Reparative Effects of VCAM-1 High-Performance MSC-derived Exosomes on Aged Diabetic Cardiomyocyte Injury: A Focus on Ferroptosis Suppression

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-03 · read from full text

The paper investigates whether exosomes derived from VCAM-1-high-performance mesenchymal stem cells (MSC-derived exosomes) can repair cardiomyocyte injury in models combining aging and diabetes, focusing on suppression of ferroptosis. High-glucose plus H2O2-induced senescent injury was used in H9c2 cells and primary rat cardiomyocytes, and aged diabetic cardiomyopathy was modeled in aged rats by high-fat diet plus streptozotocin with continued high-fat diet; outcomes included senescence/ferroptosis markers, transcriptome sequencing, and cardiac function, with gene-pathway analysis. VCAM-1+ MSCs or their exosomes reduced mitochondrial damage, iron accumulation, ROS, senescence features, ferroptosis, and improved cardiac function, with reparative effects of VCAM-1+ MSC exosomes superior to conventional MSC exosomes and mechanistic inhibition of Ras/Raf/MEK/ERK/c-FOS pathway activation. The paper does not explicitly state key limitations in the provided text and is presented as a Research Square preprint. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: The cardiac dysfunction in elderly diabetes, resulting from the superimposition of age-related myocardial senescence and diabetes-induced myocardial injury, is difficult to intervene and lacks effective therapeutic strategies. Recent studies have revealed that ferroptosis may be a key mechanism underlying cardiomyocyte injury in diabetic cardiomyopathy. Mesenchymal stem cells (MSCs) and their secreted exosomes have shown potential in promoting cardiomyocyte repair, restoring cardiac function, improving insulin sensitivity, and mitigating diabetes-related complications. MSCs or their secreted exosomes may promote the repair of cardiomyocytes and the recovery of cardiac function, while also improving insulin sensitivity and alleviating the damage of diabetic complications. However, the mechanisms of actions of MSCs and -derived exosomes, as well as their relationship with ferroptosis, remain unclear. Methods: The model of high-glucose-damaged senescent cardiomyocytes was established by continuously culturing H9c2 cells or primary rat cardiomyocytes in a high-glucose condition, combined with H₂O₂ induction. And, the animal model of diabetic cardiomyopathy in aged rats was established by high-fat diet feeding combined with streptozotocin (STZ) administration, and followed keeping on high-fat diet. The cell model and animal model were administrated with VCAM-1⁺ MSCs derived exosomes, subsequently, the cell phenotypes, transcriptome sequencing, cardiac function, and the expression of genes related to senescence and ferroptosis were assessed. Results: In high-glucose-damaged senescent H9c2 cells and primary cardiomyocytes, as well as in myocardial tissues from rats with aged diabetic cardiomyopathy, mitochondrial damage, iron-ion accumulation, and reactive oxygen species (ROS) were significantly elevated, accompanied with weakened cardiac function and pronounced features of senescence and ferroptosis. After intervention with VCAM-1⁺ MSCs or their exosomes, the degree of cardiomyocyte injury, senescence, and ferroptosis was alleviated, leading to improved cardiac function. In injury senescent diabetic cardiomyocytes and myocardial tissue, Ras/Raf/MEK/ERK/c-FOS pathway was activated, while MSC-derived exosomes treatment significantly inhibited this pathway activation. Notably, the reparative effect of VCAM-1⁺ MSCs-derived exosomes on myocardial injury was superior to that of conventional MSCs-derived exosomes. Conclusion: Exosomes derived from VCAM-1+ MSCs attenuate cardiomyocyte ferroptosis via suppression of Ras/Raf/MEK/ERK/c-FOS pathway, thereby ameliorating myocardial injury resulting from superimposition of ageing-caused myocardial senescence and diabetes-induced myocardial damage in elderly diabetic cardiomyopathy.
Full text 181,426 characters · extracted from preprint-html · click to expand
Reparative Effects of VCAM-1 High-Performance MSC-derived Exosomes on Aged Diabetic Cardiomyocyte Injury: A Focus on Ferroptosis Suppression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Reparative Effects of VCAM-1 High-Performance MSC-derived Exosomes on Aged Diabetic Cardiomyocyte Injury: A Focus on Ferroptosis Suppression Xiaoyang Yin, Yimeng Wei, Yu Liu, Gang Chen, Jing Chen, Jie Cheng, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6195440/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The cardiac dysfunction in elderly diabetes, resulting from the superimposition of age-related myocardial senescence and diabetes-induced myocardial injury, is difficult to intervene and lacks effective therapeutic strategies. Recent studies have revealed that ferroptosis may be a key mechanism underlying cardiomyocyte injury in diabetic cardiomyopathy. Mesenchymal stem cells (MSCs) and their secreted exosomes have shown potential in promoting cardiomyocyte repair, restoring cardiac function, improving insulin sensitivity, and mitigating diabetes-related complications. MSCs or their secreted exosomes may promote the repair of cardiomyocytes and the recovery of cardiac function, while also improving insulin sensitivity and alleviating the damage of diabetic complications. However, the mechanisms of actions of MSCs and -derived exosomes, as well as their relationship with ferroptosis, remain unclear. Methods: The model of high-glucose-damaged senescent cardiomyocytes was established by continuously culturing H9c2 cells or primary rat cardiomyocytes in a high-glucose condition, combined with H₂O₂ induction. And, the animal model of diabetic cardiomyopathy in aged rats was established by high-fat diet feeding combined with streptozotocin (STZ) administration, and followed keeping on high-fat diet. The cell model and animal model were administrated with VCAM-1⁺ MSCs derived exosomes, subsequently, the cell phenotypes, transcriptome sequencing, cardiac function, and the expression of genes related to senescence and ferroptosis were assessed. Results: In high-glucose-damaged senescent H9c2 cells and primary cardiomyocytes, as well as in myocardial tissues from rats with aged diabetic cardiomyopathy, mitochondrial damage, iron-ion accumulation, and reactive oxygen species (ROS) were significantly elevated, accompanied with weakened cardiac function and pronounced features of senescence and ferroptosis. After intervention with VCAM-1⁺ MSCs or their exosomes, the degree of cardiomyocyte injury, senescence, and ferroptosis was alleviated, leading to improved cardiac function. In injury senescent diabetic cardiomyocytes and myocardial tissue, Ras/Raf/MEK/ERK/c-FOS pathway was activated, while MSC-derived exosomes treatment significantly inhibited this pathway activation. Notably, the reparative effect of VCAM-1⁺ MSCs-derived exosomes on myocardial injury was superior to that of conventional MSCs-derived exosomes. Conclusion: Exosomes derived from VCAM-1 + MSCs attenuate cardiomyocyte ferroptosis via suppression of Ras/Raf/MEK/ERK/c-FOS pathway, thereby ameliorating myocardial injury resulting from superimposition of ageing-caused myocardial senescence and diabetes-induced myocardial damage in elderly diabetic cardiomyopathy. VCAM-1 High-Performance MSC Exosomes Myocardial injury Elderly diabetes mellitus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Background Diabetes mellitus is a serious health issue that affects approximately 537 million people worldwide, with type 2 diabetes accounting for more than 90% of cases. With the accelerating global population aging, elderly diabetes, particularly type 2 diabetes, has become a major public health concern worldwide 1 . The pathological physiology and metabolic disorders associated with aging significantly increase the incidence of diabetes. Additionally, age-related declines in the structure and function of various organ systems make elderly individuals with diabetes more susceptible to complications such as cardiovascular disease, nephropathy, retinopathy, and neuropathy 2 . Among these complications, diabetic cardiomyopathy is one of the leading causes of mortality in diabetic patients. However, the underlying pathological mechanisms of diabetic cardiomyopathy remain incompletely understood. Diabetic cardiomyopathy is a unique cardiac disease in diabetic patients, independent of other cardiovascular conditions such as hypertension and coronary artery disease3,4. It is characterized by structural and functional abnormalities of the heart, including myocardial fibrosis, myocardial hypertrophy, and ventricular dysfunction. During aging, myocardial structure and function undergo progressive decline, with reduced adaptability to environmental and stress-related challenges5. In the presence of diabetes, hyperglycemia, and insulin resistance contribute to myocardial metabolic disorders, mitochondrial dysfunction, interstitial fibrosis, and coronary microvascular disease, further exacerbating myocardial structural damage and functional impairment6,7. This combination of age-related myocardial deterioration and diabetes-induced myocardial injury leads to cardiac dysfunction or failure, resulting in elderly diabetic cardiomyopathy. Currently, the cardiac dysfunction caused by the interplay between age-related myocardial aging and diabetic myocardial injury in elderly diabetic patients remains difficult to manage, with no effective intervention strategies available. Ferroptosis is an iron-dependent form of programmed cell death characterized by accumulating reactive oxygen species (ROS) and increased lipid peroxidation. Recent studies have demonstrated that ferroptosis is involved in the pathogenesis of various diseases and plays a crucial role in multiple cellular activities and pathophysiological processes, including neurodegenerative diseases, cardiovascular diseases, cancer, and ischemia-reperfusion injury. Research has shown that in the cardiovascular system, ferroptosis is closely associated with ischemic or drug-induced cardiomyopathy, atherosclerosis, and acute renal failure8,9. In diabetic patients, hyperglycemia, insulin resistance, and metabolic disorders exacerbate oxidative stress in cardiomyocytes. Persistent oxidative stress damages cardiomyocytes, leading to cardiac dysfunction, while also serving as a key trigger for ferroptosis10. In diabetes, myocardial iron accumulation, mitochondrial dysfunction, and elevated oxidative stress levels activate the ferroptosis pathway. Ferroptosis is considered a critical mechanism of cellular damage in diabetic cardiomyopathy, contributing to cardiomyocyte injury, myocardial hypertrophy, fibrosis, and cardiac dysfunction11. Moreover, in elderly diabetic patients, the aging process and the senescence-associated secretory phenotype (SASP) of senescent cardiomyocytes contribute to myocardial dysfunction and fibrosis12. Senescent cardiomyocytes downregulate the expression of antioxidant proteins such as SLC7A11 and GPX413, thereby activating or exacerbating ferroptosis. In turn, ferroptosis further promotes oxidative stress and impairs the cellular antioxidant defense system through iron ion accumulation and lipid peroxidation, accelerating cardiomyocyte aging. Recent studies have partially elucidated the role and molecular mechanisms of ferroptosis in diabetic cardiomyopathy. However, current research remains in its early stages, and the precise mechanisms underlying this process have yet to be fully understood. Mesenchymal stem cells (MSCs) are multipotent stem cells of mesodermal origin with self-renewal capacity and the potential to differentiate into multiple cell lineages. They exhibit strong immunomodulatory properties, migratory ability, antioxidative effects, and the capacity to reduce inflammatory responses, promote cell proliferation and differentiation, and facilitate tissue repair, all while maintaining low immunogenicity14. Due to their superior characteristics, broad availability, and regenerative potential, MSCs have been widely applied in clinical disease treatments. Our previous studies have demonstrated that, compared to conventional MSCs, highly active MSCs with high expression of vascular cell adhesion molecule-1 (VCAM-1, also known as CD106), induced by a specific combination of cytokines (IL-1β + IL-4 + IFN-γ) (VCAM-1⁺ UC-MSCs), exhibit enhanced proliferative and secretory capacities as well as superior hematopoietic reconstitution and immunomodulatory functions15. Moreover, VCAM-1⁺ MSCs more effectively repair myocardial and vascular damage in aged diabetic rats, thereby improving their cardiac function. However, the underlying mechanisms by which MSCs repair myocardial injury in aged diabetic models require further investigation. This translation maintains the academic tone and clarity required for a scientific manuscript. Extracellular vesicles (EVs), particularly exosomes derived from stem cells, serve as crucial mediators of intercellular communication. Due to their acellular nature, low immunogenicity, and excellent tissue permeability, exosomes have demonstrated significant advantages and potential in disease diagnosis, therapy, drug delivery, and regenerative medicine. Mesenchymal stem cell (MSC)-derived exosomes have been widely studied in experimental treatments for various diseases. Studies have shown that stem cell-derived exosomes promote cardiomyocyte repair and restore cardiac function16,17, reduce post-myocardial infarction scar formation, and have the potential to improve insulin sensitivity and mitigate complications associated with diabetes. In neurodegenerative diseases, stem cell-derived exosomes facilitate neuronal regeneration and suppress inflammatory responses18. Similarly, in osteoarthritis and cartilage injuries, these exosomes enhance chondrocyte proliferation, stimulate extracellular matrix synthesis, and promote tissue repair19,20. Moreover, research suggests that VCAM-1⁺ stem cells possess enhanced pro-angiogenic capacity, superior immunomodulatory properties, and improved homing ability21. VCAM-1⁺ MSCs have been shown to protect against neuronal damage caused by ischemic stroke in rats by inhibiting apoptosis22. Additionally, injured cardiomyocytes can rapidly mobilize splenic neutrophils by generating and releasing VCAM-1⁺ extracellular vesicles23. Based on the advantages and characteristics of VCAM-1⁺ MSCs and MSC-derived exosomes, as well as the potential significant roles of ferroptosis in aged diabetic myocardial injury, we constructed cellular and animal models of aged diabetic cardiomyopathy to elucidate the mechanisms of ferroptosis underlying aged diabetic myocardial injury, as well as to explore the protective and reparative mechanisms mediated by exosomes from VCAM-1⁺ MSC through the inhibition of ferroptosis in aged diabetic myocardial injury. Methods 3.1 Induction and Identification of VCAM-1⁺ UC-MSC The umbilical cord mesenchymal stem cells (UC-MSCs) were provided by the National Engineering Research Center of Cell Products/Tianjin Amcell Cell Gene Engineering Co., Ltd. UC-MSCs were maintained in complete DMEM/F12 medium containing 10% fetal bovine serum (FBS), 1% antibiotics, 1% glutamine, 2 ng/mL β-FGF, and 10 ng/mL EGF, cultured in cell incubator at 37°C, 5% CO₂, and saturated humidity. Induction of VCAM-1 + UC-MSCs: UC-MSCs from passages 3 to 6 were seeded at a density of 1 × 10⁵ cells/mL. When the cell confluence reached 30–40%, the culture medium was replaced with complete DMEM/F12 medium containing 10 ng/mL IL-1β, 10 ng/mL IL-4, and 20 ng/mL IFN-γ21. After 48 hours of continued culture, the cells were dissociated using 0.25% trypsin-EDTA. Identification of VCAM-1 + UC-MSCs: UC-MSCs and VCAM-1 + UC-MSCs were cultured as described above. Their adipogenic, osteogenic, and chondrogenic differentiation potentials and the respective regulatory genes were assessed according to the methods outlined in the literature. Additionally, the expression of VCAM-1, SDF-1, and other MSC markers (CD105, CD73, CD90, HLA-DR, CD34, CD11b, CD19, CD45) was examined. 3.2 Establishment of high-glucose-induced damage model of senescent cardiomyocytes The rat cardiomyocyte cell line H9c2 was purchased from Wuhan Pricella Biotechnology Co., Ltd. and cultured in DMEM medium supplemented with 10% FBS, 1% antibiotics, and 1% glutamine, at 37°C, 5% CO₂, and saturated humidity. To induce high glucose conditions, 50 mM glucose was added to the H9c2 culture medium, and cells were continuously cultured under these conditions for more than two months, referred to as GLU-H9c2. After that, GLU-H9c2 cells were cultured in serum-free medium supplemented with 100 mM H₂O₂ for 4 hours, followed by a change to complete DMEM medium containing 75 mM glucose and continued culture for 48 hours to establish the glucose-damaged senescent H9c2 cell model. In the MSC exosome intervention experiment, exosomes were co-cultured with the H9c2 cell model at a concentration of 10 µg/mL for 48 hours, followed by the corresponding assays. 3.3 Isolation of primary rat cardiomyocytes and establishment of injury cell model One to three days-old Sprague − Dawley (SD) neonatal rats were obtained from the Laboratory Animal Center of Lanzhou University. Hearts were harvested from 10–15 neonatal rats after humane euthanasia, and the myocardial tissue was cut into approximately 1 mm³ pieces. The cells were then dissociated using a myocardial tissue dissociation kit, followed by repeated digestion and cell collection. The collected cells were cultured in high-glucose DMEM medium containing 15% FBS and 1% glutamine at 37°C, 5% CO₂, and saturated humidity. Under microscopic observation, the primary cardiomyocytes exhibited rhythmic contraction. The cultured primary cardiomyocytes were passaged in high-glucose DMEM medium supplemented with 50 mM glucose. After high-glucose induction, the primary cardiomyocytes were cultured in serum-free DMEM medium containing 100 mM H₂O₂ for 4 hours, followed by replacement with complete DMEM medium containing 75 mM glucose and continued culture for 48 hours to establish the glucose-damaged senescent primary cardiomyocyte model. The MSC exosome intervention experiment was performed in the same manner as the H9c2 cell model described above. 3.4 Exosomes isolation and identification MSCs were cultured in a serum-free medium, MSC-conditioned medium was collected after 48 h of culture and centrifuged at 3000×g for 30 min to remove debris and cells. The supernatant was collected and transferred to a new sterile tube and centrifuged at 10,000×g for 20 min, followed by ultracentrifugation at 100,000 × g for 90 min at 4°C to obtain exosome pellets, which were resuspended in PBS and stored at -80°C. MSCs from passages 6 were used in the experiments. We used the BCA protein assay kit (PC0020; Solarbio, Beijing, China) to determine the protein content of the concentrated exosomes. Exosomes were identified by Western blot (WB) analysis of the marker proteins CD63, CD81 and TSG101. ZetaPALS (90Plus Pals; Brookhaven, USA) was performed to measure the size distribution of isolated particles released by MSCs. The morphology of exosomes was observed using a 200 kV refrigerated transmission electron microscope (Talos F200C, FEI, Czech). 3.5 Cell viability assay MTT was used to determine the effect of different concentrations of H2O2- and glucose-induced cell damage. After H9c2 cells were passaged stably, they were seeded into 96-well plates at a density 1 × 104 cells/well. H2O2 was added to the 96-well plate at increasing concentrations for 4 h and 6 h, glucose was added to the 96-well plate at increasing concentrations. After 24 h and 48 h, the cells were incubated with 100 µL of 1 × MTT for 4 h and then, 100 µL of 10% SDS was added to each well. Absorbance was measured at 570 nm. 3.6 Colony formation assay Transfected cells were collected and inoculated into a 6-well plate at a concentration of 1,000 cells /dish. The cell clones were cultured for 2 weeks until visible cell clones emerged. Fresh medium was replaced every 3 days. The cells were gently washed with PBS twice and fixed with 4% paraformaldehyde for 20 min at room temperature, and stained with crystal violet for 20 min at room temperature. Each cell clone on the dishes was counted and photographed triplicately. 3.7 EdU incorporation assay EdU Kit (C0071s, Beyotime, Shanghai, China) was used to apply the EdU incorporation assay (EdU). H9c2 cells were seeded into 12-well plates and cultured with EdU reagent (1:1000 dilution) for 2 h. Then, 4% paraformaldehyde was used to fix the cells, and fluorescent dye and Hoechst were used to stain cells. ImageJ software was used to count EdU-positive cells. 3.8 β-galactosidase activity assay Senescence-associated β-galactosidase activity was assessed in treated-H9c2 cells using the Senescence-associated β-galactosidase staining kit (C0602, Beyotime, Shanghai, China). 3.9 Iron ion determination The total iron content in cell and heart tissue lysate was determined using total iron Assay kit (G4301; Servicebio, Wuhan, China). 3.10 Immunoblots Total protein was extracted using RIPA lysis buffer containing 1% protease inhibitor, and the concentration of the extracted protein was measured using a BCA kit. Equal amounts of protein were separated on 12% SDS-PAGE gel and then transferred onto polyvinylidene fluoride membranes. After blockade with 5% skim milk for 1 h, the membranes were incubated with primary and HRP conjugated secondary antibodies and detected using an ECL detection system (Table 1 ). Band intensity was normalized against β-actin for quantification. 3.11 RNA isolation and real-time RT-PCR Total RNA was extracted from cells using Trizol reagent according to the manufacturer’s instructions, and 1µg of total RNA was reversely transcribed into cDNA using a Reverse Transcription Kit. Primers were synthesized by Tsingke Biotech (Xian, China) (Table 2 ). The cDNA was amplified and quantified using a Rotor-Gene 3000 realtime PCR system with SYBR Green (22204-01; TOLOBIO, China). mRNA expression levels were normalized to GAPDH levels. Relative mRNA expression levels were determined using the 2-△△Ct method. 3.12 Flow cytometry MSCs were characterized for their surface markers (CD73, CD90, CD106, CD31, CD34, CD105, CD45, HLA-DR, CD11b) by a flow cytometry (NovoCyte Quanteon; Agilent, Singaporean); Cells in G0/G1, G2/M and S phases were analyzed by flow cytometry, using Cell Cycle and Apoptosis Analysis Kit (C1052; Beyotime, Shanghai, China); Reactive oxygen species (ROS) activity within the cells was measured by Intracellular ROS Assay Kit (S0033S; Beyotime, Shanghai, China) according to the manufacturer’s guidelines. ROS level was measured by flow cytometry. All FACS data were analyzed using FlowJo Software 3.13 Animals and establishment of the aged rat T2DM model Eight week-old, SPF-grade male SD rats (200 − 220 g) were purchased from the Laboratory Animal Center, Lanzhou University. All animals were housed in a specific pathogen-free (SPF) level barrier system at the Medical Experiment Center of Basic Medical Sciences, Lanzhou University, with an optimal temperature of (24 ± 2°C), a controlled light cycle, and free access to food and water. Before the experiment, healthy rats were numbered and raised to 12 months of age. At the end of acclimatization, rats were tested for fasting plasma glucose (FPG), fasting insulin (FINS), calculated Insulin sensitivity index (ISI) and performed i. p. glucose tolerance test (IPGTT). The rats were randomly divided into 4 groups: control, diabetic (T2DM), T2DM + MSC-Exosomes (Exosome), and T2DM + VCAM-1 + MSC-Exosomes (VCAM-1 + exosome) group, with 6 rats in each group. Normal rats were fed normal diets. The diabetic rat model was established by high-fat feeding (HFD) for 6 weeks, after being fasted for 12 h with free access to water, HFD fed rats were intraperitoneally injected with STZ (30 mg/kg) in 0.1 M citrate buffered saline, pH 4.5 to induce T2DM. FPG, FINS, IPGTT were performed to confirm the establishment of the T2DM rat model. The rats showed fasting glucose levels of more than 16.7 mmol/L, which were considered to be T2DM rats. T2DM rats were kept on the high-fat diet for two weeks to induce myocardial injury. Rats in the exosome and VCAM-1 + exosome group were injected with a PBS buffer mixture of MSC-exosome or VCAM-1 + MSC-exosome (200 µg/rat, approximately 200–250 ul) via the tail vein, while the Control group and T2DM group were injected with the same amount of PBS. The injections were administered three times, with a one-week interval between each injection. One week after the final injection, a cardiac ultrasound was performed. Blood collection was performed in rats under anesthesia with 2% isoflurane. Rats were euthanized with an intraperitoneal injection of 150 mg/kg sodium pentobarbital (Shanghai New Asia Pharmaceutical Co., Ltd.) to ensure a humane and rapid termination. The death of the rats was confirmed by the absence of respiration, heartbeat, and corneal reflex. The heart tissue was excised, weighed, and either stored at -80°C or fixed for subsequent experiments. No specific exclusion criteria were established, and no rat were excluded from the study. Cardiac ultrasound examination was performed for 6 animals per group; western blot, RT-qPRC, immunostaining analysis were performed for 3 animals per group. All outcome assessments were conducted by experimenters who were blinded to group assignments All animal studies were carried out with the approval of the Laboratory Animal Ethics and Welfare Committee of School of Basic Medical Sciences of Lanzhou University following the ethical code of animal use. The animal study was reviewed and approved by Laboratory Animal Science and Technology Work Management Committee, School of Basic Medicine, Lanzhou University (Lzujcyxy20250309). 3.14 ELISA analysis ELISAs were performed to determine the levels of insulin (INS), triglyceride (TG), and Total Cholesterol (TC) in rat serum and the levels of IL-6, IL-8, TGF-β in both rat serum and cell culture supernatant using commercially available kits according to the manufacturer’s instructions. 3.15 Ultrasound echocardiography Ultrasound echocardiography was performed by using a Small Animals High Resolution Ultrasound Imaging System (S-sharp; Taiwan, China) in rat under anesthesia with 2% isoflurane (RWD Life Science Co., Guangdong, China). Before the cardiac ultrasound, the rats were anesthetized in a gas anesthesia chamber and then transferred to the operating table, where anesthesia was maintained using a mask. Local hair removal was performed, and the surgical anesthesia dose was sustained throughout both the hair removal and ultrasound procedures. After the ultrasound examination, blood was collected from the tail vein under anesthesia. The heart was examined in the long-axis view at the papillary muscle level and an M-mode echocardiogram of the mid ventricle was recorded. Analysis of echocardiographic images was performed in a blinded manner. Cardiac function indices including left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), end-diastolic left ventricular internal dimension (LVID; d), end-systolic left ventricular internal dimension (LVID; s), left ventricular end-diastolic volume (LVEDV), left ventricular end-systolic volume (LVESV), and left ventricular mass (LV mass). 3.16 Hematoxylin-eosin, Masson’s trichrome and Prussian Blue Iron staining The heart tissues were fixed in tissue fixation solution (G1101; Servicebio, Wuhan, China), gradually dehydrated, embedded in paraffin, cut into 4 µm sections, and subjected for hematoxylin-eosin, Masson’s trichrome and Prussian Blue Iron staining according to the manufacturer’s protocols. 3.17 Statistical Analysis Sample sizes were determined based on our previous studies using the same T2DM model. All data are presented as the mean ± standard deviation (SD). Multiple groups were analyzed using a one-way ANOVA. Differences were considered statistically significant if P < 0.05. Statistical analyses were performed using Graphpad Prism 9.0.0 software. The work has been reported in line with the ARRIVE guidelines 2.0. Results 4.1 Characteristics of VCAM-1 + MSCs and -derived exosomes UC-MSCs were induced using a specific combination of cytokines (IL-1β + IL-4 + IFN-γ) to generate VCAM-1⁺ UC-MSCs with high activity. Phenotypic characterization and comparison with UC-MSCs demonstrated that VCAM-1⁺ UC-MSCs showed heightened adipogenic, osteogenic, and chondrogenic differentiation potential, and high-expressed respective regulatory genes (Fig. 1 A). These cells expressed MSC surface markers CD105, CD73, and CD90 while lacking the expression of CD34, CD11b, CD19, CD45, and HLA-DR, consistent with the characteristics of UC-MSCs (Fig. 1 B). However, compared with UC-MSCs, VCAM-1⁺ UC-MSCs exhibited significantly higher expression of VCAM-1 (CD106) and CD31 (Fig. 1 C), along with a markedly elevated expression of the SDF-1 gene (Fig. 1 D). These findings suggest that VCAM-1⁺ UC-MSCs possess enhanced stemness maintenance, homing capacity, and tissue repair potential. Additionally, Migration assays, along with gene expression analyses related to vascular formation and immune-inflammatory responses, revealed that VCAM-1⁺ UC-MSCs exhibited strengthened migratory ability (Fig. 1 E) as well as superior immunoregulatory and pro-angiogenic functions (Fig. 1 F). Exosomes were isolated and extracted from UC-MSCs and VCAM-1⁺ UC-MSCs using differential ultracentrifugation. A comparative analysis of their morphology and phenotype revealed that exosomes derived from both UC-MSCs and VCAM-1⁺ UC-MSCs were spherical or near-spherical in shape and possessed a membrane structure (Fig. 2 B). Their particle size distribution ranged from 50 to 150 nm (Fig. 2 A), and they expressed the characteristic exosomal markers CD63, TSG101, and CD9 (Fig. 2 C), confirming their exosomal identity. Comparatively, exosomes derived from VCAM-1⁺ UC-MSCs exhibited a slightly smaller particle size but a higher particle count, suggesting that VCAM-1⁺ UC-MSCs have a greater capacity for exosome production and secretion. 4.2 High-glucose-injured senescent cardiomyocytes exhibit ferroptosis phenotypes To investigate the mechanisms underlying myocardial injury in elderly cases with diabetes and potential interventions, we established a glucose-damaged senescent model in H9c2 cardiomyocytes using hydrogen peroxide (H₂O₂) and high glucose (GLU) stimulation. After continuous induction with high GLU for more than two months, followed by additional stimulation with H₂O₂, H9c2 cell viability suppressed in a dose-dependent manner with increasing concentrations of H₂O₂ and GLU (Fig. 3 A). The cells exhibited reduced proliferation, decreased colony formation, and impaired migratory capacity (Fig. 3 E-G). Morphological changes included increased cell volume, elongated spindle-like, flattened, or irregular shapes, as well as rough cell edges, blebbing, and cytoplasmic vacuolation (Fig. 3 B). Additionally, β-galactosidase (β-gal) staining showed a significant increase in senescent cells (Fig. 3 C). Ultrastructural observations revealed that glucose-damaged senescent cells displayed mitochondrial swelling or shrinkage, cristae reduction or loss, and rupture or damage to the outer mitochondrial membrane (Fig. 4 C). Moreover, intracellular iron accumulation (Fig. 4 D) and reactive oxygen species (ROS) levels were markedly elevated (Fig. 4 B). Cell cycle analysis demonstrated that glucose-damaged senescent cardiomyocytes were arrested in the G0/G1 phase (Fig. 3 D). Expression levels of senescence-associated genes, including P21, P16, and P53, as well as ferritin, were significantly upregulated, whereas ferroptosis-related genes, GPX4 and SLC7A11, were notably downregulated (Fig. 3 H, Fig. 4 E-F). Primary rat cardiomyocytes subjected to high GLU combined with H₂O₂ showed similar changes (Fig. 3 B-H). These findings demonstrate that high glucose combined with H₂O₂ induces significant myocardial aging and injury, characterized by prominent ferroptotic features. This suggests that ferroptosis may be implicated in the pathogenesis of diabetic cardiomyopathy in elderly individuals. 4.3 Aged diabetic rats display ferroptosis-mediated myocardial injury property To investigate the mechanisms underlying myocardial dysfunction caused by aging-related myocardial senescence combined with diabetic myocardial injury in vivo, we established an aged diabetic cardiomyopathy (DCM) model using 12-month-old Sprague-Dawley (SD) rats. The model was induced by long-term high-fat diet (HFD) feeding combined with intraperitoneal injection of streptozotocin (STZ). Initially, naturally aging rats showed a evident increase in body weight upon HFD feeding. However, following STZ injection, they developed characteristic symptoms of diabetes, including polydipsia, polyuria, and polyphagia, accompanied by rapid weight loss, yellowish and dull fur, and severe hair loss. Aged diabetic rats exhibited random blood glucose levels of ≥ 16.7 mmol/L, decreased serum insulin levels, and significantly elevated total cholesterol and triglyceride levels (Fig. 5 E). The echocardiographic assessment revealed increased left ventricular end-diastolic diameter (LVEDD) and left ventricular end-systolic diameter (LVESD), along with reduced left ventricular ejection fraction (LVEF) (Fig. 5 C-D). Histological analysis of heart tissue using hematoxylin-eosin (HE) staining demonstrated disrupted and disorganized myocardial architecture with marked inflammatory cell infiltration (Fig. 5 A). Masson's trichrome staining revealed pronounced myocardial fibrosis (Fig. 5 B). Prussian blue staining indicated a raised number of iron-positive cardiomyocytes with a marked elevation in myocardial iron content (Fig. 5 G). As shown in Fig. 5 F, ferroptosis-related gene ferritin was substantially upregulated in the myocardial tissue of aged diabetic rats, while GPX4 and SLC7A11 were notably downregulated. Additionally, Nrf2 expression and its phosphorylation levels were elevated. These findings suggest that aged diabetic rats exhibit significant myocardial injury and cardiac dysfunction, with cardiomyocyte damage displaying prominent ferroptotic characteristics. 4.4 VCAM-1 + MSCs and -derived exosomes attenuates the high glucose-induced injury in senescent cardiomyocytes by inhibiting ferroptosis To investigate the repair effect of MSC and VCAM-1 + MSC on glucose-damaged senescent cardiomyocytes, indirect co-culture of MSC/VCAM-1 + MSC with H9c2 cell damage models was performed. After co-culturing, the H9c2 model cells showed morphology close to normal control cells, with reduced cell volume, decreased intracellular vacuoles, and increased cell number (Fig. 6 A). β-galactosidase staining positive cells were reduced (Fig. 6 B), and the expression levels of P53, P16, and P21 genes and proteins in cells were significantly downregulated (Fig. 6 C). These results indicate that UC-MSC and VCAM-1 + UC-MSC have a certain repair effect on glucose-damaged senescent cardiomyocytes, and the repair effect may be achieved through their secretory function. Compared with UC-MSC, VCAM-1 + UC-MSC exhibited more pronounced reparative effects. To further explore whether the therapeutic effects are mediated by secreted exosomes, exosomes were isolated and extracted from UC-MSC and VCAM-1 + UC-MSC, and co-cultured with glucose-damaged senescent H9c2 and primary cardiomyocytes. The results showed that after co-culture with exosomes, the morphology of glucose-damaged senescent cardiomyocytes significantly improved, and the cell number augmented (Fig. 7 A). β-galactosidase staining positive cells reduced (Fig. 7 B); the proportion of cells in the G0/G1 phase of the cell cycle suppressed, while the number of cells in the S and G2/M phases increased (Fig. 7 C); cell migration ability (Fig. 7 D), colony formation ability (Fig. 7 E) and proliferation ability (Fig. 7 F)were notably enhanced; expression levels of P53, P21, and P16, as well as P53 phosphorylation, suppressed (Fig. 7 H); IL-6 and IL-8 secretion by cells were reduced, while TGF-β secretion was elevated (Fig. 7 G), indicating a recovery in cell senescence and damage status. Compared with untreated glucose-damaged senescent H9c2 cells, the number of Prussian blue staining (iron staining) positive cells was reduced after exosome treatment (Fig. 8 A), and ultrastructural observation showed an increase in the number of mitochondrial cristae, with more organized arrangement and fewer instances of cristae swelling or rupture (Fig. 8 B); ROS release (Fig. 8 C) and iron ion content (Fig. 8 D) were reduced; the expression of the ferroptosis-regulatory gene Ferritin was downregulated, while the expression of GPX4 and SLC7A11 were significantly upregulated (Fig. 8 E, F). These comprehensive results demonstrate that MSC-derived exosomes have a notable ameliorative or reparative effect on senescent and glucose-damaged cardiomyocytes, with the mechanism of action being the inhibition of ferroptosis in the damaged cells. Compared to UC-MSC-derived exosomes, VCAM-1 + UC-MSC-derived exosomes exhibited a stronger potential to improve damaged cardiomyocytes. 4.5 VCAM-1 + MSCs-derived exosomes repair myocardial injury and improve cardiac function in aged diabetic rats To investigate the protective and reparative effects of MSC exosomes on age-related diabetic cardiomyopathy and exacerbated diabetic myocardial injury in elderly rats, UC-MSC and VCAM-1 + UC-MSC exosomes were isolated and extracted. The exosomes were administered to diabetic cardiomyopathy model rats via tail vein injection; a total of three injections were given at one-week intervals. After exosome treatment, the weight loss in the treated rats slowed significantly and even slightly reversed (Fig. 9 F). Random blood glucose levels were suppressed (Fig. 9 E). ELISA analysis showed an increase in serum insulin levels, while total cholesterol and triglyceride levels declined (Fig. 9 G). The levels of IL6 and IL8 decreased, whereas the TGF-β level increased (Fig. 9 I). After MSC exosome treatment, insulin resistance and inflammation were reduced in naturally aged diabetic cardiomyopathy rats. Echocardiographic assessment revealed a decrease in left ventricular wall thickness and an increase in EF value post-treatment (Fig. 9 C-D). Histological analysis through HE and Masson staining confirmed a significant reduction in myocardial inflammatory response (Fig. 9 A) and myocardial fibrosis (Fig. 9 B) following exosome treatment. Prussian blue staining demonstrated a reduction in the number of iron-positive cardiomyocytes (Fig. 9 H). Furthermore, the expression of the ferroptosis-regulatory protein ferritin was markedly downregulated, whereas the expression of SLC7A11 was markedly upregulated (Fig. 9 J). Compared to UC-MSC exosomes, VCAM-1 + UC-MSC exosomes demonstrated superior effects in reducing insulin resistance, inflammation, and in protecting the myocardium. Taken together, these results suggest that VCAM-1 + UC-MSC exosomes have therapeutic effects on elderly diabetic cardiomyopathy rats, promoting myocardial repair and restoring heart function. 4.6 Exosomes from VCAM-1 + UC-MSCs ameliorate high-glucose-induced senescent cardiomyocyte injury via Ras/Raf/ERK/MEK/FOS pathway To investigate the potential mechanisms through which MSC exosomes alleviate or repair myocardial injury caused by aging combined with diabetes, we performed transcriptome sequencing on glucose-damaged senescent H9c2 cells treated with VCAM-1 + UC-MSC exosomes. Differential pathway analysis of cell signaling pathways revealed that pathways related to oxidative stress and inflammation were activated in the glucose-damaged aging H9c2 cells (Fig. 10 C), with a total of 1943 differentially expressed genes. After intervention with VCAM-1 + UC-MSC exosomes, 263 differentially expressed genes were identified, with 17 genes showing reversed expression levels following exosome treatment (Fig. 10 D). Sequencing, RT-qPCR, and Western blot experiments confirmed that c-FOS mRNA and protein expression were notably upregulated in both the glucose-damaged aging H9c2 cells and primary rat cardiomyocytes (from diabetic cardiomyopathy tissues of aged diabetic rats), and were considerably reduced after exosome treatment (Fig. 10 E), suggesting that the c-FOS gene may play a key role in myocardial injury caused by aging combined with high glucose. In addition to the upregulation of c-FOS, the expression levels of Ras, Raf, MEK, and ERK were also elevated, and the phosphorylation levels of MEK and ERK were substantially increased, indicating the activation of the Ras/Raf/ERK/MEK/c-FOS signaling pathway in glucose-damaged senescent cardiomyocytes. After treatment with VCAM-1 + UC-MSC exosomes, the expression of Ras, Raf, MEK, ERK, and c-FOS was markedly reduced, and the phosphorylation levels of MEK and ERK were decreased (Fig. 10 F). This suggests that MSC exosomes can significantly inhibit the activation of the Ras/Raf/ERK/MEK/c-FOS pathway in injured cardiomyocytes, thereby slowing or repairing myocardial damage caused by aging combined with high glucose, and improving heart function. Discussion Aging-related myocardial deterioration, compounded by diabetic myocardial injury, leads to progressive cardiac dysfunction that remains difficult to manage, with no effective intervention strategies currently available. Given the advantages and characteristics of VCAM-1⁺ UC-MSCs and their exosomes, this study established both cellular and animal models of myocardial injury in elderly diabetic subjects to investigate ferroptosis and the protective and reparative mechanisms of MSC-derived exosomes. Our findings demonstrated that myocardial injury resulting from aging combined with diabetes exhibits significant characteristics of ferroptosis. Treatment with VCAM-1⁺ UC-MSCs or their exosomes effectively alleviated myocardial damage, cellular senescence, and ferroptosis, leading to improved cardiac function. Furthermore, myocardial cells subjected to aging-related diabetic injury exhibited activation of the Ras/Raf/MEK/ERK/c-FOS signaling pathway. VCAM-1⁺ UC-MSC-derived exosomes were found to mitigate ferroptosis by inhibiting this pathway, thereby repairing myocardial injury induced by the combined effects of aging and diabetes and improving cardiac function. These findings provide novel insights into the mechanisms underlying diabetic cardiomyopathy in aging populations and highlight the therapeutic potential of VCAM-1⁺ UC-MSC-derived exosomes in the treatment of myocardial dysfunction associated with aging and diabetes. The process of organismal aging is characterized by the progressive decline of myocardial structure and function, accompanied by a reduced capacity to withstand environmental stress. In the presence of diabetes, hyperglycemia and insulin resistance further contribute to myocardial metabolic dysregulation 7 , 24 , interstitial fibrosis, and coronary microvascular dysfunction, exacerbating myocardial structural damage and functional impairment. The combined effects of aging-related myocardial deterioration and diabetes-induced myocardial injury can lead to cardiac dysfunction or failure, ultimately resulting in diabetic cardiomyopathy in the elderly. The pathogenesis of this condition is complex and remains incompletely understood. Ferroptosis is a mode of cell death dependent on phospholipid peroxidation and regulated by multiple metabolic events. It plays a critical role in various organ injuries and degenerative diseases. Studies have shown that ferroptosis contributes to ischemia- or drug-induced cardiomyopathy, acute renal failure, and atherosclerosis25. Notably, ferroptosis inhibitors have been found to considerably reduce cardiomyocyte death and alleviate myocardial tissue damage and functional impairment8,9. Our study reveals significant iron accumulation, mitochondrial structural and functional damage, oxidative stress, and elevated lipid peroxidation in glucose-damaged senescent cardiomyocytes and myocardial tissues of aged rats with diabetic cardiomyopathy (DCM). These changes are accompanied by increased ferritin expression and markedly decreased levels of GPX4 and SLC7A11. This phenotype of aging combined with glucose-induced damage exhibits distinct characteristics of ferroptosis, suggesting that cardiomyocyte ferroptosis may be a key mechanism underlying aged diabetic cardiomyopathy. During cellular senescence, a series of metabolic and functional alterations occur, including redox imbalance, elevated oxidative stress, and promotion of inflammatory responses and lipid peroxidation26. The accumulation of lipid peroxides, along with pro-inflammatory cytokines such as TNF-α and IL-1β, further accelerates cellular aging while disrupting iron metabolism, leading to intracellular iron accumulation and ferroptotic cell death. Additionally, oxidative stress, inflammatory factors, and hyperglycemic conditions in diabetes induce the upregulation of the transcription factor c-Fos, which regulates the expression of genes related to iron metabolism and ferroptosis, thereby affecting intracellular iron accumulation and cellular sensitivity to ferroptosis27,28. Moreover, potentiated c-Fos expression may exacerbate cellular injury by modulating inflammatory cytokine expression. Our findings further confirm that in both glucose-damaged senescent cardiomyocyte injury models and myocardial tissues of aged diabetic cardiomyopathy rats, c-Fos is significantly upregulated, while oxidative stress, inflammatory responses, iron metabolism dysregulation, and insulin resistance are activated. These results suggest that in myocardial injury caused by aging combined with high glucose exposure, c-Fos exacerbates cardiomyocyte susceptibility to ferroptosis by modulating oxidative stress, inflammatory responses, and iron metabolism, ultimately leading to cardiomyocyte damage. MSCs exhibit strong immunomodulatory properties, high migratory capacity, antioxidative effects, and the ability to reduce inflammatory responses, promote cell proliferation and differentiation, and facilitate tissue repair29. Given these advantageous characteristics, MSCs hold great potential for clinical disease treatment and tissue regeneration. However, MSCs are a heterogeneous cell population, and their functionality and therapeutic efficacy vary significantly depending on their source. Moreover, MSC transplantation faces challenges such as low survival rates, limited homing ability, and weak engraftment and repair capabilities for damaged tissues. The mechanisms underlying MSC function are complex. Besides their multilineage differentiation potential, MSCs primarily exert their effects through paracrine mechanisms, including the secretion of cytokines and exosomes. However, the functions and regulatory mechanisms of cytokines and exosomes secreted by MSCs in different microenvironments remain not fully understood. Given their significant advantages and potential, MSC-derived exosomes have been widely explored in disease diagnosis, therapy, drug delivery, and regenerative medicine30. Nonetheless, due to the heterogeneity of MSCs from different donors and tissue sources, as well as variations in preparation techniques, MSC-derived exosomes exhibit substantial differences in morphology, surface markers, cargo composition, and biological functions. Additionally, their in vivo distribution, enrichment in target tissues, and stability are difficult to precisely control. Exosomes primarily exert their effects through multiple pathways and targets via their encapsulated bioactive components, including non-coding RNAs, DNA, RNA, and proteins31. However, the complexity of exosomal cargo contributes to their functional diversity and, in some cases, even opposing effects. The mechanisms underlying their functions remain intricate and insufficiently studied. MSCs expressing high levels of VCAM-1 were induced using a specific combination of cytokines (IL-1β + IL-4 + IFN-γ). These VCAM-1 + UC-MSCs exhibit enhanced proliferative and secretory capacities and possess stronger hematopoietic reconstruction and immune regulatory functions15. Importantly, they effectively repaired myocardial and vascular damage in aged diabetic rats, leading to improved cardiac function. To investigate the mechanism underlying the repair of myocardial injury by VCAM-1 + UC-MSCs, we isolated and prepared exosomes from VCAM-1 + UC-MSCs, co-cultured them with high-glucose-induced senescent cardiomyocytes, and treated aged diabetic cardiomyopathy rats. The results demonstrated that intervention with VCAM-1 + MSC-derived exosomes significantly reduced myocardial injury, cellular senescence, and ferroptosis while promoting myocardial tissue repair and improving cardiac function. Compared with UC-MSC-derived exosomes, VCAM-1 + MSC-derived exosomes exhibited stronger myocardial repair capacity, greater inhibition of ferroptosis, and more pronounced suppression of c-FOS expression. These findings suggest that VCAM-1 + MSC-derived exosomes possess potent therapeutic effects in repairing aging- and diabetes-related myocardial injury. Further investigation into the molecular mechanisms underlying these effects is warranted to provide a more comprehensive understanding and inform potential therapeutic strategies. Our study confirmed that VCAM-1 + UC-MSCs not only highly express VCAM-1 but also exhibit elevated expression of stromal cell-derived factor-1 (SDF-1). Notably, injured tissues often show high expression of C-X-C chemokine receptor type 4 (CXCR4)32. The interaction between SDF-1 and its receptor CXCR4 facilitates the directed migration and homing of MSCs to the site of tissue injury. Additionally, SDF-1 plays a crucial role in maintaining MSC stemness and preserving their regenerative potential. VCAM-1 can bind to integrins α4β1 and α4β7, mediating the adhesive properties of cells. The high expression of VCAM-1 on MSCs facilitates their engraftment at sites of tissue injury. The high viability and regenerative capacity of VCAM-1 + UC-MSCs are closely associated with their upregulated expression of VCAM-1 and SDF-1. Specifically, SDF-1 guides MSC migration toward injured tissues, while VCAM-1 enhances their adhesion and engraftment, working synergistically to promote tissue repair. Furthermore, exosomes derived from VCAM-1 + UC-MSCs are presumed to contain not only the conventional bioactive components of UC-MSCs but also high levels of VCAM-1 and SDF-1. These exosomes accumulate at the injury site, which further facilitates the migration, adhesion, and colonization of MSCs to the injured tissues, thereby enhancing the repair function. This may be the reason why VCAM-1 + UC-MSC-derived exosomes exhibit superior myocardial repair capabilities. However, further in-depth studies are needed to verify this hypothesis. The heterogeneity of MSC-derived exosomes and the complexity of their cargo contribute to their diverse functions and mechanisms of action, leading to a significant gap in the understanding of their precise biological effects. In our study, myocardial injury caused by aging and diabetes activated ferroptosis, accompanied by increased expression of Ras, Raf, MEK, ERK, and c-Fos, as well as significantly elevated phosphorylation levels of MEK and ERK. These findings suggest that the Ras/Raf/MEK/ERK/c-Fos signaling pathway is activated in myocardial cells under aging-related diabetic myocardial injury, and ferroptosis may be regulated by this pathway. Following treatment with VCAM-1⁺ UC-MSC exosomes, myocardial cell ferroptosis and activation of the Ras/Raf/MEK/ERK/c-Fos pathway were considerably inhibited. This indicates that MSC-derived exosomes suppress ferroptosis by modulating the Ras/Raf/MEK/ERK/c-Fos pathway, thereby mitigating myocardial injury and improving cardiac function. The Ras/Raf/MEK/ERK/c-Fos signaling pathway is one of the most critical intracellular signaling cascades, transmitting extracellular signals to the nucleus through a series of kinase activation events. It regulates the expression of genes involved in various cellular processes, such as cell proliferation, differentiation, death, cell cycle, metabolism, oxidative stress, and inflammatory responses33. In aging-related diabetic cardiomyopathy, inflammatory factors associated with the aging phenotype and the hyperglycemic environment activate myocardial cell receptor tyrosine kinases, leading to the activation of Ras and Raf. Subsequently, phosphorylated MEK activates ERK, which enters the nucleus to phosphorylate c-Fos, and binds with c-Jun to form the AP-1 complex. This complex regulates genes associated with redox balance, iron metabolism, and ferroptosis, thereby activating ferroptosis and causing myocardial cell damage. MSC-derived exosomes may inhibit the activation of the Ras/Raf/MEK/ERK/c-Fos pathway in aging-injured myocardial cells via specific cellular components or cytokines, thereby suppressing ferroptosis and improving aging-related diabetic myocardial injury and cardiac function. Furthermore, exosomes derived from VCAM-1 + UC-MSCs may further enhance MSC homing and colonization at injury sites through their high levels of VCAM-1 and SDF-1, thereby boosting the reparative effects of MSCs. A notable limitation of the present study is the lack of comprehensive characterization of the bioactive constituents within exosomes derived from VCAM-1⁺ MSCs, particularly regarding the enrichment of VCAM-1 and SDF-1 and their potential roles in mediating myocardial repair by MSCs. These aspects warrant further investigation and will be prioritized in our subsequent research endeavors. In summary, our study has demonstrated that VCAM-1⁺ MSC-derived exosomes mitigate cardiomyocyte ferroptosis by inhibiting the Ras/Raf/MEK/ERK/c-FOS pathway, and subsequently repair the myocardial injury resulting from the superimposition of ageing-caused myocardial degeneration and diabetes-induced myocardial damage in elderly diabetic cardiomyopathy, hereby ameliorating cardiac function. This study lays a foundation for further elucidating the ferroptosis mechanisms of myocardial injury in elderly diabetic cardiomyopathy and for identifying potential strategies and targets utilizing MSCs and their exosomes in the prevention and treatment of myocardial injury in this context. Conclusion This study demonstrates that VCAM-1⁺ MSCs-derived exosomes effectively attenuate cardiomyocyte ferroptosis via suppressing the Ras/Raf/MEK/ERK/c-FOS signaling pathway, thereby ameliorating myocardial injury caused by the superimposed confluence of age-related myocardial senescence and diabetic detrimental effects in elderly diabetes mellitus, which lays a foundation for identifying potential prevention and treatment strategies and targets of MSCs and -derived exosomes on myocardial injury. Abbreviations Abbreviation Full Term MSCs Mesenchymal stem cells STZ streptozotocin ROS reactive oxygen species SASP senescence-associated secretory phenotype VCAM-1 vascular cell adhesion molecule-1 EVs extracellular vesicles UC-MSCs umbilical cord mesenchymal stem cells FBS fetal bovine serum SD rats Sprague-Dawley rats HFD high-fat diet INS insulin TG triglyceride TC Total Cholesterol H₂O₂ hydrogen peroxide GLU glucose β-gal β-galactosidase LVEDD left ventricular end-diastolic diameter LVESD left ventricular end-systolic diameter LVEF left ventricular ejection fraction HE hematoxylin-eosin SDF-1 stromal cell-derived factor-1 CXCR4 C-X-C chemokine receptor type 4 Declarations Ethics approval and consent to participate In this study, the UC-MSCs derived from infant umbilical cord (UC) tissue were provided by the National Engineering Research Center of Cell Products/Tianjin Amcell Gene Engineering Co., Ltd. The procurement and use of UC tissue has been ethically approved by the National Engineering Research Center of Cell Products Administration, and informed consent was obtained from all volunteer donors. The study involving the establishment of an aging type 2 diabetic rat model and exosome-based treatment were conducted in strict adherence to the Guidelines for Ethical Review of Laboratory Animal Welfare (GB/T 35892-2018). The animal study was reviewed and approved by Laboratory Animal Science and Technology Work Management Committee, School of Basic Medicine, Lanzhou University (No. Lzujcyxy20240219, Title: Establishment of an Aged Type 2 Diabetic Rat Model and Investigation of Exosome Therapy; Data of approval: Feb 20, 2024). Consent for publication All authors have read and approved the final version of the manuscript and consent to its publication. Data availability The raw data of this study are available from the corresponding author on reasonable request. Competing interests All authors declare that they have no competing interests. Fundings This work was supported by the Natural Science Foundation of China (82200326), the Gansu Provincial Youth Science and Technology Fund (22JR5RA939), and the Joint Collaborative Research Project Commissioned by The First Hospital of Lanzhou University (2022620005002181, 2022620005002182) Authors' contributions XYY, YMW and YL contributed equally to this work and are considered co-first authors. XYY and YMY conceived and designed the study. XYY and YL performed the experiments. YL, GC and JC contributed to data analysis and interpretation. JC and YML provided technical support. HLW and YMW supervised the study, provided funding and revised the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors declare that they have not use AI-generated work in this manuscript Authors' information (optional) Not applicable References World Health Organization. Global Burden of Disease 2021: Findings from the GBD 2021 Study | Institute for Health Metrics and Evaluation. https://www.healthdata.org/research-analysis/library/global-burden-disease-2021-findings-gbd-2021-study (2024). Demir, S., Nawroth, P. P., Herzig, S. & Ekim Üstünel, B. Emerging Targets in Type 2 Diabetes and Diabetic Complications. Adv Sci (Weinh) 8 , 2100275 (2021). Rubler, S. et al. New type of cardiomyopathy associated with diabetic glomerulosclerosis. Am J Cardiol 30 , 595–602 (1972). Kannel, W. B., Hjortland, M. & Castelli, W. P. Role of diabetes in congestive heart failure: the Framingham study. Am J Cardiol 34 , 29–34 (1974). Palmer, A. K., Gustafson, B., Kirkland, J. L. & Smith, U. Cellular senescence: at the nexus between ageing and diabetes. Diabetologia 62 , 1835–1841 (2019). Wu, S. et al. Hyperglycemia-Driven Inhibition of AMP-Activated Protein Kinase α2 Induces Diabetic Cardiomyopathy by Promoting Mitochondria-Associated Endoplasmic Reticulum Membranes In Vivo. Circulation 139 , 1913–1936 (2019). Palmer, A. K. et al. Targeting senescent cells alleviates obesity‐induced metabolic dysfunction. Aging Cell 18 , e12950 (2019). Gao, M., Monian, P., Quadri, N., Ramasamy, R. & Jiang, X. Glutaminolysis and Transferrin Regulate Ferroptosis. Mol Cell 59 , 298–308 (2015). Fang, X. et al. Ferroptosis as a target for protection against cardiomyopathy. Proc Natl Acad Sci U S A 116 , 2672–2680 (2019). Yu, Y. et al. Ferroptosis: a cell death connecting oxidative stress, inflammation and cardiovascular diseases. Cell Death Discov. 7 , 193 (2021). Fang, X. et al. Loss of Cardiac Ferritin H Facilitates Cardiomyopathy via Slc7a11-Mediated Ferroptosis. Circ Res 127 , 486–501 (2020). Marino, F. et al. Diabetes-Induced Cellular Senescence and Senescence-Associated Secretory Phenotype Impair Cardiac Regeneration and Function Independently of Age. Diabetes 71 , 1081–1098 (2022). Liu, Y., Wan, Y., Jiang, Y., Zhang, L. & Cheng, W. GPX4: The hub of lipid oxidation, ferroptosis, disease and treatment. Biochim Biophys Acta Rev Cancer 1878 , 188890 (2023). Lomax, G. & McNab, A. Harmonizing Standards and Coding for hESC Research. Cell Stem Cell 2 , 201–202 (2008). Liu, S. et al. Highly Purified Human Extracellular Vesicles Produced by Stem Cells Alleviate Aging Cellular Phenotypes of Senescent Human Cells. Stem Cells 37 , 779–790 (2019). Zhang, Z. et al. Mesenchymal Stem Cells Promote the Resolution of Cardiac Inflammation After Ischemia Reperfusion Via Enhancing Efferocytosis of Neutrophils. J Am Heart Assoc 9 , e014397 (2020). Vagnozzi, R. J. et al. An acute immune response underlies the benefit of cardiac stem cell therapy. Nature 577 , 405–409 (2020). Riazifar, M. et al. Stem Cell-Derived Exosomes as Nanotherapeutics for Autoimmune and Neurodegenerative Disorders. ACS Nano 13 , 6670–6688 (2019). Piñeiro-Ramil, M., Gómez-Seoane, I., Rodríguez-Cendal, A. I., Fuentes-Boquete, I. & Díaz-Prado, S. Mesenchymal stromal cells-derived extracellular vesicles in cartilage regeneration: potential and limitations. Stem Cell Res Ther 16 , 11 (2025). Rahbaran, M. et al. Therapeutic utility of mesenchymal stromal cell (MSC)-based approaches in chronic neurodegeneration: a glimpse into underlying mechanisms, current status, and prospects. Cell Mol Biol Lett 27 , 56 (2022). Wei, Y. et al. High‐efficient generation of VCAM‐1+ mesenchymal stem cells with multidimensional superiorities in signatures and efficacy on aplastic anaemia mice. Cell Prolif 53 , e12862 (2020). Zhang, X. et al. VCAM-1+ hUC-MSCs Exert Considerable Neuroprotection Against Cerebral Infarction in Rats by Suppression of NLRP3-Induced Pyroptosis. Neurochem Res 48 , 3084–3098 (2023). Akbar, N. et al. Rapid neutrophil mobilization by VCAM-1+ endothelial cell-derived extracellular vesicles. Cardiovasc Res 119 , 236–251 (2022). Ogrodnik, M. et al. Cellular senescence drives age-dependent hepatic steatosis. Nat Commun 8 , 15691 (2017). Sun, D.-Y. et al. Pro-ferroptotic signaling promotes arterial aging via vascular smooth muscle cell senescence. Nat Commun 15 , 1429 (2024). Calcinotto, A. et al. Cellular Senescence: Aging, Cancer, and Injury. Physiological Reviews 99 , 1047–1078 (2019). He, Y. et al. Butyrate reverses ferroptosis resistance in colorectal cancer by inducing c-Fos-dependent xCT suppression. Redox Biol 65 , 102822 (2023). C-FOS inhibition promotes pancreatic cancer cell ferroptosis by transcriptionally regulating the expression of SLC7A11 | Functional & Integrative Genomics. https://link.springer.com/article/10.1007/s10142-024-01429-5. Mesenchymal stem/stromal cells in cancer therapy - PMC. https://pmc.ncbi.nlm.nih.gov/articles/PMC8596342/. Tan, F. et al. Clinical applications of stem cell-derived exosomes. Signal Transduct Target Ther 9 , 17 (2024). Colombo, M., Raposo, G. & Théry, C. Biogenesis, Secretion, and Intercellular Interactions of Exosomes and Other Extracellular Vesicles. Annual Review of Cell and Developmental Biology 30 , 255–289 (2014). Teicher, B. A. & Fricker, S. P. CXCL12 (SDF-1)/CXCR4 pathway in cancer. Clin Cancer Res 16 , 2927–2931 (2010). Chang, F. et al. Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia 17 , 1263–1293 (2003). Tables Table 1. Antibodies used for Immunoblots. (Materials and Methods-3.10) Antibody Dilution Company β-actin 1:1000 Servicebio GAPDH 1:1000 Servicebio SDF-1 1:1000 BOSTER CD9 1:1000 UpingBio CD81 1:1000 UpingBio TSG101 1:1000 UpingBio p16 1:1000 Absea p53 1:1000 Abmart Phospho-p53 1:1000 Abmart p21 1:1000 Abways Nrf2 1:1000 Immunoway Phospho-Nrf2 1:1000 Immunoway SLC7A11 1:1000 BOSTER GPX4 1:1000 Servicebio c-FOS 1:1000 Abcam Ferritin 1:1000 Abmart MEK1/2 1:1000 Abcam Phospho-MEK1/2 1:1000 Affinity ERK1+ERK2 1:1000 Abcam Phospho-ERK1+ERK2 1:1000 Abcam Ras 1:1000 Abcam A-Raf 1:1000 Immunoway Phospho-A-Raf 1:1000 Immunoway HRP, Goat anti-Rat IgG 1:5000 Servicebio HRP, Goat anti-Rabbbit IgG 1:5000 Servicebio Table 2. Primer sequence. (Materials and Methods-3.11) Gene Forward sequence Reverse sequence GAPDH CAAGTTCAACGGCACAGTCAAGG ACATACTCAGCACCAGCATCACC P16 ACCAGTTCGGGAGGCAGGAG CACAGTGGGTGGGCATCGTC P53 AGATGTTCCGAGAGCTGAATGAGG AGGCTGGAGGCTGGAGTGAG P21 ACCAGTTCGGGAGGCAGGAG ACCTGCTGTGTCGAGAATATCCAAG SLC7A11 TCATCATCGGCACCGTCATCG CTCCACAGGCAGACCAGAACAC GPX4 ACCAGTTCGGGAGGCAGGAG CACAGTGGGTGGGCATCGTC c-Fos ACCATGTCAGGCGGCAGAG ATCTTATTCCTTTCCCTTCGGATTCTC TFR1 CGGAAGAGGCGGACAAGTCAG GCTGCTTGATGATGTCAGTGAACTC FTH1 AACCAGCGAGGTGGACGAATC GCCAGTTTGTGAAGTTCCAGTAGTG NCOA4 GAAGGGAAGGACAAGAATGGAATGC GGTGTCTTAGCGTGTTCTGTTAGC PRDX3 GCCTTTAGCACCAGTTCTTCATTCC ACTCTCCATTGACAACAGCAGTACC Supplementary Files AuthorChecklistFull.pdf DEGcombindednofiltered.xlsx FulllengthblotsgelsSupplementaryFigure.docx venndata.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6195440","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":433870037,"identity":"5f33e8e3-42f8-4c8f-8337-d0b6fe3a3ac9","order_by":0,"name":"Xiaoyang Yin","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyang","middleName":"","lastName":"Yin","suffix":""},{"id":433870038,"identity":"a28c4543-a2cd-4a22-8ab1-b2d3665719cd","order_by":1,"name":"Yimeng Wei","email":"","orcid":"","institution":"Lanzhou University First Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yimeng","middleName":"","lastName":"Wei","suffix":""},{"id":433870039,"identity":"9a17c323-23d7-483a-b1e3-a8a995f66a98","order_by":2,"name":"Yu Liu","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Liu","suffix":""},{"id":433870040,"identity":"7550d5ed-f68e-4df9-a1b4-1eaa882fbc6e","order_by":3,"name":"Gang Chen","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Chen","suffix":""},{"id":433870041,"identity":"4e1fa0c5-e48c-4432-b003-77d22e0b5571","order_by":4,"name":"Jing Chen","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Chen","suffix":""},{"id":433870042,"identity":"05d5566e-ffc9-4057-87b1-cbbfe155026b","order_by":5,"name":"Jie Cheng","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Cheng","suffix":""},{"id":433870043,"identity":"f4caf80e-959c-439f-bb0c-3ddfbf875a87","order_by":6,"name":"Yongming Liu","email":"","orcid":"","institution":"Lanzhou University First Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yongming","middleName":"","lastName":"Liu","suffix":""},{"id":433870044,"identity":"eb34c9ad-2670-4e3d-8885-cb1671b666fc","order_by":7,"name":"Hulai Wei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIie3RMQrCMBTG8RcK7fKga4p6h0ChCAV7lQbBLiKOBQUDhXT0Ah5GCbRL3btJETo5eALRdnMJAReH/Lc3/PiGB2Cz/WVEAmwBfW+8HFPCAIPCnIA7EGDKlLC6kHdki2movJ5CHnPhXc960lzKENkSIwUrCk3GBW5SLYlaLifInIFUlEjFBUWmJ7duIAcMCyIpeZmQlgxEfYYclxJhQJKGy+DEaqTKdeZplYUS13oSlHVPH/ku8cuya5/7eHb0Gj35LoXxTTabzWb7tTfEwTp6XMDr/AAAAABJRU5ErkJggg==","orcid":"","institution":"Lanzhou University","correspondingAuthor":true,"prefix":"","firstName":"Hulai","middleName":"","lastName":"Wei","suffix":""}],"badges":[],"createdAt":"2025-03-10 12:19:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6195440/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6195440/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":79883293,"identity":"f55ca5fa-7899-489d-afe6-7addf084faf1","added_by":"auto","created_at":"2025-04-04 05:08:43","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3444539,"visible":true,"origin":"","legend":"\u003cp\u003eCharacteristics and comparison of UC-MSCs and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSCs \u0026nbsp;A, Trilineage differentiation capacity(left) and respective regulatory genes expression(right) of UC-MSC and VCAM-1\u003csup\u003e+\u003c/sup\u003e CU-MSC; B, Expression of UC-MSC and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC surface markers; C, Differential expression of CD31 and CD106 in UC-MSC and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC; D, SDF-1 gene expression in UC-MSC and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC, Full-length blots/gels are presented in Supplementary Figure 1; E, Migration ability of UC-MSC and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC; F, Expression of genes related to immune regulation and angiogenesis in UC-MSC and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC. Data are expressed as mean ± SD, compared with MSC group,*\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ****\u003cem\u003eP\u003c/em\u003e<0.0001.\u003c/p\u003e","description":"","filename":"F1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/8e2cacaa745fc175bea30a4e.jpg"},{"id":79884117,"identity":"3087dd9a-5f29-484a-bd32-8e01a86e8e73","added_by":"auto","created_at":"2025-04-04 05:32:44","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":616609,"visible":true,"origin":"","legend":"\u003cp\u003eThe characteristics and comparison of exosomes derived from UC-MSC and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC \u0026nbsp;A, Exosomes particle size distribution; B, Exosomes morphology observed by electron microscopy; C, Expression of exosomes markers. Full-length blots/gels are presented in Supplementary Figure 2.\u003c/p\u003e","description":"","filename":"F2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/b8e0366886fd3238f28425c1.jpg"},{"id":79884121,"identity":"8cb53036-b32c-4fac-85a6-e30f22cab1f5","added_by":"auto","created_at":"2025-04-04 05:32:44","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4994711,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypic alterations in high glucose-damaged senescent cardiomyocytes. \u0026nbsp;A, Effects of different concentrations of GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e induction on H9c2 cell viability; B, Morphological changes in H9c2 cells and primary cardiomyocytes induced by GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e; C, β-Galactosidase staining of H9c2 and primary cardiomyocytes induced by GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e; D, Cell cycle changes in H9c2 and primary cardiomyocytes induced by GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e; E, GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e induction inhibits colony formation in H9c2 cells; \u0026nbsp;F, GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e induction inhibits migration ability of H9c2 cells; G, GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e induction inhibits proliferation of H9c2 cells; H, GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e induction promotes the expression of senescence-associated proteins and genes. Full-length blots/gels are presented in Supplementary Figure 3. Data are expressed as mean ± SD, compared with the control group, **P<0.01,***P<0.001,****P<0.0001.*\u003cem\u003eP\u003c/em\u003e<0.05.\u003c/p\u003e","description":"","filename":"F3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/4201eec84752ec9290779457.jpg"},{"id":79885057,"identity":"ac16a8a8-ed9d-4be7-9845-b9cfa3db7c91","added_by":"auto","created_at":"2025-04-04 05:40:44","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2153180,"visible":true,"origin":"","legend":"\u003cp\u003eThe phenotype of ferroptosis of senescent cardiomyocytes damaged by high-glucose.\u0026nbsp; A, Increase in Prussian blue staining in H9c2 cells induced by GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e; B, Flow cytometric detection of ROS changes in glucose-damaged senescent H9c2 cells; C, Electron microscopic observation of mitochondrial morphology in glucose-damaged senescent H9c2 cells; D, Increase in iron ion levels in H9c2 cells induced by GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e; E, Changes in ferroptosis-related proteins in H9c2 cells induced by GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, Full-length blots/gels are presented in Supplementary Figure 4. F, Alterations in ferroptosis-related genes in H9c2 cells induced by GLU and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. Data are expressed as mean ± SD , compared with the control group, *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ****\u003cem\u003eP\u003c/em\u003e<0.0001.\u003c/p\u003e","description":"","filename":"F4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/c6cdf90c504bb102c5217b63.jpg"},{"id":79885059,"identity":"fd414bbb-5549-4678-be0c-c5fd1ae844f1","added_by":"auto","created_at":"2025-04-04 05:40:44","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4200395,"visible":true,"origin":"","legend":"\u003cp\u003eThe ferroptosis phenotype of damaged cardiomyocytes and cardiac dysfunction in aged diabetic rats. \u0026nbsp;A, Myocardial structural damage in aged diabetic cardiomyopathy rats; B, Myocardial fibrosis in aged diabetic cardiomyopathy rats; C, Cardiac ultrasound in aged diabetic cardiomyopathy rats; D, Cardiac parameters in aged diabetic cardiomyopathy rats; E, Levels of insulin, cholesterol, triglycerides in aged diabetic cardiomyopathy rats; F, Enhanced ferroptosis in the heart of aged diabetic cardiomyopathy rats. Full-length blots/gels are presented in Supplementary Figure5; G, Expression of ferroptosis-related proteins in the heart of aged diabetic cardiomyopathy rats. Data are expressed as mean ± SD, compared with the control group, **\u003cem\u003eP\u003c/em\u003e<0.01, ****\u003cem\u003eP\u003c/em\u003e<0.0001.\u003c/p\u003e","description":"","filename":"F5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/ff10f2efad33160b9365ad18.jpg"},{"id":79883300,"identity":"8d7b3b18-0544-480e-bf69-240914052fe1","added_by":"auto","created_at":"2025-04-04 05:08:44","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1272509,"visible":true,"origin":"","legend":"\u003cp\u003eThe reparative effects of UC-MSCs and VCAM-1\u003csup\u003e+\u003c/sup\u003eUC-MSCs on glucose-damaged senescent cardiomyocytes. \u0026nbsp;Morphological changes of glucose-damaged senescent H9c2 cells co-cultured with UC-MSC or VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC (A), reduced β-galactosidase staining positive cells (B), and changes in the expression of ageing-related genes and proteins (C) and mRNA (D). Full-length blots/gels are presented in Supplementary Figure 6. Data are expressed as mean ± SD, compared with the glucose-damaged senescent model group,*\u003cem\u003eP\u003c/em\u003e<0.05,**\u003cem\u003eP\u003c/em\u003e<0.01,***\u003cem\u003eP\u003c/em\u003e<0.001,****\u003cem\u003eP\u003c/em\u003e<0.0001.\u003c/p\u003e","description":"","filename":"F6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/5bfdefb1f0aef2cd8128cfdb.jpg"},{"id":79885058,"identity":"509d2ce4-50d1-4535-ae68-ac891096d90c","added_by":"auto","created_at":"2025-04-04 05:40:44","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6630403,"visible":true,"origin":"","legend":"\u003cp\u003eThe reparative effects of UC-MSCs- and VCAM-1\u003csup\u003e+ \u003c/sup\u003eUC-MSCs-derived exosomes on glucose-damaged senescent cardiomyocytes.\u0026nbsp; After co-culturing glucose-damaged senescent H9c2 cells or primary rat cardiomyocytes with exosomes derived from UC-MSC or VCAM-1+ UC-MSC, the following changes were observed: cardiomyocyte morphological alterations(A), β-galactosidase staining positive cells(B), cell cycle distribution(C), cell migration ability (D), colony formation ability (E), cell proliferation ability(F), SASP(G), and the expression of senescence-associated proteins and genes(H). Full-length blots/gels are presented in Supplementary Figure 7. Data are expressed as mean ± SD, compared with the glucose-damaged senescent cell group,**P<0.01,***P<0.001,****P<0.0001.\u003c/p\u003e","description":"","filename":"F7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/24bfb4a87b41dbdbb21be5bb.jpg"},{"id":79883313,"identity":"e58f3ba6-008d-4693-92c0-b88b7e1407e0","added_by":"auto","created_at":"2025-04-04 05:08:44","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":3147751,"visible":true,"origin":"","legend":"\u003cp\u003eThe impact of UC-MSCs- and VCAM-1+ UC-MSCs-derived exosomes on ferroptosis in glucose-damaged senescent cardiomyocytes. \u0026nbsp;After co-culturing glucose-damaged senescent H9c2 cells with exosomes derived from UC-MSC and VCAM-1+ UC-MSC, the following results were observed: a reduction in the number of iron-staining positive cells in glucose-damaged senescent H9c2 cells(A), changes in mitochondrial morphology(B), decreased ROS release(C), a decrease in intracellular iron ion content(D), and the expression of ferroptosis-related regulatory proteins(E) and genes(F). Full-length blots/gels are presented in Supplementary Figure 8. Data are expressed as mean ± SD, compared with the glucose-damaged senescent model group. **P<0.01,***P<0.001,****P<0.0001.\u003c/p\u003e","description":"","filename":"F8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/882463f4041127752e27e2af.jpg"},{"id":79883324,"identity":"52e423d5-6ca1-464f-b47c-7ea277af260f","added_by":"auto","created_at":"2025-04-04 05:08:44","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":7174805,"visible":true,"origin":"","legend":"\u003cp\u003eTherapeutic effect of UC-MSC- and VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSC-derived exosomes on aged diabetic cardiomyopathy rats. \u0026nbsp;A, HE staining of myocardial tissue in aged diabetic cardiomyopathy rats; B, Masson staining of rats myocardial tissue shows myocardial fibrosis; C, Cardiac ultrasound of exosomes in the treatment of aged diabetic cardiomyopathy rats; D, Effect of exosomes on cardiac parameters in aged diabetic cardiomyopathy rats; E, LVID and EF values detected by cardiac ultrasound in aged diabetic cardiomyopathy rats; F, Random blood glucose changes in rats; G, Changes in body weight of rats; H, Changes in serum insulin, cholesterol, and triglyceride levels in rats; I, Prussian blue staining of myocardial tissue showing the extent of iron accumulation in rats; J, Changes in serum SASP cytokines in rats. Full-length blots/gels are presented in Supplementary Figure 9. Data are expressed as mean ± SD, compared with T2DM rats group, *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ****\u003cem\u003eP\u003c/em\u003e<0.0001。\u003c/p\u003e","description":"","filename":"F9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/dd10564c60b4049dbf68314b.jpg"},{"id":79883307,"identity":"a48d3c89-f273-40fd-bf2e-e5615c63fd99","added_by":"auto","created_at":"2025-04-04 05:08:44","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":1526196,"visible":true,"origin":"","legend":"\u003cp\u003eMSC-derived exosomes inhibit Ras/Raf/MEK/ERK/c-FOS signaling pathway in glucose-injured senescence cardiomyocytes. \u0026nbsp;A, Enrichment analysis of signaling pathways in glucose-damaged senescent cardiomyocytes after MSC exosome treatment; B, Differential gene expression in glucose-damaged senescent cardiomyocytes after MSC exosome treatment; C, Heatmap of gene changes in the oxidative stress signaling pathway of glucose-damaged senescent cardiomyocytes; D, Overlap of differentially expressed genes in glucose-damaged senescent cells before and after MSC exosome treatment; E, Expression of c-FOS gene in glucose-damaged senescent cardiomyocytes after MSC exosome treatment; F, Expression of proteins in the Ras/Raf/MEK/ERK/c-FOS signaling pathway in H9c2 cells (left) and primary cardiomyocytes (right) after MSC exosome treatment. Full-length blots/gels are presented in Supplementary Figure 10. Data are expressed as mean ± SD, compared with glucose-damaged senescent cell group, *\u003cem\u003eP\u003c/em\u003e<0.05, ***\u003cem\u003eP\u003c/em\u003e<0.001, ****\u003cem\u003eP\u003c/em\u003e<0.0001。\u003c/p\u003e","description":"","filename":"F10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/e4d583b6414cb5509cd64f35.jpg"},{"id":79887721,"identity":"31c8c230-2dd1-4c4d-9074-770874f24813","added_by":"auto","created_at":"2025-04-04 06:29:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":36536306,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/119818bd-913c-4834-ba7f-23882aff6908.pdf"},{"id":79883296,"identity":"79fb0ec8-cf1b-4cf9-9878-49694ec44262","added_by":"auto","created_at":"2025-04-04 05:08:44","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":227030,"visible":true,"origin":"","legend":"","description":"","filename":"AuthorChecklistFull.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/89a1e84c48ed8fc1c7f73156.pdf"},{"id":79884124,"identity":"9ae85153-7f3c-463f-8a03-d2a4c03a0037","added_by":"auto","created_at":"2025-04-04 05:32:47","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":8550092,"visible":true,"origin":"","legend":"","description":"","filename":"DEGcombindednofiltered.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/a2e66e21e57ba58656a098cf.xlsx"},{"id":79883304,"identity":"4d81346e-2dd3-43fa-aba6-f9aece26e112","added_by":"auto","created_at":"2025-04-04 05:08:44","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":9080581,"visible":true,"origin":"","legend":"","description":"","filename":"FulllengthblotsgelsSupplementaryFigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/aacd5442ec26f2e4173f09b4.docx"},{"id":79884118,"identity":"22d9b5fe-dc7f-489d-8ae9-442ba85e2b4f","added_by":"auto","created_at":"2025-04-04 05:32:44","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":539240,"visible":true,"origin":"","legend":"","description":"","filename":"venndata.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6195440/v1/f062cf20a629a1ec2218a54e.xlsx"}],"financialInterests":"","formattedTitle":"Reparative Effects of VCAM-1 High-Performance MSC-derived Exosomes on Aged Diabetic Cardiomyocyte Injury: A Focus on Ferroptosis Suppression","fulltext":[{"header":"Background","content":"\u003cp\u003eDiabetes mellitus is a serious health issue that affects approximately 537\u0026nbsp;million people worldwide, with type 2 diabetes accounting for more than 90% of cases. With the accelerating global population aging, elderly diabetes, particularly type 2 diabetes, has become a major public health concern worldwide\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. The pathological physiology and metabolic disorders associated with aging significantly increase the incidence of diabetes. Additionally, age-related declines in the structure and function of various organ systems make elderly individuals with diabetes more susceptible to complications such as cardiovascular disease, nephropathy, retinopathy, and neuropathy\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Among these complications, diabetic cardiomyopathy is one of the leading causes of mortality in diabetic patients. However, the underlying pathological mechanisms of diabetic cardiomyopathy remain incompletely understood.\u003c/p\u003e \u003cp\u003eDiabetic cardiomyopathy is a unique cardiac disease in diabetic patients, independent of other cardiovascular conditions such as hypertension and coronary artery disease3,4. It is characterized by structural and functional abnormalities of the heart, including myocardial fibrosis, myocardial hypertrophy, and ventricular dysfunction. During aging, myocardial structure and function undergo progressive decline, with reduced adaptability to environmental and stress-related challenges5. In the presence of diabetes, hyperglycemia, and insulin resistance contribute to myocardial metabolic disorders, mitochondrial dysfunction, interstitial fibrosis, and coronary microvascular disease, further exacerbating myocardial structural damage and functional impairment6,7. This combination of age-related myocardial deterioration and diabetes-induced myocardial injury leads to cardiac dysfunction or failure, resulting in elderly diabetic cardiomyopathy. Currently, the cardiac dysfunction caused by the interplay between age-related myocardial aging and diabetic myocardial injury in elderly diabetic patients remains difficult to manage, with no effective intervention strategies available.\u003c/p\u003e \u003cp\u003eFerroptosis is an iron-dependent form of programmed cell death characterized by accumulating reactive oxygen species (ROS) and increased lipid peroxidation. Recent studies have demonstrated that ferroptosis is involved in the pathogenesis of various diseases and plays a crucial role in multiple cellular activities and pathophysiological processes, including neurodegenerative diseases, cardiovascular diseases, cancer, and ischemia-reperfusion injury. Research has shown that in the cardiovascular system, ferroptosis is closely associated with ischemic or drug-induced cardiomyopathy, atherosclerosis, and acute renal failure8,9. In diabetic patients, hyperglycemia, insulin resistance, and metabolic disorders exacerbate oxidative stress in cardiomyocytes. Persistent oxidative stress damages cardiomyocytes, leading to cardiac dysfunction, while also serving as a key trigger for ferroptosis10. In diabetes, myocardial iron accumulation, mitochondrial dysfunction, and elevated oxidative stress levels activate the ferroptosis pathway. Ferroptosis is considered a critical mechanism of cellular damage in diabetic cardiomyopathy, contributing to cardiomyocyte injury, myocardial hypertrophy, fibrosis, and cardiac dysfunction11. Moreover, in elderly diabetic patients, the aging process and the senescence-associated secretory phenotype (SASP) of senescent cardiomyocytes contribute to myocardial dysfunction and fibrosis12. Senescent cardiomyocytes downregulate the expression of antioxidant proteins such as SLC7A11 and GPX413, thereby activating or exacerbating ferroptosis. In turn, ferroptosis further promotes oxidative stress and impairs the cellular antioxidant defense system through iron ion accumulation and lipid peroxidation, accelerating cardiomyocyte aging. Recent studies have partially elucidated the role and molecular mechanisms of ferroptosis in diabetic cardiomyopathy. However, current research remains in its early stages, and the precise mechanisms underlying this process have yet to be fully understood.\u003c/p\u003e \u003cp\u003eMesenchymal stem cells (MSCs) are multipotent stem cells of mesodermal origin with self-renewal capacity and the potential to differentiate into multiple cell lineages. They exhibit strong immunomodulatory properties, migratory ability, antioxidative effects, and the capacity to reduce inflammatory responses, promote cell proliferation and differentiation, and facilitate tissue repair, all while maintaining low immunogenicity14. Due to their superior characteristics, broad availability, and regenerative potential, MSCs have been widely applied in clinical disease treatments. Our previous studies have demonstrated that, compared to conventional MSCs, highly active MSCs with high expression of vascular cell adhesion molecule-1 (VCAM-1, also known as CD106), induced by a specific combination of cytokines (IL-1β\u0026thinsp;+\u0026thinsp;IL-4\u0026thinsp;+\u0026thinsp;IFN-γ) (VCAM-1⁺ UC-MSCs), exhibit enhanced proliferative and secretory capacities as well as superior hematopoietic reconstitution and immunomodulatory functions15. Moreover, VCAM-1⁺ MSCs more effectively repair myocardial and vascular damage in aged diabetic rats, thereby improving their cardiac function. However, the underlying mechanisms by which MSCs repair myocardial injury in aged diabetic models require further investigation. This translation maintains the academic tone and clarity required for a scientific manuscript.\u003c/p\u003e \u003cp\u003eExtracellular vesicles (EVs), particularly exosomes derived from stem cells, serve as crucial mediators of intercellular communication. Due to their acellular nature, low immunogenicity, and excellent tissue permeability, exosomes have demonstrated significant advantages and potential in disease diagnosis, therapy, drug delivery, and regenerative medicine. Mesenchymal stem cell (MSC)-derived exosomes have been widely studied in experimental treatments for various diseases. Studies have shown that stem cell-derived exosomes promote cardiomyocyte repair and restore cardiac function16,17, reduce post-myocardial infarction scar formation, and have the potential to improve insulin sensitivity and mitigate complications associated with diabetes. In neurodegenerative diseases, stem cell-derived exosomes facilitate neuronal regeneration and suppress inflammatory responses18. Similarly, in osteoarthritis and cartilage injuries, these exosomes enhance chondrocyte proliferation, stimulate extracellular matrix synthesis, and promote tissue repair19,20. Moreover, research suggests that VCAM-1⁺ stem cells possess enhanced pro-angiogenic capacity, superior immunomodulatory properties, and improved homing ability21. VCAM-1⁺ MSCs have been shown to protect against neuronal damage caused by ischemic stroke in rats by inhibiting apoptosis22. Additionally, injured cardiomyocytes can rapidly mobilize splenic neutrophils by generating and releasing VCAM-1⁺ extracellular vesicles23.\u003c/p\u003e \u003cp\u003eBased on the advantages and characteristics of VCAM-1⁺ MSCs and MSC-derived exosomes, as well as the potential significant roles of ferroptosis in aged diabetic myocardial injury, we constructed cellular and animal models of aged diabetic cardiomyopathy to elucidate the mechanisms of ferroptosis underlying aged diabetic myocardial injury, as well as to explore the protective and reparative mechanisms mediated by exosomes from VCAM-1⁺ MSC through the inhibition of ferroptosis in aged diabetic myocardial injury.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 Induction and Identification of VCAM-1⁺ UC-MSC\u003c/h2\u003e\n \u003cp\u003eThe umbilical cord mesenchymal stem cells (UC-MSCs) were provided by the National Engineering Research Center of Cell Products/Tianjin Amcell Cell Gene Engineering Co., Ltd. UC-MSCs were maintained in complete DMEM/F12 medium containing 10% fetal bovine serum (FBS), 1% antibiotics, 1% glutamine, 2 ng/mL \u0026beta;-FGF, and 10 ng/mL EGF, cultured in cell incubator at 37\u0026deg;C, 5% CO₂, and saturated humidity.\u003c/p\u003e\n \u003cp\u003eInduction of VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs: UC-MSCs from passages 3 to 6 were seeded at a density of 1 \u0026times; 10⁵ cells/mL. When the cell confluence reached 30\u0026ndash;40%, the culture medium was replaced with complete DMEM/F12 medium containing 10 ng/mL IL-1\u0026beta;, 10 ng/mL IL-4, and 20 ng/mL IFN-\u0026gamma;21. After 48 hours of continued culture, the cells were dissociated using 0.25% trypsin-EDTA.\u003c/p\u003e\n \u003cp\u003eIdentification of VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs: UC-MSCs and VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs were cultured as described above. Their adipogenic, osteogenic, and chondrogenic differentiation potentials and the respective regulatory genes were assessed according to the methods outlined in the literature. Additionally, the expression of VCAM-1, SDF-1, and other MSC markers (CD105, CD73, CD90, HLA-DR, CD34, CD11b, CD19, CD45) was examined.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Establishment of high-glucose-induced damage model of senescent cardiomyocytes\u003c/h2\u003e\n \u003cp\u003eThe rat cardiomyocyte cell line H9c2 was purchased from Wuhan Pricella Biotechnology Co., Ltd. and cultured in DMEM medium supplemented with 10% FBS, 1% antibiotics, and 1% glutamine, at 37\u0026deg;C, 5% CO₂, and saturated humidity. To induce high glucose conditions, 50 mM glucose was added to the H9c2 culture medium, and cells were continuously cultured under these conditions for more than two months, referred to as GLU-H9c2. After that, GLU-H9c2 cells were cultured in serum-free medium supplemented with 100 mM H₂O₂ for 4 hours, followed by a change to complete DMEM medium containing 75 mM glucose and continued culture for 48 hours to establish the glucose-damaged senescent H9c2 cell model. In the MSC exosome intervention experiment, exosomes were co-cultured with the H9c2 cell model at a concentration of 10 \u0026micro;g/mL for 48 hours, followed by the corresponding assays.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 Isolation of primary rat cardiomyocytes and establishment of injury cell model\u003c/h2\u003e\n \u003cp\u003eOne to three days-old Sprague\u0026thinsp;\u0026minus;\u0026thinsp;Dawley (SD) neonatal rats were obtained from the Laboratory Animal Center of Lanzhou University. Hearts were harvested from 10\u0026ndash;15 neonatal rats after humane euthanasia, and the myocardial tissue was cut into approximately 1 mm\u0026sup3; pieces. The cells were then dissociated using a myocardial tissue dissociation kit, followed by repeated digestion and cell collection. The collected cells were cultured in high-glucose DMEM medium containing 15% FBS and 1% glutamine at 37\u0026deg;C, 5% CO₂, and saturated humidity. Under microscopic observation, the primary cardiomyocytes exhibited rhythmic contraction. The cultured primary cardiomyocytes were passaged in high-glucose DMEM medium supplemented with 50 mM glucose. After high-glucose induction, the primary cardiomyocytes were cultured in serum-free DMEM medium containing 100 mM H₂O₂ for 4 hours, followed by replacement with complete DMEM medium containing 75 mM glucose and continued culture for 48 hours to establish the glucose-damaged senescent primary cardiomyocyte model. The MSC exosome intervention experiment was performed in the same manner as the H9c2 cell model described above.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4 Exosomes isolation and identification\u003c/h2\u003e\n \u003cp\u003eMSCs were cultured in a serum-free medium, MSC-conditioned medium was collected after 48 h of culture and centrifuged at 3000\u0026times;g for 30 min to remove debris and cells. The supernatant was collected and transferred to a new sterile tube and centrifuged at 10,000\u0026times;g for 20 min, followed by ultracentrifugation at 100,000 \u0026times; g for 90 min at 4\u0026deg;C to obtain exosome pellets, which were resuspended in PBS and stored at -80\u0026deg;C. MSCs from passages 6 were used in the experiments. We used the BCA protein assay kit (PC0020; Solarbio, Beijing, China) to determine the protein content of the concentrated exosomes. Exosomes were identified by Western blot (WB) analysis of the marker proteins CD63, CD81 and TSG101. ZetaPALS (90Plus Pals; Brookhaven, USA) was performed to measure the size distribution of isolated particles released by MSCs. The morphology of exosomes was observed using a 200 kV refrigerated transmission electron microscope (Talos F200C, FEI, Czech).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5 Cell viability assay\u003c/h2\u003e\n \u003cp\u003eMTT was used to determine the effect of different concentrations of H2O2- and glucose-induced cell damage. After H9c2 cells were passaged stably, they were seeded into 96-well plates at a density 1 \u0026times; 104 cells/well. H2O2 was added to the 96-well plate at increasing concentrations for 4 h and 6 h, glucose was added to the 96-well plate at increasing concentrations. After 24 h and 48 h, the cells were incubated with 100 \u0026micro;L of 1 \u0026times; MTT for 4 h and then, 100 \u0026micro;L of 10% SDS was added to each well. Absorbance was measured at 570 nm.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e3.6 Colony formation assay\u003c/h2\u003e\n \u003cp\u003eTransfected cells were collected and inoculated into a 6-well plate at a concentration of 1,000 cells /dish. The cell clones were cultured for 2 weeks until visible cell clones emerged. Fresh medium was replaced every 3 days. The cells were gently washed with PBS twice and fixed with 4% paraformaldehyde for 20 min at room temperature, and stained with crystal violet for 20 min at room temperature. Each cell clone on the dishes was counted and photographed triplicately.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e3.7 EdU incorporation assay\u003c/h2\u003e\n \u003cp\u003eEdU Kit (C0071s, Beyotime, Shanghai, China) was used to apply the EdU incorporation assay (EdU). H9c2 cells were seeded into 12-well plates and cultured with EdU reagent (1:1000 dilution) for 2 h. Then, 4% paraformaldehyde was used to fix the cells, and fluorescent dye and Hoechst were used to stain cells. ImageJ software was used to count EdU-positive cells.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e3.8 \u0026beta;-galactosidase activity assay\u003c/h2\u003e\n \u003cp\u003eSenescence-associated \u0026beta;-galactosidase activity was assessed in treated-H9c2 cells using the Senescence-associated \u0026beta;-galactosidase staining kit (C0602, Beyotime, Shanghai, China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3.9 Iron ion determination\u003c/h2\u003e\n \u003cp\u003eThe total iron content in cell and heart tissue lysate was determined using total iron Assay kit (G4301; Servicebio, Wuhan, China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.10 Immunoblots\u003c/h2\u003e\n \u003cp\u003eTotal protein was extracted using RIPA lysis buffer containing 1% protease inhibitor, and the concentration of the extracted protein was measured using a BCA kit. Equal amounts of protein were separated on 12% SDS-PAGE gel and then transferred onto polyvinylidene fluoride membranes. After blockade with 5% skim milk for 1 h, the membranes were incubated with primary and HRP conjugated secondary antibodies and detected using an ECL detection system (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Band intensity was normalized against \u0026beta;-actin for quantification.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e3.11 RNA isolation and real-time RT-PCR\u003c/h2\u003e\n \u003cp\u003eTotal RNA was extracted from cells using Trizol reagent according to the manufacturer\u0026rsquo;s instructions, and 1\u0026micro;g of total RNA was reversely transcribed into cDNA using a Reverse Transcription Kit. Primers were synthesized by Tsingke Biotech (Xian, China) (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The cDNA was amplified and quantified using a Rotor-Gene 3000 realtime PCR system with SYBR Green (22204-01; TOLOBIO, China). mRNA expression levels were normalized to GAPDH levels. Relative mRNA expression levels were determined using the 2-△△Ct method.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e3.12 Flow cytometry\u003c/h2\u003e\n \u003cp\u003eMSCs were characterized for their surface markers (CD73, CD90, CD106, CD31, CD34, CD105, CD45, HLA-DR, CD11b) by a flow cytometry (NovoCyte Quanteon; Agilent, Singaporean);\u003c/p\u003e\n \u003cp\u003eCells in G0/G1, G2/M and S phases were analyzed by flow cytometry, using Cell Cycle and Apoptosis Analysis Kit (C1052; Beyotime, Shanghai, China); Reactive oxygen species (ROS) activity within the cells was measured by Intracellular ROS Assay Kit (S0033S; Beyotime, Shanghai, China) according to the manufacturer\u0026rsquo;s guidelines. ROS level was measured by flow cytometry. All FACS data were analyzed using FlowJo Software\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003e3.13 Animals and establishment of the aged rat T2DM model\u003c/h2\u003e\n \u003cp\u003eEight week-old, SPF-grade male SD rats (200\u0026thinsp;\u0026minus;\u0026thinsp;220 g) were purchased from the Laboratory Animal Center, Lanzhou University. All animals were housed in a specific pathogen-free (SPF) level barrier system at the Medical Experiment Center of Basic Medical Sciences, Lanzhou University, with an optimal temperature of (24\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C), a controlled light cycle, and free access to food and water. Before the experiment, healthy rats were numbered and raised to 12 months of age. At the end of acclimatization, rats were tested for fasting plasma glucose (FPG), fasting insulin (FINS), calculated Insulin sensitivity index (ISI) and performed i. p. glucose tolerance test (IPGTT).\u003c/p\u003e\n \u003cp\u003eThe rats were randomly divided into 4 groups: control, diabetic (T2DM), T2DM\u0026thinsp;+\u0026thinsp;MSC-Exosomes (Exosome), and T2DM\u0026thinsp;+\u0026thinsp;VCAM-1\u003csup\u003e+\u003c/sup\u003e MSC-Exosomes (VCAM-1\u003csup\u003e+\u003c/sup\u003e exosome) group, with 6 rats in each group. Normal rats were fed normal diets. The diabetic rat model was established by high-fat feeding (HFD) for 6 weeks, after being fasted for 12 h with free access to water, HFD fed rats were intraperitoneally injected with STZ (30 mg/kg) in 0.1 M citrate buffered saline, pH 4.5 to induce T2DM. FPG, FINS, IPGTT were performed to confirm the establishment of the T2DM rat model. The rats showed fasting glucose levels of more than 16.7 mmol/L, which were considered to be T2DM rats. T2DM rats were kept on the high-fat diet for two weeks to induce myocardial injury. Rats in the exosome and VCAM-1\u003csup\u003e+\u003c/sup\u003e exosome group were injected with a PBS buffer mixture of MSC-exosome or VCAM-1\u003csup\u003e+\u003c/sup\u003e MSC-exosome (200 \u0026micro;g/rat, approximately 200\u0026ndash;250 ul) via the tail vein, while the Control group and T2DM group were injected with the same amount of PBS. The injections were administered three times, with a one-week interval between each injection. One week after the final injection, a cardiac ultrasound was performed. Blood collection was performed in rats under anesthesia with 2% isoflurane. Rats were euthanized with an intraperitoneal injection of 150 mg/kg sodium pentobarbital (Shanghai New Asia Pharmaceutical Co., Ltd.) to ensure a humane and rapid termination. The death of the rats was confirmed by the absence of respiration, heartbeat, and corneal reflex. The heart tissue was excised, weighed, and either stored at -80\u0026deg;C or fixed for subsequent experiments. No specific exclusion criteria were established, and no rat were excluded from the study. Cardiac ultrasound examination was performed for 6 animals per group; western blot, RT-qPRC, immunostaining analysis were performed for 3 animals per group. All outcome assessments were conducted by experimenters who were blinded to group assignments\u003c/p\u003e\n \u003cp\u003eAll animal studies were carried out with the approval of the Laboratory Animal Ethics and Welfare Committee of School of Basic Medical Sciences of Lanzhou University following the ethical code of animal use. The animal study was reviewed and approved by Laboratory Animal Science and Technology Work Management Committee, School of Basic Medicine, Lanzhou University (Lzujcyxy20250309).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e3.14 ELISA analysis\u003c/h2\u003e\n \u003cp\u003eELISAs were performed to determine the levels of insulin (INS), triglyceride (TG), and Total Cholesterol (TC) in rat serum and the levels of IL-6, IL-8, TGF-\u0026beta; in both rat serum and cell culture supernatant using commercially available kits according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003e3.15 Ultrasound echocardiography\u003c/h2\u003e\n \u003cp\u003eUltrasound echocardiography was performed by using a Small Animals High Resolution Ultrasound Imaging System (S-sharp; Taiwan, China) in rat under anesthesia with 2% isoflurane (RWD Life Science Co., Guangdong, China). Before the cardiac ultrasound, the rats were anesthetized in a gas anesthesia chamber and then transferred to the operating table, where anesthesia was maintained using a mask. Local hair removal was performed, and the surgical anesthesia dose was sustained throughout both the hair removal and ultrasound procedures. After the ultrasound examination, blood was collected from the tail vein under anesthesia. The heart was examined in the long-axis view at the papillary muscle level and an M-mode echocardiogram of the mid ventricle was recorded. Analysis of echocardiographic images was performed in a blinded manner. Cardiac function indices including left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), end-diastolic left ventricular internal dimension (LVID; d), end-systolic left ventricular internal dimension (LVID; s), left ventricular end-diastolic volume (LVEDV), left ventricular end-systolic volume (LVESV), and left ventricular mass (LV mass).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e3.16 Hematoxylin-eosin, Masson\u0026rsquo;s trichrome and Prussian Blue Iron staining\u003c/h2\u003e\n \u003cp\u003eThe heart tissues were fixed in tissue fixation solution (G1101; Servicebio, Wuhan, China), gradually dehydrated, embedded in paraffin, cut into 4 \u0026micro;m sections, and subjected for hematoxylin-eosin, Masson\u0026rsquo;s trichrome and Prussian Blue Iron staining according to the manufacturer\u0026rsquo;s protocols.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e3.17 Statistical Analysis\u003c/h2\u003e\n \u003cp\u003eSample sizes were determined based on our previous studies using the same T2DM model. All data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Multiple groups were analyzed using a one-way ANOVA. Differences were considered statistically significant if \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Statistical analyses were performed using Graphpad Prism 9.0.0 software.\u003c/p\u003e\n \u003cp\u003eThe work has been reported in line with the ARRIVE guidelines 2.0.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003e4.1 Characteristics of VCAM-1\u003csup\u003e+\u003c/sup\u003e MSCs and -derived exosomes\u003c/h2\u003e\n \u003cp\u003eUC-MSCs were induced using a specific combination of cytokines (IL-1\u0026beta;\u0026thinsp;+\u0026thinsp;IL-4\u0026thinsp;+\u0026thinsp;IFN-\u0026gamma;) to generate VCAM-1⁺ UC-MSCs with high activity. Phenotypic characterization and comparison with UC-MSCs demonstrated that VCAM-1⁺ UC-MSCs showed heightened adipogenic, osteogenic, and chondrogenic differentiation potential, and high-expressed respective regulatory genes (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). These cells expressed MSC surface markers CD105, CD73, and CD90 while lacking the expression of CD34, CD11b, CD19, CD45, and HLA-DR, consistent with the characteristics of UC-MSCs (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). However, compared with UC-MSCs, VCAM-1⁺ UC-MSCs exhibited significantly higher expression of VCAM-1 (CD106) and CD31 (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC), along with a markedly elevated expression of the SDF-1 gene (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD). These findings suggest that VCAM-1⁺ UC-MSCs possess enhanced stemness maintenance, homing capacity, and tissue repair potential. Additionally, Migration assays, along with gene expression analyses related to vascular formation and immune-inflammatory responses, revealed that VCAM-1⁺ UC-MSCs exhibited strengthened migratory ability (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eE) as well as superior immunoregulatory and pro-angiogenic functions (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eF).\u003c/p\u003e\n \u003cp\u003eExosomes were isolated and extracted from UC-MSCs and VCAM-1⁺ UC-MSCs using differential ultracentrifugation. A comparative analysis of their morphology and phenotype revealed that exosomes derived from both UC-MSCs and VCAM-1⁺ UC-MSCs were spherical or near-spherical in shape and possessed a membrane structure (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). Their particle size distribution ranged from 50 to 150 nm (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA), and they expressed the characteristic exosomal markers CD63, TSG101, and CD9 (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC), confirming their exosomal identity. Comparatively, exosomes derived from VCAM-1⁺ UC-MSCs exhibited a slightly smaller particle size but a higher particle count, suggesting that VCAM-1⁺ UC-MSCs have a greater capacity for exosome production and secretion.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003e4.2 High-glucose-injured senescent cardiomyocytes exhibit ferroptosis phenotypes\u003c/h2\u003e\n \u003cp\u003eTo investigate the mechanisms underlying myocardial injury in elderly cases with diabetes and potential interventions, we established a glucose-damaged senescent model in H9c2 cardiomyocytes using hydrogen peroxide (H₂O₂) and high glucose (GLU) stimulation. After continuous induction with high GLU for more than two months, followed by additional stimulation with H₂O₂, H9c2 cell viability suppressed in a dose-dependent manner with increasing concentrations of H₂O₂ and GLU (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). The cells exhibited reduced proliferation, decreased colony formation, and impaired migratory capacity (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE-G). Morphological changes included increased cell volume, elongated spindle-like, flattened, or irregular shapes, as well as rough cell edges, blebbing, and cytoplasmic vacuolation (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). Additionally, \u0026beta;-galactosidase (\u0026beta;-gal) staining showed a significant increase in senescent cells (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). Ultrastructural observations revealed that glucose-damaged senescent cells displayed mitochondrial swelling or shrinkage, cristae reduction or loss, and rupture or damage to the outer mitochondrial membrane (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC). Moreover, intracellular iron accumulation (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD) and reactive oxygen species (ROS) levels were markedly elevated (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB). Cell cycle analysis demonstrated that glucose-damaged senescent cardiomyocytes were arrested in the G0/G1 phase (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD). Expression levels of senescence-associated genes, including P21, P16, and P53, as well as ferritin, were significantly upregulated, whereas ferroptosis-related genes, GPX4 and SLC7A11, were notably downregulated (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eH, Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eE-F). Primary rat cardiomyocytes subjected to high GLU combined with H₂O₂ showed similar changes (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB-H). These findings demonstrate that high glucose combined with H₂O₂ induces significant myocardial aging and injury, characterized by prominent ferroptotic features. This suggests that ferroptosis may be implicated in the pathogenesis of diabetic cardiomyopathy in elderly individuals.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\n \u003ch2\u003e4.3 Aged diabetic rats display ferroptosis-mediated myocardial injury property\u003c/h2\u003e\n \u003cp\u003eTo investigate the mechanisms underlying myocardial dysfunction caused by aging-related myocardial senescence combined with diabetic myocardial injury in vivo, we established an aged diabetic cardiomyopathy (DCM) model using 12-month-old Sprague-Dawley (SD) rats. The model was induced by long-term high-fat diet (HFD) feeding combined with intraperitoneal injection of streptozotocin (STZ). Initially, naturally aging rats showed a evident increase in body weight upon HFD feeding. However, following STZ injection, they developed characteristic symptoms of diabetes, including polydipsia, polyuria, and polyphagia, accompanied by rapid weight loss, yellowish and dull fur, and severe hair loss. Aged diabetic rats exhibited random blood glucose levels of \u0026ge;\u0026thinsp;16.7 mmol/L, decreased serum insulin levels, and significantly elevated total cholesterol and triglyceride levels (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE). The echocardiographic assessment revealed increased left ventricular end-diastolic diameter (LVEDD) and left ventricular end-systolic diameter (LVESD), along with reduced left ventricular ejection fraction (LVEF) (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC-D). Histological analysis of heart tissue using hematoxylin-eosin (HE) staining demonstrated disrupted and disorganized myocardial architecture with marked inflammatory cell infiltration (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA). Masson\u0026apos;s trichrome staining revealed pronounced myocardial fibrosis (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB). Prussian blue staining indicated a raised number of iron-positive cardiomyocytes with a marked elevation in myocardial iron content (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eG). As shown in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eF, ferroptosis-related gene ferritin was substantially upregulated in the myocardial tissue of aged diabetic rats, while GPX4 and SLC7A11 were notably downregulated. Additionally, Nrf2 expression and its phosphorylation levels were elevated. These findings suggest that aged diabetic rats exhibit significant myocardial injury and cardiac dysfunction, with cardiomyocyte damage displaying prominent ferroptotic characteristics.\u003c/p\u003e\u003cspan\u003e\n \u003ch2\u003e4.4 VCAM-1\u003csup\u003e+\u003c/sup\u003e MSCs and -derived exosomes attenuates the high glucose-induced injury in senescent cardiomyocytes by inhibiting ferroptosis\u003c/h2\u003e\n \u003c/span\u003e\n \u003cp\u003eTo investigate the repair effect of MSC and VCAM-1\u0026thinsp;+\u0026thinsp;MSC on glucose-damaged senescent cardiomyocytes, indirect co-culture of MSC/VCAM-1\u0026thinsp;+\u0026thinsp;MSC with H9c2 cell damage models was performed. After co-culturing, the H9c2 model cells showed morphology close to normal control cells, with reduced cell volume, decreased intracellular vacuoles, and increased cell number (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). \u0026beta;-galactosidase staining positive cells were reduced (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB), and the expression levels of P53, P16, and P21 genes and proteins in cells were significantly downregulated (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC). These results indicate that UC-MSC and VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC have a certain repair effect on glucose-damaged senescent cardiomyocytes, and the repair effect may be achieved through their secretory function. Compared with UC-MSC, VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC exhibited more pronounced reparative effects.\u003c/p\u003e\n \u003cp\u003eTo further explore whether the therapeutic effects are mediated by secreted exosomes, exosomes were isolated and extracted from UC-MSC and VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC, and co-cultured with glucose-damaged senescent H9c2 and primary cardiomyocytes. The results showed that after co-culture with exosomes, the morphology of glucose-damaged senescent cardiomyocytes significantly improved, and the cell number augmented (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA). \u0026beta;-galactosidase staining positive cells reduced (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB); the proportion of cells in the G0/G1 phase of the cell cycle suppressed, while the number of cells in the S and G2/M phases increased (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC); cell migration ability (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eD), colony formation ability (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eE) and proliferation ability (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eF)were notably enhanced; expression levels of P53, P21, and P16, as well as P53 phosphorylation, suppressed (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eH); IL-6 and IL-8 secretion by cells were reduced, while TGF-\u0026beta; secretion was elevated (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eG), indicating a recovery in cell senescence and damage status. Compared with untreated glucose-damaged senescent H9c2 cells, the number of Prussian blue staining (iron staining) positive cells was reduced after exosome treatment (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eA), and ultrastructural observation showed an increase in the number of mitochondrial cristae, with more organized arrangement and fewer instances of cristae swelling or rupture (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eB); ROS release (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eC) and iron ion content (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eD) were reduced; the expression of the ferroptosis-regulatory gene Ferritin was downregulated, while the expression of GPX4 and SLC7A11 were significantly upregulated (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eE, F). These comprehensive results demonstrate that MSC-derived exosomes have a notable ameliorative or reparative effect on senescent and glucose-damaged cardiomyocytes, with the mechanism of action being the inhibition of ferroptosis in the damaged cells. Compared to UC-MSC-derived exosomes, VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC-derived exosomes exhibited a stronger potential to improve damaged cardiomyocytes.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\n \u003ch2\u003e4.5 VCAM-1\u003csup\u003e+\u003c/sup\u003e MSCs-derived exosomes repair myocardial injury and improve cardiac function in aged diabetic rats\u003c/h2\u003e\n \u003cp\u003eTo investigate the protective and reparative effects of MSC exosomes on age-related diabetic cardiomyopathy and exacerbated diabetic myocardial injury in elderly rats, UC-MSC and VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC exosomes were isolated and extracted. The exosomes were administered to diabetic cardiomyopathy model rats via tail vein injection; a total of three injections were given at one-week intervals. After exosome treatment, the weight loss in the treated rats slowed significantly and even slightly reversed (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eF). Random blood glucose levels were suppressed (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eE). ELISA analysis showed an increase in serum insulin levels, while total cholesterol and triglyceride levels declined (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eG). The levels of IL6 and IL8 decreased, whereas the TGF-\u0026beta; level increased (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eI). After MSC exosome treatment, insulin resistance and inflammation were reduced in naturally aged diabetic cardiomyopathy rats. Echocardiographic assessment revealed a decrease in left ventricular wall thickness and an increase in EF value post-treatment (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eC-D). Histological analysis through HE and Masson staining confirmed a significant reduction in myocardial inflammatory response (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eA) and myocardial fibrosis (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eB) following exosome treatment. Prussian blue staining demonstrated a reduction in the number of iron-positive cardiomyocytes (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eH). Furthermore, the expression of the ferroptosis-regulatory protein ferritin was markedly downregulated, whereas the expression of SLC7A11 was markedly upregulated (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eJ). Compared to UC-MSC exosomes, VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC exosomes demonstrated superior effects in reducing insulin resistance, inflammation, and in protecting the myocardium. Taken together, these results suggest that VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC exosomes have therapeutic effects on elderly diabetic cardiomyopathy rats, promoting myocardial repair and restoring heart function.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\n \u003ch2\u003e4.6 Exosomes from VCAM-1\u003csup\u003e+\u003c/sup\u003e UC-MSCs ameliorate high-glucose-induced senescent cardiomyocyte injury via Ras/Raf/ERK/MEK/FOS pathway\u003c/h2\u003e\n \u003cp\u003eTo investigate the potential mechanisms through which MSC exosomes alleviate or repair myocardial injury caused by aging combined with diabetes, we performed transcriptome sequencing on glucose-damaged senescent H9c2 cells treated with VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC exosomes. Differential pathway analysis of cell signaling pathways revealed that pathways related to oxidative stress and inflammation were activated in the glucose-damaged aging H9c2 cells (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eC), with a total of 1943 differentially expressed genes. After intervention with VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC exosomes, 263 differentially expressed genes were identified, with 17 genes showing reversed expression levels following exosome treatment (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eD). Sequencing, RT-qPCR, and Western blot experiments confirmed that c-FOS mRNA and protein expression were notably upregulated in both the glucose-damaged aging H9c2 cells and primary rat cardiomyocytes (from diabetic cardiomyopathy tissues of aged diabetic rats), and were considerably reduced after exosome treatment (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eE), suggesting that the c-FOS gene may play a key role in myocardial injury caused by aging combined with high glucose. In addition to the upregulation of c-FOS, the expression levels of Ras, Raf, MEK, and ERK were also elevated, and the phosphorylation levels of MEK and ERK were substantially increased, indicating the activation of the Ras/Raf/ERK/MEK/c-FOS signaling pathway in glucose-damaged senescent cardiomyocytes. After treatment with VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC exosomes, the expression of Ras, Raf, MEK, ERK, and c-FOS was markedly reduced, and the phosphorylation levels of MEK and ERK were decreased (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eF). This suggests that MSC exosomes can significantly inhibit the activation of the Ras/Raf/ERK/MEK/c-FOS pathway in injured cardiomyocytes, thereby slowing or repairing myocardial damage caused by aging combined with high glucose, and improving heart function.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAging-related myocardial deterioration, compounded by diabetic myocardial injury, leads to progressive cardiac dysfunction that remains difficult to manage, with no effective intervention strategies currently available. Given the advantages and characteristics of VCAM-1⁺ UC-MSCs and their exosomes, this study established both cellular and animal models of myocardial injury in elderly diabetic subjects to investigate ferroptosis and the protective and reparative mechanisms of MSC-derived exosomes. Our findings demonstrated that myocardial injury resulting from aging combined with diabetes exhibits significant characteristics of ferroptosis. Treatment with VCAM-1⁺ UC-MSCs or their exosomes effectively alleviated myocardial damage, cellular senescence, and ferroptosis, leading to improved cardiac function. Furthermore, myocardial cells subjected to aging-related diabetic injury exhibited activation of the Ras/Raf/MEK/ERK/c-FOS signaling pathway. VCAM-1⁺ UC-MSC-derived exosomes were found to mitigate ferroptosis by inhibiting this pathway, thereby repairing myocardial injury induced by the combined effects of aging and diabetes and improving cardiac function. These findings provide novel insights into the mechanisms underlying diabetic cardiomyopathy in aging populations and highlight the therapeutic potential of VCAM-1⁺ UC-MSC-derived exosomes in the treatment of myocardial dysfunction associated with aging and diabetes.\u003c/p\u003e \u003cp\u003eThe process of organismal aging is characterized by the progressive decline of myocardial structure and function, accompanied by a reduced capacity to withstand environmental stress. In the presence of diabetes, hyperglycemia and insulin resistance further contribute to myocardial metabolic dysregulation\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, interstitial fibrosis, and coronary microvascular dysfunction, exacerbating myocardial structural damage and functional impairment. The combined effects of aging-related myocardial deterioration and diabetes-induced myocardial injury can lead to cardiac dysfunction or failure, ultimately resulting in diabetic cardiomyopathy in the elderly. The pathogenesis of this condition is complex and remains incompletely understood.\u003c/p\u003e \u003cp\u003eFerroptosis is a mode of cell death dependent on phospholipid peroxidation and regulated by multiple metabolic events. It plays a critical role in various organ injuries and degenerative diseases. Studies have shown that ferroptosis contributes to ischemia- or drug-induced cardiomyopathy, acute renal failure, and atherosclerosis25. Notably, ferroptosis inhibitors have been found to considerably reduce cardiomyocyte death and alleviate myocardial tissue damage and functional impairment8,9. Our study reveals significant iron accumulation, mitochondrial structural and functional damage, oxidative stress, and elevated lipid peroxidation in glucose-damaged senescent cardiomyocytes and myocardial tissues of aged rats with diabetic cardiomyopathy (DCM). These changes are accompanied by increased ferritin expression and markedly decreased levels of GPX4 and SLC7A11. This phenotype of aging combined with glucose-induced damage exhibits distinct characteristics of ferroptosis, suggesting that cardiomyocyte ferroptosis may be a key mechanism underlying aged diabetic cardiomyopathy. During cellular senescence, a series of metabolic and functional alterations occur, including redox imbalance, elevated oxidative stress, and promotion of inflammatory responses and lipid peroxidation26. The accumulation of lipid peroxides, along with pro-inflammatory cytokines such as TNF-α and IL-1β, further accelerates cellular aging while disrupting iron metabolism, leading to intracellular iron accumulation and ferroptotic cell death. Additionally, oxidative stress, inflammatory factors, and hyperglycemic conditions in diabetes induce the upregulation of the transcription factor c-Fos, which regulates the expression of genes related to iron metabolism and ferroptosis, thereby affecting intracellular iron accumulation and cellular sensitivity to ferroptosis27,28. Moreover, potentiated c-Fos expression may exacerbate cellular injury by modulating inflammatory cytokine expression. Our findings further confirm that in both glucose-damaged senescent cardiomyocyte injury models and myocardial tissues of aged diabetic cardiomyopathy rats, c-Fos is significantly upregulated, while oxidative stress, inflammatory responses, iron metabolism dysregulation, and insulin resistance are activated. These results suggest that in myocardial injury caused by aging combined with high glucose exposure, c-Fos exacerbates cardiomyocyte susceptibility to ferroptosis by modulating oxidative stress, inflammatory responses, and iron metabolism, ultimately leading to cardiomyocyte damage.\u003c/p\u003e \u003cp\u003eMSCs exhibit strong immunomodulatory properties, high migratory capacity, antioxidative effects, and the ability to reduce inflammatory responses, promote cell proliferation and differentiation, and facilitate tissue repair29. Given these advantageous characteristics, MSCs hold great potential for clinical disease treatment and tissue regeneration. However, MSCs are a heterogeneous cell population, and their functionality and therapeutic efficacy vary significantly depending on their source. Moreover, MSC transplantation faces challenges such as low survival rates, limited homing ability, and weak engraftment and repair capabilities for damaged tissues. The mechanisms underlying MSC function are complex. Besides their multilineage differentiation potential, MSCs primarily exert their effects through paracrine mechanisms, including the secretion of cytokines and exosomes. However, the functions and regulatory mechanisms of cytokines and exosomes secreted by MSCs in different microenvironments remain not fully understood. Given their significant advantages and potential, MSC-derived exosomes have been widely explored in disease diagnosis, therapy, drug delivery, and regenerative medicine30. Nonetheless, due to the heterogeneity of MSCs from different donors and tissue sources, as well as variations in preparation techniques, MSC-derived exosomes exhibit substantial differences in morphology, surface markers, cargo composition, and biological functions. Additionally, their in vivo distribution, enrichment in target tissues, and stability are difficult to precisely control. Exosomes primarily exert their effects through multiple pathways and targets via their encapsulated bioactive components, including non-coding RNAs, DNA, RNA, and proteins31. However, the complexity of exosomal cargo contributes to their functional diversity and, in some cases, even opposing effects. The mechanisms underlying their functions remain intricate and insufficiently studied.\u003c/p\u003e \u003cp\u003eMSCs expressing high levels of VCAM-1 were induced using a specific combination of cytokines (IL-1β\u0026thinsp;+\u0026thinsp;IL-4\u0026thinsp;+\u0026thinsp;IFN-γ). These VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs exhibit enhanced proliferative and secretory capacities and possess stronger hematopoietic reconstruction and immune regulatory functions15. Importantly, they effectively repaired myocardial and vascular damage in aged diabetic rats, leading to improved cardiac function. To investigate the mechanism underlying the repair of myocardial injury by VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs, we isolated and prepared exosomes from VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs, co-cultured them with high-glucose-induced senescent cardiomyocytes, and treated aged diabetic cardiomyopathy rats. The results demonstrated that intervention with VCAM-1\u0026thinsp;+\u0026thinsp;MSC-derived exosomes significantly reduced myocardial injury, cellular senescence, and ferroptosis while promoting myocardial tissue repair and improving cardiac function. Compared with UC-MSC-derived exosomes, VCAM-1\u0026thinsp;+\u0026thinsp;MSC-derived exosomes exhibited stronger myocardial repair capacity, greater inhibition of ferroptosis, and more pronounced suppression of c-FOS expression. These findings suggest that VCAM-1\u0026thinsp;+\u0026thinsp;MSC-derived exosomes possess potent therapeutic effects in repairing aging- and diabetes-related myocardial injury. Further investigation into the molecular mechanisms underlying these effects is warranted to provide a more comprehensive understanding and inform potential therapeutic strategies.\u003c/p\u003e \u003cp\u003eOur study confirmed that VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs not only highly express VCAM-1 but also exhibit elevated expression of stromal cell-derived factor-1 (SDF-1). Notably, injured tissues often show high expression of C-X-C chemokine receptor type 4 (CXCR4)32. The interaction between SDF-1 and its receptor CXCR4 facilitates the directed migration and homing of MSCs to the site of tissue injury. Additionally, SDF-1 plays a crucial role in maintaining MSC stemness and preserving their regenerative potential. VCAM-1 can bind to integrins α4β1 and α4β7, mediating the adhesive properties of cells. The high expression of VCAM-1 on MSCs facilitates their engraftment at sites of tissue injury. The high viability and regenerative capacity of VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs are closely associated with their upregulated expression of VCAM-1 and SDF-1. Specifically, SDF-1 guides MSC migration toward injured tissues, while VCAM-1 enhances their adhesion and engraftment, working synergistically to promote tissue repair. Furthermore, exosomes derived from VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs are presumed to contain not only the conventional bioactive components of UC-MSCs but also high levels of VCAM-1 and SDF-1. These exosomes accumulate at the injury site, which further facilitates the migration, adhesion, and colonization of MSCs to the injured tissues, thereby enhancing the repair function. This may be the reason why VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSC-derived exosomes exhibit superior myocardial repair capabilities. However, further in-depth studies are needed to verify this hypothesis.\u003c/p\u003e \u003cp\u003eThe heterogeneity of MSC-derived exosomes and the complexity of their cargo contribute to their diverse functions and mechanisms of action, leading to a significant gap in the understanding of their precise biological effects. In our study, myocardial injury caused by aging and diabetes activated ferroptosis, accompanied by increased expression of Ras, Raf, MEK, ERK, and c-Fos, as well as significantly elevated phosphorylation levels of MEK and ERK. These findings suggest that the Ras/Raf/MEK/ERK/c-Fos signaling pathway is activated in myocardial cells under aging-related diabetic myocardial injury, and ferroptosis may be regulated by this pathway. Following treatment with VCAM-1⁺ UC-MSC exosomes, myocardial cell ferroptosis and activation of the Ras/Raf/MEK/ERK/c-Fos pathway were considerably inhibited. This indicates that MSC-derived exosomes suppress ferroptosis by modulating the Ras/Raf/MEK/ERK/c-Fos pathway, thereby mitigating myocardial injury and improving cardiac function. The Ras/Raf/MEK/ERK/c-Fos signaling pathway is one of the most critical intracellular signaling cascades, transmitting extracellular signals to the nucleus through a series of kinase activation events. It regulates the expression of genes involved in various cellular processes, such as cell proliferation, differentiation, death, cell cycle, metabolism, oxidative stress, and inflammatory responses33. In aging-related diabetic cardiomyopathy, inflammatory factors associated with the aging phenotype and the hyperglycemic environment activate myocardial cell receptor tyrosine kinases, leading to the activation of Ras and Raf. Subsequently, phosphorylated MEK activates ERK, which enters the nucleus to phosphorylate c-Fos, and binds with c-Jun to form the AP-1 complex. This complex regulates genes associated with redox balance, iron metabolism, and ferroptosis, thereby activating ferroptosis and causing myocardial cell damage. MSC-derived exosomes may inhibit the activation of the Ras/Raf/MEK/ERK/c-Fos pathway in aging-injured myocardial cells via specific cellular components or cytokines, thereby suppressing ferroptosis and improving aging-related diabetic myocardial injury and cardiac function. Furthermore, exosomes derived from VCAM-1\u0026thinsp;+\u0026thinsp;UC-MSCs may further enhance MSC homing and colonization at injury sites through their high levels of VCAM-1 and SDF-1, thereby boosting the reparative effects of MSCs. A notable limitation of the present study is the lack of comprehensive characterization of the bioactive constituents within exosomes derived from VCAM-1⁺ MSCs, particularly regarding the enrichment of VCAM-1 and SDF-1 and their potential roles in mediating myocardial repair by MSCs. These aspects warrant further investigation and will be prioritized in our subsequent research endeavors.\u003c/p\u003e \u003cp\u003eIn summary, our study has demonstrated that VCAM-1⁺ MSC-derived exosomes mitigate cardiomyocyte ferroptosis by inhibiting the Ras/Raf/MEK/ERK/c-FOS pathway, and subsequently repair the myocardial injury resulting from the superimposition of ageing-caused myocardial degeneration and diabetes-induced myocardial damage in elderly diabetic cardiomyopathy, hereby ameliorating cardiac function. This study lays a foundation for further elucidating the ferroptosis mechanisms of myocardial injury in elderly diabetic cardiomyopathy and for identifying potential strategies and targets utilizing MSCs and their exosomes in the prevention and treatment of myocardial injury in this context.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study demonstrates that VCAM-1⁺ MSCs-derived exosomes effectively attenuate cardiomyocyte ferroptosis via suppressing the Ras/Raf/MEK/ERK/c-FOS signaling pathway, thereby ameliorating myocardial injury caused by the superimposed confluence of age-related myocardial senescence and diabetic detrimental effects in elderly diabetes mellitus, which lays a foundation for identifying potential prevention and treatment strategies and targets of MSCs and -derived exosomes on myocardial injury.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"558\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eAbbreviation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eFull Term\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eMesenchymal stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eSTZ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003estreptozotocin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eROS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003ereactive oxygen species\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eSASP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003esenescence-associated secretory phenotype\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eVCAM-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003evascular cell adhesion molecule-1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eEVs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eextracellular vesicles\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eUC-MSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eumbilical cord mesenchymal stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eFBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003efetal bovine serum\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eSD rats\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eSprague-Dawley rats\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eHFD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003ehigh-fat diet\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eINS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003einsulin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003etriglyceride\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eTotal Cholesterol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eH₂O₂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003ehydrogen peroxide\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eGLU\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eglucose\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003e\u0026beta;-gal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003e\u0026beta;-galactosidase\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eLVEDD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eleft ventricular end-diastolic diameter\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eLVESD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eleft ventricular end-systolic diameter\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eLVEF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eleft ventricular ejection fraction\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eHE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003ehematoxylin-eosin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eSDF-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003estromal cell-derived factor-1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 28.853%;\"\u003e\n \u003cp\u003eCXCR4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71.147%;\"\u003e\n \u003cp\u003eC-X-C chemokine receptor type 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, the UC-MSCs derived from infant umbilical cord (UC) tissue were provided by the National Engineering Research Center of Cell Products/Tianjin Amcell Gene Engineering Co., Ltd. The procurement and use of UC tissue has been ethically approved by the National Engineering Research Center of Cell Products Administration, and informed consent was obtained from all volunteer donors.\u003c/p\u003e\n\u003cp\u003eThe study involving the establishment of an aging type 2 diabetic rat model and exosome-based treatment were conducted in strict adherence to the Guidelines for Ethical Review of Laboratory Animal Welfare (GB/T 35892-2018). The animal study was reviewed and approved by Laboratory Animal Science and Technology Work Management Committee, School of Basic Medicine, Lanzhou University (No. Lzujcyxy20240219, Title: Establishment of an Aged Type 2 Diabetic Rat Model and Investigation of Exosome Therapy; Data of approval: Feb 20, 2024).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read and approved the final version of the manuscript and consent to its publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data of this study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFundings\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of China (82200326), the Gansu Provincial Youth Science and Technology Fund (22JR5RA939), and the Joint Collaborative Research Project Commissioned by The First Hospital of Lanzhou University (2022620005002181, 2022620005002182)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXYY, YMW and YL contributed equally to this work and are considered co-first authors. XYY and YMY conceived and designed the study. XYY and YL performed the experiments. YL, GC and JC contributed to data analysis and interpretation. JC and YML provided technical support. HLW and YMW supervised the study, provided funding and revised the manuscript. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have not use AI-generated work in this manuscript \u003cstrong\u003eAuthors\u0026apos; information (optional)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWorld Health Organization. Global Burden of Disease 2021: Findings from the GBD 2021 Study | Institute for Health Metrics and Evaluation. https://www.healthdata.org/research-analysis/library/global-burden-disease-2021-findings-gbd-2021-study (2024).\u003c/li\u003e\n\u003cli\u003eDemir, S., Nawroth, P. P., Herzig, S. \u0026amp; Ekim \u0026Uuml;st\u0026uuml;nel, B. Emerging Targets in Type 2 Diabetes and Diabetic Complications. \u003cem\u003eAdv Sci (Weinh)\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 2100275 (2021).\u003c/li\u003e\n\u003cli\u003eRubler, S. \u003cem\u003eet al.\u003c/em\u003e New type of cardiomyopathy associated with diabetic glomerulosclerosis. \u003cem\u003eAm J Cardiol\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 595\u0026ndash;602 (1972).\u003c/li\u003e\n\u003cli\u003eKannel, W. B., Hjortland, M. \u0026amp; Castelli, W. P. Role of diabetes in congestive heart failure: the Framingham study. \u003cem\u003eAm J Cardiol\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 29\u0026ndash;34 (1974).\u003c/li\u003e\n\u003cli\u003ePalmer, A. K., Gustafson, B., Kirkland, J. L. \u0026amp; Smith, U. Cellular senescence: at the nexus between ageing and diabetes. \u003cem\u003eDiabetologia\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 1835\u0026ndash;1841 (2019).\u003c/li\u003e\n\u003cli\u003eWu, S. \u003cem\u003eet al.\u003c/em\u003e Hyperglycemia-Driven Inhibition of AMP-Activated Protein Kinase \u0026alpha;2 Induces Diabetic Cardiomyopathy by Promoting Mitochondria-Associated Endoplasmic Reticulum Membranes In Vivo. \u003cem\u003eCirculation\u003c/em\u003e \u003cstrong\u003e139\u003c/strong\u003e, 1913\u0026ndash;1936 (2019).\u003c/li\u003e\n\u003cli\u003ePalmer, A. K. \u003cem\u003eet al.\u003c/em\u003e Targeting senescent cells alleviates obesity‐induced metabolic dysfunction. \u003cem\u003eAging Cell\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, e12950 (2019).\u003c/li\u003e\n\u003cli\u003eGao, M., Monian, P., Quadri, N., Ramasamy, R. \u0026amp; Jiang, X. Glutaminolysis and Transferrin Regulate Ferroptosis. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 298\u0026ndash;308 (2015).\u003c/li\u003e\n\u003cli\u003eFang, X. \u003cem\u003eet al.\u003c/em\u003e Ferroptosis as a target for protection against cardiomyopathy. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e116\u003c/strong\u003e, 2672\u0026ndash;2680 (2019).\u003c/li\u003e\n\u003cli\u003eYu, Y. \u003cem\u003eet al.\u003c/em\u003e Ferroptosis: a cell death connecting oxidative stress, inflammation and cardiovascular diseases. \u003cem\u003eCell Death Discov.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 193 (2021).\u003c/li\u003e\n\u003cli\u003eFang, X. \u003cem\u003eet al.\u003c/em\u003e Loss of Cardiac Ferritin H Facilitates Cardiomyopathy via Slc7a11-Mediated Ferroptosis. \u003cem\u003eCirc Res\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e, 486\u0026ndash;501 (2020).\u003c/li\u003e\n\u003cli\u003eMarino, F. \u003cem\u003eet al.\u003c/em\u003e Diabetes-Induced Cellular Senescence and Senescence-Associated Secretory Phenotype Impair Cardiac Regeneration and Function Independently of Age. \u003cem\u003eDiabetes\u003c/em\u003e \u003cstrong\u003e71\u003c/strong\u003e, 1081\u0026ndash;1098 (2022).\u003c/li\u003e\n\u003cli\u003eLiu, Y., Wan, Y., Jiang, Y., Zhang, L. \u0026amp; Cheng, W. GPX4: The hub of lipid oxidation, ferroptosis, disease and treatment. \u003cem\u003eBiochim Biophys Acta Rev Cancer\u003c/em\u003e \u003cstrong\u003e1878\u003c/strong\u003e, 188890 (2023).\u003c/li\u003e\n\u003cli\u003eLomax, G. \u0026amp; McNab, A. Harmonizing Standards and Coding for hESC Research. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 201\u0026ndash;202 (2008).\u003c/li\u003e\n\u003cli\u003eLiu, S. \u003cem\u003eet al.\u003c/em\u003e Highly Purified Human Extracellular Vesicles Produced by Stem Cells Alleviate Aging Cellular Phenotypes of Senescent Human Cells. \u003cem\u003eStem Cells\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 779\u0026ndash;790 (2019).\u003c/li\u003e\n\u003cli\u003eZhang, Z. \u003cem\u003eet al.\u003c/em\u003e Mesenchymal Stem Cells Promote the Resolution of Cardiac Inflammation After Ischemia Reperfusion Via Enhancing Efferocytosis of Neutrophils. \u003cem\u003eJ Am Heart Assoc\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e014397 (2020).\u003c/li\u003e\n\u003cli\u003eVagnozzi, R. J. \u003cem\u003eet al.\u003c/em\u003e An acute immune response underlies the benefit of cardiac stem cell therapy. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e577\u003c/strong\u003e, 405\u0026ndash;409 (2020).\u003c/li\u003e\n\u003cli\u003eRiazifar, M. \u003cem\u003eet al.\u003c/em\u003e Stem Cell-Derived Exosomes as Nanotherapeutics for Autoimmune and Neurodegenerative Disorders. \u003cem\u003eACS Nano\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 6670\u0026ndash;6688 (2019).\u003c/li\u003e\n\u003cli\u003ePi\u0026ntilde;eiro-Ramil, M., G\u0026oacute;mez-Seoane, I., Rodr\u0026iacute;guez-Cendal, A. I., Fuentes-Boquete, I. \u0026amp; D\u0026iacute;az-Prado, S. Mesenchymal stromal cells-derived extracellular vesicles in cartilage regeneration: potential and limitations. \u003cem\u003eStem Cell Res Ther\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 11 (2025).\u003c/li\u003e\n\u003cli\u003eRahbaran, M. \u003cem\u003eet al.\u003c/em\u003e Therapeutic utility of mesenchymal stromal cell (MSC)-based approaches in chronic neurodegeneration: a glimpse into underlying mechanisms, current status, and prospects. \u003cem\u003eCell Mol Biol Lett\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 56 (2022).\u003c/li\u003e\n\u003cli\u003eWei, Y. \u003cem\u003eet al.\u003c/em\u003e High‐efficient generation of VCAM‐1+ mesenchymal stem cells with multidimensional superiorities in signatures and efficacy on aplastic anaemia mice. \u003cem\u003eCell Prolif\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, e12862 (2020).\u003c/li\u003e\n\u003cli\u003eZhang, X. \u003cem\u003eet al.\u003c/em\u003e VCAM-1+ hUC-MSCs Exert Considerable Neuroprotection Against Cerebral Infarction in Rats by Suppression of NLRP3-Induced Pyroptosis. \u003cem\u003eNeurochem Res\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 3084\u0026ndash;3098 (2023).\u003c/li\u003e\n\u003cli\u003eAkbar, N. \u003cem\u003eet al.\u003c/em\u003e Rapid neutrophil mobilization by VCAM-1+ endothelial cell-derived extracellular vesicles. \u003cem\u003eCardiovasc Res\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e, 236\u0026ndash;251 (2022).\u003c/li\u003e\n\u003cli\u003eOgrodnik, M. \u003cem\u003eet al.\u003c/em\u003e Cellular senescence drives age-dependent hepatic steatosis. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 15691 (2017).\u003c/li\u003e\n\u003cli\u003eSun, D.-Y. \u003cem\u003eet al.\u003c/em\u003e Pro-ferroptotic signaling promotes arterial aging via vascular smooth muscle cell senescence. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1429 (2024).\u003c/li\u003e\n\u003cli\u003eCalcinotto, A. \u003cem\u003eet al.\u003c/em\u003e Cellular Senescence: Aging, Cancer, and Injury. \u003cem\u003ePhysiological Reviews\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 1047\u0026ndash;1078 (2019).\u003c/li\u003e\n\u003cli\u003eHe, Y. \u003cem\u003eet al.\u003c/em\u003e Butyrate reverses ferroptosis resistance in colorectal cancer by inducing c-Fos-dependent xCT suppression. \u003cem\u003eRedox Biol\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 102822 (2023).\u003c/li\u003e\n\u003cli\u003eC-FOS inhibition promotes pancreatic cancer cell ferroptosis by transcriptionally regulating the expression of SLC7A11 | Functional \u0026amp; Integrative Genomics. https://link.springer.com/article/10.1007/s10142-024-01429-5.\u003c/li\u003e\n\u003cli\u003eMesenchymal stem/stromal cells in cancer therapy - PMC. https://pmc.ncbi.nlm.nih.gov/articles/PMC8596342/.\u003c/li\u003e\n\u003cli\u003eTan, F. \u003cem\u003eet al.\u003c/em\u003e Clinical applications of stem cell-derived exosomes. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 17 (2024).\u003c/li\u003e\n\u003cli\u003eColombo, M., Raposo, G. \u0026amp; Th\u0026eacute;ry, C. Biogenesis, Secretion, and Intercellular Interactions of Exosomes and Other Extracellular Vesicles. \u003cem\u003eAnnual Review of Cell and Developmental Biology\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 255\u0026ndash;289 (2014).\u003c/li\u003e\n\u003cli\u003eTeicher, B. A. \u0026amp; Fricker, S. P. CXCL12 (SDF-1)/CXCR4 pathway in cancer. \u003cem\u003eClin Cancer Res\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 2927\u0026ndash;2931 (2010).\u003c/li\u003e\n\u003cli\u003eChang, F. \u003cem\u003eet al.\u003c/em\u003e Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. \u003cem\u003eLeukemia\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1263\u0026ndash;1293 (2003).\u003cstrong\u003e\u003c/strong\u003e\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Antibodies used for Immunoblots. (Materials and Methods-3.10)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"558\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eAntibody\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003eDilution\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eCompany\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eServicebio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eServicebio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eSDF-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eBOSTER\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eCD9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eUpingBio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eCD81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eUpingBio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eTSG101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eUpingBio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ep16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbsea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ep53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbmart\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ePhospho-p53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbmart\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ep21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbways\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eNrf2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eImmunoway\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ePhospho-Nrf2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eImmunoway\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eSLC7A11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eBOSTER\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eGPX4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eServicebio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ec-FOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eFerritin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbmart\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eMEK1/2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ePhospho-MEK1/2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAffinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eERK1+ERK2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ePhospho-ERK1+ERK2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eRas\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eA-Raf\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eImmunoway\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003ePhospho-A-Raf\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eImmunoway\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eHRP, Goat anti-Rat IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eServicebio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 32.316%;\"\u003e\n \u003cp\u003eHRP, Goat anti-Rabbbit IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.2873%;\"\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.8761%;\"\u003e\n \u003cp\u003eServicebio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.5206%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2. Primer sequence. (Materials and Methods-3.11)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"558\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eForward sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eReverse sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eCAAGTTCAACGGCACAGTCAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eACATACTCAGCACCAGCATCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eP16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eACCAGTTCGGGAGGCAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eCACAGTGGGTGGGCATCGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eP53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eAGATGTTCCGAGAGCTGAATGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eAGGCTGGAGGCTGGAGTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eP21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eACCAGTTCGGGAGGCAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eACCTGCTGTGTCGAGAATATCCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eSLC7A11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eTCATCATCGGCACCGTCATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eCTCCACAGGCAGACCAGAACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eGPX4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eACCAGTTCGGGAGGCAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eCACAGTGGGTGGGCATCGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003ec-Fos\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eACCATGTCAGGCGGCAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eATCTTATTCCTTTCCCTTCGGATTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eTFR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eCGGAAGAGGCGGACAAGTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eGCTGCTTGATGATGTCAGTGAACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eFTH1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eAACCAGCGAGGTGGACGAATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eGCCAGTTTGTGAAGTTCCAGTAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003eNCOA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eGAAGGGAAGGACAAGAATGGAATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eGGTGTCTTAGCGTGTTCTGTTAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.6201%;\"\u003e\n \u003cp\u003ePRDX3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.681%;\"\u003e\n \u003cp\u003eGCCTTTAGCACCAGTTCTTCATTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 45.6989%;\"\u003e\n \u003cp\u003eACTCTCCATTGACAACAGCAGTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"VCAM-1 High-Performance MSC, Exosomes, Myocardial injury, Elderly diabetes mellitus","lastPublishedDoi":"10.21203/rs.3.rs-6195440/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6195440/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The cardiac dysfunction in elderly diabetes, resulting from the superimposition of age-related myocardial senescence and diabetes-induced myocardial injury, is difficult to intervene and lacks effective therapeutic strategies. Recent studies have revealed that ferroptosis may be a key mechanism underlying cardiomyocyte injury in diabetic cardiomyopathy. Mesenchymal stem cells (MSCs) and their secreted exosomes have shown potential in promoting cardiomyocyte repair, restoring cardiac function, improving insulin sensitivity, and mitigating diabetes-related complications. MSCs or their secreted exosomes may promote the repair of cardiomyocytes and the recovery of cardiac function, while also improving insulin sensitivity and alleviating the damage of diabetic complications. However, the mechanisms of actions of MSCs and -derived exosomes, as well as their relationship with ferroptosis, remain unclear.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e The model of high-glucose-damaged senescent cardiomyocytes was established by continuously culturing H9c2 cells or primary rat cardiomyocytes in a high-glucose condition, combined with H₂O₂ induction. And, the animal model of diabetic cardiomyopathy in aged rats was established by high-fat diet feeding combined with streptozotocin (STZ) administration, and followed keeping on high-fat diet. The cell model and animal model were administrated with VCAM-1⁺ MSCs derived exosomes, subsequently, the cell phenotypes, transcriptome sequencing, cardiac function, and the expression of genes related to senescence and ferroptosis were assessed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e In high-glucose-damaged senescent H9c2 cells and primary cardiomyocytes, as well as in myocardial tissues from rats with aged diabetic cardiomyopathy, mitochondrial damage, iron-ion accumulation, and reactive oxygen species (ROS) were significantly elevated, accompanied with weakened cardiac function and pronounced features of senescence and ferroptosis. After intervention with VCAM-1⁺ MSCs or their exosomes, the degree of cardiomyocyte injury, senescence, and ferroptosis was alleviated, leading to improved cardiac function. In injury senescent diabetic cardiomyocytes and myocardial tissue, Ras/Raf/MEK/ERK/c-FOS pathway was activated, while MSC-derived exosomes treatment significantly inhibited this pathway activation. Notably, the reparative effect of VCAM-1⁺ MSCs-derived exosomes on myocardial injury was superior to that of conventional MSCs-derived exosomes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e Exosomes derived from VCAM-1\u003csup\u003e+\u003c/sup\u003e MSCs attenuate cardiomyocyte ferroptosis via suppression of Ras/Raf/MEK/ERK/c-FOS pathway, thereby ameliorating myocardial injury resulting from superimposition of ageing-caused myocardial senescence and diabetes-induced myocardial damage in elderly diabetic cardiomyopathy.\u003c/p\u003e","manuscriptTitle":"Reparative Effects of VCAM-1 High-Performance MSC-derived Exosomes on Aged Diabetic Cardiomyocyte Injury: A Focus on Ferroptosis Suppression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-04 05:08:38","doi":"10.21203/rs.3.rs-6195440/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"818602ec-de9d-4027-9e00-dcbb72335aa0","owner":[],"postedDate":"April 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-30T05:53:57+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-04 05:08:38","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6195440","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6195440","identity":"rs-6195440","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-02T02:00:03.124865+00:00
License: CC-BY-4.0