Molecular Cytogenetics of Chromosome 2St as Well as Chromosome 3St Derived from Thinopyrum Intermedium and Thinopyrum Ponticum

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-16

This study derived and characterized six wheat-alien disomic substitution lines carrying chromosomes 2St and 3St from *Thinopyrum intermedium* and *Thinopyrum ponticum*, identifying chromosome 2St conferring increased kernel weight and stripe rust resistance, and chromosome 3St conferring high stripe rust resistance.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-16 · read from full text

This preprint studied the cytogenetic identity and functional value of alien chromosome substitutions in wheat by generating six disomic substitution lines carrying either the Thinopyrum intermedium–derived St chromosomes (2St: ES-23/25/26 and 3St: ES-24) or the Thinopyrum ponticum–derived St chromosomes (2St: DS2St/ES-9 and 3St: DS3St/ES-10). The lines were characterized using sequential FISH, GISH/mc-GISH, and wheat 15K SNP array genotyping with marker selection, and the authors developed St-specific SLAF-seq markers; they report that the FISH karyotypes of Th. ponticum 2St/3St chromosomes align with those of Th. intermedium, that specific hybrid chromosome configurations largely formed as expected, and that 2St vs 3St lines differed in stripe rust resistance stage specificity. A limitation explicitly stated is that the work is a preprint and has not been peer reviewed, and it presents partial molecular marker and performance evaluation within this genetic background framework. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Owing to the excellent resistance to abiotic and biotic stress, Thionpyrum intermedium (2n = 6x = 42, JJJsJsStSt) and Thinopyrum ponticum (2n = 10x = 70) are both widely utilized in wheat germplasm innovation programs. Disomic substitution lines (DSLs) carrying one pair of alien chromosomes are valuable bridge materials for novel genes transmission. In this study, six wheat-Thinopyrum DSLs were derived from crosses between Abbondanza nullisomic lines (2n = 40) and two octoploid Trititrigia lines (2n = 8x = 56), characterized by a sequential fluorescence in situ hybridization (FISH)-genome in situ hybridization (GISH), a multicolor GISH (mc-GISH), and an analysis of wheat 15K SNP array combined with molecular marker selection. ES-9 and ES-10 were two wheat- Th. ponticum disomic substitution lines, DS2St (2A) and DS3St (3D). While ES-23, ES-24, ES-25, and ES-26 were four wheat- Th. intermedium disomic substitution lines, DS2St (2A), DS3St (3D), DS2St (2B), DS2St (2D). The FISH karyotypes of Th. ponticum 2St/3St chromosomes were well coincident with the ones of Th. intermedium. The chromosome configurations of F1 hybrids derived from crosses between ES-23 and ES-9, as well as ES-24 and ES-10 were mostly formed 21Ⅱ. Four St-chromosome-specific markers were developed by specific-locus amplified fragment sequencing (SLAF-seq). Additionally, the substitution lines containing chromosome 2St conferred higher thousand-kernel weight and stripe rust resistance at adult stages, while the substitution lines containing chromosome 3St were highly resistant to stripe rust at all stages. Therefore, these six substitution lines could serve as useful bridging parents for wheat genetic improvement.
Full text 166,309 characters · extracted from preprint-html · click to expand
Molecular Cytogenetics of Chromosome 2St as Well as Chromosome 3St Derived from Thinopyrum Intermedium and Thinopyrum Ponticum | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Cytogenetics of Chromosome 2St as Well as Chromosome 3St Derived from Thinopyrum Intermedium and Thinopyrum Ponticum Siwen Wang, Changyou Wang, Xianbo Feng, Jixin Zhao, Pingchuan Deng, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-461930/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Owing to the excellent resistance to abiotic and biotic stress, Thionpyrum intermedium (2 n = 6 x = 42, JJJ s J s StSt) and Thinopyrum ponticum (2 n = 10 x = 70) are both widely utilized in wheat germplasm innovation programs. Disomic substitution lines (DSLs) carrying one pair of alien chromosomes are valuable bridge materials for novel genes transmission. In this study, six wheat- Thinopyrum DSLs were derived from crosses between Abbondanza nullisomic lines (2 n = 40) and two octoploid Trititrigia lines (2 n = 8 x = 56), characterized by a sequential fluorescence in situ hybridization (FISH)-genome in situ hybridization (GISH), a multicolor GISH (mc-GISH), and an analysis of wheat 15K SNP array combined with molecular marker selection. ES-9 and ES-10 were two wheat- Th. ponticum disomic substitution lines, DS2St (2A) and DS3St (3D). While ES-23, ES-24, ES-25, and ES-26 were four wheat- Th. intermedium disomic substitution lines, DS2St (2A), DS3St (3D), DS2St (2B), DS2St (2D). The FISH karyotypes of Th. ponticum 2St/3St chromosomes were well coincident with the ones of Th. intermedium . The chromosome configurations of F 1 hybrids derived from crosses between ES-23 and ES-9, as well as ES-24 and ES-10 were mostly formed 21Ⅱ. Four St-chromosome-specific markers were developed by specific-locus amplified fragment sequencing (SLAF-seq). Additionally, the substitution lines containing chromosome 2St conferred higher thousand-kernel weight and stripe rust resistance at adult stages, while the substitution lines containing chromosome 3St were highly resistant to stripe rust at all stages. Therefore, these six substitution lines could serve as useful bridging parents for wheat genetic improvement. Agronomy Molecular Biology Plant Molecular Biology and Genetics Thinopyrum intermedium Thinopyrum ponticum alien disomic substitution lines stripe rust resistance St-chromosome-specific molecular markers Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Intermediate wheatgrass ( Thinopyrum intermedium Barkworth & D.R. Dewey, JJJ s J s StSt, 2 n = 6 x = 42) and tall wheatgrass ( Thinopyrum ponticum (Podp.) Barkworth & D. R. Dewey, 2 n = 10 x = 70) are important allopolyploids of Thinoprum species. Because of the desirable tolerance to biotic and abiotic stresses, both of them have been widely used in wheat chromosome engineering breeding for decades (Chen et al. 2003 ; Li et al. 2008 ). According to previous studies, neither the chromosomal composition of Th. intermedium nor Th. ponticum has been fully characterized. In terms of Th. intermedium , the chromosomal composition is generally regarded as JJJ s J s StSt (Chen et al. 1998 ) or J r J r J vs J vs StSt (Wang et al. 2015 ). The subgenome J or J r is highly homologous with genome J ( Th. bessarabicum , J b , E b )/E ( Th. elongatum , J e , E e ) (Liu and Wang 1993), and the main controversy has been whether the genome V originating from Dasypyrum villosum (2 n = 2 x = 14, VV) was involved in the recombinant subgenome J s or not (Wang and Lu 2014 ; Deng et al. 2013 ). Additionally, it was convinced that Th. intermedium contained a set of St chromosomes which probably derived from diploid Pseudoroegneria spicata (2 n = 2 x = 14, StSt) (Mahelka et al. 2011 ; Cseh et al. 2019 ). However, it has been still unclear that whether Th. ponticum contains St chromosomes and if the St genome as well as the J/E genome were affected by recombination during the allopolyploidization process (Kruppa and Molnár-Láng 2016 ; He et al. 2017 ). Although there are aspects of Th. intermedium genome and Th. ponticum genome remain undiscovered, numerous partial amphiploid lines have been successfully developed during the past decades (Fedak et al. 2000 ; Han et al. 2004 ; Zheng et al. 2014 ; Kruppa et al. 2016 ). Octoploid Trititrigia with advantageous traits served as significant cytogenetic resources to develop alien introgression lines and could be further applied to wheat breeding programs (Li et al. 2016b ; Li et al. 2019a ; Li et al. 2019b ; Zheng et al. 2020 ). Furthermore, octoploid Trititrigia lines mostly carry a synthetic genome inherited from Th. intermedium or Th. ponticum . According to the defined genome composition of partial amphiploids by molecular cytogenetic mothed, to some degree, it is possible to understand the chromosomal compositions of Thinopyrum allopolyploids. TAF46 is an important wheat- Th. intermedium partial amphiploid with a common wheat Vilmorin 27 background, and the six disomic addition lines L1, L2, L3, L4, L5 with L7 were developed from TAF46 (Figueiras et al. 1986 ). Subsequently, molecular cytogenetic identification of TAF46 as well as the derived six addition lines revealed that the genome composition of TAF46 is 14A + 14B + 14D + 2(1J) + 2(2St) + 2(3J) + 2(4St) + 2(5J) + 2(6St) + 2(7J) (Friebe et al. 1992 ; Chen et al. 1999 ; Forster et al. 2009 ). It is suggested that chromosomes of St genome contained in Th. intermedium could be stably inherited. It is feasible to introduce the St chromosomes into common wheat background for wheat genetic improvement. Stripe rust ( Puccinia striiformis f.sp. tritici , Pst ) is a recurrent damaging disease causes serious yields decrease of wheat annually (Chen 2005 ). Development and transfer of novel resistant genes contained in wheat related wild species is one of the most efficient and environment-friendly solutions. According to previous studies, St chromosomes originating from Th. intermedium carry several new stripe rust resistance genes, which are potentially optimal genetic resources for wheat breeding. Except the named wheat- Th. intermedium disomic addition lines, L4 (DA4St) and L7 (DA6St), a DS1St (1D) with stripe rust resistance was produced (Hu et al. 2010 ). Additionally, a DA3St (Nie et al. 2019 ) and a DA7St (Song et al. 2013) were characterized, both carrying stripe rust resistant gene(s). Now FISH karyotypes of Th. intermedium have yet to be constructed, which limits the improvement of germplasm materials identification efficiency. Based on molecular cytogenetic identification of wheat- Th. intermedium DALs or DSLs, the St chromosome FISH karyotypes are able to be established. However, at present no wheat- Th. intermedium 2St disomic substitution lines or 2St chromosome FISH karyotypes have been reported. In the present study, four wheat- Th. intermedium disomic substitution lines, ES-22, ES-23, ES-25 and ES-26, were generated from crosses between Abbondanza nullisomic lines (2 n = 40) and Zhong4 (a wheat- Th. intermedium partial amphiploid with stripe rust, 2 n = 8 x = 56) with consecutive self-crosses for several years. While two wheat- Th. ponticum disomic substitution lines, ES-9 and ES-10, were derived from Xiaoyan784 (a wheat- Th. ponticum partial amphiploid with stripe rust, 2 n = 8 x = 56) by the same procedure. Molecular cytogenetic analysis was to determine and compare the genome composition of the six alien lines, and two 2St-chromosome-specific markers and two 3St-chromosome-specific markers were developed by SLAF-sEq. Disease evaluation results indicated that the alien lines containing Thinopyrum chromosome 2St (ES-9, ES-23, ES-25 and ES-26) conferred high level stripe rust resistance at adult stages, while alien lines containing Thinopyrum chromosome 3St (ES-10 and ES-24) are highly resistant to stripe rust at all stages. In addition, potential value of the morphological characteristics for wheat breeding was evaluated. Materials And Methods Plant materials The plant materials include Thinopyrum intermedium (2 n = 6 x = 42, JJJ s J s StSt), Thinopyrum ponticum (2 n = 10 x = 70), diploid Pseudoroegneria spicata (2 n = 2 x = 14, StSt), tetraploid Pseudoroegneria spicata (2 n = 4 x = 28, StStStSt), Thinopyrum bessarabicum (2 n = 2 x = 14, JJ), Thinopyrum elongatum (2 n = 2 x = 14, EE), wheat cv. Chinese Spring (CS), the Abbondanza lines, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, Zhong4 and Xiaoyan784, as well as two wheat- Th. intermedium disomic addition lines, L4 (DA4St) and L7 (DA6St). Twenty-six F 1 hybrids obtained from hybridizations between two pairs of cross combinations, ES-9 and ES-23 (15 plants) as well as ES-10 and ES-24 (11 plants). The BC 1 F 2 population comprising 60 individuals were derived from crosses between ES-24 and the wheat landrace Huixianhong (HXH). Five wheat- Th. intermedium disomic addition lines were developed via hybridization between Abbondanza nullisomic lines and Zhong4, including DA1St, DA2St, DA3St, DA5St and DA7St (unpublished data). All the above-mentioned plant materials were preserved at the College of Agronomy, Northwest A&F University, China. HXH was served as a susceptible control in the stripe rust resistance evaluation. The Pst races CYR32 were used for seedling stage of stripe rust resistance evaluation as well as the CYR31 and CYR32 mixture were used for adult stage evaluation. All the Pst races were provided by the College of Plant Protection, Northwest A&F University, China. In situ hybridization Chromosome spreads by drop method (Han et al. 2004) were used for in situ hybridization analyses. The protocols of genomic DNA extracting and sequential FISH–GISH as well as mc-GISH were conducted by Wang et al. (Wang et al. 2019). According to the nick translation method, total genomic DNA of Th. bessarabicum , Th . intermedium , as well as Th . ponticum was labeled with fluorescein-12-dUTP, while St genomic DNA from diploid and tetraploid P. spicata was labeled with Texas Red-5-Dutp, respectively, used as GISH and mc-GISH probes. And the sheared DNA of CS was as a blocking DNA. The Oligonucleotide probes combination of Oligo-pTa535 (red) and Oligo-pSc119.2 (green) were used for FISH analyses. Hybridization signals were observed and acquired under an Olympus BX53 fluorescence microscope. Wheat 15K SNP array analysis Wheat 15K SNP genotyping arrays were used to genotype the 9 samples, including Abbondanza, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, Th. ponticum and Th. intermedium , by using Illumina SNP genotyping technology (China Golden Marker Biotechnology Company). There were 13199 SNP loci contained in the wheat 15K array and distributed on all 21 wheat chromosomes. The calculation of the percentage of the same genotype between two materials in each chromosome was carried out as the total number of markers divided by the loci number of the same genotypes. The software Origin (OriginLab, USA) was used for data analysis and graphing. PLUG markers analysis The polymerase chain reaction (PCR)–based landmark unique gene (PLUG) markers ( http://wheat.pw.usda.gov/SNP/new/pcr_primers.shtml ) were selected for 21 wheat chromosomes among homoeologous groups 1 to 7 and then synthesized by AuGCT DNA-SYN Biotechnology Co. (Beijing, China). PCR assays and electrophoresis procedures were conducted as described (Zhu et al. 2017). Stripe rust resistance and agronomic traits evaluation The stripe rust resistance evaluation was conducted in the field at the adult stage, while seedling stage test was conducted in the greenhouse. A mixture Pst races of CYR31 and CYR32 was used to evaluated the adult plant resistance of Abbondanza, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, Xiaoyan 784 and Zhong 4, with HXH severed as susceptible control. For further genetic analyses of the resistance, Pst races CYR32 was used to inoculate the above-mentioned materials at the seedling stage as well as the BC 1 F 2 population individuals of ES-24 and HXH. The infection type (IT) was scored with a scale of 0-4 (Ma et al. 1995). To assess the morphological traits, ten plants of each materials (Abbondanza, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, Xiaoyan 784 and Zhong 4,) at physiology maturity stage were randomly selected during the 2019-2020 growing season. There were totally six agronomic traits recorded in the field which involved in plant height, spike length, number of spikelets per plant, number of tillers, number of spikelets per spike, awnedness, and thousand kernel weight. The significant differences of each agronomic trait were analyzed by Duncan’s multiple range test (P < 0.05). Meiotic chromosome pairing analysis of the F 1 hybrids Young spikes of F 1 hybrids derived from the two crosses combinations (ES-9×ES-23 as well as ES-10×ES-24) at propriate stage were extracted at the suitable temperature under field conditions, and immediately treated with Carnoy’s fixative fluid II (6:3:1 ethanol-chloroform-glacial acetic acid solution). Before cytological observation of pollen mother cells, anthers were extracted and stained with 1% acetocarmine. The chromosome configurations in the miosis period were observed, recorded and photographed. Genomic polymorphism analysis by pairwise comparisons On the basis of SLAF-seq (Sun et al. 2013), genomic DNA of Abbondanza, ES-9, ES-10, ES-23, ES-24, Th. intermedium and Th. ponticum was sequenced, carried out by Biomarker Technologies Co. (Beijing, China). The restriction endonuclease, Hae III was selected to digest the genomic DNA. According to the sequence similarity, the filtered SLAF pair-end reads (150 bp per read) were clustered. By using BLAST software, sequences with over 90% identity were divided into one SLAF locus. Genomic polymorphism analyses were conducted by intercomparisons between ES-9 and ES-23, as well as ES-10 and ES-24. Firstly, all the SLAFs from ES-9, ES-10, ES-23 and ES-24 were blasted with wheat genome, removing the sequences with high wheat homology (over 80%). Secondly, the remaining SLAFs of ES-9 and ES-10 were further blasted with the sequences of Th. ponticum , while the SLAFs of ES-23 and ES-24 were blasted with Th. intermedium . Then the SLAFs with high identity (over 90%) of each material were remained, which were served as specific sequences of Th. ponticum attributing to ES-9 and ES-10, as well as the specific sequences of Th. intermedium attributing to ES-23 and ES-24. Finally, pairwise comparisons were conducted and the respective specific SLAFs with high identity (over 90%) were acquired. Development and validation of the St-chromosome-specific markers Based on the respective specific SLAFs obtained from the intercomparisons, PCR primers were designed for the amplification of the two groups of materials (ES-9 and ES-23 as well as ES-10 and ES-24). All the primers were designed by using the online tool (Primer3 Plus, http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi ) and synthesized by AuGCT DNA-SYN Biotechnology Co. (Beijing, China). The amplified products were examined by using 2% agarose gel electrophoresis. The markers amplificated specific sequences in Th. ponticum , tetraploid P. spicata , Th. intermedium , diploid P. spicata , DA2St, ES-9 and ES-23, but not in CS, Abbondanza, Th. bessarabicum , Th. elongatum , the 1St and 3-7St addition lines, were served as 2St-chromosomes-specific molecular markers. While the markers presented in ES-10, ES-24, whereas absent in the 1-2St and 4-7St addition lines, were served as 3St-chromosomes-specific molecular markers. Subsequently, the 3St-chromosomes-specific markers were utilized in BC 1 F 2 individuals of ES-24 and HXH for specificity validation. The PCR amplifications were performed in a reaction of 20μl, containing 1.6μl of template DNA (100ng/µl), 1.6μl dNTP mixture (2.5 mM each), 2μl of 10× PCR buffer (Mg 2+ plus), 1.4μl of each primer (10 µM), 0.1μl rTaq DNA polymerase (2.5 U/μL, Takara) and 13.3μL double-distilled water. The PCR protocol was as follows: 94 °C for 4min, 32 cycles of 94 °C for 30s, 54–60 °C for 35s, 72 °C for 30s, and 72 °C for 30s, 72 °C for 10 min. Results In situ hybridization of the six substitution lines By GISH analysis of somatic cells, alien chromosomes derived from Th. ponticum or Th. intermedium were able to be traced. It was showed that all the six lines, ES-9, ES-10, ES-23, ES-24, ES-25 and ES-26 contained 42 chromosomes (Fig. 1). ES-9 and ES-10 both carried two Th. ponticum chromosomes with a bright-green hybridization signal by using Th. ponticum genome DNA as a probe (Fig. 1, b1 and b2). Whereas ES-23 (Fig. 1, b3), ES-24 (Fig. 1, b4), ES-25 (Fig. 1, b5) and ES-26 (Fig. 1, b6), each of them carried two Th. intermedium chromosomes with a bright-green hybridization signal, by using the GISH probe of Th. intermedium . Therefore, ES-9 and ES-10 were wheat- Th. ponticum disomic substitution lines, and ES-23, ES-24, ES-25, as well as ES-26 were wheat- Th. intermedium disomic substitution lines. Two Oligonucleotide probes of pTa535 and pSc119.2 were combined for a sequential FISH–GISH to simultaneously examine the elimination of wheat chromosomes in the six substitution lines. Pairwise comparisons for the FISH results between substitution lines and the corresponding parent lines, Abbondanza, Zhong4 and Xiaoyan784, were conducted. It was revealed that chromosome 2A was eliminated in ES-9 and substituted by one pair of Th. ponticum chromosomes with three specific signal bands, including the terminal pTa535 hybridization sites detected on short arms and long arms as well as an interstitial pTa535 signal on the long arms, which was different from the FISH patterns of other wheat chromosomes (Fig. 1, a1). ES-10 lost chromosome 3D and contained one pair of Th. ponticum chromosomes carrying terminal pSc119.2 hybridization sites on short arms with terminal pTa535 hybridization segments on the long arms and short arms (Fig. 1, a2). Wheat chromosome 2A, chromosome 2B, and wheat chromosome 2D were eliminated in ES-23 (Fig. 1, a3), ES-25 (Fig. 1, a5) and ES-26 (Fig. 1, a6), respectively, and replaced by the same pair of Th. intermedium chromosomes with the identical FISH patterns of the alien chromosomes presenting in ES-9. Moreover, the telomeric region of chromosome 5B carrying a bright-green fluorescence signal was eliminated in ES-25 compared with other related materials. In terms of ES-24, chromosome 3D was substituted by a pair of Th. intermedium chromosomes with the FISH patterns almost consistent with the alien chromosomes detected in ES-10 (Fig. 1, a4). In addition, according to the mc-GISH results, each of the six derived lines contained two alien chromosomes carrying a bright-red fluorescence signal originating from P. spicata (St) genome DNA (Fig. 1, c1-c6). It was suggested that ES-9 and ES-10 carried two different pairs of St chromosomes derived from Th. ponticum . While ES-23, ES-25 and ES-26 contained the same pair of St chromosomes from Th. intermedium which was distinguished from the pair of St chromosomes in ES-24. Wheat 15K SNP array analysis of the six substitution lines The chromosomal composition of the six substitution lines were determined based on genotype data by using a wheat 15K SNP array (Table S1-6). Generally, the common SNP sequences detected between the substitution lines and the same wheat parent line Abbondanza were much higher than between the substitution lines and Th. ponticum or Th. intermedium . However, obvious point of intersection was found in each of the substitution lines (Fig. 2 a-f). As shown in ES-9 (Fig. 2a), an intersection point was distinctly observed in chromosome 2A, where ES-9 had the most of the same SNP marker loci as Th. ponticum but few SNP marker loci as Abbondanza. According to the same genotype SNP loci number in chromosome 2A, ES-9 contained more of the same genotype SNP loci as Th. ponticum rather than Abbondanza. It suggested that chromosome 2A in ES-9 were replaced by the pair of Th. ponticum chromosome, which was consistent with the FISH result. In ES-10 (Fig. 2b), the intersection point was detected in chromosome 3D where ES-10 had the most of the same SNP marker loci as Th. ponticum but few SNP marker loci compared with Abbondanza, which was consistent with the FISH result, suggesting that chromosome 3D of ES-10 were substituted by the pair of Th. ponticum chromosomes. While in ES-24, the intersection point was also detected in chromosome 3D, but the most of the same SNP marker loci was obtained from the comparison between Th. intermedium and ES-24, which meant that chromosome 3D of ES-24 was replaced by the pair of Th. intermedium chromosomes (Fig. 2d). It was consistent with the FISH analysis of ES-24. In terms of ES-23, ES-25 and ES-26, the intersection point of each material was undoubtedly identified in chromosome 2A (Fig. 2c), chromosome 2B (Fig. 2e), as well as chromosome 2D (Fig. 2f). Combined with the FISH results, it was revealed that chromosome 2A in ES-23, chromosome 2B in ES-25, as well as chromosome 2D in ES-26 were substituted by the same pair of Th. intermedium chromosomes. PLUG marker analysis of the six substitution lines The 135 PLUG markers were screened to further validated the homoeologous groups for the alien chromosomes. There were four PLUG markers ( TNAC1142-Hae III, TNAC1142-Taq I, TNAC1132-Taq I, TNAC1140-Taq I) mapped to the second homoeologous group in ES-9, ES-23, ES-25 and ES-26 (Table S7, Fig. 3a-d). While three pairs of primers ( TNAC1326-Hae III, TNAC1326-Taq I, TNAC1359-Taq I) were distributed in the third homoeologous group in ES-10 and ES-24 (Table S7, Fig. 3e-g). Combined with the mc-GISH results of each substitution lines, it was showed that 2St-chromosome-specific bands could be amplified in ES-9, ES-23, ES-24, ES-25, ES-26, Th. intermedium and Th. ponticum , in addition, 3St-chromosome-specific bands were identified in ES-10, ES-24, as well as, Th. intermedium and Th. ponticum , whereas the above polymorphic bands could not be amplified in Abbondanza. The FISH karyotypes of Th. intermedium chromosomes 2St/3St, as well as, Th. ponticum chromosomes 2St/3St were characterized by in situ hybridization combined with wheat 15K SNP array analyses and a further PLIG marker screening. The genome composition of ES-25 (Fig. 4d) was 14A + 12B + 14D + 2(2St), while that of ES-26 (Fig. 4f) was 14A + 14B + 12D + 2(2St). Remarkably, chromosome 2St contained in ES-23 (Fig. 4b) were derived from Th. intermedium whereas the chromosome 2St of ES-9 (Fig. 4a) were derived from Th. ponticum , but they were for the same genome composition of 12A + 14B+ 14D+ 2(2St). In addition, chromosome 3St of ES-24 (Fig. 4e) and ES-10 (Fig. 4c) derived from Th. intermedium and Th. ponticum , respectively, were for the same genome composition of 14A+ 14B+ 12D+ 2(3St). Evaluation of resistance to stripe rust and agricultural performance of the six substitution lines The agronomic traits of the six substitution lines as well as their parents Abbondanza and Xiaoyan784 (Table 1, Fig 5) or Zhong4 (Table 2, Fig 5) were compared. On average, the tiller number of ES-9 was higher and the spikes exhibited longer than those of Abbondanza. In terms of the other substitution lines derived from Zhong4, both ES-23 and ES-26 showed much more tillers, and the spikelets per spike number of ES-26 was higher than that of Abbondanza as well as Zhong4. Surprisingly, the average thousand kernel weight of the alien lines containing chromosome 2St (ES-9, ES-23, ES-25 and ES-26) were more than 43g. It was indicated that the chromosome 2St whether originating from Th. ponticum or Th. intermedium increased thousand-kernel weight. At the adult stage, stripe rust reaction test of the six substitution lines was conducted by comparisons with the susceptible control (HXH). Sequentially, the IT score of the six substitution lines, Abbondanza, Xiaoyan784, Zhong4, as well as Th. ponticum and Th. intermedium were recorded under field conditions. The IT score of the above-mentioned materials were as follows: Th. ponticum , IT = 0, Th. intermedium , IT = 0, Xiaoyan784, IT = 0, Zhong4, IT = 0, ES-9, IT = 1, ES-10, IT = 0, ES-23, IT = 1, ES-24, IT = 0, ES-25, IT = 1, ES-26, IT = 1, Abbondanza, IT = 3, HXH, IT = 4 (Fig 5c). Furthermore, the seedling stage stripe rust infection was conducted in the greenhouse, and the IT scores were recorded at 24 days post-inoculation (Fig 5d). With an IT score of 0, Zhong4 and Xiaoyan784 were immune to the disease. Additionally, ES-10 and ES-24 were nearly immune (IT score of 1). In contrast, Abbondanza, ES-9, ES-23, ES-25 and ES-26 were susceptible (IT score of 3). The results suggested that ES-9, ES-23, ES-25 and ES-26 carried chromosome 2St of Th. ponticum or Th. intermedium showed highly resistant to stripe rust at the adult stage. While ES-10 and ES-24 contained chromosome 3St of Th. ponticum or Th. intermedium were highly resistant at all stages. Meiotic chromosome pairing analysis of F 1 hybrids Based on molecular cytogenetic identification of the six substitution lines, crosses were made between the alien lines with the same genome compositions, respectively. There were 15 F 1 plants obtained from the cross between ES-9 and ES-23, and 11 F 1 plants obtained from the cross between ES-10 and ES-24. Meiotic chromosome pairing analysis of the F 1 hybrids was conducted to further validate the related genome constitution (Table 3). More than half of the pollen mother cells (PMCs) of ES-9×ES-23 and ES-10×ES-24 had 21 bivalents at metaphase I, and there was no trivalents or quadrivalents, as well as lagging chromosomes observed at meiosis anaphase I. It was indicated that chromosome 2St originating from Th. ponticum and Th. intermedium exhibited the close homologous relationship between each other, so did the Thinopyrum chromosome 3St. Pairwise comparisons of genomic polymorphism analyses and St-chromosomes-specific molecular markers development After high-throughput sequencing, SLAF library was constructed with the sequencing details (Supplementary table 8). A total of 1,055,234 (ES-9), 938,861 (ES-10), 524,288 (ES-23), 1,026,271 (ES-24), 974,634 (Abbobdanza), 572,791 ( Th. intermedium ), and 513,056 ( Th. ponticum ) SLAFs were obtained. By bioinformatics analysis, 3203 (ES-9), 4455 (ES-23), 2775 (ES-10), and 3148 (ES-24) specific sequences were selected for further sequence alignments. There were 78 out of 263 sequences from ES-24 with homology more than 90% of ES-10 (78/153). In addition, 114 out of 221 sequences from ES-23 were more than 90% homologous with ES-9 (114/177). To some degree, these results revealed the possible genomic similarity between chromosome 2St/3St of Th. intermedium and Th. ponticum . According to the above sequence alignment results, 110 fragments from ES-23 were selected, which were regarded as 2St chromosome-specific fragments and then 73 of 3St chromosome-specific fragments from ES-24 were also selected. Subsequently, 183 pairs of primers were designed to amplify fragments from CS, Abbondanza, Zhong4, Xiaoyan784, ES-9, ES-23, ES-10, ES-24. In addition, specificity of the primers was further confirmed by analysis of Th. ponticum , Th. intermedium , tetraploid P. spicata , diploid P. spicata , Th. bessarabicum , Th. elongatum , and the wheat- Th. intermedium 1-7St addition line. A total of two 2St-chromosome-specific molecular markers, PTH-005 and PTH-013, and two 3St-chromosome-specific molecular markers, PTH-113 and PTH-135, were developed (Fig 6, Table 4). Utility of the 3St-chromosome-specific markers in BC 1 F 2 population In order to validate that the stripe rust resistance gene(s) were carried by chromosome 3St, 60 BC 1 F 2 individuals of ES-24 and HXH were further used for a genetic analysis. The evaluation of stripe rust resistance revealed that Zhong4, ES-24, and the 33 F 2 individuals were highly resistant to Pst race CYR32 at the seedling stage (Fig 7a). Subsequently, 10 resistant F 2 individuals as well as 10 susceptible ones were randomly selected for FISH analysis. Compared with the FISH karyotype of ES-24, chromosome 3St were actually detected in the resistant individuals (Fig 7b) and susceptible ones had undetectable FISH pattern of chromosome 3St (Fig 7b). It was indicated that the novel stripe rust resistant gene(s) originated from the chromosome 3St of Th. intermedium . Furthermore, the specificity of newly developed 3St-chromosome-specific molecular markers was confirmed by PCR analyses of the 60 BC 1 F 2 individuals of ES-24 and HXH (Fig 8). Combined with the result of seedling stage stripe rust resistance evaluation, it was revealed that Xiaoyan784, Zhong4, ES-9, ES-24, and the 33 BC 1 F 2 plants conferring strong resistance to Pst race CYR32 carried 3St chromosome-specific markers. Oppositely, the other 26 BC 1 F 2 plants without specific amplification as well as the parental line Abbondanza, and susceptible control HXH were seriously susceptible to Pst race CYR32. It was indicated that the newly developed St-chromosome-specific molecular markers could be used to trace the chromosome 3St in a common wheat background. Discussion On the basis of distant hybridization, chromosome manipulation has been widely utilized for wheat improvement programs, especially for breeding novel disease-resistant wheat lines. During the past few decades, numerous disease-resistant genes contained in wild related species have been successfully transferred to common wheat background by developing introgression lines (Zhan et al. 2014 ; Ma et al. 2016 ; Ceoloni et al. 2017 ; Yang et al. 2021 ). Disomic substitution lines contained one pair of defined alien chromosomes with desirable resistant genes are vital bridge materials for small segments of introgression (Guo et al. 2015 ; Mago et al. 2019 ), which are valuable germplasm resources for wheat disease-resistant breeding. In the current study, six stable wheat- Thinopyrum derived lines with remarkable stripe rust resistance were obtained from wide crosses between Abbondanza nullisomic lines and two different octoploid Trititrigia lines, which can be served as novel resistant germplasms for wheat breeding. As one of the most commonly used technique, FISH analysis is generally used with GISH to discriminate genomic composition and construct the karyotype (Wang et al. 2019 ; Wang et al. 2020b ). In this study, wheat- Th. intermedium disomic substitution lines DS2St (2A), DS2St (2B) and DS2St (2D), as well as wheat- Th. ponticum 2St(2A) disomic substitution line were developed by nullisomic backcross method. After characterized by sequential FISH–GISH and mc-GISH analysis, specific karyotype patterns of chromosome 2St were elucidated, which is significant for rapidly identifying the pair of alien chromosomes in germplasm materials. Furthermore, genomic changes in specific regions frequently happened following the process of distant hybridization (Liu et al. 2009 ; Li et al. 2015 ), which could be accurately detected by FISH. Compared with the parental lines, Abbondanza and Zhong4, telomere with subtelomeric region of chromosome 5BS carrying a blight pSc119.2 hybridization signal was eliminated in ES-25, which resulted a similar FISH pattern to chromosome 2B of common wheat. For chromosome 2B is almost metacentric whereas chromosome 5B is absolutely submetacentric, it was clear that chromosome 2B in ES-25 were replaced by chromosome 2St of Th. intermedium (Fig. 4h). Subtelomeres of Triticeae species were regarded as dynamic and relatively high frequent variable genome organization with constant homogenization between different chromosome ends (Zhang et al. 2004 ). Additionally, subtelomere regions of Schizosaccharomyces pombe showed high sequence variation, but no severe effects on the RNA expression (Oizumi et al. 2021 ). In terms of the deletion of subtelomeric region of chromosome 5BS in ES-25, it is difficult to access the possible function(s) of the regions for the variable nature. The segment elimination may have been resulted from chromosomal rearrangement via the process of chromosome 2St introduction. There were no severe effects detected on viability of ES-25, which suggested that the subtelomeric region eliminations of chromosome 5BS presumably contributed to genome diversity. Based on molecular cytogenetic identification results of the six substitution lines, ES-23 and ES-9 contained the same genome composition of 12A + 14B + 14D + 2(2St), and ES-24 as well as ES-10 were for the same genome composition of 14A + 14B + 12D + 2(3St). It is surprised that FISH patterns of Th. intermedium 2St/3St chromosomes and Th. ponticum are consistent with each other. What else, the agricultural performance evaluation suggested that chromosome 2St derived from Th. intermedium and Th. ponticum both conferred higher thousand-kernel weight, more tillers and stripe rust resistance at adult stages. And chromosome 3St of Th. ponticum and Th. intermedium were both highly resistant to stripe rust at all stages. Because of the same genome compositions, consistent FISH patterns and the similar specific agricultural performances, comparisons between ES-23 and ES-9, as well as ES-24 and ES-10, were further conducted. As one of the most traditional methods, meiotic chromosome pairing analysis of species hybrids has been used to study Triticeae species genome constitution for several decades (Lu and Vonbothmer 1993 ; Yang et al. 2015 ). In terms of the two groups of germplasm materials with the same genome compositions, more than half of the pollen mother cells of the F 1 hybrids perfectly formed 21 bivalents at metaphase I without any trivalents or quadrivalents, which revealed the close homologous relationship between Th. ponticum chromosome 2St/3St and Th. intermedium chromosome 2St/3St, respectively. Furthermore, genomic polymorphism intercomparisons between ES-23 and ES-9, as well as ES-24 and ES-10, were analyzed by SLAF-sEq. According to the sequence alignment results, 114 specific sequences of 221 (ES-23) and 177 (ES-9), as well as 78 specific sequences of 263 (ES-24) and 153 (ES-10) were with homology more than 90%. Overall, it was suggested the possible genomic similarity between chromosome 2St/3St of Th. intermedium and Th. ponticum . The genomic composition of Th. ponticum and Th. intermedium has been an interesting subject for a considerable time (Wang 1992 ; Tiryaki et al. 2021 ). During the past several decades, it was convinced that the set of St chromosomes contained in Th. intermedium were probably derived from P. spicata , whereas it has been still undefined that whether the St genome is one of the sets of chromosomes of Th. ponticum or not (Kruppa and Molnár-Láng 2016 ). In this study, Th. ponticum chromosome 2St/3St and Th. intermedium chromosome 2St/3St were simultaneously identified in the six alien substitution lines derived from two different octoploid Trititrigia lines, Xiaoyan784 (a wheat- Th. ponticum partial amphiploid) and Zhong4 (a wheat- Th. intermedium partial amphiploid). In terms of the FISH patterns of chromosome 2St/3St, no obvious variations were detected in Xiaoyan784, Zhong4 and the six substitution lines (Fig. 4h). It was implied that St chromosomes were not only included in Th. ponticum , but also could be stably inherited. Furthermore, combined with the previous results of the close homologous relationship between Th. ponticum chromosome 2St/3St and that of Th. intermedium , it is convinced that P. spicata representing the complete set of St chromosomes played an important role during the speciation of Th. ponticum , but the effects of the recombination events happened between diverse genomes through the allopolyploidization process need further analyses. Although FISH–GISH analysis has been widely utilized to precisely characterized wheat- Th. intermedium lines for several decades, it is time-consuming. Specific molecular markers are able to rapidly trace the alien chromosome or even small segment introgression with the advantage traits for wheat improvement breeding programs. However, for the complete Th. intermedium genome has not been sequenced, there are only a few chromosome-specific markers enabled to be used (Zhang et al. 2001 ; Hu et al. 2012b ; Li et al. 2016a ). With the development of sequencing technology, 635 unique Th. intermedium SNP markers have been successfully developed, including 135 St-chromosome-specific markers, with 15 of 2St-chromosome-specific markers and 10 of 3St-chromoosme-specific markers (Cseh et al. 2019 ). Due to the much more complex genomic composition of Th. ponticum , molecular marker development work was mainly focused on genome E (Hu et al. 2012a ; Baker et al. 2020 ), especially in the following of the published complete genome of Th. elongatum (Wang et al. 2020a ). In the present study, four wheat- Th. intermedium disomic substitution lines were clearly characterized, of which, ES-23(DS2St (2A)) and ES-24(DS3St (3D)) were further sequenced by SLAF-seq for St-chromosome-specific marker development. And two 2St-chromosome-specific molecular markers, PTH-005 and PTH-013, as well as two 3St-chromosome-specific molecular markers, PTH-113 and PTH-135 were obtained. The FISH analysis results showed chromosome 3St were merely detected in the resistant individuals of the BC 1 F 2 population of ES-24 and HXH (Fig. 7), which meant the stripe rust resistance gene(s) was derived from chromosome 3St of Th. intermedium . The utility of PTH-113 and PTH-135 amplification in the BC 1 F 2 individuals indicated that the St-chromosome-specific molecular markers enabled to serve as useful tools for tracing the St chromosomes of Th. intermedium in common wheat background. In addition, according to the close genetic relationship between Th. ponticum chromosome 2St/3St and that of Th. intermedium analyzed in this study, the four St-chromosome-specific markers could be simultaneously amplified in Th. ponticum , tetraploid P. spicata , Th. intermedium and diploid P. spicata , as well as the corresponding substitution lines, ES-9, ES-23, ES-10 and ES-24 (Fig. 4h). It was speculated that the four St-chromosome-specific markers could also be utilized for tracing the St genome chromosomes of Th. ponticum , which need to be validated in future genetic analyses. Conclusions Four wheat- Thinopyrum intermedium and two wheat- Thinopyrun ponticum alien disomic substitution lines were characterized and compared by molecular cytogenetic analysis. ES-9, ES-23, ES-25 and ES-26 containing chromosome 2St conferred stripe rust resistance at adult stages and higher thousand-kernel weight, and ES-10 as well as ES-24 containing chromosome 3St conferred stripe rust resistance at all stages. What else, four St-chromosome-specific molecular markers were developed. Declarations Acknowledgement We thank Prof. Baotong Wang, college of Plant Protection, Northwest A&F University, Yangling, Shaanxi 712100, China, for providing the Pst races. Author contribution WQJ and CYW designed the project, SWW performed the experiments and drafted the manuscript, JXZ provided help in analysis of wheat 15K SNP array, XBF and PCD provided help in analyzing the morphological characters, YJW and CHC provided help in preparing materials, BTW provided the Pst races. Conflict of interest No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. Ethical standards The authors declare that the experiments comply with the current laws of the country in which they were performed. Funding information This work was supported by the National Key Research and Development Program of China (grant No. 2016YFD0102001). We are grateful for their financial support. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other materials in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. References Baker L, Grewal S, Yang CY, Hubbart-Edwards S, Scholefield D, Ashling S, Burridge AJ, Przewieslik-Allen AM, Wilkinson PA, King IP, King J (2020) Exploiting the genome of Thinopyrum elongatum to expand the gene pool of hexaploid wheat. Theor Appl Genet 133 (7):2213-2226. doi:10.1007/s00122-020-03591-3 Ceoloni C, Forte P, Kuzmanovic L, Tundo S, Moscetti I, De Vita P, Virili ME, D'Ovidio R (2017) Cytogenetic mapping of a major locus for resistance to Fusarium head blight and crown rot of wheat on Thinopyrum elongatum 7EL and its pyramiding with valuable genes from a Th. ponticum homoeologous arm onto bread wheat 7DL. Theor Appl Genet 130 (10):2005-2024. doi:10.1007/s00122-017-2939-8 Chen Q, Conner RL, Laroche A, Ji WQ, Armstrong KC, Fedak G (1999) Genomic in situ hybridization analysis of Thinopyrum chromatin in a wheat - Th. intermedium partial amphiploid and six derived chromosome addition lines. Genome 42 (6):1217-1223. doi:DOI 10.1139/gen-42-6-1217 Chen Q, Conner RL, Laroche A, Thomas JB (1998) Genome analysis of Thinopyrum intermedium and Thinopyrum ponticum using genomic in situ hybridization. Genome 41 (4):580-586 Chen Q, Conner RL, Li HJ, Sun SC, Ahmad F, Laroche A, Graf RJ (2003) Molecular cytogenetic discrimination and reaction to wheat streak mosaic virus and the wheat curl mite in Zhong series of wheat-- Thinopyrum intermedium partial amphiploids. Genome 46 (1):135-145. doi:10.1139/g02-109 Chen XM (2005) Epidemiology and control of stripe rust [Puccinia striiformis f. sp tritici] on wheat. Can J Plant Pathol 27 (3):314-337 Cseh A, Yang CY, Hubbart-Edwards S, Scholefield D, Ashling SS, Burridge AJ, Wilkinson PA, King IP, King J, Grewal S (2019) Development and validation of an exome-based SNP marker set for identification of the St, J(r) and J(vs) geno9.mes of Thinopyrym intermedium in a wheat background. Theor Appl Genet 132 (5):1555-1570. doi:10.1007/s00122-019-03300-9 Deng CL, Bai LL, Fu SL, Yin WB, Zhang YX, Chen YH, Wang RRC, Zhang XQ, Han FP, Hu ZM (2013) Microdissection and Chromosome Painting of the Alien Chromosome in an Addition Line of Wheat - Thinopyrum intermedium . Plos One 8 (8). doi:ARTN e7256410.1371/journal.pone.0072564 Fedak G, Chen Q, Conner RL, Laroche A, Petroski R, Armstrong KW (2000) Characterization of wheat- Thinopyrum partial amphiploids by meiotic analysis and genomic in situ hybridization. Genome 43 (4):712-719. doi:Doi 10.1139/Gen-43-4-712 Figueiras A, González-Jaén M, Benito C (1986) Biochemical evidence of homoeology between Triticum aestivum and Agropyron intermedium chromosomes. TAG Theoretical and applied genetics Theoretische und angewandte Genetik 72 (6):826-832. doi:10.1007/bf00266553 Forster BP, Reader SM, Forsyth SA, Koebner RMD, Miller TE, Gale MD, Cauderon Y (2009) An assessment of the homoeology of six Agropyron intermedium chromosomes added to wheat. Genetical Research 50 (2):91-97. doi:10.1017/s001667230002348x Friebe B, Mukai Y, Gill B, Cauderon Y (1992) C-banding and in-situ hybridization analyses of Agropyron intermedium , a partial wheat x Ag. intermedium amphiploid, and six derived chromosome addition lines. TAG Theoretical and applied genetics Theoretische und angewandte Genetik 84:899-905. doi:10.1007/bf00227402 Guo J, Zhang XL, Hou YL, Cai JJ, Shen XR, Zhou TT, Xu HH, Ohm HW, Wang HW, Li AF, Han FP, Wang HG, Kong LR (2015) High-density mapping of the major FHB resistance gene Fhb7 derived from Thinopyrum ponticum and its pyramiding with Fhb1 by marker-assisted selection. Theor Appl Genet 128 (11):2301-2316. doi:10.1007/s00122-015-2586-x Han FP, Liu B, Fedak G, Liu ZH (2004) Genomic constitution and variation in five partial amphiploids of wheat - Thinopyrum intermedium as revealed by GISH, multicolor GISH and seed storage protein analysis. Theor Appl Genet 109 (5):1070-1076. doi:10.1007/s00122-004-1720-y He F, Xing PY, Bao YG, Ren MJ, Liu SB, Wang YH, Li XF, Wang HG (2017) Chromosome Pairing in Hybrid Progeny between Triticum aestivum and Elytrigia elongata . Front Plant Sci 8. doi:Artn 216110.3389/Fpls.2017.02161 Hu LJ, Li GR, Zeng ZX, Chang ZJ, Liu C, Zhou JP, Yang ZJ (2010) Molecular cytogenetic identification of a new wheat- Thinopyrum substitution line with stripe rust resistance. Euphytica 177 (2):169-177. doi:10.1007/s10681-010-0216-x Hu LJ, Liu C, Zeng ZX, Li GR, Song XJ, Yang ZJ (2012a) Genomic rearrangement between wheat and Thinopyrum elongatum revealed by mapped functional molecular markers. Genes & Genomics 34 (1):67-75. doi:10.1007/s13258-011-0153-7 Hu L, Li G, Zhan H, Liu C, Yang Z (2012b) New St-chromosome-specific molecular markers for identifying wheat-- Thinopyrum intermedium derivative lines. Journal of genetics 91 (2):e69-74 Kruppa K, Molnár-Láng M (2016) Simultaneous visualization of different genomes (J, JSt and St) in a Thinopyrum intermedium x Thinopyrum ponticum synthetic hybrid (Poaceae) and in its parental species by multicolour genomic in situ hybridization (mcGISH). Comp Cytogenet 10 (2):283-293. doi:10.3897/CompCytogen.v10i2.7305 Kruppa K, Turkosi E, Mayer M, Toth V, Vida G, Szakacs E, Molnár-Láng M (2016) McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat x Thinopyrum synthetic hybrid cross. J Appl Genet 57 (4):427-437. doi:10.1007/s13353-016-0343-8 Li AL, Geng SF, Zhang LQ, Liu DC, Mao L (2015) Making the Bread: Insights from Newly Synthesized Allohexaploid Wheat. Molecular Plant 8 (6):847-859. doi:10.1016/j.molp.2015.02.016 Li G, Wang H, Lang T, Li J, La S, Yang E, Yang Z (2016a) New molecular markers and cytogenetic probes enable chromosome identification of wheat- Thinopyrum intermedium introgression lines for improving protein and gluten contents. Planta 244 (4):865-876. doi:10.1007/s00425-016-2554-y Li HW, Boshoff WHP, Pretorius ZA, Zheng Q, Li B, Li ZS (2019a) Establishment of wheat- Thinopyrum ponticum translocation lines with resistance to Puccinia graminis f. sp. tritici Ug99. Journal of Genetics and Genomics 46 (8):405-407. doi:10.1016/j.jgg.2019.07.005 Li HW, Zheng Q, Pretorius ZA, Li B, Tang DZ, Li ZS (2016b) Establishment and characterization of new wheat- Thinopyrum ponticum addition and translocation lines with resistance to Ug99 races. Journal of Genetics and Genomics 43 (9):573-575. doi:10.1016/j.jgg.2016.07.004 Li JB, Chen QH, Zhang P, Lang T, Hoxha S, Li GR, Yang ZJ (2019b) Comparative FISH and molecular identification of new stripe rust resistant wheat- Thinopyrum intermedium ssp. trichophorum introgression lines. Crop J 7 (6):819-829. doi:10.1016/j.cj.2019.06.001 Li Z, Li B, Tong Y (2008) The contribution of distant hybridization with decaploid Agropyron elongatum to wheat improvement in China. Journal of genetics and genomics = Yi chuan xue bao 35 (8):451-456. doi:10.1016/S1673-8527(08)60062-4 Liu B, Xu C, Zhao N, Qi B, Kimatu JN, Pang J, Han F (2009) Rapid genomic changes in polyploid wheat and related species: implications for genome evolution and genetic improvement. Journal of Genetics and Genomics 36 (9):519-528. doi:10.1016/s1673-8527(08)60143-5 Liu ZW, Wang RR (1993) Genome analysis of Elytrigia caespitosa , Lophopyrum nodosum , Pseudoroegneria geniculata ssp. scythica , and Thinopyrum intermedium (Triticeae: Gramineae). Genome 36 (1):102-111. doi:10.1139/g93-014 Lu BR, Vonbothmer R (1993) Meiotic Analysis of Elymus-Caucasicus , E-Longearistatus , and Their Interspecific Hybrids with 23 Elymus Species ( Triticeae, Poaceae ). Plant Systematics and Evolution 185 (1-2):35-53. doi:Doi 10.1007/Bf00937719 Ma H, Singh RP, Mujeebkazi A (1995) Suppression Expression of Resistance to Stripe Rust in Synthetic Hexaploid Wheat ( Triticum-Turgidum X T-Tauschii ). Euphytica 83 (2):87-93. doi:Doi 10.1007/Bf01678034 Ma PT, Xu HX, Han GH, Luo QL, Xu YF, Zhang XT, An DG, Li LH, Sun Y (2016) Characterization of a Segregation Distortion Locus with Powdery Mildew Resistance in a Wheat- Thinopyrum intermedium Introgression Line WE99. Plant Dis 100 (8):1541-1547. doi:10.1094/Pdis-11-15-1352-Re Mago R, Zhang P, Xia XD, Zhang JP, Hoxha S, Lagudah E, Graner A, Dundas I (2019) Transfer of stem rust resistance gene SrB from Thinopyrum ponticum into wheat and development of a closely linked PCR-based marker. Theor Appl Genet 132 (2):371-382. doi:10.1007/s00122-018-3224-1 Mahelka V, Kopecky D, Pastova L (2011) On the genome constitution and evolution of intermediate wheatgrass ( Thinopyrum intermedium: Poaceae, Triticeae ). BMC Evol Biol 11:127. doi:10.1186/1471-2148-11-127 Nie L, Yang Y, Zhang J, Fu T (2019) Disomic chromosome addition from Thinopyrum intermedium to bread wheat appears to confer stripe rust resistance. Euphytica 215 (3). doi:10.1007/s10681-019-2376-7 Oizumi Y, Kaji T, Tashiro S, Takeshita Y, Date Y, Kanoh J (2021) Complete sequences of Schizosaccharomyces pombe subtelomeres reveal multiple patterns of genome variation. Nat Commun 12 (1):611. doi:10.1038/s41467-020-20595-1 Sun XW, Liu DY, Zhang XF, Li WB, Liu H, Hong WG, Jiang CB, Guan N, Ma CX, Zeng HP, Xu CH, Song J, Huang L, Wang CM, Shi JJ, Wang R, Zheng XH, Lu CY, Wang XW, Zheng HK (2013) SLAF-seq: An Efficient Method of Large-Scale De Novo SNP Discovery and Genotyping Using High-Throughput Sequencing. Plos One 8 (3). doi:ARTN e5870010.1371/journal.pone.0058700 Tiryaki I, Karaoglu GB, Yucel G, Tuna M (2021) Assessment of Thinopyrum ponticum (Podp.) Barkworth & D. R. Dewey accessions using universal rice primers and molecular cytogenetics. Genetic Resources and Crop Evolution. doi:10.1007/s10722-020-01101-4 Wang H, Sun S, Ge W, Zhao L, Hou B, Wang K, Lyu Z, Chen L, Xu S, Guo J, Li M, Su P, Li X, Wang G, Bo C, Fang X, Zhuang W, Cheng X, Wu J, Dong L, Chen W, Li W, Xiao G, Zhao J, Hao Y, Xu Y, Gao Y, Liu W, Liu Y, Yin H, Li J, Li X, Zhao Y, Wang X, Ni F, Ma X, Li A, Xu S, Bai G, Nevo E, Gao C, Ohm H, Kong L (2020a) Horizontal gene transfer of Fhb7 from fungus underlies Fusarium head blight resistance in wheat. Science (New York, NY) 368 (6493). doi:10.1126/science.aba5435 Wang RR, Larson SR, Jensen KB, Bushman BS, DeHaan LR, Wang S, Yan X (2015) Genome evolution of intermediate wheatgrass as revealed by EST-SSR markers developed from its three progenitor diploid species. Genome 58 (2):63-70. doi:10.1139/gen-2014-0186 Wang RRC (1992) Genome Relationships in the Perennial Triticeae Based on Diploid Hybrids and Beyond. Hereditas 116 (1-2):133-136. doi:DOI 10.1111/j.1601-5223.1992.tb00217.x Wang RRC, Lu BR (2014) Biosystematics and evolutionary relationships of perennial Triticeae species revealed by genomic analyses. J Syst Evol 52 (6):697-705. doi:10.1111/jse.12084 Wang SW, Wang CY, Wang YZ, Wang YJ, Chen CH, Ji WQ (2019) Molecular cytogenetic identification of two wheat- Thinopyrum ponticum substitution lines conferring stripe rust resistance. Mol Breeding 39 (11). doi:Artn 14310.1007/S11032-019-1053-9 Wang YJ, Long DY, Wang YZ, Wang CY, Liu XL, Zhang H, Tian ZR, Chen CH, Ji WQ (2020b) Characterization and Evaluation of Resistance to Powdery Mildew of Wheat- Aegilops geniculata Roth 7M(g) (7A) Alien Disomic Substitution Line W16998. Int J Mol Sci 21 (5). doi:Artn 186110.3390/Ijms21051861 Yang CR, Zhang HQ, Zhao FQ, Liu XY, Fan X, Sha LN, Kang HY, Wang Y, Zhou YH (2015) Genome constitution of Elymus tangutorum ( Poaceae: Triticeae ) inferred from meiotic pairing behavior and genomic in situ hybridization. J Syst Evol 53 (6):529-534. doi:10.1111/jse.12155 Yang G, Boshoff WHP, Li H, Pretorius ZA, Luo Q, Li B, Li Z, Zheng Q (2021) Chromosomal composition analysis and molecular marker development for the novel Ug99-resistant wheat- Thinopyrum ponticum translocation line WTT34. Theor Appl Genet. doi:10.1007/s00122-021-03796-0 Zhan HX, Li GR, Zhang XJ, Li X, Guo HJ, Gong WP, Jia JQ, Qiao LY, Ren YK, Yang ZJ, Chang ZJ (2014) Chromosomal Location and Comparative Genomics Analysis of Powdery Mildew Resistance Gene Pm51 in a Putative Wheat- Thinopyrum ponticum Introgression Line. Plos One 9 (11). doi:ARTN e11345510.1371/journal.pone.0113455 Zhang P, Li W, Fellers J, Friebe B, Gill BS (2004) BAC-FISH in wheat identifies chromosome landmarks consisting of different types of transposable elements. Chromosoma 112 (6):288-299. doi:10.1007/s00412-004-0273-9 Zhang Z, Xin Z, Larkin P (2001) Molecular characterization of a Thinopyrum intermedium group 2 chromosome (2Ai-2) conferring resistance to barley yellow dwarf virus. Genome 44 (6):1129-1135. doi:10.1139/gen-44-6-1129 Zheng Q, Lv ZL, Niu ZX, Li B, Li HW, Xu SS, Han FP, Li ZS (2014) Molecular Cytogenetic Characterization and Stem Rust Resistance of Five Wheat- Thinopyrum ponticum Partial Amphiploids. Journal of Genetics and Genomics 41 (11):591-599. doi:10.1016/j.jgg.2014.06.003 Zheng XW, Tang CG, Han R, Zhao JJ, Qiao L, Zhang SW, Qiao LY, Ge C, Zheng J, Liu C (2020) Identification, Characterization, and Evaluation of Novel Stripe Rust-Resistant Wheat- Thinopyrum intermedium Chromosome Translocation Lines. Plant Dis 104 (3):875-881. doi:10.1094/Pdis-01-19-0001-Re Zhu C, Wang YZ, Chen CH, Wang CY, Zhang AC, Peng NN, Wang YJ, Zhang H, Liu XL, Ji WQ (2017) Molecular cytogenetic identification of a wheat - Thinopyrum ponticum substitution line with stripe rust resistance. Genome 60 (10):860-867. doi:10.1139/gen-2017-0099 Tables Table 1 Agronomic traits of the alien substitution lines ES-9, ES-10, as well as their parents (Abbondanza, Xiaoyan784) Materials Plant height (cm) Tillers Spike length (cm) Spikelets/ spike Florets/ spikelet Thousand Kenel Weight (g) Awnedness Xiaoyan784 112±6a 11±3b 21±1.5a 25±2a 6±1a 31±0.5c awnless ES-9 105±5a 25±4a 13.9±1b 24±1ab 4±1b 43±1a awnless ES-10 90±5b 18±4ab 14±1.5b 20±1c 5±1ab 36±1b awnless Abbondanza 107±6a 14±3b 14.4±1b 22±1b 4±1b 42±2a awnless Note: Different letters a, b and c indicate significant differences between ES-9, ES-10 and its wheat parent ( P < 0.05) Table 2 Agronomic traits of the substitution lines ES-23, ES-24, ES-25, ES-26, as well as their parents (Abbondanza and Zhong4) Materials Plant height (cm) Tillers Spike length (cm) Spikelets/ spike Florets/ spikelet Thousand Kenel Weight (g) Awnedness Zhong4 127±4a 12±3b 16±1.5a 23±2ab 5±1a 31±0.5c Long awn ES-23 114±5b 23±4a 17±1.5a 21±2bc 4.4±1ab 43±1a awnless ES-24 87±6c 17±4b 11.6±1c 21±1c 4.4±1ab 37±2b Short awn ES-25 93±5c 15±4b 13±1.5b 23±1b 3.7±1b 45±1.5a Short awn ES-26 113±5b 27±4a 14±1.5b 25±1a 4.4±1ab 43±1.5a Short awn Abbondanza 107±6b 14±3b 14.4±1b 22±1b 4±1b 42±2ab awnless Note: Different letters a, b and c indicate significant differences between ES-23, ES-24, ES-25, ES-26 and its wheat parent ( P < 0.05) Table 3 Chromosome pairing in the meiotic and meiotic phases for the hybrid F 1 individuals Material No. of cells Chromosome configuration Univalent Bivalent Trivalent Quadrivalent Rod Ring Total ES-9×ES-23 144 0.47(0-2) 2.69(1-4) 17.93(17-21) 20.62(20-21) 0 0 ES-10×ES-24 135 0.39(0-2) 2.61(1-4) 18.19(17-21) 20.8(20-21) 0 0 Table 4 Specific amplification markers of chromosome 2St and chromosome 3St. Specific primers Primers (5’-3’) Amplified chromosomes Annealing temperatures PTH-005 F: TCCTCAACTGGAAACAAAGGA 2St 56 R: TTGGGAGTGAGTGTAGTTCAC PTH-013 F: AGCCCTCCGGAAAGAATGAA 2St 62 R: CCGCTCAAACAATCGCTACC PTH-113 F: AACAGGGTCAACGGGTTTGA 3St 60 R: TTGGTGCAGAAACAATGCGG PTH-135 F: TGCCTCTAACACATGCATGT 3St 60 R: TCCAGTAGGTCTTGGCTCCA Supplementary Supplementary table 4 to 8 are not available Supplementary Files Thesupplementarytable1.docx Thesupplementarytable2.docx Thesupplementarytable3.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 25 May, 2021 Reviewers invited by journal 13 May, 2021 Editor assigned by journal 26 Apr, 2021 First submitted to journal 24 Apr, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-461930","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":27045854,"identity":"dd973dd2-a285-4f94-9d7a-3b1fb8750b9c","order_by":0,"name":"Siwen Wang","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Siwen","middleName":"","lastName":"Wang","suffix":""},{"id":27045855,"identity":"18509f75-2723-470a-8ea6-42ed550f289d","order_by":1,"name":"Changyou Wang","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Changyou","middleName":"","lastName":"Wang","suffix":""},{"id":27045856,"identity":"bfbbd244-937a-44b8-ad8d-d7799a54a052","order_by":2,"name":"Xianbo Feng","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xianbo","middleName":"","lastName":"Feng","suffix":""},{"id":27045857,"identity":"b88a50e7-4a1c-479e-985e-080aa7b0d1a3","order_by":3,"name":"Jixin Zhao","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jixin","middleName":"","lastName":"Zhao","suffix":""},{"id":27045858,"identity":"11d4a22c-764b-43c1-910d-600c4ba81fdc","order_by":4,"name":"Pingchuan Deng","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pingchuan","middleName":"","lastName":"Deng","suffix":""},{"id":27045859,"identity":"f848bd5a-1974-44a2-885f-c75b1eb86373","order_by":5,"name":"Yajuan Wang","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yajuan","middleName":"","lastName":"Wang","suffix":""},{"id":27045860,"identity":"30cf6185-a163-4b8c-beb8-e2067e8efce8","order_by":6,"name":"Chunhuan Chen","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chunhuan","middleName":"","lastName":"Chen","suffix":""},{"id":27045861,"identity":"be1dd28b-ff94-443c-9037-4e0c78568e99","order_by":7,"name":"Baotong Wang","email":"","orcid":"","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Baotong","middleName":"","lastName":"Wang","suffix":""},{"id":27045862,"identity":"4b7b973d-9d18-4a11-bf79-bc0791be1911","order_by":8,"name":"Wanquan Ji","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYBACxmYYi72x4cCHCgk5fuK18Bw++HDGGQtjyQai7ZNISzbmbatI3EBIC3M7j+HngrLD8uYMOWaSM+dJMG5gYH746AZeh/EYS884d9hwZ8MZM4mP2ySYzRnYjI1z8Grh3SDN23aYccPBHqAt2yTYLBt42KQJaNn8G6jFfsNhHjNp3jkSPAYHCGvZBrIlccMxNqD3GyQkiNDC/82a51x68oYzzMBAPiZhINlMwC+G/ceSb/OUWdtuuP8QGJU1dfX97M0PH+PV0gAi2ZCFmPEoBwF5Bgwto2AUjIJRMArQAACXVE1A5xxC5QAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-0663-4568","institution":"Northwest A\u0026F University: Northwest Agriculture and Forestry University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Wanquan","middleName":"","lastName":"Ji","suffix":""}],"badges":[],"createdAt":"2021-04-25 14:42:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-461930/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-461930/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":9261735,"identity":"b737c248-0a78-42b0-bea1-29f98ac98b28","added_by":"auto","created_at":"2021-05-17 17:38:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":513054,"visible":true,"origin":"","legend":"In situ hybridization patterns of the six alien substitution lines. a FISH patterns of ES-9 (a1), ES-10 (a2), ES-23 (a3), ES-24 (a4), ES-25 (a5) and ES-26 (a6): Oligo-pSc119.2 (green) and Oligo-pTa535 (red) as probes. b GISH patterns of ES-9 (b1) and ES-10 (b2): Thinopyrum ponticum genomic DNA (green) as probe and CS genomic DNA as a blocker; GISH patterns of ES-23 (b3), ES-24 (b4), ES-25 (b5) and ES-26 (b6): Thinopyrum intermedium genomic DNA (green) as probe and CS genomic DNA as a blocker. c Mc-GISH patterns of ES-9 (c1), ES-10 (c2): Thinopyrum bessarabicum (J) genomic DNA (green) and tetraploid Pseudoroegneria spicata (St) genomic DNA (red) as probes, CS genomic DNA as a blocker; ES-23 (c3), ES-24 (c4), ES-25 (c5) and ES-26 (c6): Th. bessarabicum (J) genomic DNA (green) and diploid P. spicata (St) genomic DNA (red) as probes, CS genomic DNA as a blocker. The arrows indicate the alien chromosomes of the six substitution lines.","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/8c600e7e085c2e21ad288bbd.jpg"},{"id":9261344,"identity":"0feef8a6-60f6-4e89-9a5b-4ad4e4cfc8b1","added_by":"auto","created_at":"2021-05-17 17:35:30","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":358585,"visible":true,"origin":"","legend":"Wheat 15K SNP array analysis of the six alien substitution lines. a Wheat 15K SNP array analysis of ES-9. Obvious crossing point were detected in terms of the position of chromosome 2A. b Wheat 15K SNP array analysis of ES-10. Obvious crossing point were detected in terms of the position of chromosome 3D. c Wheat 15K SNP array analysis of ES-23. Obvious crossing point were detected in terms of the position of chromosome 2A. d Wheat 15K SNP array analysis of ES-24. Obvious crossing point were detected in terms of the position of chromosome 3D. e Wheat 15K SNP array analysis of ES-25. Obvious crossing point were detected in terms of the position of chromosome 2B. f Wheat 15K SNP array analysis of ES-26. Obvious crossing point were detected in terms of the position of chromosome 2D.","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/805a092ba1c43eaa7fc9b0ce.jpg"},{"id":9261736,"identity":"f696cfa2-4a97-4371-a8cb-5afe9a70d59f","added_by":"auto","created_at":"2021-05-17 17:38:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":206551,"visible":true,"origin":"","legend":"PLUG markers analysis of Abbondanza, the six alien substitution lines, Thinopyrum intermedium and Thinopyrum ponticum. a TNAC1142-HaeⅢ; b TNAC1142-TaqⅠ; c TNAC1132-TaqⅠ; d TNAC1140-TaqⅠ; e TNAC1326-HaeⅢ; f TNAC1326-TaqⅠ; g TNAC1359-TaqⅠ. Lane M: DL2000; lane 1: Abbondanza; lane 2: ES-9; lane 3: ES-23; lane 4: ES-25; lane 5: ES-26; lane 6: ES-10; lane 7: ES-24; lane 8: Th. intermedium; lane 9: Th. ponticum. The * indicates specific band of Th. ponticum and Th. intermedium.","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/9b83e503b9d97856681282b2.jpg"},{"id":9261073,"identity":"31239bcb-899b-4e51-8743-f19d0e62d5ce","added_by":"auto","created_at":"2021-05-17 17:32:30","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":556840,"visible":true,"origin":"","legend":"Karyotypes of the six alien substitution lines with the genomic composition variations. a Karyotype analysis of ES-9. Wheat chromosome 2A were replaced by Thinopyrum ponticum chromosome 2St. b Karyotype analysis of ES-23. Wheat chromosomes 2A were replaced by Thinopyrum intermedium chromosome 2St. c Karyotype analysis of ES-10. Wheat chromosome 3D were replaced by Th. ponticum chromosome 3St. d Karyotype analysis of ES-25. Wheat chromosome 2B were replaced by Th. intermedium chromosome 2St. e Karyotype analysis of ES-24. Wheat chromosome 3D were replaced by Th. intermedium chromosome 3St. f Karyotype analysis of ES-26. Wheat chromosome 2D were replaced by Th. intermedium chromosome 2St. g FISH analysis of Abbondanza. h FISH pattern comparisons of chromosome 2St, chromosome 3St, chromosome 5B and chromosome 2B between the six alien substitution lines and their parent lines Abbondanza, Xiaoyan784, and Zhong4. The telomeric region of chromosome 5BS carrying a bright-green fluorescence signal was eliminated in ES-25. Chromosome 2B are metacentric in all the above-mentioned materials except ES-25.","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/4fdb0843f445319b9f3044a8.jpg"},{"id":9261074,"identity":"6503e688-b4ca-429a-90a9-1fc2fbacd219","added_by":"auto","created_at":"2021-05-17 17:32:30","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":888116,"visible":true,"origin":"","legend":"Evaluation of agronomic traits and stripe rust resistance. a Adult plants; b seeds; c symptoms in response to inoculation with the mixture of Pst races at the adult stage; d seedling stage reactions to Pst races CYR32. (1) Huixianhong; (2) Abbondanza; (3) ES-9; (4) ES-23; (5) ES-25; (6) ES-26; (7) ES-10; (8) ES-24; (9) Xiaoyan784; (10) Zhong4; (11) Thinopyrum ponticum; (12) Thinopyrum intermedium.","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/e0f5e4465e3ffbeb74856e3a.jpg"},{"id":9261068,"identity":"08495696-7583-49e0-a051-ceb3b0607372","added_by":"auto","created_at":"2021-05-17 17:32:30","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":175530,"visible":true,"origin":"","legend":"Specific amplification markers of chromosome 2St (a and b) and chromosome 3St (c and d). a PTH-005; b PTH-013; c PTH-113; d PTH-135. Lane M: DL2000; lane 1: Chinese Spring; lane 2: Abbondanza; lane 3: Thinopyrum ponticum; lane 4: Thinopyrum intermedium; lane 5: tetraploid Pseudoroegneria spicata; lane 6: diploid Pseudoroegneria spicata; lane 7: Thinopyrum bessarabicum; lane 8: Thinopyrum elongatum; lane 9-15: wheat- Th. intermedium disomic addition lines (DALs), DA1St, DA2St; DA3St; DA4St; DA5St; DA6St; DA7St; lane 16: ES-9 (a and b), ES-10 (c and d); lane 17: ES-23 (a and b), ES-24 (c and d).","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/4ece148814e077190cd17cfd.jpg"},{"id":9261070,"identity":"45a68672-d259-465c-953f-baa50a5c11b0","added_by":"auto","created_at":"2021-05-17 17:32:30","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":261079,"visible":true,"origin":"","legend":"Stripe rust resistance evaluation and FISH analysis in BC1F2 individuals of ES-24 and Huixianhong. a Reactions to inoculation with the Pst race CYR32 of the BC1F2 individuals at the seedling stage; b FISH patterns of susceptible BC1F2 individuals; c FISH patterns of resistant BC1F2 individuals. (1) Huixianhong; (2)-(4) susceptible BC1F2 individuals; (5)-(7) resistant BC1F2 individuals; (8) Zhong4; (9) ES-24. The arrow indicates the chromosome 3St of Th. intermedium.","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/2803a049b3e0e15a832b9cde.jpg"},{"id":9261349,"identity":"d94f7289-8a8d-409e-a328-06eb710ebc42","added_by":"auto","created_at":"2021-05-17 17:35:30","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":288965,"visible":true,"origin":"","legend":"Utility of newly developed 3St-chromosome-specific markers in 60 BC1F2 individuals of ES-24 and Huixianhong (HXH). a PTH-113; b PTH-135. Lane M: DL2000; lane 1: Chinese Spring; lane 2: Abbondanza; lane 3: HXH; lane 4: Xiaoyan784 (wheat- Th. ponticum partial amphiploid with stripe rust); lane 5: Zhong4 (wheat- Th. intermedium partial amphiploid with stripe rust); lane 6: ES-10; lane 7:ES-24; lane 8-67: 60 BC1F2 individuals.","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/0fa39cfe5e1c5fd2e8cec8d3.jpg"},{"id":15672638,"identity":"d70be66a-2949-42cd-a667-c76d100645a3","added_by":"auto","created_at":"2021-11-18 14:13:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1448833,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/79276e86-07d0-4497-aa86-6b626b1bff7b.pdf"},{"id":9261065,"identity":"1573b18d-3df2-45aa-83cb-bd056b462551","added_by":"auto","created_at":"2021-05-17 17:32:30","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":53369,"visible":true,"origin":"","legend":"","description":"","filename":"Thesupplementarytable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/5e09febf4fad4095dddca9c6.docx"},{"id":9261733,"identity":"e754c7b0-44a6-4706-a0ab-082d66cdfe84","added_by":"auto","created_at":"2021-05-17 17:38:30","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":17603,"visible":true,"origin":"","legend":"","description":"","filename":"Thesupplementarytable2.docx","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/537053d2b96e6ff0b350b7bf.docx"},{"id":9261346,"identity":"8877cc2a-f359-4e18-aa65-d39c1b3353cf","added_by":"auto","created_at":"2021-05-17 17:35:30","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":16841,"visible":true,"origin":"","legend":"","description":"","filename":"Thesupplementarytable3.docx","url":"https://assets-eu.researchsquare.com/files/rs-461930/v1/7b524f0fdd6b178bdb0ab4ac.docx"}],"financialInterests":"","formattedTitle":"\u003cp\u003eMolecular Cytogenetics of Chromosome 2St as Well as Chromosome 3St Derived from \u003cem\u003eThinopyrum\u003c/em\u003e \u003cem\u003eIntermedium \u003c/em\u003eand \u003cem\u003eThinopyrum Ponticum\u003c/em\u003e \u003c/p\u003e","fulltext":[{"header":"Introduction","content":" \u003cp\u003eIntermediate wheatgrass (\u003cem\u003eThinopyrum intermedium\u003c/em\u003e Barkworth \u0026amp; D.R. Dewey, JJJ\u003csup\u003es\u003c/sup\u003eJ\u003csup\u003es\u003c/sup\u003eStSt, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;42) and tall wheatgrass (\u003cem\u003eThinopyrum ponticum\u003c/em\u003e (Podp.) Barkworth \u0026amp; D. R. Dewey, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;10\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;70) are important allopolyploids of \u003cem\u003eThinoprum\u003c/em\u003e species. Because of the desirable tolerance to biotic and abiotic stresses, both of them have been widely used in wheat chromosome engineering breeding for decades (Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). According to previous studies, neither the chromosomal composition of \u003cem\u003eTh. intermedium\u003c/em\u003e nor \u003cem\u003eTh. ponticum\u003c/em\u003e has been fully characterized. In terms of \u003cem\u003eTh. intermedium\u003c/em\u003e, the chromosomal composition is generally regarded as JJJ\u003csup\u003es\u003c/sup\u003eJ\u003csup\u003es\u003c/sup\u003eStSt (Chen et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) or J\u003csup\u003er\u003c/sup\u003eJ\u003csup\u003er\u003c/sup\u003eJ\u003csup\u003evs\u003c/sup\u003eJ\u003csup\u003evs\u003c/sup\u003eStSt (Wang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The subgenome J or J\u003csup\u003er\u003c/sup\u003e is highly homologous with genome J (\u003cem\u003eTh. bessarabicum\u003c/em\u003e, J\u003csup\u003eb\u003c/sup\u003e, E\u003csup\u003eb\u003c/sup\u003e)/E (\u003cem\u003eTh. elongatum\u003c/em\u003e, J\u003csup\u003ee\u003c/sup\u003e, E\u003csup\u003ee\u003c/sup\u003e) (Liu and Wang 1993), and the main controversy has been whether the genome V originating from \u003cem\u003eDasypyrum villosum\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;14, VV) was involved in the recombinant subgenome J\u003csup\u003es\u003c/sup\u003e or not (Wang and Lu \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Deng et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Additionally, it was convinced that \u003cem\u003eTh. intermedium\u003c/em\u003e contained a set of St chromosomes which probably derived from diploid \u003cem\u003ePseudoroegneria spicata\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;14, StSt) (Mahelka et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Cseh et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, it has been still unclear that whether \u003cem\u003eTh. ponticum\u003c/em\u003e contains St chromosomes and if the St genome as well as the J/E genome were affected by recombination during the allopolyploidization process (Kruppa and Moln\u0026aacute;r-L\u0026aacute;ng \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; He et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAlthough there are aspects of \u003cem\u003eTh. intermedium\u003c/em\u003e genome and \u003cem\u003eTh. ponticum\u003c/em\u003e genome remain undiscovered, numerous partial amphiploid lines have been successfully developed during the past decades (Fedak et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Zheng et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kruppa et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Octoploid \u003cem\u003eTrititrigia\u003c/em\u003e with advantageous traits served as significant cytogenetic resources to develop alien introgression lines and could be further applied to wheat breeding programs (Li et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2016b\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019b\u003c/span\u003e; Zheng et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Furthermore, octoploid \u003cem\u003eTrititrigia\u003c/em\u003e lines mostly carry a synthetic genome inherited from \u003cem\u003eTh. intermedium\u003c/em\u003e or \u003cem\u003eTh. ponticum\u003c/em\u003e. According to the defined genome composition of partial amphiploids by molecular cytogenetic mothed, to some degree, it is possible to understand the chromosomal compositions of \u003cem\u003eThinopyrum\u003c/em\u003e allopolyploids. TAF46 is an important wheat-\u003cem\u003eTh. intermedium\u003c/em\u003e partial amphiploid with a common wheat Vilmorin 27 background, and the six disomic addition lines L1, L2, L3, L4, L5 with L7 were developed from TAF46 (Figueiras et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1986\u003c/span\u003e). Subsequently, molecular cytogenetic identification of TAF46 as well as the derived six addition lines revealed that the genome composition of TAF46 is 14A\u0026thinsp;+\u0026thinsp;14B\u0026thinsp;+\u0026thinsp;14D\u0026thinsp;+\u0026thinsp;2(1J)\u0026thinsp;+\u0026thinsp;2(2St)\u0026thinsp;+\u0026thinsp;2(3J)\u0026thinsp;+\u0026thinsp;2(4St)\u0026thinsp;+\u0026thinsp;2(5J)\u0026thinsp;+\u0026thinsp;2(6St)\u0026thinsp;+\u0026thinsp;2(7J) (Friebe et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Forster et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). It is suggested that chromosomes of St genome contained in \u003cem\u003eTh. intermedium\u003c/em\u003e could be stably inherited. It is feasible to introduce the St chromosomes into common wheat background for wheat genetic improvement.\u003c/p\u003e \u003cp\u003eStripe rust (\u003cem\u003ePuccinia striiformis f.sp. tritici\u003c/em\u003e, \u003cem\u003ePst\u003c/em\u003e) is a recurrent damaging disease causes serious yields decrease of wheat annually (Chen \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Development and transfer of novel resistant genes contained in wheat related wild species is one of the most efficient and environment-friendly solutions. According to previous studies, St chromosomes originating from \u003cem\u003eTh. intermedium\u003c/em\u003e carry several new stripe rust resistance genes, which are potentially optimal genetic resources for wheat breeding. Except the named wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic addition lines, L4 (DA4St) and L7 (DA6St), a DS1St (1D) with stripe rust resistance was produced (Hu et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Additionally, a DA3St (Nie et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and a DA7St (Song et al. 2013) were characterized, both carrying stripe rust resistant gene(s). Now FISH karyotypes of \u003cem\u003eTh. intermedium\u003c/em\u003e have yet to be constructed, which limits the improvement of germplasm materials identification efficiency. Based on molecular cytogenetic identification of wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e DALs or DSLs, the St chromosome FISH karyotypes are able to be established. However, at present no wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e 2St disomic substitution lines or 2St chromosome FISH karyotypes have been reported.\u003c/p\u003e \u003cp\u003eIn the present study, four wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic substitution lines, ES-22, ES-23, ES-25 and ES-26, were generated from crosses between Abbondanza nullisomic lines (2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;40) and Zhong4 (a wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e partial amphiploid with stripe rust, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;56) with consecutive self-crosses for several years. While two wheat- \u003cem\u003eTh. ponticum\u003c/em\u003e disomic substitution lines, ES-9 and ES-10, were derived from Xiaoyan784 (a wheat- \u003cem\u003eTh. ponticum\u003c/em\u003e partial amphiploid with stripe rust, 2\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8\u003cem\u003ex\u003c/em\u003e\u0026thinsp;=\u0026thinsp;56) by the same procedure. Molecular cytogenetic analysis was to determine and compare the genome composition of the six alien lines, and two 2St-chromosome-specific markers and two 3St-chromosome-specific markers were developed by SLAF-sEq.\u0026nbsp;Disease evaluation results indicated that the alien lines containing \u003cem\u003eThinopyrum\u003c/em\u003e chromosome 2St (ES-9, ES-23, ES-25 and ES-26) conferred high level stripe rust resistance at adult stages, while alien lines containing \u003cem\u003eThinopyrum\u003c/em\u003e chromosome 3St (ES-10 and ES-24) are highly resistant to stripe rust at all stages. In addition, potential value of the morphological characteristics for wheat breeding was evaluated.\u003c/p\u003e "},{"header":"Materials And Methods","content":"\u003ch3\u003ePlant materials\u003c/h3\u003e\n\u003cp\u003eThe plant materials include\u003cem\u003e Thinopyrum intermedium\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 6\u003cem\u003ex\u003c/em\u003e = 42, JJJ\u003csup\u003es\u003c/sup\u003eJ\u003csup\u003es\u003c/sup\u003eStSt), \u003cem\u003eThinopyrum ponticum\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 10\u003cem\u003ex\u003c/em\u003e = 70), diploid\u003cem\u003e Pseudoroegneria spicata\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 2\u003cem\u003ex\u003c/em\u003e = 14, StSt), tetraploid\u003cem\u003e Pseudoroegneria spicata\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 4\u003cem\u003ex\u003c/em\u003e = 28, StStStSt), \u003cem\u003eThinopyrum bessarabicum\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 2\u003cem\u003ex\u003c/em\u003e = 14, JJ), \u003cem\u003eThinopyrum elongatum\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 2\u003cem\u003ex\u003c/em\u003e = 14, EE), wheat cv. Chinese Spring (CS), the Abbondanza lines, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, Zhong4 and Xiaoyan784, as well as two wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic addition lines, L4 (DA4St) and L7 (DA6St). Twenty-six F\u003csub\u003e1\u003c/sub\u003e hybrids obtained from hybridizations between two pairs of cross combinations, ES-9 and ES-23 (15 plants) as well as ES-10 and ES-24 (11 plants). The BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e population comprising 60 individuals were derived from crosses between ES-24 and the wheat landrace Huixianhong (HXH). Five wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic addition lines were developed via hybridization between Abbondanza nullisomic lines and Zhong4, including DA1St, DA2St, DA3St, DA5St and DA7St (unpublished data). All the above-mentioned plant materials were preserved at the College of Agronomy, Northwest A\u0026amp;F University, China. HXH was served as a susceptible control in the stripe rust resistance evaluation. The \u003cem\u003ePst\u003c/em\u003e races CYR32 were used for seedling stage of stripe rust resistance evaluation as well as the CYR31 and CYR32 mixture were used for adult stage evaluation. All the \u003cem\u003ePst\u003c/em\u003e races were provided by the College of Plant Protection, Northwest A\u0026amp;F University, China.\u003c/p\u003e\n\u003ch3\u003eIn situ hybridization\u003c/h3\u003e\n\u003cp\u003eChromosome spreads by drop method (Han et al. 2004) were used for \u003cem\u003ein situ\u003c/em\u003e hybridization analyses. The protocols of genomic DNA extracting and sequential FISH\u0026ndash;GISH as well as mc-GISH were conducted by Wang et al. (Wang et al. 2019). According to the nick translation method, total genomic DNA of\u003cem\u003e Th. bessarabicum\u003c/em\u003e, \u003cem\u003eTh\u003c/em\u003e.\u003cem\u003e intermedium\u003c/em\u003e, as well as\u003cem\u003e Th\u003c/em\u003e.\u003cem\u003e ponticum\u003c/em\u003e was labeled with fluorescein-12-dUTP, while St genomic DNA from diploid and tetraploid \u003cem\u003eP. spicata\u003c/em\u003e was labeled with Texas Red-5-Dutp, respectively, used as GISH and mc-GISH probes. And the sheared DNA of CS was as a blocking DNA. The Oligonucleotide probes combination of Oligo-pTa535 (red) and Oligo-pSc119.2 (green) were used for FISH analyses. Hybridization signals were observed and acquired under an Olympus BX53 fluorescence microscope.\u003c/p\u003e\n\u003ch3\u003eWheat 15K SNP array analysis\u003c/h3\u003e\n\u003cp\u003eWheat 15K SNP genotyping arrays were used to genotype the 9 samples, including Abbondanza, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, \u003cem\u003eTh. ponticum\u003c/em\u003e and \u003cem\u003eTh. intermedium\u003c/em\u003e, by using Illumina SNP genotyping technology (China Golden Marker Biotechnology Company). There were 13199 SNP loci contained in the wheat 15K array and distributed on all 21 wheat chromosomes. The calculation of the percentage of the same genotype between two materials in each chromosome was carried out as the total number of markers divided by the loci number of the same genotypes. The software Origin (OriginLab, USA) was used for data analysis and graphing.\u003c/p\u003e\n\u003ch3\u003ePLUG markers analysis\u003c/h3\u003e\n\u003cp\u003eThe polymerase chain reaction (PCR)\u0026ndash;based landmark unique gene (PLUG) markers (\u003ca href=\"http://wheat.pw.usda.gov/SNP/new/pcr_primers.shtml\"\u003ehttp://wheat.pw.usda.gov/SNP/new/pcr_primers.shtml\u003c/a\u003e) were selected for 21 wheat chromosomes among homoeologous groups 1 to 7 and then synthesized by AuGCT DNA-SYN Biotechnology Co. (Beijing, China). PCR assays and electrophoresis procedures were conducted as described (Zhu et al. 2017).\u003c/p\u003e\n\u003ch3\u003eStripe rust resistance and agronomic traits evaluation\u003c/h3\u003e\n\u003cp\u003eThe stripe rust resistance evaluation was conducted in the field at the adult stage, while seedling stage test was conducted in the greenhouse. A mixture \u003cem\u003ePst \u003c/em\u003eraces of CYR31 and CYR32 was used to evaluated the adult plant resistance of Abbondanza, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, Xiaoyan 784 and Zhong 4, with HXH severed as susceptible control. For further genetic analyses of the resistance, \u003cem\u003ePst \u003c/em\u003eraces CYR32 was used to inoculate the above-mentioned materials at the seedling stage as well as the BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2 \u003c/sub\u003epopulation individuals of ES-24 and HXH. The infection type (IT) was scored with a scale of 0-4 (Ma et al. 1995).\u003c/p\u003e\n\u003cp\u003eTo assess the morphological traits, ten plants of each materials (Abbondanza, ES-9, ES-10, ES-23, ES-24, ES-25, ES-26, Xiaoyan 784 and Zhong 4,) at physiology maturity stage were randomly selected during the 2019-2020 growing season. There were totally six agronomic traits recorded in the field which involved in plant height, spike length, number of spikelets per plant, number of tillers, number of spikelets per spike, awnedness, and thousand kernel weight. The significant differences of each agronomic trait were analyzed by Duncan\u0026rsquo;s multiple range test (P \u0026lt; 0.05).\u003c/p\u003e\n\u003ch3\u003eMeiotic chromosome pairing analysis of the F\u003csub\u003e1\u003c/sub\u003e hybrids\u003c/h3\u003e\n\u003cp\u003eYoung spikes of F\u003csub\u003e1\u003c/sub\u003e hybrids derived from the two crosses combinations (ES-9\u0026times;ES-23 as well as ES-10\u0026times;ES-24) at propriate stage were extracted at the suitable temperature under field conditions, and immediately treated with Carnoy\u0026rsquo;s fixative fluid II (6:3:1 ethanol-chloroform-glacial acetic acid solution). Before cytological observation of pollen mother cells, anthers were extracted and stained with 1% acetocarmine. The chromosome configurations in the miosis period were observed, recorded and photographed.\u003c/p\u003e\n\u003ch3\u003eGenomic polymorphism analysis by pairwise comparisons\u003c/h3\u003e\n\u003cp\u003eOn the basis of SLAF-seq (Sun et al. 2013), genomic DNA of Abbondanza, ES-9, ES-10, ES-23, ES-24, \u003cem\u003eTh. intermedium\u003c/em\u003e and \u003cem\u003eTh. ponticum\u003c/em\u003e was sequenced, carried out by Biomarker Technologies Co. (Beijing, China). The restriction endonuclease, \u003cem\u003eHae\u003c/em\u003e III was selected to digest the genomic DNA. According to the sequence similarity, the filtered SLAF pair-end reads (150 bp per read) were clustered. By using BLAST software, sequences with over 90% identity were divided into one SLAF locus. Genomic polymorphism analyses were conducted by intercomparisons between ES-9 and ES-23, as well as ES-10 and ES-24. Firstly, all the SLAFs from ES-9, ES-10, ES-23 and ES-24 were blasted with wheat genome, removing the sequences with high wheat homology (over 80%). Secondly, the remaining SLAFs of ES-9 and ES-10 were further blasted with the sequences of \u003cem\u003eTh. ponticum\u003c/em\u003e, while the SLAFs of ES-23 and ES-24 were blasted with \u003cem\u003eTh. intermedium\u003c/em\u003e. Then the SLAFs with high identity (over 90%) of each material were remained, which were served as specific sequences of \u003cem\u003eTh. ponticum\u003c/em\u003e attributing to ES-9 and ES-10, as well as the specific sequences of \u003cem\u003eTh. intermedium\u003c/em\u003e attributing to ES-23 and ES-24. Finally, pairwise comparisons were conducted and the respective specific SLAFs with high identity (over 90%) were acquired.\u003c/p\u003e\n\u003ch3\u003eDevelopment and validation of the St-chromosome-specific markers\u003c/h3\u003e\n\u003cp\u003eBased on the respective specific SLAFs obtained from the intercomparisons, PCR primers were designed for the amplification of the two groups of materials (ES-9 and ES-23 as well as ES-10 and ES-24). All the primers were designed by using the online tool (Primer3 Plus, \u003ca href=\"http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi\"\u003ehttp://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi\u003c/a\u003e) and synthesized by AuGCT DNA-SYN Biotechnology Co. (Beijing, China). The amplified products were examined by using 2% agarose gel electrophoresis. The markers amplificated specific sequences in \u003cem\u003eTh. ponticum\u003c/em\u003e, tetraploid\u003cem\u003e P. spicata\u003c/em\u003e, \u003cem\u003eTh. intermedium\u003c/em\u003e, diploid\u003cem\u003e P. spicata\u003c/em\u003e, DA2St, ES-9 and ES-23, but not in CS, Abbondanza, \u003cem\u003eTh. bessarabicum\u003c/em\u003e, \u003cem\u003eTh. elongatum\u003c/em\u003e, the 1St and 3-7St addition lines, were served as 2St-chromosomes-specific molecular markers. While the markers presented in ES-10, ES-24, whereas absent in the 1-2St and 4-7St addition lines, were served as 3St-chromosomes-specific molecular markers. Subsequently, the 3St-chromosomes-specific markers were utilized in BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2 \u003c/sub\u003eindividuals of ES-24 and HXH for specificity validation.\u003c/p\u003e\n\u003cp\u003eThe PCR amplifications were performed in a reaction of 20\u0026mu;l, containing 1.6\u0026mu;l of template DNA (100ng/\u0026micro;l), 1.6\u0026mu;l dNTP mixture (2.5 mM each), 2\u0026mu;l of 10\u0026times; PCR buffer (Mg\u003csup\u003e2+\u003c/sup\u003e\u0026nbsp;plus), 1.4\u0026mu;l of each primer (10 \u0026micro;M), 0.1\u0026mu;l\u003cem\u003e rTaq\u003c/em\u003e\u0026nbsp;DNA polymerase (2.5 U/\u0026mu;L, Takara) and 13.3\u0026mu;L double-distilled water. The PCR protocol was as follows: 94 \u0026deg;C for 4min, 32 cycles of 94 \u0026deg;C for 30s, 54\u0026ndash;60 \u0026deg;C for 35s, 72 \u0026deg;C for 30s, and 72 \u0026deg;C for 30s, 72 \u0026deg;C for 10 min.\u003c/p\u003e"},{"header":"Results","content":"\u003ch3\u003e\u003cem\u003eIn situ\u003c/em\u003e hybridization of the six substitution lines\u003c/h3\u003e\n\u003cp\u003eBy GISH analysis of somatic cells, alien chromosomes derived from \u003cem\u003eTh. ponticum\u003c/em\u003e or \u003cem\u003eTh. intermedium\u003c/em\u003e were able to be traced. It was showed that all the six lines, ES-9, ES-10, ES-23, ES-24, ES-25 and ES-26 contained 42 chromosomes (Fig. 1). ES-9 and ES-10 both carried two \u003cem\u003eTh. ponticum\u003c/em\u003e chromosomes with a bright-green hybridization signal by using \u003cem\u003eTh. ponticum\u003c/em\u003e genome DNA as a probe (Fig. 1, b1 and b2). Whereas ES-23 (Fig. 1, b3), ES-24 (Fig. 1, b4), ES-25 (Fig. 1, b5) and ES-26 (Fig. 1, b6), each of them carried two \u003cem\u003eTh. intermedium\u003c/em\u003e chromosomes with a bright-green hybridization signal, by using the GISH probe of \u003cem\u003eTh. intermedium\u003c/em\u003e. Therefore, ES-9 and ES-10 were wheat- \u003cem\u003eTh. ponticum\u003c/em\u003e disomic substitution lines, and ES-23, ES-24, ES-25, as well as ES-26 were wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic substitution lines.\u003c/p\u003e\n\u003cp\u003eTwo Oligonucleotide probes of pTa535 and pSc119.2 were combined for a sequential FISH\u0026ndash;GISH to simultaneously examine the elimination of wheat chromosomes in the six substitution lines. Pairwise comparisons for the FISH results between substitution lines and the corresponding parent lines, Abbondanza, Zhong4 and Xiaoyan784, were conducted. It was revealed that chromosome 2A was eliminated in ES-9 and substituted by one pair of \u003cem\u003eTh. ponticum\u003c/em\u003e chromosomes with three specific signal bands, including the terminal pTa535 hybridization sites detected on short arms and long arms as well as an interstitial pTa535 signal on the long arms, which was different from the FISH patterns of other wheat chromosomes (Fig. 1, a1). ES-10 lost chromosome 3D and contained one pair of \u003cem\u003eTh. ponticum\u003c/em\u003e chromosomes carrying terminal pSc119.2 hybridization sites on short arms with terminal pTa535 hybridization segments on the long arms and short arms (Fig. 1, a2). Wheat chromosome 2A, chromosome 2B, and wheat chromosome 2D were eliminated in ES-23 (Fig. 1, a3), ES-25 (Fig. 1, a5) and ES-26 (Fig. 1, a6), respectively, and replaced by the same pair of \u003cem\u003eTh. intermedium\u003c/em\u003e chromosomes with the identical FISH patterns of the alien chromosomes presenting in ES-9. Moreover, the telomeric region of chromosome 5B carrying a bright-green fluorescence signal was eliminated in ES-25 compared with other related materials. In terms of ES-24, chromosome 3D was substituted by a pair of \u003cem\u003eTh. intermedium\u003c/em\u003e chromosomes with the FISH patterns almost consistent with the alien chromosomes detected in ES-10 (Fig. 1, a4).\u003c/p\u003e\n\u003cp\u003eIn addition, according to the mc-GISH results, each of the six derived lines contained two alien chromosomes carrying a bright-red fluorescence signal originating from \u003cem\u003eP. spicata\u003c/em\u003e (St) genome DNA (Fig. 1, c1-c6). It was suggested that ES-9 and ES-10 carried two different pairs of St chromosomes derived from \u003cem\u003eTh. ponticum\u003c/em\u003e. While ES-23, ES-25 and ES-26 contained the same pair of St chromosomes from \u003cem\u003eTh. intermedium\u003c/em\u003e which was distinguished from the pair of St chromosomes in ES-24.\u003c/p\u003e\n\u003ch3\u003eWheat 15K SNP array analysis of the six substitution lines\u003c/h3\u003e\n\u003cp\u003eThe chromosomal composition of the six substitution lines were determined based on genotype data by using a wheat 15K SNP array (Table S1-6). Generally, the common SNP sequences detected between the substitution lines and the same wheat parent line Abbondanza were much higher than between the substitution lines and\u003cem\u003e Th. ponticum \u003c/em\u003eor \u003cem\u003eTh. intermedium\u003c/em\u003e. However, obvious point of intersection was found in each of the substitution lines (Fig. 2 a-f). As shown in ES-9 (Fig. 2a), an intersection point was distinctly observed in chromosome 2A, where ES-9 had the most of the same SNP marker loci as \u003cem\u003eTh. ponticum\u003c/em\u003e but few SNP marker loci as Abbondanza. According to the same genotype SNP loci number in chromosome 2A, ES-9 contained more of the same genotype SNP loci as\u003cem\u003e Th. ponticum\u003c/em\u003e rather than Abbondanza. It suggested that chromosome 2A in ES-9 were replaced by the pair of \u003cem\u003eTh. ponticum\u003c/em\u003e chromosome, which was consistent with the FISH result. In ES-10 (Fig. 2b), the intersection point was detected in chromosome 3D where ES-10 had the most of the same SNP marker loci as \u003cem\u003eTh. ponticum\u003c/em\u003e but few SNP marker loci compared with Abbondanza, which was consistent with the FISH result, suggesting that chromosome 3D of ES-10 were substituted by the pair of \u003cem\u003eTh. ponticum\u003c/em\u003e chromosomes. While in ES-24, the intersection point was also detected in chromosome 3D, but the most of the same SNP marker loci was obtained from the comparison between \u003cem\u003eTh. intermedium \u003c/em\u003eand ES-24, which meant that chromosome 3D of ES-24 was replaced by the pair of \u003cem\u003eTh. intermedium\u003c/em\u003e chromosomes (Fig. 2d). It was consistent with the FISH analysis of ES-24. In terms of ES-23, ES-25 and ES-26, the intersection point of each material was undoubtedly identified in chromosome 2A (Fig. 2c), chromosome 2B (Fig. 2e), as well as chromosome 2D (Fig. 2f). Combined with the FISH results, it was revealed that chromosome 2A in ES-23, chromosome 2B in ES-25, as well as chromosome 2D in ES-26 were substituted by the same pair of \u003cem\u003eTh. intermedium\u003c/em\u003e chromosomes.\u003c/p\u003e\n\u003ch3\u003ePLUG marker analysis of the six substitution lines\u003c/h3\u003e\n\u003cp\u003eThe 135 PLUG markers were screened to further validated the homoeologous groups for the alien chromosomes. There were four PLUG markers (\u003cem\u003eTNAC1142-Hae\u003c/em\u003eIII, \u003cem\u003eTNAC1142-Taq\u003c/em\u003eI, \u003cem\u003eTNAC1132-Taq\u003c/em\u003eI, \u003cem\u003eTNAC1140-Taq\u003c/em\u003eI) mapped to the second homoeologous group in ES-9, ES-23, ES-25 and ES-26 (Table S7, Fig. 3a-d). While three pairs of primers (\u003cem\u003eTNAC1326-Hae\u003c/em\u003eIII, \u003cem\u003eTNAC1326-Taq\u003c/em\u003eI, \u003cem\u003eTNAC1359-Taq\u003c/em\u003eI) were distributed in the third homoeologous group in ES-10 and ES-24 (Table S7, Fig. 3e-g). Combined with the mc-GISH results of each substitution lines, it was showed that 2St-chromosome-specific bands could be amplified in ES-9, ES-23, ES-24, ES-25, ES-26, \u003cem\u003eTh. intermedium\u003c/em\u003e and \u003cem\u003eTh. ponticum\u003c/em\u003e, in addition, 3St-chromosome-specific bands were identified in ES-10, ES-24, as well as, \u003cem\u003eTh. intermedium\u003c/em\u003e and\u003cem\u003e Th. ponticum\u003c/em\u003e, whereas the above polymorphic bands could not be amplified in Abbondanza.\u003c/p\u003e\n\u003cp\u003eThe FISH karyotypes of \u003cem\u003eTh. intermedium\u003c/em\u003e chromosomes 2St/3St, as well as,\u003cem\u003e Th. ponticum\u003c/em\u003e chromosomes 2St/3St were characterized by \u003cem\u003ein situ\u003c/em\u003e hybridization combined with wheat 15K SNP array analyses and a further PLIG marker screening. The genome composition of ES-25 (Fig. 4d) was 14A + 12B + 14D + 2(2St), while that of ES-26 (Fig. 4f) was 14A + 14B + 12D + 2(2St). Remarkably, chromosome 2St contained in ES-23 (Fig. 4b) were derived from \u003cem\u003eTh. intermedium\u003c/em\u003e whereas the chromosome 2St of ES-9 (Fig. 4a) were derived from \u003cem\u003eTh. ponticum\u003c/em\u003e, but they were for the same genome composition of 12A + 14B+ 14D+ 2(2St). In addition, chromosome 3St of ES-24 (Fig. 4e) and ES-10 (Fig. 4c) derived from \u003cem\u003eTh. intermedium\u003c/em\u003e and \u003cem\u003eTh. ponticum\u003c/em\u003e, respectively, were for the same genome composition of 14A+ 14B+ 12D+ 2(3St).\u003c/p\u003e\n\u003ch3\u003eEvaluation of resistance to stripe rust and agricultural performance of the six substitution lines\u003c/h3\u003e\n\u003cp\u003eThe agronomic traits of the six substitution lines as well as their parents Abbondanza and Xiaoyan784 (Table 1, Fig 5) or Zhong4 (Table 2, Fig 5) were compared. On average, the tiller number of ES-9 was higher and the spikes exhibited longer than those of Abbondanza. In terms of the other substitution lines derived from Zhong4, both ES-23 and ES-26 showed much more tillers, and the spikelets per spike number of ES-26 was higher than that of Abbondanza as well as Zhong4. Surprisingly, the average thousand kernel weight of the alien lines containing chromosome 2St (ES-9, ES-23, ES-25 and ES-26) were more than 43g. It was indicated that the chromosome 2St whether originating from \u003cem\u003eTh. ponticum\u003c/em\u003e or \u003cem\u003eTh. intermedium\u003c/em\u003e increased thousand-kernel weight.\u003c/p\u003e\n\u003cp\u003eAt the adult stage, stripe rust reaction test of the six substitution lines was conducted by comparisons with the susceptible control (HXH). Sequentially, the IT score of the six substitution lines, Abbondanza, Xiaoyan784, Zhong4, as well as \u003cem\u003eTh. ponticum\u003c/em\u003e and \u003cem\u003eTh. intermedium\u003c/em\u003e were recorded under field conditions. The IT score of the above-mentioned materials were as follows:\u003cem\u003e Th. ponticum\u003c/em\u003e, IT = 0, \u003cem\u003eTh. intermedium\u003c/em\u003e, IT = 0, Xiaoyan784, IT = 0, Zhong4, IT = 0, ES-9, IT = 1, ES-10, IT = 0, ES-23, IT = 1, ES-24, IT = 0, ES-25, IT = 1, ES-26, IT = 1, Abbondanza, IT = 3, HXH, IT = 4 (Fig 5c). Furthermore, the seedling stage stripe rust infection was conducted in the greenhouse, and the IT scores were recorded at 24 days post-inoculation (Fig 5d). With an IT score of 0, Zhong4 and Xiaoyan784 were immune to the disease. Additionally, ES-10 and ES-24 were nearly immune (IT score of 1). In contrast, Abbondanza, ES-9, ES-23, ES-25 and ES-26 were susceptible (IT score of 3). The results suggested that ES-9, ES-23, ES-25 and ES-26 carried chromosome 2St of \u003cem\u003eTh. ponticum\u003c/em\u003e or \u003cem\u003eTh. intermedium\u003c/em\u003e showed highly resistant to stripe rust at the adult stage. While ES-10 and ES-24 contained chromosome 3St of \u003cem\u003eTh. ponticum\u003c/em\u003e or \u003cem\u003eTh. intermedium\u003c/em\u003e were highly resistant at all stages.\u003c/p\u003e\n\u003ch3\u003eMeiotic chromosome pairing analysis of F\u003csub\u003e1\u003c/sub\u003e hybrids\u003c/h3\u003e\n\u003cp\u003eBased on molecular cytogenetic identification of the six substitution lines,\u0026nbsp;crosses were made between the alien lines with the same genome compositions, respectively. There were 15 F\u003csub\u003e1\u003c/sub\u003e plants obtained from the cross between ES-9 and ES-23, and 11 F\u003csub\u003e1\u003c/sub\u003e plants obtained from the cross between ES-10 and ES-24. Meiotic chromosome pairing analysis of the F\u003csub\u003e1 \u003c/sub\u003ehybrids was conducted to further validate the related genome constitution (Table 3). More than half of the pollen mother cells (PMCs) of ES-9\u0026times;ES-23 and ES-10\u0026times;ES-24 had 21 bivalents at metaphase I, and there was no trivalents or quadrivalents, as well as lagging chromosomes observed at meiosis anaphase I. It was indicated that chromosome 2St originating from\u003cem\u003e Th. ponticum\u003c/em\u003e and \u003cem\u003eTh. intermedium\u003c/em\u003e exhibited the close homologous relationship between each other, so did the \u003cem\u003eThinopyrum\u003c/em\u003e chromosome 3St.\u003c/p\u003e\n\u003ch3\u003ePairwise comparisons of genomic polymorphism analyses and St-chromosomes-specific molecular markers development\u003c/h3\u003e\n\u003cp\u003eAfter high-throughput sequencing, SLAF library was constructed with the sequencing details (Supplementary table 8). A total of 1,055,234 (ES-9), 938,861 (ES-10), 524,288 (ES-23), 1,026,271 (ES-24), 974,634 (Abbobdanza), 572,791 (\u003cem\u003eTh. intermedium\u003c/em\u003e), and 513,056 (\u003cem\u003eTh. ponticum\u003c/em\u003e) SLAFs were obtained. By bioinformatics analysis, 3203 (ES-9), 4455 (ES-23), 2775 (ES-10), and 3148 (ES-24) specific sequences were selected for further sequence alignments. There were 78 out of 263 sequences from ES-24 with homology more than 90% of ES-10 (78/153). In addition, 114 out of 221 sequences from ES-23 were more than 90% homologous with ES-9 (114/177). To some degree, these results revealed the possible genomic similarity between chromosome 2St/3St of \u003cem\u003eTh. intermedium\u003c/em\u003e and \u003cem\u003eTh. ponticum\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eAccording to the above sequence alignment results, 110 fragments from ES-23 were selected, which were regarded as 2St chromosome-specific fragments and then 73 of 3St chromosome-specific fragments from ES-24 were also selected. Subsequently, 183 pairs of primers were designed to amplify fragments from CS, Abbondanza, Zhong4, Xiaoyan784, ES-9, ES-23, ES-10, ES-24. In addition, specificity of the primers was further confirmed by analysis of \u003cem\u003eTh. ponticum\u003c/em\u003e,\u003cem\u003e Th. intermedium\u003c/em\u003e, tetraploid\u003cem\u003e P. spicata\u003c/em\u003e, diploid\u003cem\u003e P. spicata\u003c/em\u003e, \u003cem\u003eTh. bessarabicum\u003c/em\u003e, \u003cem\u003eTh. elongatum\u003c/em\u003e, and the wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e 1-7St addition line. A total of two 2St-chromosome-specific molecular markers, PTH-005 and PTH-013, and two 3St-chromosome-specific molecular markers, PTH-113 and PTH-135, were developed (Fig 6, Table 4).\u003c/p\u003e\n\u003ch3\u003eUtility of the 3St-chromosome-specific markers in BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e population\u003c/h3\u003e\n\u003cp\u003eIn order to validate that the stripe rust resistance gene(s) were carried by chromosome 3St, 60 BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e individuals of ES-24 and HXH were further used for a genetic analysis. The evaluation of stripe rust resistance revealed that Zhong4, ES-24, and the 33 F\u003csub\u003e2 \u003c/sub\u003eindividuals were highly resistant to \u003cem\u003ePst \u003c/em\u003erace CYR32 at the seedling stage (Fig 7a). Subsequently, 10 resistant F\u003csub\u003e2 \u003c/sub\u003eindividuals as well as 10 susceptible ones were randomly selected for FISH analysis. Compared with the FISH karyotype of ES-24, chromosome 3St were actually detected in the resistant individuals (Fig 7b) and susceptible ones had undetectable FISH pattern of chromosome 3St (Fig 7b). It was indicated that the novel stripe rust resistant gene(s) originated from the chromosome 3St of \u003cem\u003eTh. intermedium\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eFurthermore, the specificity of newly developed 3St-chromosome-specific molecular markers was confirmed by PCR analyses of the 60 BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e individuals of ES-24 and HXH (Fig 8). Combined with the result of seedling stage stripe rust resistance evaluation, it was revealed that Xiaoyan784, Zhong4, ES-9, ES-24, and the 33 BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2 \u003c/sub\u003eplants conferring strong resistance to \u003cem\u003ePst\u003c/em\u003e race CYR32 carried 3St chromosome-specific markers. Oppositely, the other 26 BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2 \u003c/sub\u003eplants without specific amplification as well as the parental line Abbondanza, and susceptible control HXH were seriously susceptible to \u003cem\u003ePst\u003c/em\u003e race CYR32. It was indicated that the newly developed St-chromosome-specific molecular markers could be used to trace the chromosome 3St in a common wheat background.\u003c/p\u003e"},{"header":"Discussion","content":" \u003cp\u003eOn the basis of distant hybridization, chromosome manipulation has been widely utilized for wheat improvement programs, especially for breeding novel disease-resistant wheat lines. During the past few decades, numerous disease-resistant genes contained in wild related species have been successfully transferred to common wheat background by developing introgression lines (Zhan et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ceoloni et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Disomic substitution lines contained one pair of defined alien chromosomes with desirable resistant genes are vital bridge materials for small segments of introgression (Guo et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Mago et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), which are valuable germplasm resources for wheat disease-resistant breeding. In the current study, six stable wheat-\u003cem\u003eThinopyrum\u003c/em\u003e derived lines with remarkable stripe rust resistance were obtained from wide crosses between Abbondanza nullisomic lines and two different octoploid \u003cem\u003eTrititrigia\u003c/em\u003e lines, which can be served as novel resistant germplasms for wheat breeding.\u003c/p\u003e \u003cp\u003eAs one of the most commonly used technique, FISH analysis is generally used with GISH to discriminate genomic composition and construct the karyotype (Wang et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e). In this study, wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic substitution lines DS2St (2A), DS2St (2B) and DS2St (2D), as well as wheat- \u003cem\u003eTh. ponticum\u003c/em\u003e 2St(2A) disomic substitution line were developed by nullisomic backcross method. After characterized by sequential FISH\u0026ndash;GISH and mc-GISH analysis, specific karyotype patterns of chromosome 2St were elucidated, which is significant for rapidly identifying the pair of alien chromosomes in germplasm materials. Furthermore, genomic changes in specific regions frequently happened following the process of distant hybridization (Liu et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), which could be accurately detected by FISH. Compared with the parental lines, Abbondanza and Zhong4, telomere with subtelomeric region of chromosome 5BS carrying a blight pSc119.2 hybridization signal was eliminated in ES-25, which resulted a similar FISH pattern to chromosome 2B of common wheat. For chromosome 2B is almost metacentric whereas chromosome 5B is absolutely submetacentric, it was clear that chromosome 2B in ES-25 were replaced by chromosome 2St of \u003cem\u003eTh. intermedium\u003c/em\u003e (Fig.\u0026nbsp;4h). Subtelomeres of \u003cem\u003eTriticeae\u003c/em\u003e species were regarded as dynamic and relatively high frequent variable genome organization with constant homogenization between different chromosome ends (Zhang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Additionally, subtelomere regions of \u003cem\u003eSchizosaccharomyces pombe\u003c/em\u003e showed high sequence variation, but no severe effects on the RNA expression (Oizumi et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In terms of the deletion of subtelomeric region of chromosome 5BS in ES-25, it is difficult to access the possible function(s) of the regions for the variable nature. The segment elimination may have been resulted from chromosomal rearrangement via the process of chromosome 2St introduction. There were no severe effects detected on viability of ES-25, which suggested that the subtelomeric region eliminations of chromosome 5BS presumably contributed to genome diversity.\u003c/p\u003e \u003cp\u003eBased on molecular cytogenetic identification results of the six substitution lines, ES-23 and ES-9 contained the same genome composition of 12A\u0026thinsp;+\u0026thinsp;14B\u0026thinsp;+\u0026thinsp;14D\u0026thinsp;+\u0026thinsp;2(2St), and ES-24 as well as ES-10 were for the same genome composition of 14A\u0026thinsp;+\u0026thinsp;14B\u0026thinsp;+\u0026thinsp;12D\u0026thinsp;+\u0026thinsp;2(3St). It is surprised that FISH patterns of \u003cem\u003eTh. intermedium\u003c/em\u003e 2St/3St chromosomes and \u003cem\u003eTh. ponticum\u003c/em\u003e are consistent with each other. What else, the agricultural performance evaluation suggested that chromosome 2St derived from \u003cem\u003eTh. intermedium\u003c/em\u003e and \u003cem\u003eTh. ponticum\u003c/em\u003e both conferred higher thousand-kernel weight, more tillers and stripe rust resistance at adult stages. And chromosome 3St of \u003cem\u003eTh. ponticum\u003c/em\u003e and \u003cem\u003eTh. intermedium\u003c/em\u003e were both highly resistant to stripe rust at all stages. Because of the same genome compositions, consistent FISH patterns and the similar specific agricultural performances, comparisons between ES-23 and ES-9, as well as ES-24 and ES-10, were further conducted. As one of the most traditional methods, meiotic chromosome pairing analysis of species hybrids has been used to study \u003cem\u003eTriticeae\u003c/em\u003e species genome constitution for several decades (Lu and Vonbothmer \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In terms of the two groups of germplasm materials with the same genome compositions, more than half of the pollen mother cells of the F\u003csub\u003e1\u003c/sub\u003e hybrids perfectly formed 21 bivalents at metaphase I without any trivalents or quadrivalents, which revealed the close homologous relationship between \u003cem\u003eTh. ponticum\u003c/em\u003e chromosome 2St/3St and \u003cem\u003eTh. intermedium\u003c/em\u003e chromosome 2St/3St, respectively. Furthermore, genomic polymorphism intercomparisons between ES-23 and ES-9, as well as ES-24 and ES-10, were analyzed by SLAF-sEq.\u0026nbsp;According to the sequence alignment results, 114 specific sequences of 221 (ES-23) and 177 (ES-9), as well as 78 specific sequences of 263 (ES-24) and 153 (ES-10) were with homology more than 90%. Overall, it was suggested the possible genomic similarity between chromosome 2St/3St of \u003cem\u003eTh. intermedium\u003c/em\u003e and \u003cem\u003eTh. ponticum\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThe genomic composition of \u003cem\u003eTh. ponticum\u003c/em\u003e and \u003cem\u003eTh. intermedium\u003c/em\u003e has been an interesting subject for a considerable time (Wang \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Tiryaki et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). During the past several decades, it was convinced that the set of St chromosomes contained in \u003cem\u003eTh. intermedium\u003c/em\u003e were probably derived from \u003cem\u003eP. spicata\u003c/em\u003e, whereas it has been still undefined that whether the St genome is one of the sets of chromosomes of \u003cem\u003eTh. ponticum\u003c/em\u003e or not (Kruppa and Moln\u0026aacute;r-L\u0026aacute;ng \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In this study, \u003cem\u003eTh. ponticum\u003c/em\u003e chromosome 2St/3St and \u003cem\u003eTh. intermedium\u003c/em\u003e chromosome 2St/3St were simultaneously identified in the six alien substitution lines derived from two different octoploid \u003cem\u003eTrititrigia\u003c/em\u003e lines, Xiaoyan784 (a wheat- \u003cem\u003eTh. ponticum\u003c/em\u003e partial amphiploid) and Zhong4 (a wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e partial amphiploid). In terms of the FISH patterns of chromosome 2St/3St, no obvious variations were detected in Xiaoyan784, Zhong4 and the six substitution lines (Fig.\u0026nbsp;4h). It was implied that St chromosomes were not only included in \u003cem\u003eTh. ponticum\u003c/em\u003e, but also could be stably inherited. Furthermore, combined with the previous results of the close homologous relationship between \u003cem\u003eTh. ponticum\u003c/em\u003e chromosome 2St/3St and that of \u003cem\u003eTh. intermedium\u003c/em\u003e, it is convinced that \u003cem\u003eP. spicata\u003c/em\u003e representing the complete set of St chromosomes played an important role during the speciation of \u003cem\u003eTh. ponticum\u003c/em\u003e, but the effects of the recombination events happened between diverse genomes through the allopolyploidization process need further analyses.\u003c/p\u003e \u003cp\u003eAlthough FISH\u0026ndash;GISH analysis has been widely utilized to precisely characterized wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e lines for several decades, it is time-consuming. Specific molecular markers are able to rapidly trace the alien chromosome or even small segment introgression with the advantage traits for wheat improvement breeding programs. However, for the complete \u003cem\u003eTh. intermedium\u003c/em\u003e genome has not been sequenced, there are only a few chromosome-specific markers enabled to be used (Zhang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2012b\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016a\u003c/span\u003e). With the development of sequencing technology, 635 unique \u003cem\u003eTh. intermedium\u003c/em\u003e SNP markers have been successfully developed, including 135 St-chromosome-specific markers, with 15 of 2St-chromosome-specific markers and 10 of 3St-chromoosme-specific markers (Cseh et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Due to the much more complex genomic composition of \u003cem\u003eTh. ponticum\u003c/em\u003e, molecular marker development work was mainly focused on genome E (Hu et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012a\u003c/span\u003e; Baker et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), especially in the following of the published complete genome of \u003cem\u003eTh. elongatum\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e). In the present study, four wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic substitution lines were clearly characterized, of which, ES-23(DS2St (2A)) and ES-24(DS3St (3D)) were further sequenced by SLAF-seq for St-chromosome-specific marker development. And two 2St-chromosome-specific molecular markers, PTH-005 and PTH-013, as well as two 3St-chromosome-specific molecular markers, PTH-113 and PTH-135 were obtained. The FISH analysis results showed chromosome 3St were merely detected in the resistant individuals of the BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e population of ES-24 and HXH (Fig.\u0026nbsp;7), which meant the stripe rust resistance gene(s) was derived from chromosome 3St of \u003cem\u003eTh. intermedium\u003c/em\u003e. The utility of PTH-113 and PTH-135 amplification in the BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e individuals indicated that the St-chromosome-specific molecular markers enabled to serve as useful tools for tracing the St chromosomes of \u003cem\u003eTh. intermedium\u003c/em\u003e in common wheat background. In addition, according to the close genetic relationship between \u003cem\u003eTh. ponticum\u003c/em\u003e chromosome 2St/3St and that of \u003cem\u003eTh. intermedium\u003c/em\u003e analyzed in this study, the four St-chromosome-specific markers could be simultaneously amplified in \u003cem\u003eTh. ponticum\u003c/em\u003e, tetraploid \u003cem\u003eP. spicata\u003c/em\u003e, \u003cem\u003eTh. intermedium\u003c/em\u003e and diploid \u003cem\u003eP. spicata\u003c/em\u003e, as well as the corresponding substitution lines, ES-9, ES-23, ES-10 and ES-24 (Fig.\u0026nbsp;4h). It was speculated that the four St-chromosome-specific markers could also be utilized for tracing the St genome chromosomes of \u003cem\u003eTh. ponticum\u003c/em\u003e, which need to be validated in future genetic analyses.\u003c/p\u003e "},{"header":"Conclusions","content":" \u003cp\u003eFour wheat- \u003cem\u003eThinopyrum intermedium\u003c/em\u003e and two wheat- \u003cem\u003eThinopyrun ponticum\u003c/em\u003e alien disomic substitution lines were characterized and compared by molecular cytogenetic analysis. ES-9, ES-23, ES-25 and ES-26 containing chromosome 2St conferred stripe rust resistance at adult stages and higher thousand-kernel weight, and ES-10 as well as ES-24 containing chromosome 3St conferred stripe rust resistance at all stages. What else, four St-chromosome-specific molecular markers were developed.\u003c/p\u003e "},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eWe thank Prof. Baotong Wang, college of Plant Protection, Northwest A\u0026amp;F University, Yangling, Shaanxi 712100, China, for providing the \u003cem\u003ePst\u003c/em\u003e races.\u003c/p\u003e\n\u003ch2\u003eAuthor contribution\u003c/h2\u003e\n\u003cp\u003eWQJ and CYW designed the project, SWW performed the experiments and drafted the manuscript, JXZ provided help in analysis of wheat 15K SNP array, XBF and PCD provided help in analyzing the morphological characters, YJW and CHC provided help in preparing materials, BTW provided the \u003cem\u003ePst\u003c/em\u003e races.\u003c/p\u003e\n\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eNo conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication.\u003c/p\u003e\n\u003ch2\u003eEthical standards\u003c/h2\u003e\n\u003cp\u003eThe authors declare that the experiments comply with the current laws of the country in which they were performed.\u003c/p\u003e\n\u003ch2\u003eFunding information\u003c/h2\u003e\n\u003cp\u003eThis work was supported by the National Key Research and Development Program of China (grant No. 2016YFD0102001). We are grateful for their financial support.\u003c/p\u003e\n\u003ch2\u003eOpen Access\u003c/h2\u003e\n\u003cp\u003eThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other materials in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBaker L, Grewal S, Yang CY, Hubbart-Edwards S, Scholefield D, Ashling S, Burridge AJ, Przewieslik-Allen AM, Wilkinson PA, King IP, King J (2020) Exploiting the genome of \u003cem\u003eThinopyrum elongatum\u003c/em\u003e to expand the gene pool of hexaploid wheat. Theor Appl Genet 133 (7):2213-2226. doi:10.1007/s00122-020-03591-3\u003c/li\u003e\n\u003cli\u003eCeoloni C, Forte P, Kuzmanovic L, Tundo S, Moscetti I, De Vita P, Virili ME, D'Ovidio R (2017) Cytogenetic mapping of a major locus for resistance to \u003cem\u003eFusarium\u003c/em\u003e head blight and crown rot of wheat on \u003cem\u003eThinopyrum elongatum\u003c/em\u003e 7EL and its pyramiding with valuable genes from a \u003cem\u003eTh. ponticum\u003c/em\u003e homoeologous arm onto bread wheat 7DL. Theor Appl Genet 130 (10):2005-2024. doi:10.1007/s00122-017-2939-8\u003c/li\u003e\n\u003cli\u003eChen Q, Conner RL, Laroche A, Ji WQ, Armstrong KC, Fedak G (1999) Genomic \u003cem\u003ein situ\u003c/em\u003e hybridization analysis of \u003cem\u003eThinopyrum\u003c/em\u003e chromatin in a wheat - \u003cem\u003eTh. intermedium\u003c/em\u003e partial amphiploid and six derived chromosome addition lines. Genome 42 (6):1217-1223. doi:DOI 10.1139/gen-42-6-1217\u003c/li\u003e\n\u003cli\u003eChen Q, Conner RL, Laroche A, Thomas JB (1998) Genome analysis of \u003cem\u003eThinopyrum intermedium\u003c/em\u003e and \u003cem\u003eThinopyrum ponticum\u003c/em\u003e using genomic \u003cem\u003ein situ\u003c/em\u003e hybridization. Genome 41 (4):580-586\u003c/li\u003e\n\u003cli\u003eChen Q, Conner RL, Li HJ, Sun SC, Ahmad F, Laroche A, Graf RJ (2003) Molecular cytogenetic discrimination and reaction to wheat streak mosaic virus and the wheat curl mite in Zhong series of wheat--\u003cem\u003eThinopyrum intermedium\u003c/em\u003e partial amphiploids. Genome 46 (1):135-145. doi:10.1139/g02-109\u003c/li\u003e\n\u003cli\u003eChen XM (2005) Epidemiology and control of stripe rust [Puccinia striiformis f. sp tritici] on wheat. Can J Plant Pathol 27 (3):314-337\u003c/li\u003e\n\u003cli\u003eCseh A, Yang CY, Hubbart-Edwards S, Scholefield D, Ashling SS, Burridge AJ, Wilkinson PA, King IP, King J, Grewal S (2019) Development and validation of an exome-based SNP marker set for identification of the St, J(r) and J(vs) geno9.mes of \u003cem\u003eThinopyrym intermedium\u003c/em\u003e in a wheat background. Theor Appl Genet 132 (5):1555-1570. doi:10.1007/s00122-019-03300-9\u003c/li\u003e\n\u003cli\u003eDeng CL, Bai LL, Fu SL, Yin WB, Zhang YX, Chen YH, Wang RRC, Zhang XQ, Han FP, Hu ZM (2013) Microdissection and Chromosome Painting of the Alien Chromosome in an Addition Line of Wheat - \u003cem\u003eThinopyrum intermedium\u003c/em\u003e. Plos One 8 (8). doi:ARTN e7256410.1371/journal.pone.0072564\u003c/li\u003e\n\u003cli\u003eFedak G, Chen Q, Conner RL, Laroche A, Petroski R, Armstrong KW (2000) Characterization of wheat-\u003cem\u003eThinopyrum\u003c/em\u003e partial amphiploids by meiotic analysis and genomic \u003cem\u003ein situ\u003c/em\u003e hybridization. Genome 43 (4):712-719. doi:Doi 10.1139/Gen-43-4-712\u003c/li\u003e\n\u003cli\u003eFigueiras A, Gonz\u0026aacute;lez-Ja\u0026eacute;n M, Benito C (1986) Biochemical evidence of homoeology between \u003cem\u003eTriticum aestivum\u003c/em\u003e and \u003cem\u003eAgropyron intermedium\u003c/em\u003e chromosomes. TAG Theoretical and applied genetics Theoretische und angewandte Genetik 72 (6):826-832. doi:10.1007/bf00266553\u003c/li\u003e\n\u003cli\u003eForster BP, Reader SM, Forsyth SA, Koebner RMD, Miller TE, Gale MD, Cauderon Y (2009) An assessment of the homoeology of six \u003cem\u003eAgropyron intermedium\u003c/em\u003e chromosomes added to wheat. Genetical Research 50 (2):91-97. doi:10.1017/s001667230002348x\u003c/li\u003e\n\u003cli\u003eFriebe B, Mukai Y, Gill B, Cauderon Y (1992) C-banding and \u003cem\u003ein-situ\u003c/em\u003e hybridization analyses of \u003cem\u003eAgropyron intermedium\u003c/em\u003e, a partial wheat x \u003cem\u003eAg. intermedium\u003c/em\u003e amphiploid, and six derived chromosome addition lines. TAG Theoretical and applied genetics Theoretische und angewandte Genetik 84:899-905. doi:10.1007/bf00227402\u003c/li\u003e\n\u003cli\u003eGuo J, Zhang XL, Hou YL, Cai JJ, Shen XR, Zhou TT, Xu HH, Ohm HW, Wang HW, Li AF, Han FP, Wang HG, Kong LR (2015) High-density mapping of the major FHB resistance gene \u003cem\u003eFhb7\u003c/em\u003e derived from \u003cem\u003eThinopyrum ponticum\u003c/em\u003e and its pyramiding with \u003cem\u003eFhb1\u003c/em\u003e by marker-assisted selection. Theor Appl Genet 128 (11):2301-2316. doi:10.1007/s00122-015-2586-x\u003c/li\u003e\n\u003cli\u003eHan FP, Liu B, Fedak G, Liu ZH (2004) Genomic constitution and variation in five partial amphiploids of wheat - \u003cem\u003eThinopyrum intermedium\u003c/em\u003e as revealed by GISH, multicolor GISH and seed storage protein analysis. Theor Appl Genet 109 (5):1070-1076. doi:10.1007/s00122-004-1720-y\u003c/li\u003e\n\u003cli\u003eHe F, Xing PY, Bao YG, Ren MJ, Liu SB, Wang YH, Li XF, Wang HG (2017) Chromosome Pairing in Hybrid Progeny between \u003cem\u003eTriticum aestivum\u003c/em\u003e and \u003cem\u003eElytrigia elongata\u003c/em\u003e. Front Plant Sci 8. doi:Artn 216110.3389/Fpls.2017.02161\u003c/li\u003e\n\u003cli\u003eHu LJ, Li GR, Zeng ZX, Chang ZJ, Liu C, Zhou JP, Yang ZJ (2010) Molecular cytogenetic identification of a new wheat-\u003cem\u003eThinopyrum\u003c/em\u003e substitution line with stripe rust resistance. Euphytica 177 (2):169-177. doi:10.1007/s10681-010-0216-x\u003c/li\u003e\n\u003cli\u003eHu LJ, Liu C, Zeng ZX, Li GR, Song XJ, Yang ZJ (2012a) Genomic rearrangement between wheat and \u003cem\u003eThinopyrum elongatum\u003c/em\u003e revealed by mapped functional molecular markers. Genes \u0026amp; Genomics 34 (1):67-75. doi:10.1007/s13258-011-0153-7\u003c/li\u003e\n\u003cli\u003eHu L, Li G, Zhan H, Liu C, Yang Z (2012b) New St-chromosome-specific molecular markers for identifying wheat--\u003cem\u003eThinopyrum intermedium\u003c/em\u003e derivative lines. Journal of genetics 91 (2):e69-74\u003c/li\u003e\n\u003cli\u003eKruppa K, Moln\u0026aacute;r-L\u0026aacute;ng M (2016) Simultaneous visualization of different genomes (J, JSt and St) in a \u003cem\u003eThinopyrum intermedium\u003c/em\u003e x \u003cem\u003eThinopyrum ponticum\u003c/em\u003e synthetic hybrid (Poaceae) and in its parental species by multicolour genomic \u003cem\u003ein situ\u003c/em\u003e hybridization (mcGISH). Comp Cytogenet 10 (2):283-293. doi:10.3897/CompCytogen.v10i2.7305\u003c/li\u003e\n\u003cli\u003eKruppa K, Turkosi E, Mayer M, Toth V, Vida G, Szakacs E, Moln\u0026aacute;r-L\u0026aacute;ng M (2016) McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat x \u003cem\u003eThinopyrum\u003c/em\u003e synthetic hybrid cross. J Appl Genet 57 (4):427-437. doi:10.1007/s13353-016-0343-8\u003c/li\u003e\n\u003cli\u003eLi AL, Geng SF, Zhang LQ, Liu DC, Mao L (2015) Making the Bread: Insights from Newly Synthesized Allohexaploid Wheat. Molecular Plant 8 (6):847-859. doi:10.1016/j.molp.2015.02.016\u003c/li\u003e\n\u003cli\u003eLi G, Wang H, Lang T, Li J, La S, Yang E, Yang Z (2016a) New molecular markers and cytogenetic probes enable chromosome identification of wheat-\u003cem\u003eThinopyrum intermedium\u003c/em\u003e introgression lines for improving protein and gluten contents. Planta 244 (4):865-876. doi:10.1007/s00425-016-2554-y\u003c/li\u003e\n\u003cli\u003eLi HW, Boshoff WHP, Pretorius ZA, Zheng Q, Li B, Li ZS (2019a) Establishment of wheat-\u003cem\u003eThinopyrum ponticum\u003c/em\u003e translocation lines with resistance to Puccinia graminis f. sp. tritici Ug99. Journal of Genetics and Genomics 46 (8):405-407. doi:10.1016/j.jgg.2019.07.005\u003c/li\u003e\n\u003cli\u003eLi HW, Zheng Q, Pretorius ZA, Li B, Tang DZ, Li ZS (2016b) Establishment and characterization of new wheat-\u003cem\u003eThinopyrum ponticum\u003c/em\u003e addition and translocation lines with resistance to Ug99 races. Journal of Genetics and Genomics 43 (9):573-575. doi:10.1016/j.jgg.2016.07.004\u003c/li\u003e\n\u003cli\u003eLi JB, Chen QH, Zhang P, Lang T, Hoxha S, Li GR, Yang ZJ (2019b) Comparative FISH and molecular identification of new stripe rust resistant wheat-\u003cem\u003eThinopyrum intermedium\u003c/em\u003e ssp. \u003cem\u003etrichophorum\u003c/em\u003e introgression lines. Crop J 7 (6):819-829. doi:10.1016/j.cj.2019.06.001\u003c/li\u003e\n\u003cli\u003eLi Z, Li B, Tong Y (2008) The contribution of distant hybridization with decaploid \u003cem\u003eAgropyron elongatum\u003c/em\u003e to wheat improvement in China. Journal of genetics and genomics = Yi chuan xue bao 35 (8):451-456. doi:10.1016/S1673-8527(08)60062-4\u003c/li\u003e\n\u003cli\u003eLiu B, Xu C, Zhao N, Qi B, Kimatu JN, Pang J, Han F (2009) Rapid genomic changes in polyploid wheat and related species: implications for genome evolution and genetic improvement. Journal of Genetics and Genomics 36 (9):519-528. doi:10.1016/s1673-8527(08)60143-5\u003c/li\u003e\n\u003cli\u003eLiu ZW, Wang RR (1993) Genome analysis of \u003cem\u003eElytrigia caespitosa\u003c/em\u003e, \u003cem\u003eLophopyrum nodosum\u003c/em\u003e, \u003cem\u003ePseudoroegneria geniculata\u003c/em\u003e ssp. \u003cem\u003escythica\u003c/em\u003e, and \u003cem\u003eThinopyrum intermedium\u003c/em\u003e (Triticeae: Gramineae). Genome 36 (1):102-111. doi:10.1139/g93-014\u003c/li\u003e\n\u003cli\u003eLu BR, Vonbothmer R (1993) Meiotic Analysis of \u003cem\u003eElymus-Caucasicus\u003c/em\u003e, \u003cem\u003eE-Longearistatus\u003c/em\u003e, and Their Interspecific Hybrids with 23 \u003cem\u003eElymus\u003c/em\u003e Species (\u003cem\u003eTriticeae, Poaceae\u003c/em\u003e). Plant Systematics and Evolution 185 (1-2):35-53. doi:Doi 10.1007/Bf00937719\u003c/li\u003e\n\u003cli\u003eMa H, Singh RP, Mujeebkazi A (1995) Suppression Expression of Resistance to Stripe Rust in Synthetic Hexaploid Wheat (\u003cem\u003eTriticum-Turgidum X T-Tauschii\u003c/em\u003e). Euphytica 83 (2):87-93. doi:Doi 10.1007/Bf01678034\u003c/li\u003e\n\u003cli\u003eMa PT, Xu HX, Han GH, Luo QL, Xu YF, Zhang XT, An DG, Li LH, Sun Y (2016) Characterization of a Segregation Distortion Locus with Powdery Mildew Resistance in a Wheat-\u003cem\u003eThinopyrum intermedium\u003c/em\u003e Introgression Line WE99. Plant Dis 100 (8):1541-1547. doi:10.1094/Pdis-11-15-1352-Re\u003c/li\u003e\n\u003cli\u003eMago R, Zhang P, Xia XD, Zhang JP, Hoxha S, Lagudah E, Graner A, Dundas I (2019) Transfer of stem rust resistance gene \u003cem\u003eSrB\u003c/em\u003e from \u003cem\u003eThinopyrum ponticum\u003c/em\u003e into wheat and development of a closely linked PCR-based marker. Theor Appl Genet 132 (2):371-382. doi:10.1007/s00122-018-3224-1\u003c/li\u003e\n\u003cli\u003eMahelka V, Kopecky D, Pastova L (2011) On the genome constitution and evolution of intermediate wheatgrass (\u003cem\u003eThinopyrum intermedium: Poaceae, Triticeae\u003c/em\u003e). BMC Evol Biol 11:127. doi:10.1186/1471-2148-11-127\u003c/li\u003e\n\u003cli\u003eNie L, Yang Y, Zhang J, Fu T (2019) Disomic chromosome addition from \u003cem\u003eThinopyrum intermedium\u003c/em\u003e to bread wheat appears to confer stripe rust resistance. Euphytica 215 (3). doi:10.1007/s10681-019-2376-7\u003c/li\u003e\n\u003cli\u003eOizumi Y, Kaji T, Tashiro S, Takeshita Y, Date Y, Kanoh J (2021) Complete sequences of \u003cem\u003eSchizosaccharomyces pombe\u003c/em\u003e subtelomeres reveal multiple patterns of genome variation. Nat Commun 12 (1):611. doi:10.1038/s41467-020-20595-1\u003c/li\u003e\n\u003cli\u003eSun XW, Liu DY, Zhang XF, Li WB, Liu H, Hong WG, Jiang CB, Guan N, Ma CX, Zeng HP, Xu CH, Song J, Huang L, Wang CM, Shi JJ, Wang R, Zheng XH, Lu CY, Wang XW, Zheng HK (2013) SLAF-seq: An Efficient Method of Large-Scale De Novo SNP Discovery and Genotyping Using High-Throughput Sequencing. Plos One 8 (3). doi:ARTN e5870010.1371/journal.pone.0058700\u003c/li\u003e\n\u003cli\u003eTiryaki I, Karaoglu GB, Yucel G, Tuna M (2021) Assessment of \u003cem\u003eThinopyrum ponticum\u003c/em\u003e (Podp.) Barkworth \u0026amp; D. R. Dewey accessions using universal rice primers and molecular cytogenetics. Genetic Resources and Crop Evolution. doi:10.1007/s10722-020-01101-4\u003c/li\u003e\n\u003cli\u003eWang H, Sun S, Ge W, Zhao L, Hou B, Wang K, Lyu Z, Chen L, Xu S, Guo J, Li M, Su P, Li X, Wang G, Bo C, Fang X, Zhuang W, Cheng X, Wu J, Dong L, Chen W, Li W, Xiao G, Zhao J, Hao Y, Xu Y, Gao Y, Liu W, Liu Y, Yin H, Li J, Li X, Zhao Y, Wang X, Ni F, Ma X, Li A, Xu S, Bai G, Nevo E, Gao C, Ohm H, Kong L (2020a) Horizontal gene transfer of \u003cem\u003eFhb7\u003c/em\u003e from fungus underlies \u003cem\u003eFusarium \u003c/em\u003ehead blight resistance in wheat. Science (New York, NY) 368 (6493). doi:10.1126/science.aba5435\u003c/li\u003e\n\u003cli\u003eWang RR, Larson SR, Jensen KB, Bushman BS, DeHaan LR, Wang S, Yan X (2015) Genome evolution of intermediate wheatgrass as revealed by EST-SSR markers developed from its three progenitor diploid species. Genome 58 (2):63-70. doi:10.1139/gen-2014-0186\u003c/li\u003e\n\u003cli\u003eWang RRC (1992) Genome Relationships in the Perennial Triticeae Based on Diploid Hybrids and Beyond. Hereditas 116 (1-2):133-136. doi:DOI 10.1111/j.1601-5223.1992.tb00217.x\u003c/li\u003e\n\u003cli\u003eWang RRC, Lu BR (2014) Biosystematics and evolutionary relationships of perennial \u003cem\u003eTriticeae\u003c/em\u003e species revealed by genomic analyses. J Syst Evol 52 (6):697-705. doi:10.1111/jse.12084\u003c/li\u003e\n\u003cli\u003eWang SW, Wang CY, Wang YZ, Wang YJ, Chen CH, Ji WQ (2019) Molecular cytogenetic identification of two wheat-\u003cem\u003eThinopyrum ponticum\u003c/em\u003e substitution lines conferring stripe rust resistance. Mol Breeding 39 (11). doi:Artn 14310.1007/S11032-019-1053-9\u003c/li\u003e\n\u003cli\u003eWang YJ, Long DY, Wang YZ, Wang CY, Liu XL, Zhang H, Tian ZR, Chen CH, Ji WQ (2020b) Characterization and Evaluation of Resistance to Powdery Mildew of Wheat-\u003cem\u003eAegilops geniculata\u003c/em\u003e Roth 7M(g) (7A) Alien Disomic Substitution Line W16998. Int J Mol Sci 21 (5). doi:Artn 186110.3390/Ijms21051861\u003c/li\u003e\n\u003cli\u003eYang CR, Zhang HQ, Zhao FQ, Liu XY, Fan X, Sha LN, Kang HY, Wang Y, Zhou YH (2015) Genome constitution of \u003cem\u003eElymus tangutorum\u003c/em\u003e (\u003cem\u003ePoaceae: Triticeae\u003c/em\u003e) inferred from meiotic pairing behavior and genomic \u003cem\u003ein situ\u003c/em\u003e hybridization. J Syst Evol 53 (6):529-534. doi:10.1111/jse.12155\u003c/li\u003e\n\u003cli\u003eYang G, Boshoff WHP, Li H, Pretorius ZA, Luo Q, Li B, Li Z, Zheng Q (2021) Chromosomal composition analysis and molecular marker development for the novel Ug99-resistant wheat-\u003cem\u003eThinopyrum ponticum\u003c/em\u003e translocation line WTT34. Theor Appl Genet. doi:10.1007/s00122-021-03796-0\u003c/li\u003e\n\u003cli\u003eZhan HX, Li GR, Zhang XJ, Li X, Guo HJ, Gong WP, Jia JQ, Qiao LY, Ren YK, Yang ZJ, Chang ZJ (2014) Chromosomal Location and Comparative Genomics Analysis of Powdery Mildew Resistance Gene \u003cem\u003ePm51\u003c/em\u003e in a Putative Wheat-\u003cem\u003eThinopyrum ponticum\u003c/em\u003e Introgression Line. Plos One 9 (11). doi:ARTN e11345510.1371/journal.pone.0113455\u003c/li\u003e\n\u003cli\u003eZhang P, Li W, Fellers J, Friebe B, Gill BS (2004) BAC-FISH in wheat identifies chromosome landmarks consisting of different types of transposable elements. Chromosoma 112 (6):288-299. doi:10.1007/s00412-004-0273-9\u003c/li\u003e\n\u003cli\u003eZhang Z, Xin Z, Larkin P (2001) Molecular characterization of a \u003cem\u003eThinopyrum intermedium\u003c/em\u003e group 2 chromosome (2Ai-2) conferring resistance to barley yellow dwarf virus. Genome 44 (6):1129-1135. doi:10.1139/gen-44-6-1129\u003c/li\u003e\n\u003cli\u003eZheng Q, Lv ZL, Niu ZX, Li B, Li HW, Xu SS, Han FP, Li ZS (2014) Molecular Cytogenetic Characterization and Stem Rust Resistance of Five Wheat-\u003cem\u003eThinopyrum ponticum\u003c/em\u003e Partial Amphiploids. Journal of Genetics and Genomics 41 (11):591-599. doi:10.1016/j.jgg.2014.06.003\u003c/li\u003e\n\u003cli\u003eZheng XW, Tang CG, Han R, Zhao JJ, Qiao L, Zhang SW, Qiao LY, Ge C, Zheng J, Liu C (2020) Identification, Characterization, and Evaluation of Novel Stripe Rust-Resistant Wheat-\u003cem\u003eThinopyrum intermedium\u003c/em\u003e Chromosome Translocation Lines. Plant Dis 104 (3):875-881. doi:10.1094/Pdis-01-19-0001-Re\u003c/li\u003e\n\u003cli\u003eZhu C, Wang YZ, Chen CH, Wang CY, Zhang AC, Peng NN, Wang YJ, Zhang H, Liu XL, Ji WQ (2017) Molecular cytogenetic identification of a wheat - \u003cem\u003eThinopyrum ponticum\u003c/em\u003e substitution line with stripe rust resistance. Genome 60 (10):860-867. doi:10.1139/gen-2017-0099\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e Agronomic traits of the alien substitution lines ES-9, ES-10, as well as their parents (Abbondanza, Xiaoyan784)\u003c/p\u003e\n\u003ctable border=\"1\" width=\"0\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003ePlant height (cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eTillers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eSpike length (cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eSpikelets/ spike\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eFlorets/ spikelet\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eThousand Kenel Weight (g)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eAwnedness\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eXiaoyan784\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e112\u0026plusmn;6a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e11\u0026plusmn;3b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e21\u0026plusmn;1.5a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e25\u0026plusmn;2a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e6\u0026plusmn;1a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e31\u0026plusmn;0.5c\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eawnless\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-9\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e105\u0026plusmn;5a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e25\u0026plusmn;4a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e13.9\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e24\u0026plusmn;1ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e4\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e43\u0026plusmn;1a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eawnless\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-10\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e90\u0026plusmn;5b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e18\u0026plusmn;4ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e14\u0026plusmn;1.5b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e20\u0026plusmn;1c\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5\u0026plusmn;1ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e36\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eawnless\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eAbbondanza\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e107\u0026plusmn;6a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e14\u0026plusmn;3b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e14.4\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e22\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e4\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e42\u0026plusmn;2a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eawnless\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNote: Different letters a, b and c indicate significant differences between ES-9, ES-10 and its wheat parent (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e Agronomic traits of the substitution lines ES-23, ES-24, ES-25, ES-26, as well as their parents (Abbondanza and Zhong4)\u003c/p\u003e\n\u003ctable border=\"1\" width=\"0\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003ePlant height (cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eTillers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eSpike length (cm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eSpikelets/ spike\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eFlorets/ spikelet\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eThousand Kenel Weight (g)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eAwnedness\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eZhong4\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e127\u0026plusmn;4a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e12\u0026plusmn;3b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e16\u0026plusmn;1.5a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e23\u0026plusmn;2ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5\u0026plusmn;1a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e31\u0026plusmn;0.5c\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eLong awn\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-23\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e114\u0026plusmn;5b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e23\u0026plusmn;4a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e17\u0026plusmn;1.5a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e21\u0026plusmn;2bc\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e4.4\u0026plusmn;1ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e43\u0026plusmn;1a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eawnless\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-24\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e87\u0026plusmn;6c\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e17\u0026plusmn;4b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e11.6\u0026plusmn;1c\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e21\u0026plusmn;1c\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e4.4\u0026plusmn;1ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e37\u0026plusmn;2b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eShort awn\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-25\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e93\u0026plusmn;5c\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e15\u0026plusmn;4b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e13\u0026plusmn;1.5b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e23\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e3.7\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e45\u0026plusmn;1.5a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eShort awn\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-26\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e113\u0026plusmn;5b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e27\u0026plusmn;4a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e14\u0026plusmn;1.5b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e25\u0026plusmn;1a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e4.4\u0026plusmn;1ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e43\u0026plusmn;1.5a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eShort awn\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eAbbondanza\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e107\u0026plusmn;6b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e14\u0026plusmn;3b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e14.4\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e22\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e4\u0026plusmn;1b\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e42\u0026plusmn;2ab\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003eawnless\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNote: Different letters a, b and c indicate significant differences between ES-23, ES-24, ES-25, ES-26 and its wheat parent (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e Chromosome pairing in the meiotic and meiotic phases for the hybrid F\u003csub\u003e1 \u003c/sub\u003eindividuals\u003c/p\u003e\n\u003ctable border=\"1\" width=\"0\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eMaterial\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eNo. of cells\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eChromosome configuration\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eUnivalent\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eBivalent\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eTrivalent\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eQuadrivalent\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eRod\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eRing\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-9\u0026times;ES-23\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e144\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e0.47(0-2)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e2.69(1-4)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e17.93(17-21)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e20.62(20-21)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003eES-10\u0026times;ES-24\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e135\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e0.39(0-2)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e2.61(1-4)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e18.19(17-21)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e20.8(20-21)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4\u003c/strong\u003e Specific amplification markers of chromosome 2St and chromosome 3St.\u003c/p\u003e\n\u003ctable border=\"1\" width=\"0\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"105\"\u003e\n\u003cp\u003e\u003cstrong\u003eSpecific primers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003e\u003cstrong\u003ePrimers (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"96\"\u003e\n\u003cp\u003e\u003cstrong\u003eAmplified chromosomes\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"99\"\u003e\n\u003cp\u003e\u003cstrong\u003eAnnealing temperatures\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"105\"\u003e\n\u003cp\u003e\u003cstrong\u003ePTH-005\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eF: TCCTCAACTGGAAACAAAGGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"96\"\u003e\n\u003cp\u003e2St\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"99\"\u003e\n\u003cp\u003e56\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eR: TTGGGAGTGAGTGTAGTTCAC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"105\"\u003e\n\u003cp\u003e\u003cstrong\u003ePTH-013\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eF: AGCCCTCCGGAAAGAATGAA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"96\"\u003e\n\u003cp\u003e2St\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"99\"\u003e\n\u003cp\u003e62\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eR: CCGCTCAAACAATCGCTACC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"105\"\u003e\n\u003cp\u003e\u003cstrong\u003ePTH-113\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eF: AACAGGGTCAACGGGTTTGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"96\"\u003e\n\u003cp\u003e3St\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"99\"\u003e\n\u003cp\u003e60\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eR: TTGGTGCAGAAACAATGCGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"105\"\u003e\n\u003cp\u003e\u003cstrong\u003ePTH-135\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eF: TGCCTCTAACACATGCATGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"96\"\u003e\n\u003cp\u003e3St\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"99\"\u003e\n\u003cp\u003e60\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"311\"\u003e\n\u003cp\u003eR: TCCAGTAGGTCTTGGCTCCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Supplementary","content":"\u003cp\u003eSupplementary table 4 to 8 are not available\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-breeding","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"molb","sideBox":"Learn more about [Molecular Breeding](https://www.springer.com/journal/11032)","snPcode":"11032","submissionUrl":"https://submission.nature.com/new-submission/11032/3","title":"Molecular Breeding","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Thinopyrum intermedium, Thinopyrum ponticum, alien disomic substitution lines, stripe rust resistance, St-chromosome-specific molecular markers","lastPublishedDoi":"10.21203/rs.3.rs-461930/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-461930/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOwing to the excellent resistance to abiotic and biotic stress,\u003cem\u003e Thionpyrum intermedium\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 6\u003cem\u003ex\u003c/em\u003e = 42, JJJ\u003csup\u003es\u003c/sup\u003eJ\u003csup\u003es\u003c/sup\u003eStSt) and \u003cem\u003eThinopyrum ponticum\u003c/em\u003e (2\u003cem\u003en\u003c/em\u003e = 10\u003cem\u003ex\u003c/em\u003e = 70) are both widely utilized in wheat germplasm innovation programs. Disomic substitution lines (DSLs) carrying one pair of alien chromosomes are valuable bridge materials for novel genes transmission. In this study, six wheat-\u003cem\u003eThinopyrum\u003c/em\u003e DSLs were derived from crosses between Abbondanza nullisomic lines (2\u003cem\u003en\u003c/em\u003e = 40) and two octoploid \u003cem\u003eTrititrigia\u003c/em\u003e lines (2\u003cem\u003en\u003c/em\u003e = 8\u003cem\u003ex\u003c/em\u003e = 56), characterized by a sequential fluorescence \u003cem\u003ein situ\u003c/em\u003e hybridization (FISH)-genome \u003cem\u003ein situ\u003c/em\u003e hybridization (GISH), a multicolor GISH (mc-GISH), and an analysis of wheat 15K SNP array combined with molecular marker selection. ES-9 and ES-10 were two wheat- \u003cem\u003eTh. ponticum \u003c/em\u003edisomic substitution lines, DS2St (2A) and DS3St (3D). While ES-23, ES-24, ES-25, and ES-26 were four wheat- \u003cem\u003eTh. intermedium\u003c/em\u003e disomic substitution lines, DS2St (2A), DS3St (3D), DS2St (2B), DS2St (2D). The FISH karyotypes of \u003cem\u003eTh. ponticum \u003c/em\u003e2St/3St chromosomes were well coincident with the ones\u003cem\u003e \u003c/em\u003eof \u003cem\u003eTh. intermedium\u003c/em\u003e. The chromosome configurations of F\u003csub\u003e1 \u003c/sub\u003ehybrids derived from crosses between ES-23 and ES-9, as well as ES-24 and ES-10 were mostly formed 21Ⅱ. Four St-chromosome-specific markers were developed by specific-locus amplified fragment sequencing (SLAF-seq). Additionally, the substitution lines containing chromosome 2St conferred higher thousand-kernel weight and stripe rust resistance at adult stages, while the substitution lines containing chromosome 3St were highly resistant to stripe rust at all stages. Therefore, these six substitution lines could serve as useful bridging parents for wheat genetic improvement.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Molecular Cytogenetics of Chromosome 2St as Well as Chromosome 3St Derived from Thinopyrum Intermedium and Thinopyrum Ponticum","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-05-17 17:32:28","doi":"10.21203/rs.3.rs-461930/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2021-05-25T14:35:00+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-05-13T08:47:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-04-27T00:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Breeding","date":"2021-04-24T07:45:55+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-breeding","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"molb","sideBox":"Learn more about [Molecular Breeding](https://www.springer.com/journal/11032)","snPcode":"11032","submissionUrl":"https://submission.nature.com/new-submission/11032/3","title":"Molecular Breeding","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"0e391fcd-e2f8-4e15-9308-03818744df77","owner":[],"postedDate":"May 17th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":4355760,"name":"Agronomy"},{"id":4355761,"name":"Molecular Biology"},{"id":4355762,"name":"Plant Molecular Biology and Genetics"}],"tags":[],"updatedAt":"2021-05-17T17:32:28+00:00","versionOfRecord":[],"versionCreatedAt":"2021-05-17 17:32:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-461930","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-461930","identity":"rs-461930","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-06-02T02:00:03.124865+00:00
License: CC-BY-4.0