 24 hours. n = 5 per group. The mRNA(E) and protein (F, G, H) expressions of the indicated proteins in total cell lysates are presented. Gene and protein expression levels were normalized to GAPDH and presented as relative expression. Full-length blots are presented in Supplementary Figure 1. n = 3 per group. The data were presented as the mean ± SEM. Statistical significance was indicated as *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 vs. Control; ###P \u0026lt; 0.001 vs. H₂O₂ group.\u003c/p\u003e","description":"","filename":"figure2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/634f0877e83ede40999462ba.jpg"},{"id":82899894,"identity":"81b033a4-9bb1-4c14-879b-76e074d553ec","added_by":"auto","created_at":"2025-05-16 13:22:07","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":607954,"visible":true,"origin":"","legend":"\u003cp\u003eβ-Sitosterol inhibited H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced oxidative stress in primary rabbit BMSCs. n = 3 per group. Flow cytometry analysis of ROS levels (A, C) and mitochondrial membrane potential (ΔΨm) changes (B, D) in BMSCs under different treatments. (E) mRNA expression levels of antioxidant enzymes analyzed by qPCR and normalized to GAPDH. Enzymatic activities of SOD (F), CAT (G), and GSH-Px (H) in BMSCs under the indicated treatments. Data were presented as mean ± SEM. Statistical significance: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 vs. Control; #P \u0026lt; 0.05, ##P \u0026lt; 0.01, ###P \u0026lt; 0.001 vs. H₂O₂ group.\u003c/p\u003e","description":"","filename":"figure3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/3d602b9b373c755d2a8d052b.jpg"},{"id":82901345,"identity":"4b9c6574-920c-43a6-94c0-735445b47cb5","added_by":"auto","created_at":"2025-05-16 13:30:07","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":889176,"visible":true,"origin":"","legend":"\u003cp\u003eβ-Sitosterol inhibited H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced oxidative stress in primary rabbit chondrocytes. n = 3 per group. Flow cytometry analysis of ROS levels (A, C) and mitochondrial membrane potential (ΔΨm) changes (B, D) in chondrocytes under different treatments. (E) mRNA expression levels of antioxidant enzymes analyzed by qPCR and normalized to GAPDH. Results of JC-1 (F) and ROS (G) immunofluorescence staining. Scale bar, 100 μm. Enzymatic activities of SOD (H), CAT (I), and GSH-Px (J) in chondrocytes under the indicated treatments. Data were presented as mean ± SEM. Statistical significance: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 vs. Control; #P \u0026lt; 0.05, ##P \u0026lt; 0.01, ###P \u0026lt; 0.001 vs. H₂O₂ group.\u003c/p\u003e","description":"","filename":"figure4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/1cc3919bab47de3ecbbfa5a3.jpg"},{"id":82899896,"identity":"9a2c2606-b120-4a8a-9799-c8ab929aec4d","added_by":"auto","created_at":"2025-05-16 13:22:07","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1478247,"visible":true,"origin":"","legend":"\u003cp\u003eIntra-articular injection of β-sitosterol-pretreated BMSCs ameliorated OA progression in the rabbit OA model. n = 6 per group. Gross evaluations (A) and ICRS macroscopic scores (D) of repaired cartilages at 6 weeks. (B) Representative images of articular cartilage stained with H\u0026amp;E, S–O and immunohistochemistry for Col2a1 and aggrecan expression. Scale bar: 500 μm. (C) Relevant mRNA expression levels analyzed by qPCR and normalized to GAPDH. Enzymatic activities of SOD (E), CAT (F), and GSH-Px (G) in cartilage tissue. Data were presented as mean ± SEM. Statistical significance: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 vs. Control; #P \u0026lt; 0.05, ##P \u0026lt; 0.01, ###P \u0026lt; 0.001 vs. H₂O₂ group.\u003c/p\u003e","description":"","filename":"figure5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/64d6b8e7796771d87d8d2a96.jpg"},{"id":82899052,"identity":"0123fed4-7651-4ed7-9c12-797ed40a215a","added_by":"auto","created_at":"2025-05-16 13:14:07","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":558167,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of β-Sitosterol and its pretreated BMSCs on bone architecture and mechanical properties. n = 6 per group. Length (A), diameter (B), and weight (C) of the femur and tibia. Mechanical properties of the femur and tibia, including maximum load (D), maximum bending stress (E), and stiffness (F). Elastic modulus (G), flexural rigidity (H), maximum flexural strain (I), work to maximum load (J), BMC (K), and BMD (L) of the femur and tibia. Data were presented as mean ± SEM. Statistical significance: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 vs. Sham; #P \u0026lt; 0.05, ##P \u0026lt; 0.01, ###P \u0026lt; 0.001 vs. OA group.\u003c/p\u003e","description":"","filename":"figure6.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/ba7c7d868bdb8d6ba9d4ff9a.jpg"},{"id":90344891,"identity":"af727983-d240-4485-a104-41887ab78503","added_by":"auto","created_at":"2025-09-01 16:07:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6437547,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/83c68b34-9d5c-464b-a941-10e6525aebc6.pdf"},{"id":82899046,"identity":"7ef52f2a-a9d3-448c-93c8-a3427b625920","added_by":"auto","created_at":"2025-05-16 13:14:07","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3006227,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScheme 1 \u003c/strong\u003eExperimental framework for investigating β-sitosterol’s effects on oxidative stress and OA progression\u003c/p\u003e","description":"","filename":"Scheme1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/cd57438e99d014a0a97e7c61.jpeg"},{"id":82899045,"identity":"ee2147ca-c393-4583-9e48-b1033f7f9c09","added_by":"auto","created_at":"2025-05-16 13:14:07","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":171264,"visible":true,"origin":"","legend":"","description":"","filename":"ARRIVEchecklist.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/f9e9621af4413bc03c540017.pdf"},{"id":82899053,"identity":"c09082c7-49b1-48ef-9962-65a80a8f1e82","added_by":"auto","created_at":"2025-05-16 13:14:07","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":13695143,"visible":true,"origin":"","legend":"","description":"","filename":"renamedcd30c.docx","url":"https://assets-eu.researchsquare.com/files/rs-6426541/v1/9792eab5cf21d0793c868842.docx"}],"financialInterests":"","formattedTitle":"β-Sitosterol Preconditioning Enhances the Resistance of BMSCs and Chondrocyte to Oxidative Stress and Promotes Cartilage Repair in Osteoarthritis","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eOsteoarthritis (\u003cb\u003eOA\u003c/b\u003e) is one of the most prevalent skeletal disorders and a leading cause of mobility impairment among the aging population. Despite extensive studies, with no effective cure for OA is currently available(\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). OA is characterized primarily by the progressive degradation of articular cartilage. Conventional therapeutic approaches, including hyaluronic acid injections, joint replacement, and non-steroidal anti-inflammatory drugs, are primarily palliative, offering symptomatic relief but failing to promote cartilage regeneration or halt disease progression. Moreover, these treatments are often associated with notable adverse effects, particularly with long-term use(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Thus, there is an urgent need to develop new regenerative strategies capable of addressing the underlying pathology of OA and facilitating cartilage repair, which holds considerable promise for improving clinical outcomes.\u003c/p\u003e \u003cp\u003eRecently, BMSCs have emerged as a promising therapeutic approach for cartilage repair in OA, attributed to their pluripotent differentiation potential and immunoregulatory properties(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Significant progress has been achieved in preclinical studies using animal models, with some BMSC-based therapies already demonstrating promising results(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). For instance, intra-articular injection of BMSCs has demonstrated efficacy in mitigating pathological symptoms of mild to moderate OA by alleviating cartilage degradation and subchondral bone damage(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Nonetheless, the oxidative stress microenvironment in OA lesions posed a major challenge, significantly impairing the survival, engraftment, and treatment efficacy of transplanted BMSCs.\u003c/p\u003e \u003cp\u003eβ-Sitosterol, a natural bioactive ingredient, has been broadly utilized in the medical and health food industries(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Previous studies have demonstrated that β-sitosterol significantly ameliorates tissue damage in cardiovascular and neurodegenerative diseases by inhibiting reactive oxygen species (\u003cb\u003eROS\u003c/b\u003e) production(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Furthermore, network pharmacology analysis has identified 13 shared targets between β-sitosterol and OA, including key proteins like Bcl2, CASP3, and CASP8, suggesting its potential value in OA management(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). To date, the effects of β-sitosterol on OA treatment, particularly its role in modulating antioxidative stress in BMSCs and chondrocytes, remain largely unexplored.\u003c/p\u003e \u003cp\u003eIn this work, we investigated, for the first time, the potential of β-sitosterol pretreatment to enhance the antioxidative stress capacity of BMSCs and chondrocytes, as well as its therapeutic effects in a rabbit OA model. Our study focused on evaluating the effects of β-sitosterol on enhancing cell viability under oxidative stress and its ability to alleviate OA-related cartilage damage. The present study provides novel insights and a scientific basis for optimizing BMSC-based therapies, offering a promising strategy to enhance their clinical application in OA treatment.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e \u003cb\u003eChemicals, Reagents, and Antibodies.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eβ-sitosterol (purity\u0026thinsp;\u0026gt;\u0026thinsp;98%, HY-N0171A) was obtained from MedChemExpress (Monmouth Junction, NJ, USA). All antibodies were provided by Proteintech Group, Inc (Wuhan, China). Glutathione Peroxidase (\u003cb\u003eGSH-Px\u003c/b\u003e) Assay Kit, Total Superoxide Dismutase (\u003cb\u003eSOD\u003c/b\u003e) Activity Assay Kit, Catalase (\u003cb\u003eCAT\u003c/b\u003e) Assay Kit, Reactive Oxygen Species Assay Kit, and JC-1 dye were obtained from Beyotime Biotechnology (Shanghai, China).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePrimary Culture of Rabbit BMSCs.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNew Zealand White rabbits (one month old) were humanely euthanized with an overdose of sodium pentobarbital (150 mg/kg) administered via intravenous injection, in accordance with institutional ethical guidelines. The epiphyses of the femur and tibia were removed to expose the marrow cavity, which was washed with DMEM/F12 medium containing 1% penicillin-streptomycin until the epiphyses turned white. The flushing solution was passed through a 70 \u0026micro;m sieve, spun and resuspended in the complete medium as shown in Scheme \u003cspan refid=\"Sch1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. We seeded cells at 1\u0026times;10⁵/mL in a 25 cm\u0026sup2; flask, with the first medium change after 48 h. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePrimary Culture of Rabbit Chondrocyte.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNew Zealand White rabbits (one month old) were euthanized with sodium pentobarbital, and articular cartilage was aseptically isolated from the knee joints. T The cartilage was finely chopped, washed and incubated with 0.1% hyaluronidase and 0.2% collagenase II (Biosharp Biotechnology Co., Ltd., Hefei, China) for 16\u0026ndash;24 hours at 37\u0026deg;C. Following digestion, the suspension was spun down, and the collected pellet was redispersed in the same culture medium and conditions as those used for culturing BMSCs. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell Viability.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBMSCs and chondrocytes were plated into 96-well plates and subjected to the designated treatments as shown in Scheme \u003cspan refid=\"Sch1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. In short, cells were pretreated with β-sitosterol at concentrations of 0 and 50 \u0026micro;mol/L for 24 hours, followed by induction with H₂O₂ for another 24 hours. Cell Counting Kit-8 (\u003cb\u003eCCK-8\u003c/b\u003e, Biosharp, Hefei, China) assay was used to assess cell viability and OD values were taken at 450 nm.\u003c/p\u003e \u003cp\u003e \u003cb\u003eQuantitative Real-Time Polymerase Chain Reaction (qPCR).\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTotal RNA was collected by TRIzol reagent, then transcribed into cDNA with the HiScript II QRT SuperMix (Vazyme Biotech, Nanjing, China) using an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA). Primer sequences can be found in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The mRNA primers were supplied by Shanghai Generay Biotech Co., Ltd. (Shanghai, China). We used 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method to quantify the targeted mRNAs, with Glyceraldehyde-3-phosphate dehydrogenase (\u003cb\u003eGAPDH\u003c/b\u003e) as the reference gene.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026prime; \u0026minus;\u0026thinsp;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSOD3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: ATGCTGGCGTTGGTGTGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GGATCTGCTCCACCGTGTCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCAT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: ATCCAGCCAGCGACCAGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GCCCTGCCGTGATGATGTTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGSH-Px\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GCTGCCCAGTCTGTGTACTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CTCAGAGCGACGCCACATTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCol2a1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CCACCGTGCCCAAGAAGAACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GAAGCCGCCATTGATGGTCTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAggrecan\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GCACGCCTGAGACCATTGATGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: TCCACTTGGTGAGCCACTGACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMMP13\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TCTGGTCTTCTGGCTCACGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: TGGGCAGCAACGAGAAACAAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBcl2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGGGATGCCTTCGTGGAACTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CCGAGGGTGATGCAAGCTCCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCaspase3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AGCCACGGTGATGAAGGAGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: TGTGCCTCGGCAAGCCTGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCaspase9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GCTGCGTGGTTGTCATCCTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GGGTATCCGTCCGTGCCATAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GAAGGTGGTGAAGCAGGCATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GGCACTGTTGAAGTCGCAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern Blotting.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe total protein was separated on 10% SDSPAGE gel (Yazyme Bio Co., Ltd., Shanghai, China) and transferred to polyvinylidene difluoride (\u003cb\u003ePVDF\u003c/b\u003e) membranes with a pore size of 0.45 \u0026micro;m. All antibodies were diluted at a ratio of 1:1,000. ImageLab software was used to observe and analyze the target strip.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eFlow Cytometry\u003c/h2\u003e \u003cp\u003eMitochondrial membrane potential and intracellular ROS levels were measured using JC-1 dye and DCFH-DA, respectively. Following treatment, primary rabbit BMSCs and chondrocytes were stained with the corresponding dyes for 20 minutes at 37\u0026deg;C, rinsed, and analyzed using a BD FACSVerse flow cytometer (BD Biosciences, USA). ROS levels and JC-1 red-to-green fluorescence ratios were quantified using FlowJo software.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFluorescence Microscopy\u003c/h3\u003e\n\u003cp\u003eThe cell treatment in fluorescence microscopy was consistent with the method described above for flow cytometry. We took the images with a Nikon Upright Microscope (Nikon Corporation, Tokyo, Japan).\u003c/p\u003e\n\u003ch3\u003eOxidative Stress-related Enzyme Activity\u003c/h3\u003e\n\u003cp\u003eThe activities of SOD, CAT, and GSH-Px were measured using enzyme activity assay kits from Beyotime Biotechnology (S0101S, S0051, S0056, Beyotime Biotechnology, Shanghai, China). We recorded absorbance at 520 nm, 520 nm and 340 nm, respectively.\u003c/p\u003e\n\u003ch3\u003eAnimal Model\u003c/h3\u003e\n\u003cp\u003e The methods and the use of New Zealand White rabbits (12 weeks old, 2.5\u0026ndash;3.0 kg, male) in this study were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University. (Permit No: 20230920142). The work has been reported in line with the ARRIVE guidelines 2.0.\u003c/p\u003e \u003cp\u003eWe assigned 30 rabbits to five groups in a random manner: Sham group (normal knee joint), OA group (untreated defect), the β-sitosterol treatment group, the BMSC treatment group, and the β-sitosterol-pretreated BMSC treatment group, with six rabbits in each group. The experimental unit was a single rabbit. In short, the rabbits were administered pentobarbital sodium (30 mg/kg) via intraperitoneal injection for anesthesia and maintained under 3% isoflurane. The surgical approach was established and the trochlea was exposed using a previously reported method as presented in Scheme \u003cspan refid=\"Sch1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe β-sitosterol treatment group, BMSC injection treatment group, and β-sitosterol-pretreated BMSC injection treatment group were administered intra-articular injections of 0.2 mL β-sitosterol (50 \u0026micro;mol/L), BMSCs (5\u0026times;10⁶ cells/mL), or β-sitosterol-pretreated BMSCs (5\u0026times;10⁶ cells/mL), respectively, on postoperative days 1, 3, 5, and 7. The OA group received the same quantity of PBS. Six weeks after surgery, the rabbits were euthanized with an overdose of sodium pentobarbital (150 mg/kg) administered via intravenous injection, and the knee joints were subjected to gross observation and photographed. Cartilage tissue samples from the knee joints were collected, and the specimens were fixed in 4% paraformaldehyde.\u003c/p\u003e\n\u003ch3\u003eHistological and immunohistochemical analysis\u003c/h3\u003e\n\u003cp\u003eThe samples were dehydrated, embedded in paraffin, sliced into sections, then subjected to haematoxylin and eosin (\u003cb\u003eH\u0026amp;E\u003c/b\u003e) staining and safranin O (\u003cb\u003eS\u0026ndash;O\u003c/b\u003e) staining.\u003c/p\u003e \u003cp\u003eDuring immunohistochemical processing, the slide sections were incubated overnight in a humidified chamber with primary antibodies, including anti-Col2a1 and anti-aggrecan, following the manufacturer's guidelines.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of Osteometric Parameters, Bone Mineral Density and Bone Strength\u003c/h2\u003e \u003cp\u003eThe femur and tibia were weighed after the removal of muscles. We measured the bones' length and vertical external diameter with a precision vernier caliper.\u003c/p\u003e \u003cp\u003eBone mineral content (\u003cb\u003eBMC\u003c/b\u003e) and bone mineral density (\u003cb\u003eBMD\u003c/b\u003e) were analyzed with a dual-energy X-ray absorptiometry (Medikors, Inc., Gyeonggi-do, Korea). The InAlyzer 1.0 image processing system was utilized to evaluate the BMC and BMD of the entire bone regions. Following this, a universal materials testing machine (LR10K PLUS, Lloyd Instruments Ltd., Hampshire, UK) was employed to perform three-point bending tests and assess the mechanical properties of the bones.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis of the data was conducted using SPSS version 26.0 software. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (\u003cb\u003eSEM\u003c/b\u003e). Statistical analyses were performed by one-way analysis of variance (\u003cb\u003eANOVA\u003c/b\u003e). Osteoarthritis Research Society International (\u003cb\u003eOARSI\u003c/b\u003e)scores were analyzed by the Kruskal\u0026ndash;Wallis H test.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eProtective Effects of β-Sitosterol on H₂O₂-Induced Damage in Primary Rabbit BMSCs and Chondrocytes\u003c/h2\u003e \u003cp\u003eWe isolated primary BMSCs and chondrocytes from rabbits as to examine the effects of β-sitosterol on BMSCs and chondrocytes in vitro. Differentiation assays confirmed the osteogenic, adipogenic, and chondrogenic potential of BMSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eβ-Sitosterol treatment at 50 \u0026micro;M significantly enhanced BMSC viability to 115.4%, marking it as the optimal experimental concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). H₂O₂ exposure significantly reduced BMSC viability (68.3%), while β-sitosterol pretreatment restored it to 98.5% (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Similarly, in chondrocytes, β-sitosterol pretreatment improved viability from 43.1% (H₂O₂-treated) to 85.3% (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAt the molecular level, H₂O₂ significantly decreased Col2a1 and aggrecan expression while increasing MMP13, contributing to ECM degradation (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). β-Sitosterol pretreatment effectively upregulated Col2a1 while reducing MMP13 expression. Additionally, H₂O₂ treatment disrupted apoptotic balance by decreasing Bcl2 and increasing Caspase 9, while β-sitosterol restored Bcl2 expression (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Protein expression analysis confirmed these protective effects, with β-sitosterol reversing H₂O₂-induced reductions in ECM-related proteins. Notably, β-sitosterol alone did not significantly alter mRNA or protein expression levels (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), indicating its effects were specific to oxidative stress conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eβ-Sitosterol Inhibited H₂O₂-Induced Oxidative Stress in Primary Rabbit BMSCs and Chondrocytes\u003c/h2\u003e \u003cp\u003eTo evaluate β-sitosterol's antioxidant properties, ROS production and mitochondrial function were analyzed. Flow cytometry results demonstrated that H₂O₂ stimulation significantly increased ROS levels (504.1%, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and C), while β-sitosterol pretreatment effectively reduced ROS accumulation to 206.9% in BMSCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and C). In primary chondrocytes, a similar trend was observed, with H₂O₂ significantly increasing ROS levels, which were restored following β-sitosterol pretreatment (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, C and G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMitochondrial membrane potential (ΔΨm) was markedly disrupted by H₂O₂, decreasing it to 33.4% of the control level in BMSCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and D). β-Sitosterol pretreatment significantly restored mitochondrial membrane potential to 57.9% of the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and D). Likewise, in chondrocytes, H₂O₂ exposure significantly impaired mitochondrial function, while β-sitosterol pretreatment partially restored ΔΨm, as demonstrated by fluorescence imaging and flow cytometry(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, D and F).\u003c/p\u003e \u003cp\u003eThe expression of SOD, CAT, and GSH-Px was significantly downregulated by H₂O₂ in both BMSCs and chondrocytes (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). However, β-sitosterol pretreatment significantly upregulated SOD and GSH-Px expression compared to the H₂O₂ group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Further enzymatic activity assays confirmed these findings, showing that β-sitosterol pretreatment partly restored H₂O₂-induced reductions in SOD and GSH-Px activities in both BMSCs and chondrocytes (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF and H; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH and J) while significantly enhancing CAT activity in chondrocytes (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIntra-articular Injection of β-sitosterol-pretreated BMSCs Ameliorated OA Progression in The Rabbit OA Model\u003c/h2\u003e \u003cp\u003eA surgical OA model was established in New Zealand white rabbits to evaluate the effects of intra-articular injections of β-sitosterol and β-sitosterol-pretreated BMSCs. Injections were given on postoperative days 1, 3, 5, and 7, and samples were harvested for analysis after 6 weeks. Surface examination of the joints showed better cartilage restoration in the medicated groups than in the OA model group, with the β-sitosterol-pretreated BMSCs injection group exhibiting the best results. The repaired cartilage was smooth and uniform, with defect areas filled by newly formed tissue, closely resembling the Sham group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). These findings were further supported by ICRS scores (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAnalysis at the molecular level revealed significantly decreased mRNA expression of SOD, CAT, GSH-Px, Col2a1, and aggrecan in the cartilage of the OA group, with a corresponding significant increase in Casp3 expression (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In the β-sitosterol-pretreated BMSCs injection group, those decreased mRNA in OA group along with Bcl2 were significantly increased, whereas MMP13, Casp3, and Casp9 expression levels were attenuated. (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). While the β-sitosterol-alone and BMSCs injection groups displayed some degree of improvement, their outcomes were slightly less favorable than those of the β-sitosterol-pretreated BMSCs group.\u003c/p\u003e \u003cp\u003eHistological analysis (H\u0026amp;E, S-O) indicated that the cartilage in the Sham group was smooth and structurally intact, whereas the OA group showed rough cartilage surfaces and disorganized subchondral bone. Among the treatment groups, the β-sitosterol-pretreated BMSCs injection group had the best repair outcome, with clearly defined cartilage and subchondral bone boundaries. Immunohistochemistry results further supported the above findings, showing higher Col2a1 and aggrecan expression in the β-sitosterol-pretreated BMSCs injection group, with the morphology of the repaired tissue cells resembling normal cartilage (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAdditionally, oxidative stress-related enzyme activity were significantly reduced in OA model (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, F, and G). All treatment groups partially restored antioxidant enzyme activities, with the β-sitosterol-pretreated BMSCs injection group achieving the best recovery.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEffects of β-Sitosterol and Its Pretreated BMSCs on Bone Architecture and Mechanical Properties\u003c/h2\u003e \u003cp\u003eThe diameters and weights of the femur and tibia showed no significant statistical differences across the Sham, OA, β-sitosterol, BMSCs, and β-sitosterol-pretreated BMSCs groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB and C), suggesting consistent skeletal architecture among the experimental rabbits. Femoral and tibial lengths were slightly longer in the β-sitosterol group contrasted with the Sham as well as OA groups, yet the overall changes were marginal. (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). BMC and BMD data presented no notable statistical differences among groups. (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eK and L).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe tibia displayed a significantly higher difference in bone strength compared to the femur. The β-sitosterol treatment group exhibited significantly greater tibial maximum load and bending stress than the OA group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD and E). Tibial stiffness, Young's modulus, and bending rigidity were significantly reduced in the OA group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF, G, and H). All treatment groups showed varying degrees of improvement, with the β-sitosterol group nearly restoring these measures to Sham group levels. Additionally, the trends for maximum bending strain and the work from preload to maximum load in both the femur and tibia were similar, with the values in the femoral BMSCs injection group notably higher than those injected PBS (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI and J).\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOsteoarthritis is a highly prevalent disorder that significantly impairs patients\u0026rsquo; quality of life(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Both BMSCs and chondrocytes play crucial roles in the pathogenesis and treatment of OA, with the therapeutic potential of exogenous BMSCs being well-documented in numerous studies(\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Oxidative stress microenvironment at OA lesion sites significantly compromises the survival and reparative functions of BMSCs, acting as a critical limitation to their treatment efficacy(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Antioxidant interventions aimed at reducing oxidative stress may enhance the therapeutic performance of BMSCs. As a major oxidative stress metabolite, H₂O₂ is frequently used in vitro to simulate oxidative stress-induced cellular damage and evaluate potential protective treatments(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). H₂O₂ accelerates OA progression by suppressing ECM synthesis in chondrocytes and inducing apoptotic cell death(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). As a natural active compound, β-sitosterol exhibits a range of biological activities, such as anti-inflammatory, antioxidant, and immunomodulatory effects(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Earlier bioinformatics analyses have identified 13 shared targets between β-sitosterol and OA(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Moreover, β-sitosterol has been shown to improve hepatotoxicity and diabetes in mouse models by boosting the mitochondrial glutathione redox system and lowering ROS levels (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). To this day, no studies have specifically investigated the effects of β-sitosterol on OA or its functional role in modulating oxidative stress in BMSCs and chondrocytes. By evaluating the antioxidative effects of β-sitosterol pretreatment on BMSCs and chondrocytes and validating its cartilage repair potential in a rabbit OA model, this study provides foundational experimental evidence for the development of novel treatment for OA.\u003c/p\u003e \u003cp\u003eThrough in vitro studies, this study demonstrated the antioxidative and protective effects of β-sitosterol against H₂O₂-induced damage in BMSCs and chondrocytes. A significant reduction in cell viability was observed in both BMSC and chondrocyte following H₂O₂ treatment, consistent with the prior findings reported by Mathy-Hartert et al(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). The findings further showed that H₂O₂-induced oxidative stress markedly downregulated the expressions of Col2a1, aggrecan and Bcl2 while upregulated the expression of MMP13 in both cell types. β-sitosterol pretreatment significantly enhanced cell viability, the mRNA expression of Col2a1 and aggrecan, and effectively suppressed the upregulation of MMP13. These findings confirm that β-sitosterol preserves ECM integrity by inhibiting the overexpression of matrix-degrading enzyme (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThis study also explored the effects of β-sitosterol pretreatment on oxidative stress induced by H₂O₂ in BMSCs and chondrocytes, with a particular focus on ROS generation, mitochondrial membrane potential, and the expression and activity of key antioxidant enzymes. In both BMSCs and chondrocytes, β-sitosterol pretreatment significantly lowered intracellular ROS levels. Additionally, the restoration of mitochondrial membrane potential in BMSCs was evident and further verified by flow cytometry analysis of ROS and JC-1 staining, as well as immunofluorescence imaging in chondrocytes. MMP recovery signifies the preservation of mitochondrial function. Further analysis revealed that β-sitosterol pretreatment markedly upregulated the mRNA expression of SOD and GSH-Px, while also significantly enhanced GSH-Px activity. A significant improvement in CAT activity was observed in chondrocytes (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Collectively, these results demonstrate that β-sitosterol mitigates oxidative damage by augmenting the antioxidant enzyme system.\u003c/p\u003e \u003cp\u003eThis study evaluated the therapeutic potential of β-sitosterol and β-sitosterol-preconditioned BMSCs administered via intra-articular injection in a rabbit OA model. The OA group exhibited a rough cartilage surface and incomplete regeneration of cartilage tissue in the defect area. Histological analysis revealed disorganization of the subchondral bone and an unclear interface between the cartilage and subchondral bone, consistent with Zhou et al.'s findings(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Compared to the β-sitosterol or BMSCs group, the β-sitosterol-pretreated BMSCs group exhibited markedly improved cartilage repair, recovery of antioxidant enzyme activity, and improved gene regulation. These outcomes are likely attributable to the synergistic antioxidative and anti-apoptotic mechanisms of β-sitosterol-preconditioned BMSCs. Prior findings suggest that BMSCs function in both repair processes and inflammation control, and β-sitosterol may enhance these functions through its antioxidative and anti-inflammatory properties(\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Specifically, the β-sitosterol-pretreated BMSCs group exhibited the best cartilage repair outcomes, as evidenced by both macroscopic observations and histological staining. ICRS evaluation confirmed these results, highlighting a substantial improvement in tissue repair performance. Regan et al. found the significant downregulation of antioxidant enzymes in OA joints at the molecular level(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Sharmila and Yin et al. reported that β-sitosterol mitigates oxidative stress by activating NRF2, boosting phase II enzymes (HO-1, NQO1, GST), and upregulating SOD, CAT, and GSH-Px(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). In the present study, we observed that β-sitosterol alleviates CAT and GSH-Px downregulation in OA model. Among the treatment groups, the β-sitosterol-pretreated BMSCs group exhibited the strongest recovery of antioxidant enzyme activity, emphasizing its potent antioxidative properties. Furthermore, immunohistochemistry revealed enhanced expression of Col2a1 and aggrecan, providing additional evidence of the therapeutic benefits of β-sitosterol-pretreated BMSCs in promoting cartilage repair.\u003c/p\u003e \u003cp\u003eFurther analysis of the femur and tibia in the rabbit OA model showed no significant differences in basic skeletal parameters (diameter, weight, BMC, BMD) across groups, ensuring uniformity. Interestingly, the β-sitosterol group exhibited the most substantial improvement in tibial mechanical properties, including maximum load, stiffness, and Young\u0026rsquo;s modulus, surpassing the stem cell injection group and approaching levels comparable to the Sham group. It has shown that β-sitosterol increases the expression of osteoclast differentiation factor and osteoprotegerin in osteoblasts, while simultaneously inhibiting osteoclastic activity, thereby contributing to the regulation of skeletal metabolic balance(\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Our data indicate a potential role for β-sitosterol in enhancing bone strength and quality in the treatment of bone-related disorders.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eIn summary, this study assessed the therapeutic potential of β-sitosterol in the treatment of OA model. The findings support the potential of β-sitosterol as a novel antioxidant for OA management and suggest a new direction for combined therapies with BMSCs. However, several limitations remain, including the untested long-term safety profile of β-sitosterol and the need to further elucidate its underlying regulatory mechanisms crucial for optimizing its efficacy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article and its supplementary information files. Additional raw data are available from the corresponding author upon reasonable request. Full-length Western blot images and the completed ARRIVE checklist have been provided as supplementary materials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthical Approval and Consent to participate\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University. (Permit No: 20230920142). The approved project was titled \u0026ldquo;Protective effects of \u0026beta;-sitosterol on stem cells and cartilage repair in a rabbit model of osteoarthritis\u0026rdquo;. The approval date was September 20, 2023.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAvailability of supporting data\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article and its supplementary information files. Additional raw data are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (grant number 32273080) and the Key Project of the 2023 Luoyang City Public Welfare Industry Research Program (grant number 2302005A).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAuthors\u0026apos; contributions\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChengyin Liu,\u0026nbsp;Zhenlei Zhou\u0026nbsp;and\u0026nbsp;Qi Chang designed the study.\u0026nbsp;Chengyin Liu,\u0026nbsp;Xiaoman Wang,\u0026nbsp;Yanyan Zhang and Hongfan Ge\u0026nbsp;performed the experiments.\u0026nbsp;Chengyin Liu\u0026nbsp;analyzed the data.\u0026nbsp;Chengyin Liu\u0026nbsp;and\u0026nbsp;Zhenlei Zhou\u0026nbsp;wrote the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eACKNOWLEDGMENTS\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to express their sincere gratitude to the College of Veterinary Medicine, Nanjing Agricultural University, and the Department of Orthopaedics, The 989 Hospital of the People\u0026apos;s Liberation Army Joint Service Support Force, for their valuable support and assistance throughout this study. The authors declare that they have not used AI-generated work in this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePerruccio AV, Young JJ, Wilfong JM, Denise Power J, Canizares M, Badley EM. Osteoarthritis year in review 2023: Epidemiology \u0026amp; therapy. Osteoarthritis Cartilage. 2024;32(2):159-65.\u003c/li\u003e\n\u003cli\u003eLiu Y, Zhang Z, Li T, Xu H, Zhang H. Senescence in osteoarthritis: from mechanism to potential treatment. Arthritis Res Ther. 2022;24(1):174.\u003c/li\u003e\n\u003cli\u003eScheuing WJ, Reginato AM, Deeb M, Acer Kasman S. The burden of osteoarthritis: Is it a rising problem? Best Pract Res Clin Rheumatol. 2023;37(2):101836.\u003c/li\u003e\n\u003cli\u003eYao Q, Wu X, Tao C, Gong W, Chen M, Qu M, et al. Osteoarthritis: pathogenic signaling pathways and therapeutic targets. Signal Transduct Target Ther. 2023;8(1):56.\u003c/li\u003e\n\u003cli\u003eTsokanos A, Livieratou E, Billis E, Tsekoura M, Tatsios P, Tsepis E, et al. The Efficacy of Manual Therapy in Patients with Knee Osteoarthritis: A Systematic Review. Medicina (Kaunas). 2021;57(7).\u003c/li\u003e\n\u003cli\u003eJang S, Lee K, Ju JH. Recent Updates of Diagnosis, Pathophysiology, and Treatment on Osteoarthritis of the Knee. Int J Mol Sci. 2021;22(5).\u003c/li\u003e\n\u003cli\u003eMaumus M, Guerit D, Toupet K, Jorgensen C, Noel D. Mesenchymal stem cell-based therapies in regenerative medicine: applications in rheumatology. Stem Cell Res Ther. 2011;2(2):14.\u003c/li\u003e\n\u003cli\u003eZhou Y, He X, Zhang W, Zhang W, Zhao H, Zhou X, et al. Cell-recruited microspheres for OA treatment by dual-modulating inflammatory and chondrocyte metabolism. Mater Today Bio. 2024;27:101127.\u003c/li\u003e\n\u003cli\u003eHe L, He T, Xing J, Zhou Q, Fan L, Liu C, et al. Bone marrow mesenchymal stem cell-derived exosomes protect cartilage damage and relieve knee osteoarthritis pain in a rat model of osteoarthritis. Stem Cell Res Ther. 2020;11(1):276.\u003c/li\u003e\n\u003cli\u003eMurphy JM, Fink DJ, Hunziker EB, Barry FP. Stem cell therapy in a caprine model of osteoarthritis. Arthritis Rheum. 2003;48(12):3464-74.\u003c/li\u003e\n\u003cli\u003eCenteno CJ, Busse D, Kisiday J, Keohan C, Freeman M, Karli D. Increased knee cartilage volume in degenerative joint disease using percutaneously implanted, autologous mesenchymal stem cells. Pain Physician. 2008;11(3):343-53.\u003c/li\u003e\n\u003cli\u003eBabu S, Jayaraman S. An update on beta-sitosterol: A potential herbal nutraceutical for diabetic management. Biomed Pharmacother. 2020;131:110702.\u003c/li\u003e\n\u003cli\u003eMacoska JA. The use of beta-sitosterol for the treatment of prostate cancer and benign prostatic hyperplasia. Am J Clin Exp Urol. 2023;11(6):467-80.\u003c/li\u003e\n\u003cli\u003eKhan Z, Nath N, Rauf A, Emran TB, Mitra S, Islam F, et al. Multifunctional roles and pharmacological potential of beta-sitosterol: Emerging evidence toward clinical applications. Chem Biol Interact. 2022;365:110117.\u003c/li\u003e\n\u003cli\u003eGupta R, Sharma AK, Dobhal MP, Sharma MC, Gupta RS. Antidiabetic and antioxidant potential of beta-sitosterol in streptozotocin-induced experimental hyperglycemia. J Diabetes. 2011;3(1):29-37.\u003c/li\u003e\n\u003cli\u003eLiu C, Yu L, Jiang Y, Gu S, Li C, Yin W, et al. The Possibility of Polygonum cuspidatum against Osteoarthritis based on Network Pharmacology. Curr Comput Aided Drug Des. 2024;20(2):121-33.\u003c/li\u003e\n\u003cli\u003eZhang W, Zhang F, Shi H, Tan R, Han S, Ye G, et al. Comparisons of rabbit bone marrow mesenchymal stem cell isolation and culture methods in vitro. PLoS One. 2014;9(2):e88794.\u003c/li\u003e\n\u003cli\u003eYu Y, Jiang Y, Ge H, Fan X, Gao H, Zhou Z. HIF-1alpha in cartilage homeostasis, apoptosis, and glycolysis in mice with steroid-induced osteonecrosis of the femoral head. J Cell Physiol. 2024;239(5):e31224.\u003c/li\u003e\n\u003cli\u003eChen Z, Zhang Q, Li H, Wei Q, Zhao X, Chen F. Elastin-like polypeptide modified silk fibroin porous scaffold promotes osteochondral repair. Bioact Mater. 2021;6(3):589-601.\u003c/li\u003e\n\u003cli\u003eHawker GA. Osteoarthritis is a serious disease. Clin Exp Rheumatol. 2019;37 Suppl 120(5):3-6.\u003c/li\u003e\n\u003cli\u003eRim YA, Nam Y, Ju JH. The Role of Chondrocyte Hypertrophy and Senescence in Osteoarthritis Initiation and Progression. Int J Mol Sci. 2020;21(7).\u003c/li\u003e\n\u003cli\u003eZhang M, Yang H, Lu L, Wan X, Zhang J, Zhang H, et al. Matrix replenishing by BMSCs is beneficial for osteoarthritic temporomandibular joint cartilage. Osteoarthritis Cartilage. 2017;25(9):1551-62.\u003c/li\u003e\n\u003cli\u003eLiu Y, Peng L, Li L, Huang C, Shi K, Meng X, et al. 3D-bioprinted BMSC-laden biomimetic multiphasic scaffolds for efficient repair of osteochondral defects in an osteoarthritic rat model. Biomaterials. 2021;279:121216.\u003c/li\u003e\n\u003cli\u003eAnsari MY, Ahmad N, Haqqi TM. Oxidative stress and inflammation in osteoarthritis pathogenesis: Role of polyphenols. Biomed Pharmacother. 2020;129:110452.\u003c/li\u003e\n\u003cli\u003eZhou Z, Zhang L, Liu Y, Huang C, Xia W, Zhou H, et al. Luteolin Protects Chondrocytes from H(2)O(2)-Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling. Oxid Med Cell Longev. 2022;2022:5635797.\u003c/li\u003e\n\u003cli\u003eLee DY, Park YJ, Song MG, Kim DR, Zada S, Kim DH. Cytoprotective Effects of Delphinidin for Human Chondrocytes against Oxidative Stress through Activation of Autophagy. Antioxidants (Basel). 2020;9(1).\u003c/li\u003e\n\u003cli\u003eWang H, Wang Z, Zhang Z, Liu J, Hong L. beta-Sitosterol as a Promising Anticancer Agent for Chemoprevention and Chemotherapy: Mechanisms of Action and Future Prospects. Adv Nutr. 2023;14(5):1085-110.\u003c/li\u003e\n\u003cli\u003eWong HS, Chen JH, Leong PK, Leung HY, Chan WM, Ko KM. beta-sitosterol protects against carbon tetrachloride hepatotoxicity but not gentamicin nephrotoxicity in rats via the induction of mitochondrial glutathione redox cycling. Molecules. 2014;19(11):17649-62.\u003c/li\u003e\n\u003cli\u003eRahimifard M, Manayi A, Baeeri M, Gholami M, Saeidnia S, Abdollahi M. Investigation of beta-Sitosterol and Prangol Extracted from Achillea Tenoifolia Along with Whole Root Extract on Isolated Rat Pancreatic Islets. Iran J Pharm Res. 2018;17(1):317-25.\u003c/li\u003e\n\u003cli\u003eMathy-Hartert M, Deby-Dupont GP, Reginster JY, Ayache N, Pujol JP, Henrotin YE. Regulation by reactive oxygen species of interleukin-1beta, nitric oxide and prostaglandin E(2) production by human chondrocytes. Osteoarthritis Cartilage. 2002;10(7):547-55.\u003c/li\u003e\n\u003cli\u003eHui W, Young DA, Rowan AD, Xu X, Cawston TE, Proctor CJ. Oxidative changes and signalling pathways are pivotal in initiating age-related changes in articular cartilage. Ann Rheum Dis. 2016;75(2):449-58.\u003c/li\u003e\n\u003cli\u003eVivancos M, Moreno JJ. beta-Sitosterol modulates antioxidant enzyme response in RAW 264.7 macrophages. Free Radic Biol Med. 2005;39(1):91-7.\u003c/li\u003e\n\u003cli\u003eYin Y, Liu X, Liu J, Cai E, Zhu H, Li H, et al. Beta-sitosterol and its derivatives repress lipopolysaccharide/d-galactosamine-induced acute hepatic injury by inhibiting the oxidation and inflammation in mice. Bioorg Med Chem Lett. 2018;28(9):1525-33.\u003c/li\u003e\n\u003cli\u003eDing N, Li E, Ouyang X, Guo J, Wei B. The Therapeutic Potential of Bone Marrow Mesenchymal Stem Cells for Articular Cartilage Regeneration in Osteoarthritis. Curr Stem Cell Res Ther. 2021;16(7):840-7.\u003c/li\u003e\n\u003cli\u003eRegan E, Flannelly J, Bowler R, Tran K, Nicks M, Carbone BD, et al. Extracellular superoxide dismutase and oxidant damage in osteoarthritis. Arthritis Rheum. 2005;52(11):3479-91.\u003c/li\u003e\n\u003cli\u003eSharmila R, Sindhu G. Modulation of Angiogenesis, Proliferative Response and Apoptosis by beta-Sitosterol in Rat Model of Renal Carcinogenesis. Indian J Clin Biochem. 2017;32(2):142-52.\u003c/li\u003e\n\u003cli\u003eMalini T, Vanithakumari G. Comparative study of the effects of beta-sitosterol, estradiol and progesterone on selected biochemical parameters of the uterus of ovariectomised rats. J Ethnopharmacol. 1992;36(1):51-5.\u003c/li\u003e\n\u003cli\u003eWang T, Li S, Yi C, Wang X, Han X. Protective Role of beta-Sitosterol in Glucocorticoid-Induced Osteoporosis in Rats Via the RANKL/OPG Pathway. Altern Ther Health Med. 2022;28(7):18-25.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Scheme 1","content":"\u003cp\u003eScheme 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"β-sitosterol, Osteoarthritis, Oxidative stress, BMSCs, Cartilage repair","lastPublishedDoi":"10.21203/rs.3.rs-6426541/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6426541/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eI. Background:\u003c/h2\u003e \u003cp\u003eOsteoarthritis (OA) is a joint disorder that severely affects patients' mobility, overall health, and ability to perform daily activities. Despite advancements in therapeutic strategies, stem cell-based therapies for OA still face challenges, particularly in enhancing the antioxidative capacity of stem cells to improve therapeutic outcomes. Therefore, this study aimed to explore the potential of β-sitosterol in this context.\u003c/p\u003e\u003ch2\u003eII. Methods:\u003c/h2\u003e \u003cp\u003eThis study evaluated the protective effects of β-sitosterol on bone marrow-derived mesenchymal stem cells (BMSCs) and chondrocytes under oxidative stress conditions and assessed its potential in promoting cartilage repair in a rabbit OA model. Cell viability, gene expression, oxidative stress markers, and mitochondrial function were examined. In vivo therapeutic effects were evaluated through histological and immunohistochemical analyses.\u003c/p\u003e\u003ch2\u003eIII. Results:\u003c/h2\u003e \u003cp\u003eThe results revealed that β-sitosterol significantly enhanced BMSC viability, upregulated the expression of Col2a1 and aggrecan, while inhibiting MMP13 expression. Furthermore, β-sitosterol effectively alleviated oxidative stress and preserved mitochondrial function in BMSCs. Notably, BMSCs pretreated with β-Sitosterol exhibited a higher potential for facilitating cartilage regeneration in the OA model, as evidence by histopathological analysis.\u003c/p\u003e\u003ch2\u003eIV. Conclusions:\u003c/h2\u003e \u003cp\u003eThese findings suggest that β-sitosterol possesses significant antioxidative and chondroprotective properties, which enhance the therapeutic efficacy of BMSCs in addressing OA-related cartilage damage.\u003c/p\u003e","manuscriptTitle":"β-Sitosterol Preconditioning Enhances the Resistance of BMSCs and Chondrocyte to Oxidative Stress and Promotes Cartilage Repair in Osteoarthritis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-16 13:14:02","doi":"10.21203/rs.3.rs-6426541/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-05-19T09:29:21+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-14T00:56:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-16T22:14:36+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2025-04-16T07:39:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"42be6ad9-505b-4c15-953f-747141a779ae","owner":[],"postedDate":"May 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-09-01T16:01:52+00:00","versionOfRecord":{"articleIdentity":"rs-6426541","link":"https://doi.org/10.1186/s13287-025-04613-x","journal":{"identity":"stem-cell-research-and-therapy","isVorOnly":false,"title":"Stem Cell Research \u0026 Therapy"},"publishedOn":"2025-08-26 15:57:48","publishedOnDateReadable":"August 26th, 2025"},"versionCreatedAt":"2025-05-16 13:14:02","video":"","vorDoi":"10.1186/s13287-025-04613-x","vorDoiUrl":"https://doi.org/10.1186/s13287-025-04613-x","workflowStages":[]},"version":"v1","identity":"rs-6426541","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6426541","identity":"rs-6426541","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}