Phytohormones and microbial elicitation on glycyrrhizin production and gene expression in the hairy root of Glycyrrhiza glabra L. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Phytohormones and microbial elicitation on glycyrrhizin production and gene expression in the hairy root of Glycyrrhiza glabra L. Assieh Behdad, Ali Ganjeali This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5241404/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Dec, 2024 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted 4 You are reading this latest preprint version Abstract Glycyrrhiza glabra (licorice) is a valuable and endangered medicinal plant recognized for its rich saponin content, particularly glycyrrhizin. Hairy root culture offers a sustainable alternative for continuous glycyrrhizin production while preserving the species' biodiversity. This study aimed to determine the most effective Agrobacterium rhizogenes strain (ATCC 15834, A4, and A13) for hairy root induction and to assess the influence of Rhizobium leguminosarum (R) and Pseudomonas putida (P) on glycyrrhizin and saponin production. Additionally, the combined effects of the most efficient biotic elicitor with methyl jasmonate (MeJA) and gibberellin (GA) on the phytochemical and physiological responses of licorice hairy roots were investigated. The expression of genes related to glycyrrhizin biosynthesis was also analyzed. The hairy root transformation was confirmed in all strains through rolB gene amplification, with strain A13 identified as the most efficient. R. leguminosarum was more effective than P. putida in increasing glycyrrhizin and saponin content. Treatments with Rhizobium , MeJA, and GA increased oxidative stress markers, membrane damage, and the activity of enzymatic and non-enzymatic antioxidants. The highest glycyrrhizin and saponin levels were found in the MeJA×R and R treatments, respectively. RT‒PCR analysis demonstrated that the gene expression of bAS , CYP88D6 , and CYP72A154 elevated under MeJA×R treatment compared to the control. The PCA-biplot analysis showed that DPPH (IC 50 ) and H 2 O 2 levels had the most difference in assayed traits. In summary, the MeJA×R combination may activate a complex signaling network that scavenges ROS, leading to higher glycyrrhizin accumulation and upregulation of its biosynthetic pathway in licorice hairy roots. Licorice Glycyrrhizin RT‒PCR Rhizobium leguminosarum Pseudomonas putida PCA-biplot Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Key Massage Application of the methyl jasmonate and Rhizobium leguminosarum interaction as the best elicitor is a good strategy for continuously producing glycyrrhizin in the hairy roots of Glycyrrhiza glabra , which provides the potential for large-scale commercial production. Introduction Glycyrrhiza glabra L. (licorice) is a popular medicinal genus from the Fabaceae family growing in arid and semi-arid regions (Mehrotra et al., 2008 ; haghighi et al., 2022). The rhizomes and roots of licorice are rich in glycyrrhizin, ranging from 2–8% in dry weight (Hosseini et al. 2018 ; Shirazi et al. 2019 ). Glycyrrhizic acid, a triterpene saponin, has significant medicinal value, offering antiviral, anti-HIV, antiulcer, antiallergic, antibacterial, and anticancer properties (Pastorino et al., 2018 ; Selyutina and Polyakov, 2019 ; Nascimento and de Araújo, 2022 ). Saponins, a broad group of high-molecular-weight phytochemicals, have applications in pharmaceuticals, cosmetics, and food industries (Behdad et al., 2020a ; Sharma et al., 2023 ). Additionally, licorice contains crucial phenolic compounds, especially coumarins, chalcones, isoflavones, and flavonols (Srivastava and Misra, 2017 ). Various strategies have been employed to induce the biosynthesis of valuable phytochemicals under in vitro conditions (Ali 2021 ). A promising technique involves cultivating transformed hairy roots using Agrobacterium rhizogenes , a soil-borne gram-negative bacterium (Sujatha et al. 2013 ). Hairy root cultures offer advantages, such as more stable production of secondary metabolites, rapid growth in hormone-free media, and genetic and biochemical stability (Thwe et al., 2016 ; Srivastava et al., 2019 ). Elicitors, known as pattern-triggered immunity (PTI), are chemical substances secreted in minimal amounts that cause plant defenses to respond to adverse conditions and produce secondary metabolites (Ahlawat et al., 2014 ; Thakur et al., 2019 ; Yuan et al., 2021 ). Abiotic treatments include physical, chemical, and hormonal treatments, but materials derived from microorganisms are biotic elicitors (Chamkhi et al., 2021 ). The elicitation process begins with the interaction of an elicitor with a plant receptor, leading to changes in cytoplasmic ion concentration. Secondary messengers like Ca + 2 depolarize the plasma membrane and activate plant enzymes such as MAPKs, which in turn stimulate reactive oxygen species (ROS) and transcription factors, eventually triggering the expression of defense-related genes and increasing the biosynthesis of secondary metabolites (Hao et al., 2020 ; Chamkhi et al., 2021 ; Bhaskar et al., 2022 ). Biotic elicitation is an efficient and economical method for enhancing secondary metabolites because an individual colony of bacteria can produce high levels of elicitor proteins (Ramirez-Estrada et al., 2016 ; Le et al., 2018a ). Rhizosphere bacteria such as Pseudomonas , Rhizobium , and Azospirillum act as biotic elicitors that promote secondary metabolite biosynthesis in plants (Thakur et al. 2019 ). Bacillus subtillus regulates gymnemic acid metabolite synthesis in Gymnema sylvestre through cross-talk between signaling molecules (Humbal and Pathak, 2023 ). Le et al. ( 2018a ) reported that treatment with Rhizobium , a nitrogen-fixing bacterium, is a major strategy to increase the biosynthesis of plant secondary metabolites, especially those of the leguminous genus. Pseudomonas and Rhizobium species are the plant growth-promoting rhizobacteria (PGPR) that can biosynthesize plant hormones such as IAA and GA (Planchamp et al., 2015 ; Keswani et al., 2022 ). Several reports have shown that phytohormones improve the production of bioactive compounds in hairy root cultures of numerous medicinal species (Wongwicha et al., 2011 ; Liang et al., 2013 ; Lu et al., 2019 ; Yousefian et al., 2020a ). Methyl jasmonate (MeJA) is a signaling molecule that activates the defense response pathway to improve plant secondary metabolites (Awad et al., 2014 ; Yousefian et al., 2020a ; Jeyasri et al., 2023 ). Gibberellic acid (GA) is a widely used phytohormone that effectively modulates plant growth and the biosynthesis of secondary metabolites (Li et al., 2016b ). Plant defense systems rely on enzymatic and non-enzymatic antioxidants to mitigate ROS damage (Meng et al. 2018 ). Superoxide dismutase (SOD), for instance, converts superoxide anions into hydrogen peroxide and oxygen, while ascorbate peroxidase (APX) in the ascorbate-glutathione cycle reduces hydrogen peroxide into water and oxygen (Gill and Tuteja, 2010; Somboon et al., 2019 ). Further insights into metabolite biosynthesis can be gained by adding elicitors to in vitro cultures and observing gene responses (Pauwels et al. 2009 ). The biosynthesis of licorice saponins is carried out through several sequential enzymatic reactions. In the mevalonate pathway, Farnesyl pyrophosphate is converted into squalene, a precursor of all saponins, by squalene synthase (SQS) (Seki et al. 2011 ; Shirazi et al. 2018 ). β-Amyrin, lupeol, and cycloartenol are produced from 2,3-oxidosqualene by beta-amyrin synthase (bAS), lupeol synthase (LUS), and cycloartenol synthase (CAS), respectively (Hayashi et al. 2004 ). Beta-amyrin is the initiator of the glycyrrhizin and soyasaponin biosynthesis pathway. After two consecutive steps of saponin oxidation by CYP88D6 and CYP72A154, glycyrrhizin is biosynthesized (Seki et al. 2015 ; Shirazi et al. 2018 ). Due to excessive harvesting and extraction, wild licorice has become an endangered species (Manzoor et al., 2020 ; Behdad et al., 2021 ). However, the use of hairy root cultures in bioreactor systems provides a sustainable means for large-scale glycyrrhizin production (Srivastava et al., 2019 ). Hairy roots are particularly suitable for boosting secondary metabolite biosynthesis in endangered plants due to their high biomass yield in nutrient-limited conditions. Although previous studies have reported the successful production of hairy roots in licorice (Tenea et al., 2008; Mehrotra et al., 2008 ; Shirazi et al., 2012), the influence of biotic elicitors on the phytochemical content of licorice hairy roots has not been fully explored. This study aims to evaluate the effects of two biotic elicitors, Rhizobium leguminosarum and P seudomonas putida , on saponin and glycyrrhizin content in licorice hairy roots. Additionally, the study examined the combined effects of these biotic elicitors with MeJA and GA on glycyrrhizin accumulation, antioxidant capacity, and oxidative balance. Finally, the expression levels of key biosynthetic genes, including bAS and cytochrome P450s ( CYP88D6 and CYP72A154 ), were analyzed in response to the most effective elicitor treatment. Materials and methods Plant material G. glabra seeds were purchased from Pakan-Bazr Company in Isfahan, Iran. After disinfection with ethanol (70%) and NaClO (1%), the seeds were treated with 98% H 2 SO 4 (20 min) and then cleaned with sterile water. The seeds were subsequently grown on Murashige and Skoog (MS) solid media and exposed to an incubator with 60 µmol photons m − 2 s − 1 light of 16 h at 28 ± 2°C. Induction and proliferation of hairy root cultures For hairy root induction, four-week-old plantlets were applied as explants for A. rhizogenes injection. Single clones of A. rhizogene s strains ATCC 15834, A4, and A13 were grown in liquid yeast mannitol broth (YMB) supplemented with 50 mg/L rifampicin overnight at 28 ± 2°C and 150 rpm in a shaker incubator (Wise Cube, Germany). After the OD600 (optical density) of the Agrobacterium suspension reached 0.6–0.7, it was centrifuged (Pars-azma, Iran) at 4000 rpm for 15 min. The obtained pellet was again suspended in fresh liquid MS media and shaken at 70 rpm for 20 min. The leaf margins and edges were cut off and pricked manually with a sterile scalpel. The explants in the prepared infection suspension were immersed and transferred to a shaker (70 rpm for 20 min). Leaves as a control sample were subsequently immersed in distilled water, and other steps were performed under similar conditions. For co-cultivation, the infected explants were transferred to solid MS media and grown at 28°C for 72 h (Srivastava et al., 2019 ). To remove A. rhizogenes , the leaves were placed in fresh 1/2 MS media supplemented with 250 mg/L cefotaxime (without phytohormones) and then rinsed in distilled water containing cefotaxime. After the hairy roots reached a length of about 3–4 cm, they were cultured in 1/2 MS liquid media and kept in the dark at 25 ± 2°C with constant stirring at 90 rpm on an incubator shaker. The antibiotic concentration was decreased, and the bacteria were removed finally from each subculture. Extraction of genomic DNA and PCR analysis of putative transgenic Genomic DNA was extracted from hairy roots and control roots (negative control) using the CTAB method (Khan et al. 2007 ). Polymerase chain reaction (PCR) amplification (Thermo Fisher Scientific, USA) was performed with the rolB gene (accession no. 15952), and the T-DNA from the Ri plasmid integration and presence in hairy roots were assessed via the forward sequence 5'-GCTGATTATCCAGGTTTTCGG-3' and reverse sequence 5'-GATAAGAAAGGGGCACAGGAC-3'. The VirD1 gene (accession no. X51418.1) with the forward sequence 5'-GGTACGCTTGCTGGTGGAATAG-3ʹ and reverse sequence 5ʹ-GACGCTCGAAACGAACAAAGAC-3ʹ was utilized as a negative control to verify that A. rhizogenes was absent in the hairy roots. The amplification conditions for PCR were 94°C for 3 min, followed by 36 cycles of 94°C for 30 s, 58°C for 30 s, 72°C for 45 s, and 72°C for 5 min. The amplified product was observed via electrophoresis in a 1% agarose gel. Preparation and treatment of biotic and abiotic elicitors In this study, R. leguminosarum (RL330) and P. putida (KT2440) were used as bacterial elicitors. First, R. leguminosarum and P. putida were cultured in YMB at 28 ± 2°C and 150 rpm overnight. According to the growth curve, after 14 and 12 hours of R. leguminosarum and P. putida growth (In logarithmic growth), respectively, the bacterial OD600 was measured using a spectrophotometer (Analytik Jena-Spekol 1500, Germany). Then, 2 ml of the grown R. leguminosarum and P. putida was applied for elicitor. MeJA (Sigma, Germany) and GA (Sigma, Germany) were used as abiotic elicitors. For MeJA and GA treatment, stock solutions of 10 mM and 5 g/L, respectively, were prepared and then filter-sterilized. Sterilized MeJA (0.1 mM) GA (50 mg/L) was fed to 28-day-old licorice hairy roots. Hairy root cultures without elicitors served as controls. After all the elicitors were incubated into four-week-old hairy roots, the plants were incubated at 25 ± 2°C under agitation (100 rpm) for three days (Awad et al. 2014 ). The hairy roots were then harvested, thoroughly cleaned in distilled water, and allowed to air dry for future laboratory studies. Some of the samples were additionally frozen in liquid N 2 and kept at -70°C. Sample extraction Dried and ground hairy roots were extracted with methanol (1/10 w/v) and sonicated (Parsonic 2600s, Iran) for 30 min at 30°C. The extracts were then collected and replaced with new methanol, repeating the extraction process twice. The methanol was evaporated in a laboratory hood at a temperature of 18 ± 3°C for 24 h. The extract was utilized, for phytochemical studies. Determination of phenolic compounds content The colorimetric method was utilized to determine the content of phenolic compounds measured by (Chizzola et al. 2014 ). The extract was combined with a 1:10 dilution of Folin–Ciocalteu reagent used in distilled water. After 5 min, sodium bicarbonate (60 g L − 1 ) was added, and the mixture was maintained at room temperature for 90 min. The absorbance was assayed with a spectrophotometer (Analytik Jena-Spekol 1500, Germany) at 750 nm and reported in mg GA (gallic acid)/100 g dw. GA was utilized as a standard sample. Determination of flavonoid content To determine the content of flavonoid, potassium acetate (1 M), 10% (w/v) AlCl 3 , and distilled water were combined with the ethanolic extract. After the reaction mixture was put in the dark at room temperature (90 min), the absorbance of the samples was measured at 415 nm with a spectrophotometer (Analytik Jena-Spekol 1500, Germany). The quercetin equivalent (QE)/100 g dry weight was the reported flavonoid content (Chang et al. 2002 ). The reference concentration for quercetin was in the range of 20–120 mg ml − 1 . Determination of phenolic acid content The content of phenolic acid was assessed according to the methods of Matkowski et al. ( 2008 ). The methanolic extract was mixed with water, 10% HCl (w/v), Arnow reagent, and NaOH (1 M), and the absorbance was then immediately measured at 490 nm. Determination of saponin content The saponin content was measured using a vanillin-sulfuric acid assay. First, the extracts were kept in water at 65°C to eliminate methanol. The test tubes were then filled with 8% (w/v) vanillin solution and 72% (v/v) H 2 SO 4 and mixed with a vortex (Daihan Scientific, Korea). After incubation at 60°C (15 min), the tubes were placed in cool water at room temperature. Finally, absorption at 560 nm was measured via a spectrophotometer (Analytik Jena-Spekol 1500, Germany) (Le et al., 2018b ). The formula for calculating saponin content was µg of sapogenin/mg dry weight. Determination of glycyrrhizin content To determine the glycyrrhizin content, the dried and powdered hairy roots were extracted (1/10 w/v) with 80% (v/v) methanol at 40–45°C for 16–18 h. The centrifuged supernatant was then evaporated for 24 h at 18 ± 3°C in a lab hood (Srivastava et al., 2019 ). Using a high-performance liquid chromatography (HPLC) device, residual extracts were injected to measure the amount of glycyrrhizin. Standard glycyrrhizin was utilized at a concentration of 1 mg L − 1 . A C-18 reversed-phase column (15 × 4.6 cm) and a UV detector (K2501) at 254 nm were included in the HPLC instrument (KNAUER, Germany). Glacial acetic acid, acetonitrile, and water (6:30:64 v/v/v) formed the mobile phase and a gradient method at a rate of 1.5 ml/min was used. The ammonium salt of glycyrrhizin (Sigma‒Aldrich) was employed as a standard. Determination of DPPH radical scavenging capacity The methanolic solution of DPPH (0.1 mM) contained 0–100 µl of the methanolic extract and was diluted to a final volume of 1.5 ml. After the samples were allowed the rest in the dark for 60 min, the absorption rate at 517 nm was measured by spectrophotometer (Analytik Jena-Spekol 1500, Germany). The following formula was used to calculate the radical scavenging activity: A control = absorbance of the control sample; A sample = absorbance of the extract (Akowuah et al. 2005 ). Lipid peroxidation (malondialdehyde (MDA)) content Malondialdehyde was calculated using the method of Heath and Packer ( 1968 ). The hairy roots were powdered in trichloroacetic acid (TCA) at a concentration of 0.1% (w/v). Following centrifugation, the supernatant was mixed with 20% TCA containing 0.5% (w/v) TBA, warmed in water, and cooled. A spectrophotometer (Analytik Jena-Spekol 1500, Germany) was used to measure the absorption at 532 and 600 nm. The MDA content of hairy roots was reported as nmol g − 1 fw, with an extinction coefficient of 155 mM − 1 cm − 1 . Determination of H 2 O 2 For measurement of H 2 O 2 , hairy roots were extracted with 0.1% (w/v) TCA in an ice bath. The supernatant was centrifuged and then combined with 1 M KI and 10 mM K-phosphate buffer (pH = 7.0). The absorption was detected at 390 nm using a spectrophotometer (Analytik Jena-Spekol 1500, Germany). To calculate the H 2 O 2 concentration, a standard curve of H 2 O 2 was used and expressed as µmol g − 1 fw (Sagisaka 1976 ). Antioxidant enzyme activities Hairy roots were ground in liquid nitrogen and suspended in phosphate buffer (pH = 7.0) including 1% (w/v) polyvinylpyrrolidone (PVP) and 0.1 mM EDTA. After centrifugation at 4°C (Pars-azma, Iran), the supernatant was used to determine the activity of the antioxidant enzyme (Yan et al. 2006 ). APX activity (EC 1.11.1.11) was measured by scanning the reduction in ascorbate absorption. The hairy root extract (100 µl) was mixed with a solution of 0.5 mM ascorbate, 50 mM potassium phosphate buffer (pH = 7.0), and 0.1 mM EDTA. The absorbance (A290) was measured at 15-second intervals via a spectrophotometer (Analytik Jena-Spekol 1500, Germany), and the extinction coefficient was 2.8 mM − 1 cm − 1 (Nakano and Asada, 1981 ). SOD activity (EC 1.15.1.1) was assayed using the nitro blue tetrazolium (NBT) method (Becana et al. 1989 ). For this test, hairy extract (100 µl) was added to 0.1 mM EDTA, 82.5 µM NBT, 14.3 mM methionine, and 2.2 µM riboflavin dissolved in phosphate buffer (pH = 7.8) as a reaction mixture, to start the reaction. After incubation in each tube for 30 min under a light source (six 15 W fluorescent lamps) at a distance of 30 cm, the light was turned off to stop the reaction. As a control sample, a tube without enzyme extract was stored in the dark. As a dark control, 100 µl of the enzyme extract was added to the reaction mixture, which was then incubated in the dark. Using a spectrophotometer (Analytik Jena-Spekol 1500, Germany), the reduction of NBT was determined by scanning the A560 nm, and the SOD activity g − 1 fresh weight was expressed in units (U). Total RNA extraction, cDNA synthesis, and RT‒PCR analysis The total RNA of 30-day-old hairy roots was extracted with RNX plus solution (Sina Clon BioScience, IRAN) according to the instructions of the manufacturer. Triplicate technical replicates and three RNA extraction samples were used for each treatment and control. The RNA samples were analyzed for quantity and quality via a NanoDrop spectrophotometer (Analytic Jena, Germany). The integrity of the RNA was also checked visually by electrophoresis gel. According to the cDNA synthesis kit manufacturer's instructions (Denazist Asia, Mashhad, Iran), 1 µg of total RNA was utilized for the synthesis of first-strand cDNA. Reverse transcription polymerase chain reaction (RT‒PCR) was done quantitatively on cDNA via Master Mix Green (Ampliqon, Denmark). The program's cycle sequence comprised one denaturation cycle at 95°C for 5 min, then 45 cycles at 95°C for 30 s, 58°C for 20 s, and 72°C for 15 s. bAS , CYP88D6 , and CYP72A154 as specific primers were created using Primer 3 software (version 0.4.0). The housekeeping gene was 18S ribosomal RNA ( 18SrRNA ) (Table 1 ). The study used RT‒PCR amplification (Thermo Fisher Scientific, USA) was used to examine the relative expression of the important genes for the biosynthesis of glycyrrhizin. The replication of the desired gene fragments as PCR products was confirmed by the successful synthesis of cDNA. A sample without cDNA was used as a negative control. Finally, the intensity and width of the obtained bands were compared via image analysis via ImageJ software, and the resulting data were analyzed. Table 1 List of the primers used in RT-PCR analysis of the genes involved in glycyrrhizin biosynthesis in hairy roots of G. glabra. Gene Accession No. Forward and Reverse Primers 18SrRNA X02623 F: CTTCCTTGGATGTGGTAG R: TCGATGGTAGGATAGAGG GgbAS AB037203 F: TCCAGGGCATAGGAAGAAAG R: GCGAACCAAGAACCGTAAGT GgCYP88D6 KP851192.1 F: GTCCGCTGCCACTTTGTT R: TGGGTGTTCTTTCCTTCTTAGT GgCYP72A15 AB558153.1 F: TCATCACAGACCCAGAGCAA R: CCCATTTGTCACCCTCATAC Statistical analysis The experiment was performed as a fully randomized factorial design (3 phytohormones and 2 Rhizobium ). Except for the gene expression data, all data were obtained in triplicate. However, the selection of the best A. rhizogenes strain and the efficient biotic elicitor were done in a completely randomized design. Analysis of variance (ANOVA) and least squares means differences Student’s tests were used to define significant differences at P ≤ 0.05 by JMP version 9. The diagrams were drawn via Excel. The mean ± standard error (SE) was used to report the values. Multivariate statistical analyses were done by PAST ver., 3.14 (Hammer and Harper, 2006). Quantitative traits for treated licorice hairy roots by biotic and abiotic elicitors were measured by principal component analysis (PCA)-biplot (Unweighted Pair-group Method with Arithmetic Mean) (Sneath and Sokal, 1973). Results Establishment, proliferation and molecular confirmation of hairy roots In the study, all strains of A. rhizogenes (ATCC 15834, A4, and A13) were able to successfully produce hairy roots using the leaf explants (Table 2 ). Approximately 2 to 3 weeks after inoculation with A. rhizogenes strains, hairy roots emerged from the injured leaf site without callus development. The control samples that were inoculated with water did not observe the hairy roots. The proliferation of 775bp fragments related to the rol gene in the produced hairy roots confirmed the transformation and appearance of the hairy roots (Fig. 1 ). Additionally, to ensure that the roots were not contaminated with bacteria, specific VirA primers were used and did not propagate segments of 1390bp (Table 2 ). Table 2 The effect of three strains of Agrobacterium rhizogenes strains (ATTC15834, A4, and A13) on percentage of induction, the length, fresh, and dry weight in hairy roots of G. glabra. Data are means ± standard error (n = 3). Means followed by the same letter are not significantly different ( P ≤ 0.05 ) by LSMeans Student's t. Source percentage of hairy root induction Length (more than 2 cm) Fresh weight (g) Dry weight (g) ATCC 15834 50.16 a ± 4.01 25.33 ab ± 1.20 0.31 b ± 0.04 0.02 ab ± 0.00 A4 32.33 b ± 4.97 18 b ± 5.19 0.19 b ± 0.02 0.01 b ± 0.00 A13 30.33 b ± 5.17 34 a ± 2.08 0.66 a ± 0.14 0.04 a ± 0.01 Selecting the indicator strain of A. rhizogenes Analysis of variance showed that the percentage of hairy root induction, hairy root length, fresh weight, and dry weight were significantly affected by different strains of A. rhizogenes ( P ≤ 0.05 ). Thirty days after the first subculture, the highest level of hairy root formation was associated with strain ATCC 15834, and the maximum level of hairy root length, fresh weight, and dry weight was observed with strain A13 (Table 2 ). The amount of biomass produced by the A13 strain was significantly two and four-fold greater than that produced by ATCC 15834 and A4 respectively, so the A13 strain was chosen as an efficient strain because of its rapid growth among the studied strains (Fig. 2 ). After the indicator strain was selected, a growth curve was generated to determine the growth period and the appropriate time to apply the treatments. In the study, the hairy roots of G. glabra grew very slowly until the tenth day, and their exponential growth started from the fifteenth day, followed by their growth stability on the thirtieth day. The hairy roots were slender and light yellow and presented many lateral branches, but the color gradually changed to light brown from 3–4 weeks. Selecting the efficient biotic elicitor Based on Fig. 3 , the effects of R. leguminosarum and Pseudomonas putida on the content of saponin and glycyrrhizin in the licorice hairy roots were significant ( P ≤ 0.001 ). The saponin and glycyrrhizin content of the treated hairy roots with bacteria were enhanced, compared with the control. The highest saponin and glycyrrhizin content was related to R. leguminosarum treatment, which increased by 46% and 94%, respectively, compared to the control group (Fig. 3 ). Phenolic compounds, flavonoids, and phenolic acid contents The results showed that phytohormones (MeJA and GA) and R. leguminosarum and their interactions significantly affected on the content of phenolic acid, flavonoids, and phenolic compounds in hairy roots ( P ≤ 0.01 ) (Table 3 ). Compared with the control, all the elicitors led to a marked increase in phenolic compounds, flavonoids, and phenolic acid contents. The lowest and highest phenolic compounds were observed in the MeJA (27.63 mg/g dw) and GA×R (35.89 mg/g dw) treatments, respectively (Fig. 4 ). As shown in Fig. 4 , the trend of changes in flavonoid and phenolic acid contents was similar in all the treatments with biotic and abiotic elicitors. However, the maximum values of flavonoids and phenolic acids were detected in hairy roots treated with gibberellic acid and methyl jasmonate (3.5 and 3.4 fold, greater than those in the controls), respectively. Table 3 Analysis of variances (ANOVA) of the effect of phytohoemones (MeJa and GA), Rhizobium leguminosarum and interactions on phenolic compounds, flavonoids, and phenolic acids DPPH (IC 50 ), saponin, glycyrrhizin, MDA, and H 2 O 2 content, APX, and SOD activity in the hairy roots of G. glabra . Source df Phenolic compounds (mg/ g dw) Flavonoid (mg/ g dw) Phenolic acid (mg/ g dw) DPPH IC 50 (mg/ml) Saponin (mg/g dw) Glycyrrhizin (mg/ g dw) MDA (nmol − 1 FW) H 2 O 2 (µmol − 1 FW) APX (Unit g − 1 FW) SOD (Unit g − 1 FW) Phytohormones 2 65.166 *** 8.406 *** 6.855 *** 1052 *** 0.024 NS 0.395 *** 5.253 *** 508 *** 0.110 *** 2.228 *** R. leguminosarum 1 76.495 *** 0.154 NS 0.139 NS 1938 *** 2.638 * 0.679 *** 38.587 *** 1159 *** 1.871 *** 35.186 *** Phytohormones× R. leguminosarum 2 7.173 ** 1.944 *** 4.254 *** 940 ** 2.811 ** 0.084 ** 0.109 * 194 *** 0.025 * 0.635 *** Error 12 0.656 0.047 0.150 52.78 0.335 0.008 0.024 7.560 0.005 0.0138 “NS” indicates that the differences are not significant. * P < 0.05. ** P < 0.01. *** P < 0.001 Saponin and glycyrrhizin contents The results revealed that biotic elicitor, phytohormones, and their interactions had significant effects on saponin and glycyrrhizin contents in the licorice hairy roots ( P ≤ 0.05 ) (Table 3 ). The saponin and glycyrrhizin contents of the hairy root extracts were markedly greater (10–32% and 11–51%, respectively) than those of the control samples (Fig. 4 ). According to HPLC analysis, the highest concentration of glycyrrhizin (2.82 mg/g dw) was observed in hairy roots treated with concomitant treatment (MeJA and bacteria). However, the use of R. leguminosarum increased the maximum saponin level (8.97 mg/g dw). Antioxidant capacity As shown in Table 3 , the antioxidant capacity determined by DPPH (IC 50 ) of the treated licorice hairy roots decreased significantly ( P ≤ 0.01 ) compared with that of the controls. However, the antioxidant capacity of all the elicitors (except MeJA) was not significantly different from each other (Fig. 5 ). The highest DPPH radical scavenging activity (lowest IC 50 ) was related to the application of GA, which resulted in a 1.6-fold decrease compared with that of control but was 6.2 times more than the antioxidant capacity of ascorbate (standard sample). The interaction effect of MeJA application and bacteria was greater effective than that of the MeJA alone on DPPH radical scavenging, leading to a significant decrease in the IC 50 value. Oxidative stress markers Biotic and abiotic elicitors and their interaction markedly induced lipid peroxidation and hydrogen peroxide ( P ≤ 0.05 ) (Table 3 ). As shown in Fig. 6 , the MDA content in the hairy root extracts elevated, ranging from 1.5- to 2.7-fold, which was related to the GA factor and MeJA×R interaction. The pattern of changes in H 2 O 2 levels was comparable to that of malondialdehyde levels and significantly increased ( P ≤ 0.01 ). High induction of H 2 O 2 was detected in response to the simultaneous application of GA and R factors (GA×R), which showed a six-fold enhancement compared to the untreated hairy roots. Antioxidant enzyme activities The activities of APX and SOD were significantly higher ( P ≤ 0.05 ) in all biotic and abiotic elicitors than compared to the control (Table 3 ). In the study, the MeJA×R and GA×R interactions resulted in a greater increase in APX and SOD activity than did the R and MeJA treatments alone. The highest levels of APX and SOD activity were observed for the GA×R and MeJA×R interactions, with values three and four times greater than those of the controls, respectively. The patterns of APX and SOD activity were similar, but the activity level of the superoxide dismutase enzyme was observed higher than that of the ascorbate peroxidase enzyme (Fig. 7 ). Pathway gene expression analysis RT‒PCR results indicated that MeJA×R interactions significantly enhanced the expression of CYP88D6 , CYP72A154 , and bAS , compared with that in the untreated samples (P ≤ 0.05) (Table 4 ). In comparison to the control, the relative expression levels of the CYP88D6 , CYP72A154 , and bAS genes were elevated by 32%, 86%, and 21%, respectively (Fig. 8 ). Table 4 Analysis of variances (ANOVA) of the effect of MeJA and Rhizobium leguminosarum on relative gene expression of bAS, CYP88D6 , and CYP72A154 in the hairy roots of G. glabra. Source df bAS CYP88D6 CYP72A154 MeJA× Rhizobium leguminosarum 1 0.071 * 0.162 *** 1.127 *** Error 4 0.004 0.001 0.006 “NS” indicates that the differences are not significant. * P < 0.05. ** P < 0.01. *** P < 0.001 PCA-biplot analysis PCA-biplot was performed using eigenvalues and % variance based on assayed traits of treated licorice hairy roots by biotic and abiotic elicitors. Ten phytochemical and physiological characteristics were noticed in three main components (Table 5 ). The first principle component (PC1) DPPH (IC 50 ) values had the highest variance content, showing 78.532% of the overall variance. In PC2, most portion of the variance was related to H 2 O 2 levels, clarifying 20.524% of the total variance (Fig. 9 and Table 5 ). Table 5 Eigenvalues and % of variance for factors obtained from the principal component analysis (PCA) based on assayed traits for treated licorice hairy roots by biotic and abiotic elicitors. Variable Component PC1 PC2 PC3 Phenolic compound -0.1612 0.0305 0.8448 Flavonoid -0.0371 -0.0251 0.2372 Phenolic acid -0.0290 0.0261 0.1104 DPPH (IC 50 ) 0.8984 0.4126 0.1070 Saponin -0.0230 -0.0252 -0.2344 Glycyrrhizin -0.0080 0.0109 -0.1421 SOD -0.0590 0.0767 -0.2141 APX -0.0117 0.0199 -0.0599 MDA -0.0655 0.0795 -0.2836 H 2 O 2 -0.3951 0.9022 -0.0344 Eigenvalue 463.703 121.189 2.1443 % variance 78.532 20.524 0.5352 Discussion The results showed that all strains of A. rhizogenes (ATCC 15834, A4, and A13) were capable of establishing hairy roots with different efficiencies in G. glabra leaf explants. There were no hairy roots in the untransformed explants. Compared with other strains, A13-transformed hairy roots were selected as an efficient strain for licorice root hairy induction because of their faster growth and greater biomass. The transformation efficiency was more influenced by different Agrobacterium strains (Jain and Singh 2015 ). Mehrotra et al. (2018) and Srivastava et al. ( 2019 ) produced hairy roots with the A4 and K599 strains of licorice leaf explants, respectively, via the immersion method. Yousefian et al. ( 2020b ) reported that strain A13 exhibited greater infection efficiency than other strains (R318, A4, GMI 9534, and ATCC 15834) for hairy root formation in Mentha spicata L. According to the results of Srivastava et al. ( 2019 ), 4-week-old seedling leaves were used as explants because 4-week-old plants are highly efficient at hairy root induction. Agrobacterium -mediated transformation is closely correlated with the age and hormonal balance of explants (Sujatha et al. 2013 ). The infection site and its cell division, as well as the integration of the T-DNA region into plant genes, are essential and play important roles in the appearance of the hairy root (Chaudhuri et al. 2005 ; Grzegorczyk-Karolak et al. 2018 ). When the vein part of a leaf is wounded, the phloem cells in the leaf vein likely contain high amounts of sucrose and auxin and can be suitable for the establishment of bacterial A. rhizogenes infection and the emergence of hairy roots (Tiwari et al. 2007 ). During hairy root production, the biosynthesis of MeJA is induced in wounded and infected leaves by A. rhizogenes to activate signal transduction processes (Yousefian et al. 2020b ). PCR analysis revealed the existence of rolB gene bands in the roots of plants transformed with all the strains of A. rhizogenes , confirming that the T-DNA region of the plasmid was transferred into the plant genome. However, the absence of the virA sequence was demonstrated (Fig. 2 ). T-DNA is transferred from a plasmid (pRi) of A. rhizogenes , and the integration of the genes rolA , rolB , rolC , and rolD into the genome of plants leads to the formation of hairy roots (Chandra, 2012 ; Singh et al., 2014 ). The co-cultivation of A. rhizogenes with the injured tissue of the host plant causes the release of signaling molecules from the bacteria and thus vir gene induction (Tavassoli and Safipour Afshar, 2018 ). Grzegorczyk-Karolak et al. ( 2018 ) proposed that the rolB gene is the most important gene. However, the rolA , rolC , and rolD genes synergistically enhance the induction of hairy root growth. The difference in the amount of plant growth regulators is due to the expression and presence of the rolA , rolB , and rolC genes, and the susceptibility of plant cells to these genes leads to differences in the growth of clones (Ono and Tian, 2011 ; Grzegorczyk-Karolak et al., 2018 ). rol genes influence the growth and secondary metabolite biosynthesis of transformed roots by inducing the activation of plant defense genes and the biosynthesis of the PR protein (Bulgakov et al. 2013 ; Grzegorczyk-Karolak et al. 2018 ; Yousefian et al. 2020a ). In this study, the hairy roots produced by the A13 strain were slender and light yellow and presented many lateral branches, but the color gradually changed to light brown after 3–4 weeks. The best time to apply elicitors was 4 weeks after the hairy roots appeared. Similarly, the hairy roots of Tylophora indica changed from white to reddish-brown from 6–8 weeks (Chaudhuri et al. 2005 ). According to the results of Wongwicha et al. ( 2011 ), the best time to apply the treatments was in the fourth week of culture, when the glycine content reached the maximum level. Based on Fig. 3 , R. leguminosarum was more effective than P. putida in increasing glycyrrhizin and saponin content. Similarly, Awad et al. ( 2014 ) indicated that the maximum level of glycyrrhizin in hairy roots of Taverniera cuneifolia treated with different biotic elicitors was related to R. leguminosarum treatment. Polysaccharides of microbial cell walls are generally efficient elicitors (Mañero et al., 2012 ; Le et al., 2018a ). Chamkhi et al. ( 2021 ) reported that microbial elicitation stimulates the production of plant secondary metabolites to different extents depending on the type of carbohydrate and polysaccharide fraction. Li et al. ( 2016a ) demonstrated that the amounts of total flavonoids, glycyrrhizic acid, glycyrrhetinic acid, and polysaccharides produced were twofold greater in G. uralensis treated with protein fragment elicitors than in the control. In addition, Pathogenesis-related (PR) proteins are encoded by the host plant and are induced to overcome stress conditions (Somboon et al. 2019 ). After microbial infection, SA and JA-mediated defense signaling pathways are induced and increase the biosynthesis of PR proteins (Zehra et al. 2021 ). In microbe treatments, the defense pathway mediated by JA/ET activated which induced ROS and biosynthesis of bioactive components (Zehra et al. 2021 ). In the study, the higher increase in glycyrrhizin content of the treated hairy roots with R. leguminosarum occurred likely because G. glabra is a plant from the Fabaceae family and potentially closely interacts with nodulation bacteria (Mañero et al., 2012 ). In addition, R. leguminosarum probably caused more activation of defense pathways or increased GA and JA endogenously and as a result, production of more glycyrrhizin and saponin levels than P. putida treatment. In the present study, the phenolic compound, flavonoid, and phenolic acid contents increased in response to biotic elicitors and phytohormones and their interactions in comparison to those in the controls. Compared with the other treatments, the application of GA led to the maximum levels of phenolic compounds in licorice hairy roots (Fig. 4 ). Plant growth regulators such as MeJA can increase the flavonoid content in Glycyrrhiza inflata (Yang et al., 2008) and the rosmarinic acid content in S. miltiorrhiza (Xing et al. 2018 ), and GA 3 treatment is a good strategy for increasing the caffeic acid content in Echinacea purpurea hairy roots (Abbasi et al., 2012 ). Depending on the type of elicitors and the target cell, different inducers can activate distinct signaling pathways in plant cells (Chamkhi et al. 2021 ). Exogenous treatment of jasmonate as a chemical messenger increases the biosynthesis of phenolic compounds by stimulating different signaling cascades and phenylpropanoid pathway genes (Yousefian et al. 2021 ). According to Liang et al. ( 2013 ), GA 3 treatment, which affects tyrosine aminotransferase (TAT) and phenylalanine ammonia-lyase (PAL) activities, increases the phenolic acid content in Salvia miltiorrhiza hairy roots. Most likely, GA 3 supplementation increased the amount of phenolic compounds in treated hair roots by influencing the lignification of hairy roots (Abbasi et al. 2012 ). Moreover, endogenous GA contributed to the simultaneous accumulation of phenolic compounds under gibberellic acid treatment (Liang et al. 2013 ). Zhang et al. (2022) reported that Flavonoid 3’-monooxygenase as an important enzyme in the flavonoid biosynthesis pathway negatively correlates with glycyrrhizin in G. uralensis . Yeast extract is a biotic factor that increases flavonoid biosynthesis in G. uralensis Fisch hairy roots (Zhang et al., 2009 ). Martin-Rivilla et al., (2021) reported that treatment of P. fluorescens reinforced flavonoid biosynthesis in fruits and leaves of blackberry. The rolB gene can also increase the accumulation of phenols and flavonoids in hairy roots by influencing the biosynthetic pathway of phytochemicals (Tavassoli and Safipour Afshar 2018 ). Shkryl et al. ( 2008 ) reported that the rolA , rolB , and rolC genes can increase the production of quinones in the transformed cells of Rubia cordifolia . In addition, hairy roots have the potential to produce new natural metabolites. For example, Li et al. ( 1998 ) reported licoagrodione as a novel biflavonoid with antimicrobial activity obtained from licorice hairy root. As shown in Fig. 4 , the exposure of hairy roots to the GA, MeJA, Rhizobium , and GA×R and MeJA×R interactions led to elevated saponin and glycyrrhizin contents (16–19% and 11–51%, respectively) compared with those in the control. The greatest increases in the saponin and glycyrrhizin contents were observed for the R and MeJA×R interactions, respectively. Khan et al., (2024) reported that the combination effect of MeJA and P. fluorescens caused elevated secondary metabolites biosynthesis and osmotic balance in Brassica juncea under drought conditions. Exogenously applied methyl jasmonate and jasmonic acid (JA) could modify the biosynthesis of saponins in different plant species, such as ginsenosides in adventitious root cultures of Panax ginseng (Hao et al. 2020 ), soyasaponin in licorice cell cultures (Hayashi et al., 2003 ), glycyrrhizin in hairy roots of Abrus precatorius (Sajjalaguddam and Paladugu 2016 ), and artemisinin in Artemisia annua (Harfi et al. 2018 ). Additionally, the optimization of both the exposure time and concentration of treatment are important factors for achieving the highest level of triterpene production (Shabani et al., 2009 ; Yousefian et al., 2021 ). Several reports have shown that 100 µM MeJA is the optimal concentration to achieve high biosynthesis of glycyrrhizin in various in in vitro cultures (Bonfill et al., 2011 ; Wongwicha et al., 2011 ; Awad et al., 2014 ). MeJA treatment stimulates the signaling network of the endogenous hormones JA and ethylene by increasing ROS production, thereby activating the expression of transcription factors and genes involved in secondary metabolite biosynthesis (Leon-Reyes et al. 2009 ; Somboon et al. 2019 ). Li et al. ( 2016b ) reported that the accumulation of glycyrrhizic acid in G. uralensis was significantly accelerated by treatment with auxin and gibberellic acid. Moreover, Yuan et al. ( 2008 ) reported that GA 3 treatment led to an increase in tanshinone in S. miltiorrhiza. Considering that the biosynthesis of gibberellic acid and glycyrrhizin (as triterpenes) both initiate from the common mevalonic acid pathway, it can be concluded that exogenous treatment with GA 3 probably results in carbon diversion into the glycyrrhizin biosynthesis pathway after the formation of FPP and enhances the glycyrrhizin content (Zhang et al., 2005 ). Bacterial species are sometimes recognized by plants as noninvasive pathogens and cause the biosynthesis of secondary metabolites (Mañero et al., 2012 ; Hao et al., 2020 ). In the study, R. leguminosarum treatment probably activated defense pathways related to JA and elevated ROS levels which induced glycyrrhizin and saponin biosynthesis (Zehra et al. 2021 ). Similarly, Le et al. ( 2018a ) stated that gram-negative bacteria including Mesorhizobium huakuii , Mesorhizobium amorphae , Bradyrhizobium ganzhouense , and Azotobacter beijerinckii were utilized to a greater extent for the biosynthesis of ginsenoside (known as saponin) than were gram-positive bacteria ( Bacillus sp. and Leuconostoc sp.) in Panax ginseng . In another study, Escherichia coli elicitation resulted in the production of a protein (more than 10 kDa) that regulated the genes responsible for glycyrrhizin production in G. uralensis (Li et al., 2016a ). In the present study, compared to the control treatment, hairy roots treated with biotic and abiotic elicitors exhibited greater DPPH antioxidant capacity and a greater reduction in the IC 50 . El-Esawi et al. ( 2017 ) reported that increasing the amount of phenolic compounds, elevated the DPPH antioxidant capacity of transformed hairy root of Lactuca serriola L. compared to the controls. Similarly, Abbasi et al. ( 2012 ) indicated that the antioxidant properties of DPPH are related to the accumulation of phenolic compounds, flavonoids, and phenolic acids. The presence of free OH groups in the structure of phenolic compounds results in their antioxidant effects as well as the removal and neutralization of free radicals (Somboon et al. 2019 ). The antioxidant capacity mitigates the destructive effect of free radicals by maintaining the structure and function of DNA, proteins, and enzymes and stabilizing membrane integrity (Behdad et al. 2021 ). Moreover, the antioxidant system plays an important role in combating and eliminating oxidative stress (Tohma and Gulçin 2010 ). Phytohormones play an important function in stimulating defense responses (Halder et al. 2019 ). In addition, high radical scavenging activity was observed in the hairy roots of E. purpurea under GA 3 treatment (Abbasi et al. 2012 ). Bacterial elicitors stimulate cellular defense responses against pathogens (Le et al., 2018a ). Rhizobium species are a group of rhizobacteria that activate alternative defense mechanisms in plants by inducing the accumulation of ABA (Wang et al. 2020 ). As an antioxidant, glycyrrhizin (triterpenoid) and its derivatives can combat and minimize the toxic effects of ROS (Hosseini et al., 2018 ; Srivastava et al., 2019 ). Nasrollahi et al. ( 2014 ) indicated that triterpenes and b-amyrin (a precursor of glycyrrhizin), a secondary metabolite of extracted Jatropha gaumeri leaves, had antioxidant effects. Probably, Rhizobium as PGPR leads to systemic resistance through induce Ja biosynthesis and signaling transduction pathways (Thakur et al. 2019 ). The present results showed that the increase in the MDA and H 2 O 2 concentrations in licorice hairy roots in response to elicitor application could reflect cell destruction caused by oxidative stress. The maximum contents of oxidative markers were detected in the MeJA×R and GA×R interactions. In an experiment, the application of biotic and abiotic elicitors led to increased levels of ROS and thus induced oxidative stress (Srivastava et al., 2019 ). Hao et al. ( 2020 ) reported that fungal elicitor treatment of adventitious roots in Panax ginseng caused an excessive increase in the rate of H 2 O 2 and modulated the biosynthesis of ginsenoside (Humbal and Pathak 2023 ). Ca + 2 , NO, and H 2 O 2 are important signaling molecules that activate the defense system of plants and improve plant metabolite production (Hao et al. 2020 ). The movement of H 2 O 2 across the cytoplasmic membrane affects the permeability of the membrane and increases the content of MDA, which is an indicator of lipid peroxidation of the membrane, thereby causing cellular disorders (Behdad et al. 2021 ). Moreover, MeJA has an important function in defense responses against oxidative and membrane-destructive stresses (Amani et al. 2019 ). After elicitation, the receptor on the cell membrane recognizes the elicitor, and different physiological and biochemical events occur, such as an increase in the calcium concentration in the cytosol, phosphorylation, and dephosphorylation of the plasma membrane, especially increased plasma membrane H + -ATPase activity, leading to the inward flow of protons, cytoplasmic acidification and a decrease in pH (Tohma and Gulçin, 2010 ; Jeyasri et al., 2023 ). As a result of these events, the mitogen-activated protein kinase (MAPK) and NADPH oxidase signaling pathways are activated, increasing ROS and jasmonate levels and reinforcing the plant defense system (Hao et al. 2020 ; Humbal and Pathak 2023 ). Under biotic treatments, increasing H 2 O 2 level induces phosphorylation of transcription factors and MAPK cascade, as a result of activation defense pathway gen (JA) and antioxidant enzymes and PR (Sun et al., 2023). In addition, the bacterial elicitor itself can release acidic metabolites and lower the pH of the cells (Le et al., 2018a ). Similarly, Wu et al. ( 2007 ) reported that the pH of culture media containing hairy roots of Salvia miltiorrhiza treated with B. cereus decreased dramatically. In the study, R. leguminosarum led to accumulation higher level of H 2 O 2 than abiotic elicitors (MeJA and GA). Similarly, Hao et al. ( 2020 ) reported that peroxide hydrogen bursts occurred after fungal elicitation treatment. Excess ROS, which acts as signaling molecules, stimulate the biosynthesis of secondary metabolites and activate defense responses against free radicals (Amani et al. 2019 ). Bulgakov (2008) reported a positive correlation between the expression of the rol gene and the rise in ROS levels in plant cells. In this study, the SOD and APX enzyme activities were elevated (1.77–5.05-fold and 1.08–4.08-fold, respectively) under the bacterial and phytohormone treatments compared with those of the controls. Under the simultaneous treatment with phytohormones and bacteria, the activity levels of SOD and APX were greater than those under the treatments alone. Similarly, the greatest increase in SOD activity was reported compared to that of other antioxidant enzymes (Srivastava et al., 2019 ). SOD is an essential antioxidant enzyme because it acts as the first defense line and is capable of converting superoxide to hydrogen peroxide (Behdad et al., 2020b ). Toxic H 2 O 2 is scavenged and converted to H 2 O by catalase and APX (Çoban and Baydar 2016 ). The positive relationship between stimulation of the SOD activity and the ability of plants to withstand oxidative stress indicates the critical importance of this antioxidant enzyme (Srivastava et al. 2019 a). According to a report by Jeyasri et al. ( 2023 ), the exposure of hairy roots to MeJA likely leads to the activation of signal transduction and plant defense mechanisms through the upregulation of the CuZn-SOD, glutathione peroxidase (GPX), and APX genes. In addition, the levels of the antioxidant enzymes catalase and peroxidase enhanced along with the increasing oxidant content, H 2 O 2 and malondialdehyde content in G. inflata treated with methyl jasmonate (Yang Ying et al. 2008 ). The results stated that MeJA can mitigate oxidative stress by increasing the antioxidant enzymes activity (Lang et al., 2020). JA has been reported to protect plants by inhibiting oxidative stress damage (Pedranzani et al., 2003). Rudrappa et al. ( 2006 ) showed that Candida versatilis treatment significantly increased the activity of peroxidase enzymes. Srivastava et al. ( 2019 ) stated that the SOD and APX enzyme activities in the hairy roots of licorice plants under cellulase and mannan treatment significantly increased compared to the control. The cellulase of R. leguminosarum is a 1,4-β-d-endoglucanase that hydrolyzes and biosynthesizes rhizobial cellulose (Menéndez et al., 2016 ). The presence of cellulose in the bacteria might be caused by an increase in antioxidant enzyme activity. In this study, the transcription rates of glycyrrhizin biosynthesis pathway genes were investigated via RT‒PCR. Compared the control, the gene expression levels of CYP88D6 , CYP72A154 , and bAS significantly increased in response to MeJA×R, as the best elicitor. Consistent with other studies, Hayashi et al. ( 2003 ) showed that treatment with MeJA (100 µM) resulted in an increase in the mRNA level of the bAS gene. Srivastava et al. ( 2019 ) reported that the relative levels of SQS , bAS , and CYP88D6 gene expression in abiotic elicitor-treated licorice hairy roots were significantly greater than those in control plants. As signaling molecules, elicitors can activate signal transduction pathways and regulate secondary metabolism via transcription factors in response to stimuli (Halder et al., 2019 ; Bhaskar et al., 2022 ). Glycyrrhizin biosynthesis occurs through the mevalonate pathway (MVA) (Alcalde et al. 2022 ). In this pathway, FPP is converted to squalene by the enzyme SQS. The enzyme bAS is involved in the cyclization of 2,3-oxidosqualane, which leads to the biosynthesis of beta-amyrin (Seki et al. 2015 ; Tamura et al. 2017 ). The enzymes CYP88D6 and CYP72A154 divert the soyasaponin biosynthetic pathway to produce glycyrrhizin (Seki et al., 2015 ; Xie et al., 2018). Beta-amyrin-11 oxidase (CYP88D6) plays an important function in the engineering pathway of glycyrrhizin production by converting beta-amyrin to 11-oxo-β-amyrin via two oxidation steps (Seki et al. 2011 ). The triterpene oxidation enzymes of the cytochrome P450 family (CYP72 and CYP88) are in charge of the biosynthesis of terpenoids, including glycyrrhizin, artemisinin, and taxol (Seki et al., 2008, 2011 ). The expression of genes involved in the biosynthetic pathways of secondary metabolites was strongly correlated with their biosynthetic levels (Srivastava et al., 2019 ). Shabani et al. ( 2009 ) demonstrated that the glycyrrhizin content can be significantly altered by slight variations in bAS gene expression. Shirazi et al. ( 2019 ) found that glycyrrhizin production is significantly influenced by CYP88D6 and SQS 1 . In this study, the level of CYP72A154 gene expression increased more than that of the other studied genes under MeJA + R treatment. SQS , squalene epoxidase ( SE ), and bAS genes related to the biosynthesis of saponins are upregulated by MeJA (Hayashi et al., 2003 ; Shabani et al., 2009 ). A similar study by Chandran et al. (2020) indicated that two JA-responsive transcription factors (AP2/ERF proteins) bind to the promoters of genes and catalyze artemisinin synthesis in Artemisia annua . Suzuki et al. (2002) demonstrated that the transcription of bAS increased 30-fold under MeJA treatment with suspensions of Medicago truncatula roots for 8–24 h compared with the control. Furthermore, MeJA treatment (0.5 mM) resulted in a twofold increase in the number of bAS transcripts in Bupleurum kaoi (Chen et al., 2007 ). Most likely, MeJA and Rhizobium enhance glycyrrhizin biosynthesis by affecting the activities of important enzymes involved in saponin production or gene expression. Conclusion The results revealed that the A13 strain was the indicator strain, as evidenced by it having the highest growth rate of hairy roots among the strains studied. R. leguminosarum was more effective than P. putida in increasing the glycyrrhizin and saponin content of licorice hairy root. R. leguminosarum , MeJA, and GA, both individually and in combination, elevated the levels of oxidative markers and induced the production of enzymatic and nonenzymatic antioxidants, thereby mitigating ROS. The combination treatment (MeJA×R) directly increased glycyrrhizin biosynthesis by upregulating the expression of important genes ( bAS , CYP88D6 , and CYP72A154 ) related to triterpenoid saponin production. In confirmation of the obtained results, PCA-biplot analysis showed that the amount of H 2 O 2 and DPPH (IC 50 ) as effective factors has a greater impact on the content of phytochemical compounds in the MeJA×R treatment, compared to other treatments. The application of MeJA×R interactions was found to be an effective strategy for the continuous biosynthesis of glycyrrhizin in licorice hairy roots. Abbreviations MeJA, methyl jasmonate; GA, gibberellic acid; R, Rhizobium leguminosarum ; P, Pseudomonas putida ; DPPH, 2,2-diphenyl-1-picrylhydrazyl; ROS, reactive oxygen species; MDA, malodialdehyde; APX, ascorbate peroxidase; SOD, superoxide dismutase; HPLC, high-performance liquid chromatography; RT‒PCR, reverse transcription-polymerase chain reaction; PAL, phenylalanine ammonia-lyase; YMB, yeast mannitol broth; bAS, beta-amyrin synthase; SQS, squalene synthase; JA, jasmonic acid; PCA-biplot, principal component analysis-biplot. IAA, Indol acetic acid. Declarations Acknowledgements We would like to thank the Iran National Science Foundation for financial support (4000573) of this research, Tehran, Iran. Author contribution AB performed the experiments, data analysis, wrote and revised the manuscript. AG supervised the whole research work, administrated the project, and revised the manuscript. All authors contributed to the editing and approved the final version of the manuscript. Competing interests The authors have no competing interests to disclose or personal relationships that could influence the work presented in this article. Ethical statement The authors declare no conflict of interest. References Abbasi BH, Stiles AR, Saxena PK, Liu C-Z (2012) Gibberellic acid increases secondary metabolite production in Echinacea purpurea hairy roots. Appl Biochem Biotechnol 168:2057–2066. https://doi.org/10.1007/s12010-012-9917-z. Ahlawat S, Saxena P, Alam P, et al (2014) Modulation of artemisinin biosynthesis by elicitors, inhibitor, and precursor in hairy root cultures of Artemisia Annua L. J Plant Interact 9(1):811–824. https://doi.org/10.1080/17429145.2014.949885 Akowuah GA, Ismail Z, Norhayati I, Sadikun A (2005) The effects of different extraction solvents of varying polarities on polyphenols of Orthosiphon stamineus and evaluation of the free radical-scavenging activity. Food Chem 93:311–317. https://doi.org/10.1016/j.foodchem.2004.09.028. Alcalde MA, Cusido RM, Moyano E, et al (2022) Metabolic gene expression and centelloside production in elicited Centella asiatica hairy root cultures. Ind Crops Prod 184:114988. https://doi.org/10.1016/j.indcrop.2022.114988. Ali B (2021) Practical applications of jasmonates in the biosynthesis and accumulation of secondary metabolites in plants. Biocatal Agric Biotechnol 38:102205. https://doi.org/10.1016/j.bcab.2021.102205. Amani S, Mohebodini M, Khademvatan S, Jafari M (2019) Agrobacterium rhizogenes -mediated hairy root induction and plant regeneration from transgenic roots in Ficus carica L. Journal of Plant Molecular Breeding 7:10–21. https://doi.org/10.22058/jpmb.2019.112410.1188. Awad V, Kuvalekar A, Harsulkar A (2014) Microbial elicitation in root cultures of Taverniera cuneifolia (Roth) Arn. for elevated glycyrrhizic acid production. Ind Crops Prod. 54:13-16. https://doi.org/10.1016/j.indcrop.2013.12.036 Becana M, Paris FJ, Sandalio LM, Del Rio LA (1989) Isoenzymes of superoxide dismutase in nodules of Phaseolus vulgaris L., Pisum sativum L., and Vigna unguiculata (L.) Walp. Plant Physiol 90:1286–1292. https://doi.org/10.1104/pp.90.4.1286. Behdad A, Mohsenzadeh S, Azizi M (2021) Growth, leaf gas exchange and physiological parameters of two Glycyrrhiza glabra L. populations subjected to salt stress condition. Rhizosphere 17:100319. https://doi.org/10.1016/j.rhisph.2021.100319. Behdad A, Mohsenzadeh S, Azizi M (2020a) Comparison of phytochemical compounds of two Glycyrrhiza glabra L. populations and their relationship with the ecological factors. Acta Physiol Plant 42:1–18. https://doi.org/ 10.1007/s11738-020-03121-0. Behdad A, Mohsenzadeh S, Azizi M, Moshtaghi N (2020b) Salinity effects on physiological and phytochemical characteristics and gene expression of two Glycyrrhiza glabra L. populations. Phytochemistry 171:112236. https://doi.org/10.1016/j.phytochem.2019.112236 Bhaskar R, Xavier LSE, Udayakumaran G, et al (2022) Biotic elicitors: A boon for the in-vitro production of plant secondary metabolites. Plant Cell, Tissue Organ Cult 149:7–24. https://doi.org/10.1007/s11240-021-02131-1. Bonfill M, Mangas S, Moyano E, et al (2011) Production of centellosides and phytosterols in cell suspension cultures of Centella asiatica . Plant Cell, Tissue Organ Cult 104:61–67. https://doi.org/10.1007/s11240-010-9804-7. Bulgakov VP, Shkryl YN, Veremeichik GN, et al (2013) Recent advances in the understanding of Agrobacterium rhizogenes -derived genes and their effects on stress resistance and plant metabolism. Biotechnol hairy root Syst 1–22. https://doi.org/10.1007/10_2013_179. Chamkhi I, Benali T, Aanniz T, et al (2021) Plant-microbial interaction: The mechanism and the application of microbial elicitor induced secondary metabolites biosynthesis in medicinal plants. Plant Physiol Biochem 167:269–295. https://doi.org/10.1016/j.plaphy.2021.08.001. Chandra S (2012) Natural plant genetic engineer Agrobacterium rhizogenes : Role of T-DNA in plant secondary metabolism. Biotechnol Lett 34:407–415. https://doi.org/10.1007/s10529-011-0785-3. Chang C-C, Yang M-H, Wen H-M, Chern J-C (2002) Estimation of total flavonoid content in propolis by two complementary colorimetric methods. J food drug Anal 10: 3. https://doi.org/10.38212/2224-6614.2748. Chaudhuri KN, Ghosh B, Tepfer D, Jha S (2005) Genetic transformation of Tylophora indica with Agrobacterium rhizogenes A4: growth and tylophorine productivity in different transformed root clones. Plant Cell Rep 24:25–35. https://doi.org/10.1007/s00299-004-0904-x. Chen L-R, Chen Y-J, Lee C-Y, Lin T-Y (2007) MeJA-induced transcriptional changes in adventitious roots of Bupleurum kaoi . Plant Sci 173:12–24. https://doi.org/10.1016/j.plantsci.2007.03.013. Chizzola R, Saeidnejad AH, Azizi M, et al (2014) Bunium persicum : variability in essential oil and antioxidants activity of fruits from different Iranian wild populations. Genet Resour Crop Evol 61:1621–1631. https://doi.org/10.1007/s10722-014-0158-6. Çoban Ö, Baydar NG (2016) Brassinosteroid effects on some physical and biochemical properties and secondary metabolite accumulation in peppermint ( Mentha piperita L.) under salt stress. Ind Crops Prod 86:251–258. https://doi.org/10.1016/j.indcrop.2016.03.049. El-Esawi MA, Elkelish A, Elansary HO, et al (2017) Genetic transformation and hairy root induction enhance the antioxidant potential of Lactuca serriola L. Oxid Med Cell Longev 2017(1):5604746. https://doi.org/10.1155/2017/5604746. Grzegorczyk-Karolak I, Kuźma Ł, Skała E, Kiss AK (2018) Hairy root cultures of Salvia viridis L. for production of polyphenolic compounds. Ind Crops Prod 117:235–244. https://doi.org/10.1016/j.indcrop.2018.03.014 Halder M, Sarkar S, Jha S (2019) Elicitation: A biotechnological tool for enhanced production of secondary metabolites in hairy root cultures. Eng Life Sci 19:880–895. https://doi.org/10.1002/elsc.201900058. Hao Y-J, An X-L, Sun H-D, et al (2020) Ginsenoside synthesis of adventitious roots in Panax ginseng is promoted by fungal suspension homogenate of Alternaria panax and regulated by several signaling molecules. Ind Crops Prod 150:112414. https://doi.org/10.1016/j.indcrop.2020.112414. Harfi B, Khelifi L, Khelifi-Slaoui M, et al (2018) Tropane alkaloids GC/MS analysis and low dose elicitors’ effects on hyoscyamine biosynthetic pathway in hairy roots of Algerian Datura species. Sci Rep 8:17951. https://doi.org/10.1038/s41598-018-36625-4. Hayashi H, Huang P, Inoue K (2003) Up-regulation of soyasaponin biosynthesis by methyl jasmonate in cultured cells of Glycyrrhiza glabra . Plant cell Physiol 44:404–411. https://doi.org/10.1093/pcp/pcg054. Hayashi H, Huang P, Takada S, et al (2004) Differential expression of three oxidosqualene cyclase mRNAs in Glycyrrhiza glabra . Biol Pharm Bull 27:1086–1092. https://doi.org/10.1248/bpb.27.1086. Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 125:189–198. https://doi.org/10.1016/0003-9861(68)90654-1. Hosseini MS, Samsampour D, Ebrahimi M, et al (2018) Effect of drought stress on growth parameters, osmolyte contents, antioxidant enzymes and glycyrrhizin synthesis in licorice ( Glycyrrhiza glabra L.) grown in the field. Phytochemistry 156:124–134. https://doi.org/10.1016/j.phytochem.2018.08.018. Humbal A, Pathak B (2023) Influence of Exogenous Elicitors on the Production of Secondary Metabolite in Plants: A review (' “VSI: Secondary Metabolites”’). Plant Stress 100166. https://doi.org/10.1016/j.stress.2023.100166. Jain A, Singh S (2015) Effect of growth regulators and elicitors for the enhanced production of solasodine in hairy root culture of Solanum melongena (L.). J Indian Bot Soc 94:23–39. https://doi.org/10.1093/pcp/pcg054. Javier Gutiérrez Mañero F, Algar E, Martín Gómez MS, et al (2012) Elicitation of secondary metabolism in Hypericum perforatum by rhizosphere bacteria and derived elicitors in seedlings and shoot cultures. Pharm Biol 50:1201–1209. https://doi.org/10.3109/13880209.2012.664150. Jeyasri R, Muthuramalingam P, Karthick K, et al (2023) Methyl jasmonate and salicylic acid as powerful elicitors for enhancing the production of secondary metabolites in medicinal plants: an updated review. Plant Cell, Tissue Organ Cult 153:447–458. https://doi.org/10.3109/13880209.2012.664150. Khan S, Qureshi MI, Alam T, Abdin MZ (2007) Protocol for isolation of genomic DNA from dry and fresh roots of medicinal plants suitable for RAPD and restriction digestion. African J Biotechnol 6:175. Keswani C, Singh SP, García‐Estrada C, et al (2022) Biosynthesis and beneficial effects of microbial gibberellins on crops for sustainable agriculture. Journal of Applied Microbiology. 132, 1597–1615. https://doi.org/10.1111/jam.15348. Le K-C, Im W-T, Paek K-Y, Park S-Y (2018a) Biotic elicitation of ginsenoside metabolism of mutant adventitious root culture in Panax ginseng . Appl Microbiol Biotechnol 102:1687–1697. https://doi.org/10.1007/s00253-018-8751-9. Le A V, Parks SE, Nguyen MH, Roach PD (2018b) Optimisation of the microwave-assisted ethanol extraction of saponins from Gac ( Momordica cochinchinensis Spreng.) seeds. Medicines 5:70. https://doi.org/10.3390/medicines5030070. Leon-Reyes A, Spoel SH, De Lange ES, et al (2009) Ethylene modulates the role of nonexpressor of pathogenesis-related genes1 in cross talk between salicylate and jasmonate signaling. Plant Physiol 149:1797–1809. https://doi.org/10.1104/pp.108.133926. Li W, Asada Y, Yoshikawa T (1998) Antimicrobial flavonoids from Glycyrrhiza glabra hairy root cultures. Planta Med 64:746–747. https://doi.org/10.1055/s-2006-957571. Li J, Wang J, Li J, et al (2016a) Protein elicitor isolated from Escherichia coli induced bioactive compound biosynthesis as well as gene expression in Glycyrrhiza uralensis Fisch adventitious roots. RSC Adv. 6(112):111622–111631. https://doi.org/10.1039/C6RA16903A. Li Y, Yu C, Qiao J, et al (2016b) Effect of exogenous phytohormones treatment on glycyrrhizic acid accumulation and preliminary exploration of the chemical control network based on glycyrrhizic acid in root of Glycyrrhiza uralensis . Rev Bras Farmacogn 26:490–496. https://doi.org/10.1016/j.bjp.2016.02.009. Liang Z, Ma Y, Xu T, et al (2013) Effects of abscisic acid, gibberellin, ethylene and their interactions on production of phenolic acids in Salvia miltiorrhiza Bunge hairy roots. PLoS One 8:e72806. https://doi.org/10.1371/journal.pone.0072806. Lu J, Liang W, Wei K, et al (2019) Induction of signal molecules and expression of functional genes after Pichia pastoris stimulation in Glycyrrhiza uralensis Fisch adventitious roots. J Food Biochem 43(4), e12798. https://doi.org/10.1111/jfbc.12798 Mañero FJG, Algar E, Martin Gomez MS, et al (2012) Elicitation of secondary metabolism in Hypericum perforatum by rhizosphere bacteria and derived elicitors in seedlings and shoot cultures. Pharm Biol 50:1201–1209. https://doi.org/10.3109/13880209.2012.664150. Manzoor MM, Goyal P, Gupta AP, et al (2020) Chemical and real-time based analysis revealed active gene machinery of glycyrrhizin biosynthesis and its accumulation in the aerial tissues of in-vitro regenerated Glycyrrhiza glabra L. Plant Growth Regul 92:263–271. https://doi.org/10.1007/s10725-022-00933-7. Matkowski A, Zielińska S, Oszmiański J, Lamer-Zarawska E (2008) Antioxidant activity of extracts from leaves and roots of Salvia iltiorrhiza Bunge, S. przewalskii Maxim., and S. verticillata L. Bioresour Technol 99:7892–7896. https://doi.org/10.1016/j.biortech.2008.02.013. Mehrotra S, Kukreja AK, Khanuja SPS, Mishra BN (2008) Genetic transformation studies and scale up of hairy root culture of Glycyrrhiza glabra in bioreactor. Electron J Biotechnol. 11(2), 69–75. https://doi.org/10.2225/vol11-issue2-fulltext-6. Menéndez E, Díez-Méndez A, Marcos-García M, et al (2016) Rhizobium symbiotic enzyme cellulase CelC2: Properties and Applications. In: New and Future Developments in Microbial Biotechnology and Bioengineering. Elsevier, pp 81–89. https://doi.org/10.1016/B978-0-444-63507-5.00008-3. Meng X, Zhou J, Sui N (2018) Mechanisms of salt tolerance in halophytes: Current understanding and recent advances. Open life Sci 13:149–154. https://doi.org/10.1515/biol-2018-0020. Nakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant cell Physiol 22:867–880. https://doi.org/10.1093/oxfordjournals.pcp.a076232. Nascimento MHM do, de Araújo DR (2022) Exploring the pharmacological potential of glycyrrhizic acid: From therapeutic applications to trends in nanomedicine. Futur Pharmacol 2:1–15. https://doi.org/10.3390/futurepharmacol2010001. Nasrollahi V, Mirzaie-Asl A, Piri K, et al (2014) The effect of drought stress on the expression of key genes involved in the biosynthesis of triterpenoid saponins in liquorice ( Glycyrrhiza glabra ). Phytochemistry 103:32–37. https://doi.org/10.1016/j.phytochem.2014.03.004. Ono NN, Tian L (2011) The multiplicity of hairy root cultures: prolific possibilities. Plant Sci 180:439–446. https://doi.org/10.1016/j.plantsci.2010.11.012. Pastorino G, Cornara L, Soares S, et al (2018) Liquorice ( Glycyrrhiza glabra ): A phytochemical and pharmacological review. Phyther Res 32:2323–2339. https://doi.org/10.1002/ptr.6178. Pauwels L, Inzé D, Goossens A (2009) Jasmonate-inducible gene: what does it mean? Trends Plant Sci 14:87–91. https://doi.org/10.1016/j.tplants.2008.11.005. Planchamp C, Glauser G, Mauch-Mani B (2015) Root inoculation with Pseudomonas putida KT2440 induces transcriptional and metabolic changes and systemic resistance in maize plants. Front. Plant Sci. 5:719. https://doi.org/10.3389/fpls.2014.00719. Ramirez-Estrada K, Vidal-Limon H, Hidalgo D, et al (2016) Elicitation, an effective strategy for the biotechnological production of bioactive high-added value compounds in plant cell factories. Molecules 21:. https://doi.org/10.3390/molecules21020182. Rudrappa T, Neelwarne B, Lakshmanan V, et al (2006) Elicitation of peroxidase activity in genetically transformed root cultures of Beta vulgaris L. Electron J Biotechnol 9(5):0. https://doi.org/10.4067/S0717-34582006000500006. Ruiz-May E, De-la-Pena C, Galaz-Avalos RM, et al (2011) Methyl jasmonate induces ATP biosynthesis deficiency and accumulation of proteins related to secondary metabolism in Catharanthus roseus (L.) G. hairy roots. Plant cell Physiol 52:1401–1421. https://doi.org/10.1093/pcp/pcr086. Sagisaka S (1976) The occurrence of peroxide in a perennial plant, Populus gelrica . Plant Physiol 57:308–309. https://doi.org/10.1104/pp.57.2.308. Sajjalaguddam RR, Paladugu A (2016) Influence of Agrobacterium rhizogenes strains and elicitation on hairy root induction and glycyrrhizin production from Abrus precatorius . J Pharm Sci Res 8:1353–1357. https://doi.org/10.4103/0973-1296.90411. Seki H, Sawai S, Ohyama K, et al (2011) Triterpene functional genomics in licorice for identification of CYP72A154 involved in the biosynthesis of glycyrrhizin. Plant Cell 23:4112–4123. https://doi.org/10.1105/tpc.110.082685. Seki H, Tamura K, Muranaka T (2015) P450s and UGTs: key players in the structural diversity of triterpenoid saponins. Plant Cell Physiol 56:1463–1471. https://doi.org/10.1093/pcp/pcv062. Selyutina OY, Polyakov NE (2019) Glycyrrhizic acid as a multifunctional drug carrier–From physicochemical properties to biomedical applications: A modern insight on the ancient drug. Int J Pharm 559:271–279. https://doi.org/10.1016/j.ijpharm.2019.01.047. Shabani L, Ehsanpour AA, Asghari G, Emami J (2009) Glycyrrhizin production by in vitro cultured Glycyrrhiza glabra elicited by methyl jasmonate and salicylic acid1. Russ J Plant Physiol 56:621–626. https://doi.org/10.1134/S1021443709050069 Sharma K, Kaur R, Kumar S, et al (2023) Saponins: A concise review on food related aspects, applications and health implications. Food Chem Adv 2:100191. https://doi.org/10.1016/j.focha.2023.100191. Shirazi Z, Aalami A, Tohidfar M, Sohani MM (2019) Triterpenoid gene expression and phytochemical content in Iranian licorice under salinity stress. Protoplasma 256:827–837. https://doi.org/10.1007/s00709-018-01340-4 Shirazi Z, Aalami A, Tohidfar M, Sohani MM (2018) Metabolic Engineering of Glycyrrhizin Pathway by Over-Expression of Beta-amyrin 11-Oxidase in Transgenic Roots of Glycyrrhiza glabra. Mol Biotechnol 60:412–419. https://doi.org/10.1007/s12033-018-0082-7. Shkryl YN, Veremeichik GN, Bulgakov VP, et al (2008) Individual and combined effects of the rolA, B, and C genes on anthraquinone production in Rubia cordifolia transformed calli. Biotechnol Bioeng 100:118–125. https://doi.org/10.1002/bit.21727. Singh R, Kamal S, Rani D, et al (2014) Development of hairy root culture system of Phlogacanthus thyrsiflorus Nees. J Appl Res Med Aromat Plants 1:107–112. https://doi.org/10.1016/j.jarmap.2014.08.001. Somboon T, Chayjarung P, Pilaisangsuree V, et al (2019) Methyl jasmonate and cyclodextrin-mediated defense mechanism and protective effect in response to paraquat-induced stress in peanut hairy root. Phytochemistry 163:11–22. https://doi.org/10.1016/j.phytochem.2019.03.017. Srivastava M, Misra P (2017) Enhancement of medicinally important bioactive compounds in hairy root cultures of Glycyrrhiza , Rauwolfia , and Solanum through in vitro stress application. Prod Plant Deriv Nat Compd through Hairy Root Cult 117–132. https://doi.org/10.1007/978-3-319-69769-7_6. Srivastava M, Singh G, Sharma S, et al (2019) Elicitation Enhanced the Yield of Glycyrrhizin and Antioxidant Activities in Hairy Root Cultures of Glycyrrhiza glabra L. J Plant Growth Regul 38:373–384. https://doi.org/10.1007/s00344-018-9847-2 Sujatha G, Zdravković-Korać S, Ćalić D, et al (2013) High-efficiency Agrobacterium rhizogenes -mediated genetic transformation in Artemisia vulgaris : hairy root production and essential oil analysis. Ind Crops Prod 44:643–652. https://doi.org/10.1016/j.indcrop.2012.09.007. Tamura K, Seki H, Suzuki H, et al (2017) CYP716A179 functions as a triterpene C-28 oxidase in tissue-cultured stolons of Glycyrrhiza uralensis . Plant Cell Rep 36:437–445. https://doi.org/10.1007/s00299-016-2092-x Tavassoli P, Safipour Afshar A (2018) Influence of different Agrobacterium rhizogenes strains on hairy root induction and analysis of phenolic and flavonoid compounds in marshmallow ( Althaea officinalis L.). 3 Biotech 8:1–8. https://doi.org/10.1007/s13205-018-1375-z. Thakur M, Bhattacharya S, Khosla PK, Puri S (2019) Improving production of plant secondary metabolites through biotic and abiotic elicitation. J Appl Res Med Aromat Plants 12:1–12. https://doi.org/10.1016/j.jarmap.2018.11.004. Thwe A, Arasu MV, Li X, et al (2016) Effect of different Agrobacterium rhizogenes strains on hairy root induction and phenylpropanoid biosynthesis in tartary buckwheat ( Fagopyrum tataricum Gaertn). Front Microbiol 7:1–10. https://doi.org/10.3389/fmicb.2016.00318. Tiwari RK, Trivedi M, Guang ZC, et al (2007) Genetic transformation of Gentiana macrophylla with Agrobacterium rhizogenes : growth and production of secoiridoid glucoside gentiopicroside in transformed hairy root cultures. Plant Cell Rep 26:199–210. https://doi.org/10.1007/s00299-006-0236-0. Tohma HS, Gulçin I (2010) Antioxidant and radical scavenging activity of aerial parts and roots of Turkish liquorice ( Glycyrrhiza glabra L.). Int J Food Prop 13:657–671. https://doi.org/10.1080/10942911003773916. Wang R, Wang H-L, Tang R-P, et al (2020) Pseudomonas putida represses JA-and SA-mediated defense pathways in rice and promotes an alternative defense mechanism possibly through ABA signaling. Plants 9:1641. https://doi.org/10.3390/plants9121641. Wongwicha W, Tanaka H, Shoyama Y, Putalun W (2011) Methyl jasmonate elicitation enhances glycyrrhizin production in glycyrrhiza inflata hairy roots cultures. Zeitschrift fur Naturforsch - Sect C J Biosci 66(7-8) https://doi.org/10.1515/znc-2011-7-815. Wu J-Y, Ng J, Shi M, Wu S-J (2007) Enhanced secondary metabolite (tanshinone) production of S alvia miltiorrhiza hairy roots in a novel root–bacteria coculture process. Appl Microbiol Biotechnol 77:543–550. https://doi.org/10.1007/s00253-007-1192-5. Xing B, Yang D, Liu L, et al (2018) Phenolic acid production is more effectively enhanced than tanshinone production by methyl jasmonate in Salvia miltiorrhiza hairy roots. Plant Cell, Tissue Organ Cult 134:119–129. https://doi.org/10.1007/s11240-018-1405-x. Yan Q, Shi M, Ng J, Wu JY (2006) Elicitor-induced rosmarinic acid accumulation and secondary metabolism enzyme activities in Salvia miltiorrhiza hairy roots. Plant Sci 170:853–858. https://doi.org/10.1016/j.plantsci.2005.12.004. Yang Ying YY, Zheng Hui ZH, He Feng HF, et al (2008) The effects of methyl jasmonate on the flavonoids synthesis in cell suspension culture of Glycyrrhiza inflata (Leguminosae). Plant Divers 30, 586–592. https://doi.org/10.3724 SP.J.1143.2008.07326. Yousefian S, Lohrasebi T, Farhadpour M, Haghbeen K (2020a) Effect of methyl jasmonate on phenolic acids accumulation and the expression profile of their biosynthesis-related genes in Mentha spicata hairy root cultures. Plant Cell Tissue Organ Cult 142(2):285–197. https://doi.org/10.1007/s11240-020-01856-9. Yousefian S, Lohrasebi T, Farhadpour M, Haghbeen K (2020b) Production of phenolic acids in hairy root cultures of medicinal plant Mentha spicata L. in response to elicitors. Mol Biol Res Commun 9:23–34. https://doi.org/10.22099/mbrc.2020.36031.1475 Yousefian Z, Golkar P, Mirjalili MH (2021) Production enhancement of medicinally active coumarin and phenolic compounds in hairy root cultures of Pelargonium sidoides : the effect of elicitation and sucrose. J Plant Growth Regul 40:628–641. https://doi.org/10.1007/s00344-020-10127-y. Yuan M, Ngou BPM, Ding P, Xin X-F (2021) PTI-ETI crosstalk: an integrative view of plant immunity. Curr Opin Plant Biol 62:102030. https://doi.org/10.1016/j.pbi.2021.102030. Yuan Y, Huang L, Cui GH, et al (2008) Effect of gibberellins and its synthetic inhibitor on metabolism of tanshinones. Chin J Exp Tradit Med Formulae 14:6–8. https://doi.org/10.1371/journal.pone.0072806. Zehra A, Raytekar NA, Meena M, Swapnil P (2021) Efficiency of microbial bio-agents as elicitors in plant defense mechanism under biotic stress: A review. Curr Res Microb Sci 2:100054. https://doi.org/10.1016/j.crmicr.2021.100054. Zhang HC, Liu JM, Lu HY, Gao SL (2009) Enhanced flavonoid production in hairy root cultures of Glycyrrhiza uralensis Fisch by combining the over-expression of chalcone isomerase gene with the elicitation treatment. Plant Cell Rep 28:12.05–1213. https://doi.org/10.1007/s00299-009-0721-3. Zhang YS, Ye HC, Liu BY, et al (2005) Exogenous GA3 and flowering induce the conversion of artemisinic acid to artemisinin in Artemisia annua plants. Russ J Plant Physiol 52:58–62. https://doi.org/10.1007/s11183-005-0009-6. Cite Share Download PDF Status: Published Journal Publication published 18 Dec, 2024 Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) → Version 1 posted Reviewers agreed at journal 17 Oct, 2024 Reviewers invited by journal 17 Oct, 2024 Editor assigned by journal 17 Oct, 2024 First submitted to journal 14 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5241404","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":367353442,"identity":"c0b59582-fa85-4f32-aeae-01193b6b1502","order_by":0,"name":"Assieh Behdad","email":"","orcid":"","institution":"Ferdowsi University of Mashhad Faculty of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Assieh","middleName":"","lastName":"Behdad","suffix":""},{"id":367353443,"identity":"b5f647f5-5cf5-46e4-96e0-cf4f852848de","order_by":1,"name":"Ali Ganjeali","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYJACAwYGCx5+KIeHWC0SPJINpGgBAgkGgwPEqpV3P3ug4EONhIzxjewEhh81DDLmDQS0GJ7JSzCccUyCx+xG7gbGnmMMPDKErDNsyDEw5mGDaGHgbWDgkSDkMMP+NwbGf/5J8BjPANrylxgt8hJAWxjbJHgMJHI3MBNli4HEGwPD3j4JHokzbzcclgF6irAt/TlmBj++2djzt+dufPimxsaesC0HGNgMYJwDoAgiCOQbGJgfEFY2CkbBKBgFIxoAAPx5NddSdrCRAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-0956-8650","institution":"Ferdowsi University of Mashhad Faculty of Sciences","correspondingAuthor":true,"prefix":"","firstName":"Ali","middleName":"","lastName":"Ganjeali","suffix":""}],"badges":[],"createdAt":"2024-10-10 17:15:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5241404/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5241404/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11240-024-02941-z","type":"published","date":"2024-12-18T15:57:59+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":67113360,"identity":"2314e294-02dc-473b-836a-992c9ba996af","added_by":"auto","created_at":"2024-10-21 10:01:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":111756,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of PCR amplification with specific primers of \u003cem\u003erolB\u003c/em\u003e (A) and \u003cem\u003eVirA\u003c/em\u003e (B) genes, which amplified 775bp fragment in ATCC 15834, A4, and A13 strains of \u003cem\u003eA. rhizogenes\u003c/em\u003e (DNA ladder 50bp).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/32bfc411ccb01e116d1961e1.png"},{"id":67114271,"identity":"9edc8e9b-74cd-4487-a187-81eb0b82e66b","added_by":"auto","created_at":"2024-10-21 10:09:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":281828,"visible":true,"origin":"","legend":"\u003cp\u003eProliferation of hairy roots produced by \u003cem\u003eA. rhizogenes\u003c/em\u003e strain A13 of \u003cem\u003eG. glabra\u003c/em\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/eec9ee9cc4877a3c376e62c9.png"},{"id":67113361,"identity":"81238863-4f9b-4391-9b10-4931d2293c82","added_by":"auto","created_at":"2024-10-21 10:01:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":77358,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of \u003cem\u003eR. leguminosarum\u003c/em\u003e, \u003cem\u003ePseudomonas putida\u003c/em\u003e and the control on the content of saponin, and glycyrrhizin in the hairy roots of \u003cem\u003eG glabra\u003c/em\u003e. Data are means ± standard error (n=3).Means followed by the same letter are not significantly different (\u003cem\u003eP ≤ 0.05\u003c/em\u003e) by LSMeans Student's t.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/36ddefc48b4983b534541d60.png"},{"id":67114274,"identity":"508ca083-1e62-4516-a9a7-ef117b7f497e","added_by":"auto","created_at":"2024-10-21 10:09:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":19350,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of \u003cem\u003eR. leguminosarum\u003c/em\u003e (R), methyl jasmonate (MeJA), gibberellic acid (GA), interaction of methyl jasmonate and bacteria (MeJAR), the interaction of gibberellic acid and bacteria (GAR) and the control on the content of phenolic compound, flavonoid, phenolic acid, saponin, and glycyrrhizin in the hairy roots of \u003cem\u003eG glabra\u003c/em\u003e. Data are means ± standard error (n=3). Means followed by the same letter are not significantly different (\u003cem\u003eP ≤ 0.05\u003c/em\u003e) by LSMeans Student's t.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/f81011f17cc47c14f74b8dea.png"},{"id":67114272,"identity":"4fe52fc1-d67c-4e04-a468-71377e16bbd3","added_by":"auto","created_at":"2024-10-21 10:09:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":40843,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of \u003cem\u003eR. leguminosarum\u003c/em\u003e (R), methyl jasmonate (MeJA), gibberellic acid (GA), interaction of methyl jasmonate and bacteria (MeJAR), the interaction of gibberellic acid and bacteria (GAR) and the control on the DPPH antioxidant capacity (IC\u003csub\u003e50\u003c/sub\u003e level) in the hairy roots of \u003cem\u003eG glabra\u003c/em\u003e. Data are means ± standard error (n=3). Means followed by the same letter are not significantly different (\u003cem\u003eP ≤ 0.05\u003c/em\u003e) by LSMeans Student's t.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/86dec47ad454001f806de5e8.png"},{"id":67113363,"identity":"b40a2a11-521c-42c6-90b8-9f6d75e94832","added_by":"auto","created_at":"2024-10-21 10:01:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":89838,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of \u003cem\u003eR. leguminosarum\u003c/em\u003e (R), methyl jasmonate (MeJA), gibberellic acid (GA), interaction of methyl jasmonate and bacteria (MeJAR), the interaction of gibberellic acid and bacteria (GAR) and the control on the content of malondialdehyde (MDA) and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in the hairy roots of \u003cem\u003eG. glabra\u003c/em\u003e. Data are means ± standard error (n=3). Means followed by the same letter are not significantly different (\u003cem\u003eP ≤ 0.05\u003c/em\u003e) by LSMeans Student's t.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/b073526712d1adeb2c1eb5ab.png"},{"id":67113368,"identity":"41124f91-0720-47ce-ac32-34d8d1969c9c","added_by":"auto","created_at":"2024-10-21 10:01:38","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":77031,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of \u003cem\u003eR. leguminosarum\u003c/em\u003e (R), methyl jasmonate (MeJA), gibberellic acid (GA), interaction of methyl jasmonate and bacteria (MeJAR), and the interaction of gibberellic acid and bacteria (GAR) on the ascorbate peroxidase (APX) and superoxide dismutase (SOD) in the hairy roots of \u003cem\u003eG. glabra\u003c/em\u003e. Data are means ± standard error (n=3).Means followed by the same letter are not significantly different (\u003cem\u003eP ≤ 0.05\u003c/em\u003e) by LSMeans Student's t.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/6f18a7ed8493d13614cb54d8.png"},{"id":67113364,"identity":"06da5233-f4db-453d-80ac-ef409d25cf98","added_by":"auto","created_at":"2024-10-21 10:01:38","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":69043,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of interaction of methyl jasmonate and bacteria (MeJAR) on relative expression \u003cem\u003ebAS \u003c/em\u003e(A), \u003cem\u003eCYP88D6\u003c/em\u003e (B), and \u003cem\u003eCYP72A154 \u003c/em\u003e(C)\u003cem\u003e \u003c/em\u003ein the hairy roots of \u003cem\u003eG. glabra\u003c/em\u003e. Data are means ± standard error (n=3). Means followed by the same letter are not significantly different (\u003cem\u003eP ≤ 0.05\u003c/em\u003e) by LSMeans Student's t.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/a938912150894d871d1da568.png"},{"id":67113366,"identity":"a3b80bcc-33ab-48d6-a04f-95a4a4b5b13d","added_by":"auto","created_at":"2024-10-21 10:01:38","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":93004,"visible":true,"origin":"","legend":"\u003cp\u003eBiplot of the first two principal components (PCs) based on assayed traits for treated licorice hairy roots by biotic and abiotic elicitors (methyl jasmonate (MeJA), gibberellic acid (GA), interaction of methyl jasmonate and bacteria (MeJAR), the interaction of gibberellic acid and bacteria (GAR), malondialdehyde (MDA), ascorbate peroxidase (APX) and superoxide dismutase (SOD))\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/466869fb9973b60bf7bdbc97.png"},{"id":72202062,"identity":"0a5caeda-bf88-4cc2-b8c4-c82979bc6fee","added_by":"auto","created_at":"2024-12-23 16:14:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2101086,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5241404/v1/299bfb3f-afa9-4f80-b60a-4c1324e8a357.pdf"}],"financialInterests":"","formattedTitle":"Phytohormones and microbial elicitation on glycyrrhizin production and gene expression in the hairy root of Glycyrrhiza glabra L.","fulltext":[{"header":"Key Massage","content":"\u003cp\u003eApplication of the methyl jasmonate and \u003cem\u003eRhizobium leguminosarum\u003c/em\u003e interaction as the best elicitor is a good strategy for continuously producing glycyrrhizin in the hairy roots of \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e, which provides the potential for large-scale commercial production.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eGlycyrrhiza glabra L.\u003c/em\u003e (licorice) is a popular medicinal genus from the Fabaceae family growing in arid and semi-arid regions (Mehrotra et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; haghighi et al., 2022). The rhizomes and roots of licorice are rich in glycyrrhizin, ranging from 2\u0026ndash;8% in dry weight (Hosseini et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Shirazi et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Glycyrrhizic acid, a triterpene saponin, has significant medicinal value, offering antiviral, anti-HIV, antiulcer, antiallergic, antibacterial, and anticancer properties (Pastorino et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Selyutina and Polyakov, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Nascimento and de Ara\u0026uacute;jo, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Saponins, a broad group of high-molecular-weight phytochemicals, have applications in pharmaceuticals, cosmetics, and food industries (Behdad et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e; Sharma et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Additionally, licorice contains crucial phenolic compounds, especially coumarins, chalcones, isoflavones, and flavonols (Srivastava and Misra, \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eVarious strategies have been employed to induce the biosynthesis of valuable phytochemicals under in vitro conditions (Ali \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). A promising technique involves cultivating transformed hairy roots using \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e, a soil-borne gram-negative bacterium (Sujatha et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Hairy root cultures offer advantages, such as more stable production of secondary metabolites, rapid growth in hormone-free media, and genetic and biochemical stability (Thwe et al., \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eElicitors, known as pattern-triggered immunity (PTI), are chemical substances secreted in minimal amounts that cause plant defenses to respond to adverse conditions and produce secondary metabolites (Ahlawat et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Thakur et al., \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yuan et al., \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Abiotic treatments include physical, chemical, and hormonal treatments, but materials derived from microorganisms are biotic elicitors (Chamkhi et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The elicitation process begins with the interaction of an elicitor with a plant receptor, leading to changes in cytoplasmic ion concentration. Secondary messengers like Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e depolarize the plasma membrane and activate plant enzymes such as MAPKs, which in turn stimulate reactive oxygen species (ROS) and transcription factors, eventually triggering the expression of defense-related genes and increasing the biosynthesis of secondary metabolites (Hao et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Chamkhi et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Bhaskar et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBiotic elicitation is an efficient and economical method for enhancing secondary metabolites because an individual colony of bacteria can produce high levels of elicitor proteins (Ramirez-Estrada et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Le et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e). Rhizosphere bacteria such as \u003cem\u003ePseudomonas\u003c/em\u003e, \u003cem\u003eRhizobium\u003c/em\u003e, and \u003cem\u003eAzospirillum\u003c/em\u003e act as biotic elicitors that promote secondary metabolite biosynthesis in plants (Thakur et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). \u003cem\u003eBacillus subtillus\u003c/em\u003e regulates gymnemic acid metabolite synthesis in \u003cem\u003eGymnema sylvestre\u003c/em\u003e through cross-talk between signaling molecules (Humbal and Pathak, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Le et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e) reported that treatment with \u003cem\u003eRhizobium\u003c/em\u003e, a nitrogen-fixing bacterium, is a major strategy to increase the biosynthesis of plant secondary metabolites, especially those of the leguminous genus. \u003cem\u003ePseudomonas\u003c/em\u003e and \u003cem\u003eRhizobium\u003c/em\u003e species are the plant growth-promoting rhizobacteria (PGPR) that can biosynthesize plant hormones such as IAA and GA (Planchamp et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Keswani et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral reports have shown that phytohormones improve the production of bioactive compounds in hairy root cultures of numerous medicinal species (Wongwicha et al., \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Liang et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Lu et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yousefian et al., \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e). Methyl jasmonate (MeJA) is a signaling molecule that activates the defense response pathway to improve plant secondary metabolites (Awad et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Yousefian et al., \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e; Jeyasri et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Gibberellic acid (GA) is a widely used phytohormone that effectively modulates plant growth and the biosynthesis of secondary metabolites (Li et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2016b\u003c/span\u003e). Plant defense systems rely on enzymatic and non-enzymatic antioxidants to mitigate ROS damage (Meng et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Superoxide dismutase (SOD), for instance, converts superoxide anions into hydrogen peroxide and oxygen, while ascorbate peroxidase (APX) in the ascorbate-glutathione cycle reduces hydrogen peroxide into water and oxygen (Gill and Tuteja, 2010; Somboon et al., \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurther insights into metabolite biosynthesis can be gained by adding elicitors to in vitro cultures and observing gene responses (Pauwels et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The biosynthesis of licorice saponins is carried out through several sequential enzymatic reactions. In the mevalonate pathway, Farnesyl pyrophosphate is converted into squalene, a precursor of all saponins, by squalene synthase (SQS) (Seki et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Shirazi et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). β-Amyrin, lupeol, and cycloartenol are produced from 2,3-oxidosqualene by beta-amyrin synthase (bAS), lupeol synthase (LUS), and cycloartenol synthase (CAS), respectively (Hayashi et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Beta-amyrin is the initiator of the glycyrrhizin and soyasaponin biosynthesis pathway. After two consecutive steps of saponin oxidation by CYP88D6 and CYP72A154, glycyrrhizin is biosynthesized (Seki et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Shirazi et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDue to excessive harvesting and extraction, wild licorice has become an endangered species (Manzoor et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Behdad et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, the use of hairy root cultures in bioreactor systems provides a sustainable means for large-scale glycyrrhizin production (Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Hairy roots are particularly suitable for boosting secondary metabolite biosynthesis in endangered plants due to their high biomass yield in nutrient-limited conditions. Although previous studies have reported the successful production of hairy roots in licorice (Tenea et al., 2008; Mehrotra et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Shirazi et al., 2012), the influence of biotic elicitors on the phytochemical content of licorice hairy roots has not been fully explored.\u003c/p\u003e \u003cp\u003eThis study aims to evaluate the effects of two biotic elicitors, \u003cem\u003eRhizobium leguminosarum\u003c/em\u003e and P\u003cem\u003eseudomonas putida\u003c/em\u003e, on saponin and glycyrrhizin content in licorice hairy roots. Additionally, the study examined the combined effects of these biotic elicitors with MeJA and GA on glycyrrhizin accumulation, antioxidant capacity, and oxidative balance. Finally, the expression levels of key biosynthetic genes, including \u003cem\u003ebAS\u003c/em\u003e and cytochrome P450s (\u003cem\u003eCYP88D6\u003c/em\u003e and \u003cem\u003eCYP72A154\u003c/em\u003e), were analyzed in response to the most effective elicitor treatment.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant material\u003c/h2\u003e \u003cp\u003e \u003cem\u003eG. glabra\u003c/em\u003e seeds were purchased from Pakan-Bazr Company in Isfahan, Iran. After disinfection with ethanol (70%) and NaClO (1%), the seeds were treated with 98% H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e (20 min) and then cleaned with sterile water. The seeds were subsequently grown on Murashige and Skoog (MS) solid media and exposed to an incubator with 60 \u0026micro;mol photons m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003es\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e light of 16 h at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eInduction and proliferation of hairy root cultures\u003c/h3\u003e\n\u003cp\u003eFor hairy root induction, four-week-old plantlets were applied as explants for \u003cem\u003eA. rhizogenes\u003c/em\u003e injection. Single clones of \u003cem\u003eA. rhizogene\u003c/em\u003es strains ATCC 15834, A4, and A13 were grown in liquid yeast mannitol broth (YMB) supplemented with 50 mg/L rifampicin overnight at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 150 rpm in a shaker incubator (Wise Cube, Germany). After the OD600 (optical density) of the \u003cem\u003eAgrobacterium\u003c/em\u003e suspension reached 0.6\u0026ndash;0.7, it was centrifuged (Pars-azma, Iran) at 4000 rpm for 15 min. The obtained pellet was again suspended in fresh liquid MS media and shaken at 70 rpm for 20 min. The leaf margins and edges were cut off and pricked manually with a sterile scalpel. The explants in the prepared infection suspension were immersed and transferred to a shaker (70 rpm for 20 min). Leaves as a control sample were subsequently immersed in distilled water, and other steps were performed under similar conditions. For co-cultivation, the infected explants were transferred to solid MS media and grown at 28\u0026deg;C for 72 h (Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). To remove \u003cem\u003eA. rhizogenes\u003c/em\u003e, the leaves were placed in fresh 1/2 MS media supplemented with 250 mg/L cefotaxime (without phytohormones) and then rinsed in distilled water containing cefotaxime. After the hairy roots reached a length of about 3\u0026ndash;4 cm, they were cultured in 1/2 MS liquid media and kept in the dark at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C with constant stirring at 90 rpm on an incubator shaker. The antibiotic concentration was decreased, and the bacteria were removed finally from each subculture.\u003c/p\u003e\n\u003ch3\u003eExtraction of genomic DNA and PCR analysis of putative transgenic\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was extracted from hairy roots and control roots (negative control) using the CTAB method (Khan et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Polymerase chain reaction (PCR) amplification (Thermo Fisher Scientific, USA) was performed with the \u003cem\u003erolB\u003c/em\u003e gene (accession no. 15952), and the T-DNA from the Ri plasmid integration and presence in hairy roots were assessed via the forward sequence 5'-GCTGATTATCCAGGTTTTCGG-3' and reverse sequence 5'-GATAAGAAAGGGGCACAGGAC-3'. The \u003cem\u003eVirD1\u003c/em\u003e gene (accession no. X51418.1) with the forward sequence 5'-GGTACGCTTGCTGGTGGAATAG-3ʹ and reverse sequence 5ʹ-GACGCTCGAAACGAACAAAGAC-3ʹ was utilized as a negative control to verify that \u003cem\u003eA. rhizogenes\u003c/em\u003e was absent in the hairy roots. The amplification conditions for PCR were 94\u0026deg;C for 3 min, followed by 36 cycles of 94\u0026deg;C for 30 s, 58\u0026deg;C for 30 s, 72\u0026deg;C for 45 s, and 72\u0026deg;C for 5 min. The amplified product was observed via electrophoresis in a 1% agarose gel.\u003c/p\u003e\n\u003ch3\u003ePreparation and treatment of biotic and abiotic elicitors\u003c/h3\u003e\n\u003cp\u003eIn this study, \u003cem\u003eR. leguminosarum\u003c/em\u003e (RL330) and \u003cem\u003eP. putida\u003c/em\u003e (KT2440) were used as bacterial elicitors. First, \u003cem\u003eR. leguminosarum\u003c/em\u003e and \u003cem\u003eP. putida\u003c/em\u003e were cultured in YMB at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 150 rpm overnight. According to the growth curve, after 14 and 12 hours of \u003cem\u003eR. leguminosarum\u003c/em\u003e and \u003cem\u003eP. putida\u003c/em\u003e growth (In logarithmic growth), respectively, the bacterial OD600 was measured using a spectrophotometer (Analytik Jena-Spekol 1500, Germany). Then, 2 ml of the grown \u003cem\u003eR. leguminosarum\u003c/em\u003e and \u003cem\u003eP. putida\u003c/em\u003e was applied for elicitor. MeJA (Sigma, Germany) and GA (Sigma, Germany) were used as abiotic elicitors. For MeJA and GA treatment, stock solutions of 10 mM and 5 g/L, respectively, were prepared and then filter-sterilized. Sterilized MeJA (0.1 mM) GA (50 mg/L) was fed to 28-day-old licorice hairy roots. Hairy root cultures without elicitors served as controls. After all the elicitors were incubated into four-week-old hairy roots, the plants were incubated at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C under agitation (100 rpm) for three days (Awad et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The hairy roots were then harvested, thoroughly cleaned in distilled water, and allowed to air dry for future laboratory studies. Some of the samples were additionally frozen in liquid N\u003csub\u003e2\u003c/sub\u003e and kept at -70\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eSample extraction\u003c/h3\u003e\n\u003cp\u003eDried and ground hairy roots were extracted with methanol (1/10 w/v) and sonicated (Parsonic 2600s, Iran) for 30 min at 30\u0026deg;C. The extracts were then collected and replaced with new methanol, repeating the extraction process twice. The methanol was evaporated in a laboratory hood at a temperature of 18\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u0026deg;C for 24 h. The extract was utilized, for phytochemical studies.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of phenolic compounds content\u003c/h2\u003e \u003cp\u003eThe colorimetric method was utilized to determine the content of phenolic compounds measured by (Chizzola et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The extract was combined with a 1:10 dilution of Folin\u0026ndash;Ciocalteu reagent used in distilled water. After 5 min, sodium bicarbonate (60 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was added, and the mixture was maintained at room temperature for 90 min. The absorbance was assayed with a spectrophotometer (Analytik Jena-Spekol 1500, Germany) at 750 nm and reported in mg GA (gallic acid)/100 g dw. GA was utilized as a standard sample.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDetermination of flavonoid content\u003c/h3\u003e\n\u003cp\u003eTo determine the content of flavonoid, potassium acetate (1 M), 10% (w/v) AlCl\u003csub\u003e3\u003c/sub\u003e, and distilled water were combined with the ethanolic extract. After the reaction mixture was put in the dark at room temperature (90 min), the absorbance of the samples was measured at 415 nm with a spectrophotometer (Analytik Jena-Spekol 1500, Germany). The quercetin equivalent (QE)/100 g dry weight was the reported flavonoid content (Chang et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). The reference concentration for quercetin was in the range of 20\u0026ndash;120 mg ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003eDetermination of phenolic acid content\u003c/h3\u003e\n\u003cp\u003eThe content of phenolic acid was assessed according to the methods of Matkowski et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The methanolic extract was mixed with water, 10% HCl (w/v), Arnow reagent, and NaOH (1 M), and the absorbance was then immediately measured at 490 nm.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of saponin content\u003c/h2\u003e \u003cp\u003eThe saponin content was measured using a vanillin-sulfuric acid assay. First, the extracts were kept in water at 65\u0026deg;C to eliminate methanol. The test tubes were then filled with 8% (w/v) vanillin solution and 72% (v/v) H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e and mixed with a vortex (Daihan Scientific, Korea). After incubation at 60\u0026deg;C (15 min), the tubes were placed in cool water at room temperature. Finally, absorption at 560 nm was measured via a spectrophotometer (Analytik Jena-Spekol 1500, Germany) (Le et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2018b\u003c/span\u003e). The formula for calculating saponin content was \u0026micro;g of sapogenin/mg dry weight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of glycyrrhizin content\u003c/h2\u003e \u003cp\u003eTo determine the glycyrrhizin content, the dried and powdered hairy roots were extracted (1/10 w/v) with 80% (v/v) methanol at 40\u0026ndash;45\u0026deg;C for 16\u0026ndash;18 h. The centrifuged supernatant was then evaporated for 24 h at 18\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u0026deg;C in a lab hood (Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Using a high-performance liquid chromatography (HPLC) device, residual extracts were injected to measure the amount of glycyrrhizin. Standard glycyrrhizin was utilized at a concentration of 1 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. A C-18 reversed-phase column (15 \u0026times; 4.6 cm) and a UV detector (K2501) at 254 nm were included in the HPLC instrument (KNAUER, Germany). Glacial acetic acid, acetonitrile, and water (6:30:64 v/v/v) formed the mobile phase and a gradient method at a rate of 1.5 ml/min was used. The ammonium salt of glycyrrhizin (Sigma‒Aldrich) was employed as a standard.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of DPPH radical scavenging capacity\u003c/h2\u003e \u003cp\u003eThe methanolic solution of DPPH (0.1 mM) contained 0\u0026ndash;100 \u0026micro;l of the methanolic extract and was diluted to a final volume of 1.5 ml. After the samples were allowed the rest in the dark for 60 min, the absorption rate at 517 nm was measured by spectrophotometer (Analytik Jena-Spekol 1500, Germany). The following formula was used to calculate the radical scavenging activity: A control\u0026thinsp;=\u0026thinsp;absorbance of the control sample; A sample\u0026thinsp;=\u0026thinsp;absorbance of the extract (Akowuah et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eLipid peroxidation (malondialdehyde (MDA)) content\u003c/h2\u003e \u003cp\u003eMalondialdehyde was calculated using the method of Heath and Packer (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1968\u003c/span\u003e). The hairy roots were powdered in trichloroacetic acid (TCA) at a concentration of 0.1% (w/v). Following centrifugation, the supernatant was mixed with 20% TCA containing 0.5% (w/v) TBA, warmed in water, and cooled. A spectrophotometer (Analytik Jena-Spekol 1500, Germany) was used to measure the absorption at 532 and 600 nm. The MDA content of hairy roots was reported as nmol g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e fw, with an extinction coefficient of 155 mM\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/h2\u003e \u003cp\u003eFor measurement of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, hairy roots were extracted with 0.1% (w/v) TCA in an ice bath. The supernatant was centrifuged and then combined with 1 M KI and 10 mM K-phosphate buffer (pH\u0026thinsp;=\u0026thinsp;7.0). The absorption was detected at 390 nm using a spectrophotometer (Analytik Jena-Spekol 1500, Germany). To calculate the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentration, a standard curve of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was used and expressed as \u0026micro;mol g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e fw (Sagisaka \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e1976\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eAntioxidant enzyme activities\u003c/h2\u003e \u003cp\u003eHairy roots were ground in liquid nitrogen and suspended in phosphate buffer (pH\u0026thinsp;=\u0026thinsp;7.0) including 1% (w/v) polyvinylpyrrolidone (PVP) and 0.1 mM EDTA. After centrifugation at 4\u0026deg;C (Pars-azma, Iran), the supernatant was used to determine the activity of the antioxidant enzyme (Yan et al. \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAPX activity (EC 1.11.1.11) was measured by scanning the reduction in ascorbate absorption. The hairy root extract (100 \u0026micro;l) was mixed with a solution of 0.5 mM ascorbate, 50 mM potassium phosphate buffer (pH\u0026thinsp;=\u0026thinsp;7.0), and 0.1 mM EDTA. The absorbance (A290) was measured at 15-second intervals via a spectrophotometer (Analytik Jena-Spekol 1500, Germany), and the extinction coefficient was 2.8 mM\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (Nakano and Asada, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e1981\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSOD activity (EC 1.15.1.1) was assayed using the nitro blue tetrazolium (NBT) method (Becana et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). For this test, hairy extract (100 \u0026micro;l) was added to 0.1 mM EDTA, 82.5 \u0026micro;M NBT, 14.3 mM methionine, and 2.2 \u0026micro;M riboflavin dissolved in phosphate buffer (pH\u0026thinsp;=\u0026thinsp;7.8) as a reaction mixture, to start the reaction. After incubation in each tube for 30 min under a light source (six 15 W fluorescent lamps) at a distance of 30 cm, the light was turned off to stop the reaction. As a control sample, a tube without enzyme extract was stored in the dark. As a dark control, 100 \u0026micro;l of the enzyme extract was added to the reaction mixture, which was then incubated in the dark. Using a spectrophotometer (Analytik Jena-Spekol 1500, Germany), the reduction of NBT was determined by scanning the A560 nm, and the SOD activity g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e fresh weight was expressed in units (U).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eTotal RNA extraction, cDNA synthesis, and RT‒PCR analysis\u003c/h2\u003e \u003cp\u003e The total RNA of 30-day-old hairy roots was extracted with RNX plus solution (Sina Clon BioScience, IRAN) according to the instructions of the manufacturer. Triplicate technical replicates and three RNA extraction samples were used for each treatment and control. The RNA samples were analyzed for quantity and quality via a NanoDrop spectrophotometer (Analytic Jena, Germany). The integrity of the RNA was also checked visually by electrophoresis gel. According to the cDNA synthesis kit manufacturer's instructions (Denazist Asia, Mashhad, Iran), 1 \u0026micro;g of total RNA was utilized for the synthesis of first-strand cDNA. Reverse transcription polymerase chain reaction (RT‒PCR) was done quantitatively on cDNA via Master Mix Green (Ampliqon, Denmark). The program's cycle sequence comprised one denaturation cycle at 95\u0026deg;C for 5 min, then 45 cycles at 95\u0026deg;C for 30 s, 58\u0026deg;C for 20 s, and 72\u0026deg;C for 15 s. \u003cem\u003ebAS\u003c/em\u003e, \u003cem\u003eCYP88D6\u003c/em\u003e, and \u003cem\u003eCYP72A154\u003c/em\u003e as specific primers were created using Primer 3 software (version 0.4.0). The housekeeping gene was 18S ribosomal RNA (\u003cem\u003e18SrRNA\u003c/em\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The study used RT‒PCR amplification (Thermo Fisher Scientific, USA) was used to examine the relative expression of the important genes for the biosynthesis of glycyrrhizin. The replication of the desired gene fragments as PCR products was confirmed by the successful synthesis of cDNA. A sample without cDNA was used as a negative control. Finally, the intensity and width of the obtained bands were compared via image analysis via ImageJ software, and the resulting data were analyzed.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of the primers used in RT-PCR analysis of the genes involved in glycyrrhizin biosynthesis in hairy roots of \u003cem\u003eG. glabra.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eAccession No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eForward and Reverse Primers\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e18SrRNA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eX02623\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: CTTCCTTGGATGTGGTAG\u003c/p\u003e \u003cp\u003eR: TCGATGGTAGGATAGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGgbAS\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eAB037203\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: TCCAGGGCATAGGAAGAAAG\u003c/p\u003e \u003cp\u003eR: GCGAACCAAGAACCGTAAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGgCYP88D6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKP851192.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: GTCCGCTGCCACTTTGTT\u003c/p\u003e \u003cp\u003eR: TGGGTGTTCTTTCCTTCTTAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGgCYP72A15\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAB558153.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: TCATCACAGACCCAGAGCAA\u003c/p\u003e \u003cp\u003eR: CCCATTTGTCACCCTCATAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe experiment was performed as a fully randomized factorial design (3 phytohormones and 2 \u003cem\u003eRhizobium\u003c/em\u003e). Except for the gene expression data, all data were obtained in triplicate. However, the selection of the best \u003cem\u003eA. rhizogenes\u003c/em\u003e strain and the efficient biotic elicitor were done in a completely randomized design. Analysis of variance (ANOVA) and least squares means differences Student\u0026rsquo;s tests were used to define significant differences at \u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e by JMP version 9. The diagrams were drawn via Excel. The mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE) was used to report the values. Multivariate statistical analyses were done by PAST ver., 3.14 (Hammer and Harper, 2006). Quantitative traits for treated licorice hairy roots by biotic and abiotic elicitors were measured by principal component analysis (PCA)-biplot (Unweighted Pair-group Method with Arithmetic Mean) (Sneath and Sokal, 1973).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment, proliferation and molecular confirmation of hairy roots\u003c/h2\u003e \u003cp\u003eIn the study, all strains of \u003cem\u003eA. rhizogenes\u003c/em\u003e (ATCC 15834, A4, and A13) were able to successfully produce hairy roots using the leaf explants (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Approximately 2 to 3 weeks after inoculation with \u003cem\u003eA. rhizogenes\u003c/em\u003e strains, hairy roots emerged from the injured leaf site without callus development. The control samples that were inoculated with water did not observe the hairy roots. The proliferation of 775bp fragments related to the \u003cem\u003erol\u003c/em\u003e gene in the produced hairy roots confirmed the transformation and appearance of the hairy roots (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Additionally, to ensure that the roots were not contaminated with bacteria, specific \u003cem\u003eVirA\u003c/em\u003e primers were used and did not propagate segments of 1390bp (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe effect of three strains of \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e strains (ATTC15834, A4, and A13) on percentage of induction, the length, fresh, and dry weight in hairy roots of \u003cem\u003eG. glabra.\u003c/em\u003e Data are means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (n\u0026thinsp;=\u0026thinsp;3). Means followed by the same letter are not significantly different (\u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e) by LSMeans Student's t.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003epercentage of hairy root induction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLength\u003c/p\u003e \u003cp\u003e(more than 2 cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFresh weight\u003c/p\u003e \u003cp\u003e(g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDry weight\u003c/p\u003e \u003cp\u003e(g)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATCC 15834\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50.16\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;4.01\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.33\u003csup\u003eab\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;1.20\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.31\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.02\u003csup\u003eab\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA4\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32.33\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;4.97\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;5.19\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.19\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.01\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eA13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30.33\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;5.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;2.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.66\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.04\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSelecting the indicator strain of\u003c/b\u003e \u003cb\u003eA. rhizogenes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAnalysis of variance showed that the percentage of hairy root induction, hairy root length, fresh weight, and dry weight were significantly affected by different strains of \u003cem\u003eA. rhizogenes\u003c/em\u003e (\u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e). Thirty days after the first subculture, the highest level of hairy root formation was associated with strain ATCC 15834, and the maximum level of hairy root length, fresh weight, and dry weight was observed with strain A13 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The amount of biomass produced by the A13 strain was significantly two and four-fold greater than that produced by ATCC 15834 and A4 respectively, so the A13 strain was chosen as an efficient strain because of its rapid growth among the studied strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). After the indicator strain was selected, a growth curve was generated to determine the growth period and the appropriate time to apply the treatments. In the study, the hairy roots of \u003cem\u003eG. glabra\u003c/em\u003e grew very slowly until the tenth day, and their exponential growth started from the fifteenth day, followed by their growth stability on the thirtieth day. The hairy roots were slender and light yellow and presented many lateral branches, but the color gradually changed to light brown from 3\u0026ndash;4 weeks.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eSelecting the efficient biotic elicitor\u003c/h2\u003e \u003cp\u003eBased on Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the effects of \u003cem\u003eR. leguminosarum\u003c/em\u003e and \u003cem\u003ePseudomonas putida\u003c/em\u003e on the content of saponin and glycyrrhizin in the licorice hairy roots were significant (\u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.001\u003c/em\u003e). The saponin and glycyrrhizin content of the treated hairy roots with bacteria were enhanced, compared with the control. The highest saponin and glycyrrhizin content was related to \u003cem\u003eR. leguminosarum\u003c/em\u003e treatment, which increased by 46% and 94%, respectively, compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003ePhenolic compounds, flavonoids, and phenolic acid contents\u003c/h2\u003e \u003cp\u003eThe results showed that phytohormones (MeJA and GA) and \u003cem\u003eR. leguminosarum\u003c/em\u003e and their interactions significantly affected on the content of phenolic acid, flavonoids, and phenolic compounds in hairy roots (\u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.01\u003c/em\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Compared with the control, all the elicitors led to a marked increase in phenolic compounds, flavonoids, and phenolic acid contents. The lowest and highest phenolic compounds were observed in the MeJA (27.63 mg/g dw) and GA\u0026times;R (35.89 mg/g dw) treatments, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the trend of changes in flavonoid and phenolic acid contents was similar in all the treatments with biotic and abiotic elicitors. However, the maximum values of flavonoids and phenolic acids were detected in hairy roots treated with gibberellic acid and methyl jasmonate (3.5 and 3.4 fold, greater than those in the controls), respectively.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalysis of variances (ANOVA) of the effect of phytohoemones (MeJa and GA), \u003cem\u003eRhizobium leguminosarum\u003c/em\u003e and interactions on phenolic compounds, flavonoids, and phenolic acids DPPH (IC\u003csub\u003e50\u003c/sub\u003e), saponin, glycyrrhizin, MDA, and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content, APX, and SOD activity in the hairy roots of \u003cem\u003eG. glabra\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"14\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePhenolic compounds\u003c/p\u003e \u003cp\u003e(mg/ g dw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFlavonoid\u003c/p\u003e \u003cp\u003e(mg/ g dw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePhenolic acid\u003c/p\u003e \u003cp\u003e(mg/ g dw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDPPH IC\u003csub\u003e50\u003c/sub\u003e\u003c/p\u003e \u003cp\u003e(mg/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSaponin\u003c/p\u003e \u003cp\u003e(mg/g dw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eGlycyrrhizin\u003c/p\u003e \u003cp\u003e(mg/ g dw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e \u003cp\u003eMDA\u003c/p\u003e \u003cp\u003e(nmol\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e \u003cp\u003eH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003cp\u003e(\u0026micro;mol\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eAPX\u003c/p\u003e \u003cp\u003e(Unit g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eSOD\u003c/p\u003e \u003cp\u003e(Unit g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePhytohormones\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e65.166\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.406\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.855\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1052\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.024 \u003csup\u003eNS\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.395\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e5.253\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e508\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c13\" namest=\"c12\"\u003e \u003cp\u003e0.110\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e2.228\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eR. leguminosarum\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e76.495\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.154 \u003csup\u003eNS\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.139 \u003csup\u003eNS\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1938\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.638\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.679\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e38.587\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e1159\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c13\" namest=\"c12\"\u003e \u003cp\u003e1.871\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e35.186\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePhytohormones\u0026times;\u003c/b\u003e \u003cb\u003eR. leguminosarum\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.173\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.944\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.254\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e940\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.811\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.084\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.109\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e194\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c13\" namest=\"c12\"\u003e \u003cp\u003e0.025\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.635\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eError\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.656\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.047\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e52.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.335\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e7.560\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c13\" namest=\"c12\"\u003e \u003cp\u003e0.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0138\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"14\"\u003e\u0026ldquo;NS\u0026rdquo; indicates that the differences are not significant.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"14\"\u003e\u003cem\u003e* P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"14\"\u003e\u003cem\u003e** P\u0026thinsp;\u0026lt;\u0026thinsp;0.01.\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"14\"\u003e\u003cem\u003e*** P\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eSaponin and glycyrrhizin contents\u003c/h2\u003e \u003cp\u003eThe results revealed that biotic elicitor, phytohormones, and their interactions had significant effects on saponin and glycyrrhizin contents in the licorice hairy roots (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;\u003cem\u003e0.05\u003c/em\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The saponin and glycyrrhizin contents of the hairy root extracts were markedly greater (10\u0026ndash;32% and 11\u0026ndash;51%, respectively) than those of the control samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). According to HPLC analysis, the highest concentration of glycyrrhizin (2.82 mg/g dw) was observed in hairy roots treated with concomitant treatment (MeJA and bacteria). However, the use of \u003cem\u003eR. leguminosarum\u003c/em\u003e increased the maximum saponin level (8.97 mg/g dw).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eAntioxidant capacity\u003c/h2\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the antioxidant capacity determined by DPPH (IC\u003csub\u003e50\u003c/sub\u003e) of the treated licorice hairy roots decreased significantly (\u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.01\u003c/em\u003e) compared with that of the controls. However, the antioxidant capacity of all the elicitors (except MeJA) was not significantly different from each other (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The highest DPPH radical scavenging activity (lowest IC\u003csub\u003e50\u003c/sub\u003e) was related to the application of GA, which resulted in a 1.6-fold decrease compared with that of control but was 6.2 times more than the antioxidant capacity of ascorbate (standard sample). The interaction effect of MeJA application and bacteria was greater effective than that of the MeJA alone on DPPH radical scavenging, leading to a significant decrease in the IC\u003csub\u003e50\u003c/sub\u003e value.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eOxidative stress markers\u003c/h2\u003e \u003cp\u003eBiotic and abiotic elicitors and their interaction markedly induced lipid peroxidation and hydrogen peroxide (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;\u003cem\u003e0.05\u003c/em\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, the MDA content in the hairy root extracts elevated, ranging from 1.5- to 2.7-fold, which was related to the GA factor and MeJA\u0026times;R interaction. The pattern of changes in H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e levels was comparable to that of malondialdehyde levels and significantly increased (\u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.01\u003c/em\u003e). High induction of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was detected in response to the simultaneous application of GA and R factors (GA\u0026times;R), which showed a six-fold enhancement compared to the untreated hairy roots.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eAntioxidant enzyme activities\u003c/h2\u003e \u003cp\u003eThe activities of APX and SOD were significantly higher (\u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e) in all biotic and abiotic elicitors than compared to the control (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In the study, the MeJA\u0026times;R and GA\u0026times;R interactions resulted in a greater increase in APX and SOD activity than did the R and MeJA treatments alone. The highest levels of APX and SOD activity were observed for the GA\u0026times;R and MeJA\u0026times;R interactions, with values three and four times greater than those of the controls, respectively. The patterns of APX and SOD activity were similar, but the activity level of the superoxide dismutase enzyme was observed higher than that of the ascorbate peroxidase enzyme (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003ePathway gene expression analysis\u003c/h2\u003e \u003cp\u003eRT‒PCR results indicated that MeJA\u0026times;R interactions significantly enhanced the expression of \u003cem\u003eCYP88D6\u003c/em\u003e, \u003cem\u003eCYP72A154\u003c/em\u003e, and \u003cem\u003ebAS\u003c/em\u003e, compared with that in the untreated samples \u003cem\u003e(P\u0026thinsp;\u0026le;\u0026thinsp;0.05)\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In comparison to the control, the relative expression levels of the \u003cem\u003eCYP88D6\u003c/em\u003e, \u003cem\u003eCYP72A154\u003c/em\u003e, and \u003cem\u003ebAS\u003c/em\u003e genes were elevated by 32%, 86%, and 21%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalysis of variances (ANOVA) of the effect of MeJA and \u003cem\u003eRhizobium leguminosarum\u003c/em\u003e on relative gene expression of \u003cem\u003ebAS, CYP88D6\u003c/em\u003e, and \u003cem\u003eCYP72A154\u003c/em\u003e in the hairy roots of \u003cem\u003eG. glabra.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003ebAS\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eCYP88D6\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCYP72A154\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMeJA\u0026times;\u003c/b\u003e \u003cb\u003eRhizobium leguminosarum\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.071\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.162\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.127\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eError\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.006\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u0026ldquo;NS\u0026rdquo; indicates that the differences are not significant.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003cem\u003e* P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003cem\u003e** P\u0026thinsp;\u0026lt;\u0026thinsp;0.01.\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003cem\u003e*** P\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003ePCA-biplot analysis\u003c/h2\u003e \u003cp\u003ePCA-biplot was performed using eigenvalues and % variance based on assayed traits of treated licorice hairy roots by biotic and abiotic elicitors. Ten phytochemical and physiological characteristics were noticed in three main components (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The first principle component (PC1) DPPH (IC\u003csub\u003e50\u003c/sub\u003e) values had the highest variance content, showing 78.532% of the overall variance. In PC2, most portion of the variance was related to H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e levels, clarifying 20.524% of the total variance (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eTable 5\u003c/strong\u003e Eigenvalues and % of variance for factors obtained from the principal component analysis (PCA) based on assayed traits for treated licorice hairy roots by biotic and abiotic elicitors.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"395\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 24.0196%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eVariable\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 38.2353%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eComponent \u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePC1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 17.3203%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePC2 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePC3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 16.781%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhenolic compound\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 8.0556%;\"\u003e\n \u003cp\u003e-0.1612\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 16.9935%;\"\u003e\n \u003cp\u003e0.0305\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e0.8448\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.299%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFlavonoid\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 8.0556%;\"\u003e\n \u003cp\u003e-0.0371\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 16.9935%;\"\u003e\n \u003cp\u003e-0.0251\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e0.2372\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.299%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhenolic acid\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 8.0556%;\"\u003e\n \u003cp\u003e-0.0290\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 16.9935%;\"\u003e\n \u003cp\u003e0.0261\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e0.1104\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.299%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDPPH (IC\u003csub\u003e50\u003c/sub\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 8.0556%;\"\u003e\n \u003cp\u003e0.8984\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 16.9935%;\"\u003e\n \u003cp\u003e0.4126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e0.1070\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.299%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSaponin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 8.0556%;\"\u003e\n \u003cp\u003e-0.0230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 16.9935%;\"\u003e\n \u003cp\u003e-0.0252\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e-0.2344\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.0082%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGlycyrrhizin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 8.3824%;\"\u003e\n \u003cp\u003e-0.0080\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 16.8301%;\"\u003e\n \u003cp\u003e0.0109\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e-0.1421\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25.817%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSOD\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 8.3824%;\"\u003e\n \u003cp\u003e-0.0590\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 16.8301%;\"\u003e\n \u003cp\u003e0.0767\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e-0.2141\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25.817%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAPX\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 8.3824%;\"\u003e\n \u003cp\u003e-0.0117\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 16.8301%;\"\u003e\n \u003cp\u003e0.0199\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e-0.0599\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25.817%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMDA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 8.3824%;\"\u003e\n \u003cp\u003e-0.0655\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 16.8301%;\"\u003e\n \u003cp\u003e0.0795\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e-0.2836\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25.817%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 8.3824%;\"\u003e\n \u003cp\u003e-0.3951\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 16.8301%;\"\u003e\n \u003cp\u003e0.9022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e-0.0344\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25.817%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEigenvalue\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 6.4461%;\"\u003e\n \u003cp\u003e463.703\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 16.8301%;\"\u003e\n \u003cp\u003e121.189\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e2.1443\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25.817%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e% variance\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" style=\"width: 3.8644%;\"\u003e\n \u003cp\u003e78.532\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 16.8301%;\"\u003e\n \u003cp\u003e20.524\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9.4771%;\"\u003e\n \u003cp\u003e0.5352\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe results showed that all strains of \u003cem\u003eA. rhizogenes\u003c/em\u003e (ATCC 15834, A4, and A13) were capable of establishing hairy roots with different efficiencies in \u003cem\u003eG. glabra\u003c/em\u003e leaf explants. There were no hairy roots in the untransformed explants. Compared with other strains, A13-transformed hairy roots were selected as an efficient strain for licorice root hairy induction because of their faster growth and greater biomass. The transformation efficiency was more influenced by different \u003cem\u003eAgrobacterium\u003c/em\u003e strains (Jain and Singh \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Mehrotra et al. (2018) and Srivastava et al. (\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) produced hairy roots with the A4 and K599 strains of licorice leaf explants, respectively, via the immersion method. Yousefian et al. (\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e) reported that strain A13 exhibited greater infection efficiency than other strains (R318, A4, GMI 9534, and ATCC 15834) for hairy root formation in \u003cem\u003eMentha spicata\u003c/em\u003e L. According to the results of Srivastava et al. (\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), 4-week-old seedling leaves were used as explants because 4-week-old plants are highly efficient at hairy root induction. \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation is closely correlated with the age and hormonal balance of explants (Sujatha et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The infection site and its cell division, as well as the integration of the T-DNA region into plant genes, are essential and play important roles in the appearance of the hairy root (Chaudhuri et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Grzegorczyk-Karolak et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). When the vein part of a leaf is wounded, the phloem cells in the leaf vein likely contain high amounts of sucrose and auxin and can be suitable for the establishment of bacterial \u003cem\u003eA. rhizogenes\u003c/em\u003e infection and the emergence of hairy roots (Tiwari et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). During hairy root production, the biosynthesis of MeJA is induced in wounded and infected leaves by \u003cem\u003eA. rhizogenes\u003c/em\u003e to activate signal transduction processes (Yousefian et al. \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePCR analysis revealed the existence of \u003cem\u003erolB\u003c/em\u003e gene bands in the roots of plants transformed with all the strains of \u003cem\u003eA. rhizogenes\u003c/em\u003e, confirming that the T-DNA region of the plasmid was transferred into the plant genome. However, the absence of the \u003cem\u003evirA\u003c/em\u003e sequence was demonstrated (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). T-DNA is transferred from a plasmid (pRi) of \u003cem\u003eA. rhizogenes\u003c/em\u003e, and the integration of the genes \u003cem\u003erolA\u003c/em\u003e, \u003cem\u003erolB\u003c/em\u003e, \u003cem\u003erolC\u003c/em\u003e, and \u003cem\u003erolD\u003c/em\u003e into the genome of plants leads to the formation of hairy roots (Chandra, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Singh et al., \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The co-cultivation of \u003cem\u003eA. rhizogenes\u003c/em\u003e with the injured tissue of the host plant causes the release of signaling molecules from the bacteria and thus \u003cem\u003evir\u003c/em\u003e gene induction (Tavassoli and Safipour Afshar, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Grzegorczyk-Karolak et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) proposed that the \u003cem\u003erolB\u003c/em\u003e gene is the most important gene. However, the \u003cem\u003erolA\u003c/em\u003e, \u003cem\u003erolC\u003c/em\u003e, and \u003cem\u003erolD\u003c/em\u003e genes synergistically enhance the induction of hairy root growth. The difference in the amount of plant growth regulators is due to the expression and presence of the \u003cem\u003erolA\u003c/em\u003e, \u003cem\u003erolB\u003c/em\u003e, and \u003cem\u003erolC\u003c/em\u003e genes, and the susceptibility of plant cells to these genes leads to differences in the growth of clones (Ono and Tian, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Grzegorczyk-Karolak et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). \u003cem\u003erol\u003c/em\u003e genes influence the growth and secondary metabolite biosynthesis of transformed roots by inducing the activation of plant defense genes and the biosynthesis of the PR protein (Bulgakov et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Grzegorczyk-Karolak et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Yousefian et al. \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, the hairy roots produced by the A13 strain were slender and light yellow and presented many lateral branches, but the color gradually changed to light brown after 3\u0026ndash;4 weeks. The best time to apply elicitors was 4 weeks after the hairy roots appeared. Similarly, the hairy roots of \u003cem\u003eTylophora indica\u003c/em\u003e changed from white to reddish-brown from 6\u0026ndash;8 weeks (Chaudhuri et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). According to the results of Wongwicha et al. (\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), the best time to apply the treatments was in the fourth week of culture, when the glycine content reached the maximum level.\u003c/p\u003e \u003cp\u003eBased on Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, R. \u003cem\u003eleguminosarum\u003c/em\u003e was more effective than \u003cem\u003eP. putida\u003c/em\u003e in increasing glycyrrhizin and saponin content. Similarly, Awad et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) indicated that the maximum level of glycyrrhizin in hairy roots of \u003cem\u003eTaverniera cuneifolia\u003c/em\u003e treated with different biotic elicitors was related to \u003cem\u003eR. leguminosarum\u003c/em\u003e treatment. Polysaccharides of microbial cell walls are generally efficient elicitors (Ma\u0026ntilde;ero et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Le et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e). Chamkhi et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) reported that microbial elicitation stimulates the production of plant secondary metabolites to different extents depending on the type of carbohydrate and polysaccharide fraction. Li et al. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2016a\u003c/span\u003e) demonstrated that the amounts of total flavonoids, glycyrrhizic acid, glycyrrhetinic acid, and polysaccharides produced were twofold greater in \u003cem\u003eG. uralensis\u003c/em\u003e treated with protein fragment elicitors than in the control. In addition, Pathogenesis-related (PR) proteins are encoded by the host plant and are induced to overcome stress conditions (Somboon et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). After microbial infection, SA and JA-mediated defense signaling pathways are induced and increase the biosynthesis of PR proteins (Zehra et al. \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In microbe treatments, the defense pathway mediated by JA/ET activated which induced ROS and biosynthesis of bioactive components (Zehra et al. \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In the study, the higher increase in glycyrrhizin content of the treated hairy roots with \u003cem\u003eR. leguminosarum\u003c/em\u003e occurred likely because \u003cem\u003eG. glabra\u003c/em\u003e is a plant from the Fabaceae family and potentially closely interacts with nodulation bacteria (Ma\u0026ntilde;ero et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). In addition, \u003cem\u003eR. leguminosarum\u003c/em\u003e probably caused more activation of defense pathways or increased GA and JA endogenously and as a result, production of more glycyrrhizin and saponin levels than \u003cem\u003eP. putida\u003c/em\u003e treatment.\u003c/p\u003e \u003cp\u003eIn the present study, the phenolic compound, flavonoid, and phenolic acid contents increased in response to biotic elicitors and phytohormones and their interactions in comparison to those in the controls. Compared with the other treatments, the application of GA led to the maximum levels of phenolic compounds in licorice hairy roots (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Plant growth regulators such as MeJA can increase the flavonoid content in \u003cem\u003eGlycyrrhiza inflata\u003c/em\u003e (Yang et al., 2008) and the rosmarinic acid content in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e (Xing et al. \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and GA\u003csub\u003e3\u003c/sub\u003e treatment is a good strategy for increasing the caffeic acid content in \u003cem\u003eEchinacea purpurea\u003c/em\u003e hairy roots (Abbasi et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Depending on the type of elicitors and the target cell, different inducers can activate distinct signaling pathways in plant cells (Chamkhi et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Exogenous treatment of jasmonate as a chemical messenger increases the biosynthesis of phenolic compounds by stimulating different signaling cascades and phenylpropanoid pathway genes (Yousefian et al. \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). According to Liang et al. (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), GA\u003csub\u003e3\u003c/sub\u003e treatment, which affects tyrosine aminotransferase (TAT) and phenylalanine ammonia-lyase (PAL) activities, increases the phenolic acid content in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots. Most likely, GA\u003csub\u003e3\u003c/sub\u003e supplementation increased the amount of phenolic compounds in treated hair roots by influencing the lignification of hairy roots (Abbasi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Moreover, endogenous GA contributed to the simultaneous accumulation of phenolic compounds under gibberellic acid treatment (Liang et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Zhang et al. (2022) reported that Flavonoid 3\u0026rsquo;-monooxygenase as an important enzyme in the flavonoid biosynthesis pathway negatively correlates with glycyrrhizin in \u003cem\u003eG. uralensis\u003c/em\u003e. Yeast extract is a biotic factor that increases flavonoid biosynthesis in \u003cem\u003eG. uralensis\u003c/em\u003e Fisch hairy roots (Zhang et al., \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Martin-Rivilla et al., (2021) reported that treatment of \u003cem\u003eP. fluorescens\u003c/em\u003e reinforced flavonoid biosynthesis in fruits and leaves of blackberry. The \u003cem\u003erolB\u003c/em\u003e gene can also increase the accumulation of phenols and flavonoids in hairy roots by influencing the biosynthetic pathway of phytochemicals (Tavassoli and Safipour Afshar \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Shkryl et al. (\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) reported that the \u003cem\u003erolA\u003c/em\u003e, \u003cem\u003erolB\u003c/em\u003e, and \u003cem\u003erolC\u003c/em\u003e genes can increase the production of quinones in the transformed cells of \u003cem\u003eRubia cordifolia\u003c/em\u003e. In addition, hairy roots have the potential to produce new natural metabolites. For example, Li et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) reported licoagrodione as a novel biflavonoid with antimicrobial activity obtained from licorice hairy root.\u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the exposure of hairy roots to the GA, MeJA, \u003cem\u003eRhizobium\u003c/em\u003e, and GA\u0026times;R and MeJA\u0026times;R interactions led to elevated saponin and glycyrrhizin contents (16\u0026ndash;19% and 11\u0026ndash;51%, respectively) compared with those in the control. The greatest increases in the saponin and glycyrrhizin contents were observed for the R and MeJA\u0026times;R interactions, respectively. Khan et al., (2024) reported that the combination effect of MeJA and \u003cem\u003eP. fluorescens\u003c/em\u003e caused elevated secondary metabolites biosynthesis and osmotic balance in \u003cem\u003eBrassica juncea\u003c/em\u003e under drought conditions. Exogenously applied methyl jasmonate and jasmonic acid (JA) could modify the biosynthesis of saponins in different plant species, such as ginsenosides in adventitious root cultures of \u003cem\u003ePanax ginseng\u003c/em\u003e (Hao et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), soyasaponin in licorice cell cultures (Hayashi et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), glycyrrhizin in hairy roots of \u003cem\u003eAbrus precatorius\u003c/em\u003e (Sajjalaguddam and Paladugu \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and artemisinin in \u003cem\u003eArtemisia annua\u003c/em\u003e (Harfi et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Additionally, the optimization of both the exposure time and concentration of treatment are important factors for achieving the highest level of triterpene production (Shabani et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Yousefian et al., \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Several reports have shown that 100 \u0026micro;M MeJA is the optimal concentration to achieve high biosynthesis of glycyrrhizin in various in \u003cem\u003ein vitro\u003c/em\u003e cultures (Bonfill et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Wongwicha et al., \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Awad et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). MeJA treatment stimulates the signaling network of the endogenous hormones JA and ethylene by increasing ROS production, thereby activating the expression of transcription factors and genes involved in secondary metabolite biosynthesis (Leon-Reyes et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Somboon et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Li et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2016b\u003c/span\u003e) reported that the accumulation of glycyrrhizic acid in \u003cem\u003eG. uralensis\u003c/em\u003e was significantly accelerated by treatment with auxin and gibberellic acid. Moreover, Yuan et al. (\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) reported that GA\u003csub\u003e3\u003c/sub\u003e treatment led to an increase in tanshinone in \u003cem\u003eS. miltiorrhiza.\u003c/em\u003e Considering that the biosynthesis of gibberellic acid and glycyrrhizin (as triterpenes) both initiate from the common mevalonic acid pathway, it can be concluded that exogenous treatment with GA\u003csub\u003e3\u003c/sub\u003e probably results in carbon diversion into the glycyrrhizin biosynthesis pathway after the formation of FPP and enhances the glycyrrhizin content (Zhang et al., \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Bacterial species are sometimes recognized by plants as noninvasive pathogens and cause the biosynthesis of secondary metabolites (Ma\u0026ntilde;ero et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Hao et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the study, \u003cem\u003eR. leguminosarum\u003c/em\u003e treatment probably activated defense pathways related to JA and elevated ROS levels which induced glycyrrhizin and saponin biosynthesis (Zehra et al. \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Similarly, Le et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e) stated that gram-negative bacteria including \u003cem\u003eMesorhizobium huakuii\u003c/em\u003e, \u003cem\u003eMesorhizobium amorphae\u003c/em\u003e, \u003cem\u003eBradyrhizobium ganzhouense\u003c/em\u003e, and \u003cem\u003eAzotobacter beijerinckii\u003c/em\u003e were utilized to a greater extent for the biosynthesis of ginsenoside (known as saponin) than were gram-positive bacteria (\u003cem\u003eBacillus\u003c/em\u003e sp. and \u003cem\u003eLeuconostoc\u003c/em\u003e sp.) in \u003cem\u003ePanax ginseng\u003c/em\u003e. In another study, \u003cem\u003eEscherichia coli\u003c/em\u003e elicitation resulted in the production of a protein (more than 10 kDa) that regulated the genes responsible for glycyrrhizin production in \u003cem\u003eG. uralensis\u003c/em\u003e (Li et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2016a\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the present study, compared to the control treatment, hairy roots treated with biotic and abiotic elicitors exhibited greater DPPH antioxidant capacity and a greater reduction in the IC\u003csub\u003e50\u003c/sub\u003e. El-Esawi et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) reported that increasing the amount of phenolic compounds, elevated the DPPH antioxidant capacity of transformed hairy root of \u003cem\u003eLactuca serriola\u003c/em\u003e L. compared to the controls. Similarly, Abbasi et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) indicated that the antioxidant properties of DPPH are related to the accumulation of phenolic compounds, flavonoids, and phenolic acids. The presence of free OH groups in the structure of phenolic compounds results in their antioxidant effects as well as the removal and neutralization of free radicals (Somboon et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The antioxidant capacity mitigates the destructive effect of free radicals by maintaining the structure and function of DNA, proteins, and enzymes and stabilizing membrane integrity (Behdad et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Moreover, the antioxidant system plays an important role in combating and eliminating oxidative stress (Tohma and Gul\u0026ccedil;in \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Phytohormones play an important function in stimulating defense responses (Halder et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In addition, high radical scavenging activity was observed in the hairy roots of \u003cem\u003eE. purpurea\u003c/em\u003e under GA\u003csub\u003e3\u003c/sub\u003e treatment (Abbasi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Bacterial elicitors stimulate cellular defense responses against pathogens (Le et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e). \u003cem\u003eRhizobium\u003c/em\u003e species are a group of rhizobacteria that activate alternative defense mechanisms in plants by inducing the accumulation of ABA (Wang et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). As an antioxidant, glycyrrhizin (triterpenoid) and its derivatives can combat and minimize the toxic effects of ROS (Hosseini et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Nasrollahi et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) indicated that triterpenes and b-amyrin (a precursor of glycyrrhizin), a secondary metabolite of extracted \u003cem\u003eJatropha gaumeri\u003c/em\u003e leaves, had antioxidant effects. Probably, Rhizobium as PGPR leads to systemic resistance through induce Ja biosynthesis and signaling transduction pathways (Thakur et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe present results showed that the increase in the MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentrations in licorice hairy roots in response to elicitor application could reflect cell destruction caused by oxidative stress. The maximum contents of oxidative markers were detected in the MeJA\u0026times;R and GA\u0026times;R interactions. In an experiment, the application of biotic and abiotic elicitors led to increased levels of ROS and thus induced oxidative stress (Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Hao et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) reported that fungal elicitor treatment of adventitious roots in \u003cem\u003ePanax ginseng\u003c/em\u003e caused an excessive increase in the rate of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and modulated the biosynthesis of ginsenoside (Humbal and Pathak \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Ca\u003csup\u003e+\u0026thinsp;2\u003c/sup\u003e, NO, and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e are important signaling molecules that activate the defense system of plants and improve plant metabolite production (Hao et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The movement of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e across the cytoplasmic membrane affects the permeability of the membrane and increases the content of MDA, which is an indicator of lipid peroxidation of the membrane, thereby causing cellular disorders (Behdad et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Moreover, MeJA has an important function in defense responses against oxidative and membrane-destructive stresses (Amani et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). After elicitation, the receptor on the cell membrane recognizes the elicitor, and different physiological and biochemical events occur, such as an increase in the calcium concentration in the cytosol, phosphorylation, and dephosphorylation of the plasma membrane, especially increased plasma membrane H\u003csup\u003e+\u003c/sup\u003e-ATPase activity, leading to the inward flow of protons, cytoplasmic acidification and a decrease in pH (Tohma and Gul\u0026ccedil;in, \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Jeyasri et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). As a result of these events, the mitogen-activated protein kinase (MAPK) and NADPH oxidase signaling pathways are activated, increasing ROS and jasmonate levels and reinforcing the plant defense system (Hao et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Humbal and Pathak \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Under biotic treatments, increasing H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e level induces phosphorylation of transcription factors and MAPK cascade, as a result of activation defense pathway gen (JA) and antioxidant enzymes and PR (Sun et al., 2023). In addition, the bacterial elicitor itself can release acidic metabolites and lower the pH of the cells (Le et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e). Similarly, Wu et al. (\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) reported that the pH of culture media containing hairy roots of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e treated with \u003cem\u003eB. cereus\u003c/em\u003e decreased dramatically. In the study, \u003cem\u003eR. leguminosarum\u003c/em\u003e led to accumulation higher level of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e than abiotic elicitors (MeJA and GA). Similarly, Hao et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) reported that peroxide hydrogen bursts occurred after fungal elicitation treatment. Excess ROS, which acts as signaling molecules, stimulate the biosynthesis of secondary metabolites and activate defense responses against free radicals (Amani et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Bulgakov (2008) reported a positive correlation between the expression of the \u003cem\u003erol\u003c/em\u003e gene and the rise in ROS levels in plant cells.\u003c/p\u003e \u003cp\u003eIn this study, the SOD and APX enzyme activities were elevated (1.77\u0026ndash;5.05-fold and 1.08\u0026ndash;4.08-fold, respectively) under the bacterial and phytohormone treatments compared with those of the controls. Under the simultaneous treatment with phytohormones and bacteria, the activity levels of SOD and APX were greater than those under the treatments alone. Similarly, the greatest increase in SOD activity was reported compared to that of other antioxidant enzymes (Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). SOD is an essential antioxidant enzyme because it acts as the first defense line and is capable of converting superoxide to hydrogen peroxide (Behdad et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e). Toxic H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e is scavenged and converted to H\u003csub\u003e2\u003c/sub\u003eO by catalase and APX (\u0026Ccedil;oban and Baydar \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The positive relationship between stimulation of the SOD activity and the ability of plants to withstand oxidative stress indicates the critical importance of this antioxidant enzyme (Srivastava et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003ea). According to a report by Jeyasri et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), the exposure of hairy roots to MeJA likely leads to the activation of signal transduction and plant defense mechanisms through the upregulation of the CuZn-SOD, glutathione peroxidase (GPX), and APX genes. In addition, the levels of the antioxidant enzymes catalase and peroxidase enhanced along with the increasing oxidant content, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and malondialdehyde content in \u003cem\u003eG. inflata\u003c/em\u003e treated with methyl jasmonate (Yang Ying et al. \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The results stated that MeJA can mitigate oxidative stress by increasing the antioxidant enzymes activity (Lang et al., 2020). JA has been reported to protect plants by inhibiting oxidative stress damage (Pedranzani et al., 2003). Rudrappa et al. (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) showed that \u003cem\u003eCandida versatilis\u003c/em\u003e treatment significantly increased the activity of peroxidase enzymes. Srivastava et al. (\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) stated that the SOD and APX enzyme activities in the hairy roots of licorice plants under cellulase and mannan treatment significantly increased compared to the control. The cellulase of \u003cem\u003eR. leguminosarum\u003c/em\u003e is a 1,4-β-d-endoglucanase that hydrolyzes and biosynthesizes rhizobial cellulose (Men\u0026eacute;ndez et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The presence of cellulose in the bacteria might be caused by an increase in antioxidant enzyme activity.\u003c/p\u003e \u003cp\u003eIn this study, the transcription rates of glycyrrhizin biosynthesis pathway genes were investigated via RT‒PCR. Compared the control, the gene expression levels of \u003cem\u003eCYP88D6\u003c/em\u003e, \u003cem\u003eCYP72A154\u003c/em\u003e, and \u003cem\u003ebAS\u003c/em\u003e significantly increased in response to MeJA\u0026times;R, as the best elicitor. Consistent with other studies, Hayashi et al. (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) showed that treatment with MeJA (100 \u0026micro;M) resulted in an increase in the mRNA level of the \u003cem\u003ebAS\u003c/em\u003e gene. Srivastava et al. (\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) reported that the relative levels of \u003cem\u003eSQS\u003c/em\u003e, \u003cem\u003ebAS\u003c/em\u003e, and \u003cem\u003eCYP88D6\u003c/em\u003e gene expression in abiotic elicitor-treated licorice hairy roots were significantly greater than those in control plants. As signaling molecules, elicitors can activate signal transduction pathways and regulate secondary metabolism via transcription factors in response to stimuli (Halder et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Bhaskar et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Glycyrrhizin biosynthesis occurs through the mevalonate pathway (MVA) (Alcalde et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this pathway, FPP is converted to squalene by the enzyme SQS. The enzyme bAS is involved in the cyclization of 2,3-oxidosqualane, which leads to the biosynthesis of beta-amyrin (Seki et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Tamura et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The enzymes CYP88D6 and CYP72A154 divert the soyasaponin biosynthetic pathway to produce glycyrrhizin (Seki et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Xie et al., 2018). Beta-amyrin-11 oxidase (CYP88D6) plays an important function in the engineering pathway of glycyrrhizin production by converting beta-amyrin to 11-oxo-β-amyrin via two oxidation steps (Seki et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The triterpene oxidation enzymes of the cytochrome P450 family (CYP72 and CYP88) are in charge of the biosynthesis of terpenoids, including glycyrrhizin, artemisinin, and taxol (Seki et al., 2008, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The expression of genes involved in the biosynthetic pathways of secondary metabolites was strongly correlated with their biosynthetic levels (Srivastava et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Shabani et al. (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) demonstrated that the glycyrrhizin content can be significantly altered by slight variations in \u003cem\u003ebAS\u003c/em\u003e gene expression. Shirazi et al. (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) found that glycyrrhizin production is significantly influenced by \u003cem\u003eCYP88D6\u003c/em\u003e and \u003cem\u003eSQS\u003c/em\u003e\u003csub\u003e\u003cem\u003e1\u003c/em\u003e\u003c/sub\u003e. In this study, the level of \u003cem\u003eCYP72A154\u003c/em\u003e gene expression increased more than that of the other studied genes under MeJA\u0026thinsp;+\u0026thinsp;R treatment. \u003cem\u003eSQS\u003c/em\u003e, squalene epoxidase (\u003cem\u003eSE\u003c/em\u003e), and \u003cem\u003ebAS\u003c/em\u003e genes related to the biosynthesis of saponins are upregulated by MeJA (Hayashi et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Shabani et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). A similar study by Chandran et al. (2020) indicated that two JA-responsive transcription factors (AP2/ERF proteins) bind to the promoters of genes and catalyze artemisinin synthesis in \u003cem\u003eArtemisia annua\u003c/em\u003e. Suzuki et al. (2002) demonstrated that the transcription of \u003cem\u003ebAS\u003c/em\u003e increased 30-fold under MeJA treatment with suspensions of \u003cem\u003eMedicago truncatula\u003c/em\u003e roots for 8\u0026ndash;24 h compared with the control. Furthermore, MeJA treatment (0.5 mM) resulted in a twofold increase in the number of \u003cem\u003ebAS\u003c/em\u003e transcripts in \u003cem\u003eBupleurum kaoi\u003c/em\u003e (Chen et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Most likely, MeJA and \u003cem\u003eRhizobium\u003c/em\u003e enhance glycyrrhizin biosynthesis by affecting the activities of important enzymes involved in saponin production or gene expression.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe results revealed that the A13 strain was the indicator strain, as evidenced by it having the highest growth rate of hairy roots among the strains studied. \u003cem\u003eR. leguminosarum\u003c/em\u003e was more effective than \u003cem\u003eP. putida\u003c/em\u003e in increasing the glycyrrhizin and saponin content of licorice hairy root. \u003cem\u003eR. leguminosarum\u003c/em\u003e, MeJA, and GA, both individually and in combination, elevated the levels of oxidative markers and induced the production of enzymatic and nonenzymatic antioxidants, thereby mitigating ROS. The combination treatment (MeJA\u0026times;R) directly increased glycyrrhizin biosynthesis by upregulating the expression of important genes (\u003cem\u003ebAS\u003c/em\u003e, \u003cem\u003eCYP88D6\u003c/em\u003e, and \u003cem\u003eCYP72A154\u003c/em\u003e) related to triterpenoid saponin production. In confirmation of the obtained results, PCA-biplot analysis showed that the amount of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and DPPH (IC\u003csub\u003e50\u003c/sub\u003e) as effective factors has a greater impact on the content of phytochemical compounds in the MeJA\u0026times;R treatment, compared to other treatments. The application of MeJA\u0026times;R interactions was found to be an effective strategy for the continuous biosynthesis of glycyrrhizin in licorice hairy roots.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eMeJA,\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003emethyl jasmonate;\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eGA, gibberellic acid; R, \u003cem\u003eRhizobium leguminosarum\u003c/em\u003e; P, \u003cem\u003ePseudomonas putida\u003c/em\u003e; DPPH, 2,2-diphenyl-1-picrylhydrazyl; ROS, reactive oxygen species; MDA, malodialdehyde; APX, ascorbate peroxidase; SOD, superoxide dismutase; HPLC, high-performance liquid chromatography; RT‒PCR, reverse transcription-polymerase chain reaction; PAL, phenylalanine ammonia-lyase; YMB, yeast mannitol broth; bAS, beta-amyrin synthase; SQS, squalene synthase; JA, jasmonic acid; PCA-biplot, principal component analysis-biplot. IAA, Indol acetic acid.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003eWe would like to thank the Iran National Science Foundation for financial support (4000573) of this research, Tehran, Iran.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAB performed the experiments, data analysis, wrote and revised the manuscript. AG supervised the whole research work, administrated the project, and revised the manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAll authors contributed to the editing and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003eThe authors have no competing interests to disclose or personal relationships that could influence the work presented in this article.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEthical statement The authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbbasi BH, Stiles AR, Saxena PK, Liu C-Z (2012) Gibberellic acid increases secondary metabolite production in \u003cem\u003eEchinacea purpurea\u003c/em\u003e hairy roots. Appl Biochem Biotechnol 168:2057\u0026ndash;2066. https://doi.org/10.1007/s12010-012-9917-z.\u003c/li\u003e\n\u003cli\u003eAhlawat S, Saxena P, Alam P, et al (2014) Modulation of artemisinin biosynthesis by elicitors, inhibitor, and precursor in hairy root cultures of \u003cem\u003eArtemisia Annua\u003c/em\u003e L. J Plant Interact 9(1):811\u0026ndash;824. https://doi.org/10.1080/17429145.2014.949885\u003c/li\u003e\n\u003cli\u003eAkowuah GA, Ismail Z, Norhayati I, Sadikun A (2005) The effects of different extraction solvents of varying polarities on polyphenols of \u003cem\u003eOrthosiphon stamineus\u003c/em\u003e and evaluation of the free radical-scavenging activity. Food Chem 93:311\u0026ndash;317. https://doi.org/10.1016/j.foodchem.2004.09.028.\u003c/li\u003e\n\u003cli\u003eAlcalde MA, Cusido RM, Moyano E, et al (2022) Metabolic gene expression and centelloside production in elicited \u003cem\u003eCentella asiatica\u003c/em\u003e hairy root cultures. Ind Crops Prod 184:114988. https://doi.org/10.1016/j.indcrop.2022.114988.\u003c/li\u003e\n\u003cli\u003eAli B (2021) Practical applications of jasmonates in the biosynthesis and accumulation of secondary metabolites in plants. Biocatal Agric Biotechnol 38:102205. https://doi.org/10.1016/j.bcab.2021.102205.\u003c/li\u003e\n\u003cli\u003eAmani S, Mohebodini M, Khademvatan S, Jafari M (2019) \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e -mediated hairy root induction and plant regeneration from transgenic roots in \u003cem\u003eFicus carica\u003c/em\u003e L. Journal of Plant Molecular Breeding 7:10\u0026ndash;21. https://doi.org/10.22058/jpmb.2019.112410.1188.\u003c/li\u003e\n\u003cli\u003eAwad V, Kuvalekar A, Harsulkar A (2014) Microbial elicitation in root cultures of \u003cem\u003eTaverniera cuneifolia\u003c/em\u003e (Roth) Arn. for elevated glycyrrhizic acid production. Ind Crops Prod. 54:13-16. https://doi.org/10.1016/j.indcrop.2013.12.036\u003c/li\u003e\n\u003cli\u003eBecana M, Paris FJ, Sandalio LM, Del Rio LA (1989) Isoenzymes of superoxide dismutase in nodules of \u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L., \u003cem\u003ePisum sativum\u003c/em\u003e L., and \u003cem\u003eVigna unguiculata\u003c/em\u003e (L.) Walp. Plant Physiol 90:1286\u0026ndash;1292. https://doi.org/10.1104/pp.90.4.1286.\u003c/li\u003e\n\u003cli\u003eBehdad A, Mohsenzadeh S, Azizi M (2021) Growth, leaf gas exchange and physiological parameters of two \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e L. populations subjected to salt stress condition. Rhizosphere 17:100319. https://doi.org/10.1016/j.rhisph.2021.100319.\u003c/li\u003e\n\u003cli\u003eBehdad A, Mohsenzadeh S, Azizi M (2020a) Comparison of phytochemical compounds of two \u003cem\u003eGlycyrrhiza glabra \u003c/em\u003eL. populations and their relationship with the ecological factors. Acta Physiol Plant 42:1\u0026ndash;18. https://doi.org/ 10.1007/s11738-020-03121-0.\u003c/li\u003e\n\u003cli\u003eBehdad A, Mohsenzadeh S, Azizi M, Moshtaghi N (2020b) Salinity effects on physiological and phytochemical characteristics and gene expression of two \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e L. populations. Phytochemistry 171:112236. https://doi.org/10.1016/j.phytochem.2019.112236\u003c/li\u003e\n\u003cli\u003eBhaskar R, Xavier LSE, Udayakumaran G, et al (2022) Biotic elicitors: A boon for the in-vitro production of plant secondary metabolites. Plant Cell, Tissue Organ Cult 149:7\u0026ndash;24. https://doi.org/10.1007/s11240-021-02131-1.\u003c/li\u003e\n\u003cli\u003eBonfill M, Mangas S, Moyano E, et al (2011) Production of centellosides and phytosterols in cell suspension cultures of \u003cem\u003eCentella asiatica\u003c/em\u003e. Plant Cell, Tissue Organ Cult 104:61\u0026ndash;67. https://doi.org/10.1007/s11240-010-9804-7.\u003c/li\u003e\n\u003cli\u003eBulgakov VP, Shkryl YN, Veremeichik GN, et al (2013) Recent advances in the understanding of \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e-derived genes and their effects on stress resistance and plant metabolism. Biotechnol hairy root Syst 1\u0026ndash;22. https://doi.org/10.1007/10_2013_179.\u003c/li\u003e\n\u003cli\u003eChamkhi I, Benali T, Aanniz T, et al (2021) Plant-microbial interaction: The mechanism and the application of microbial elicitor induced secondary metabolites biosynthesis in medicinal plants. Plant Physiol Biochem 167:269\u0026ndash;295. https://doi.org/10.1016/j.plaphy.2021.08.001.\u003c/li\u003e\n\u003cli\u003eChandra S (2012) Natural plant genetic engineer \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e: Role of T-DNA in plant secondary metabolism. Biotechnol Lett 34:407\u0026ndash;415. https://doi.org/10.1007/s10529-011-0785-3.\u003c/li\u003e\n\u003cli\u003eChang C-C, Yang M-H, Wen H-M, Chern J-C (2002) Estimation of total flavonoid content in propolis by two complementary colorimetric methods. J food drug Anal 10: 3. https://doi.org/10.38212/2224-6614.2748.\u003c/li\u003e\n\u003cli\u003eChaudhuri KN, Ghosh B, Tepfer D, Jha S (2005) Genetic transformation of \u003cem\u003eTylophora indica\u003c/em\u003e with \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e A4: growth and tylophorine productivity in different transformed root clones. Plant Cell Rep 24:25\u0026ndash;35. https://doi.org/10.1007/s00299-004-0904-x.\u003c/li\u003e\n\u003cli\u003eChen L-R, Chen Y-J, Lee C-Y, Lin T-Y (2007) MeJA-induced transcriptional changes in adventitious roots of \u003cem\u003eBupleurum kaoi\u003c/em\u003e. Plant Sci 173:12\u0026ndash;24. https://doi.org/10.1016/j.plantsci.2007.03.013.\u003c/li\u003e\n\u003cli\u003eChizzola R, Saeidnejad AH, Azizi M, et al (2014) \u003cem\u003eBunium persicum\u003c/em\u003e: variability in essential oil and antioxidants activity of fruits from different Iranian wild populations. Genet Resour Crop Evol 61:1621\u0026ndash;1631. https://doi.org/10.1007/s10722-014-0158-6.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;oban \u0026Ouml;, Baydar NG (2016) Brassinosteroid effects on some physical and biochemical properties and secondary metabolite accumulation in peppermint (\u003cem\u003eMentha piperita\u003c/em\u003e L.) under salt stress. Ind Crops Prod 86:251\u0026ndash;258. https://doi.org/10.1016/j.indcrop.2016.03.049.\u003c/li\u003e\n\u003cli\u003eEl-Esawi MA, Elkelish A, Elansary HO, et al (2017) Genetic transformation and hairy root induction enhance the antioxidant potential of \u003cem\u003eLactuca serriola\u003c/em\u003e L. Oxid Med Cell Longev 2017(1):5604746. https://doi.org/10.1155/2017/5604746.\u003c/li\u003e\n\u003cli\u003eGrzegorczyk-Karolak I, Kuźma Ł, Skała E, Kiss AK (2018) Hairy root cultures of\u003cem\u003e Salvia viridis\u003c/em\u003e L. for production of polyphenolic compounds. Ind Crops Prod 117:235\u0026ndash;244. https://doi.org/10.1016/j.indcrop.2018.03.014\u003c/li\u003e\n\u003cli\u003eHalder M, Sarkar S, Jha S (2019) Elicitation: A biotechnological tool for enhanced production of secondary metabolites in hairy root cultures. Eng Life Sci 19:880\u0026ndash;895. https://doi.org/10.1002/elsc.201900058.\u003c/li\u003e\n\u003cli\u003eHao Y-J, An X-L, Sun H-D, et al (2020) Ginsenoside synthesis of adventitious roots in \u003cem\u003ePanax ginseng\u003c/em\u003e is promoted by fungal suspension homogenate of \u003cem\u003eAlternaria panax\u003c/em\u003e and regulated by several signaling molecules. Ind Crops Prod 150:112414. https://doi.org/10.1016/j.indcrop.2020.112414.\u003c/li\u003e\n\u003cli\u003eHarfi B, Khelifi L, Khelifi-Slaoui M, et al (2018) Tropane alkaloids GC/MS analysis and low dose elicitors\u0026rsquo; effects on hyoscyamine biosynthetic pathway in hairy roots of Algerian \u003cem\u003eDatura\u003c/em\u003e species. Sci Rep 8:17951. https://doi.org/10.1038/s41598-018-36625-4.\u003c/li\u003e\n\u003cli\u003eHayashi H, Huang P, Inoue K (2003) Up-regulation of soyasaponin biosynthesis by methyl jasmonate in cultured cells of \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e. Plant cell Physiol 44:404\u0026ndash;411. https://doi.org/10.1093/pcp/pcg054.\u003c/li\u003e\n\u003cli\u003eHayashi H, Huang P, Takada S, et al (2004) Differential expression of three oxidosqualene cyclase mRNAs in \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e. Biol Pharm Bull 27:1086\u0026ndash;1092. https://doi.org/10.1248/bpb.27.1086.\u003c/li\u003e\n\u003cli\u003eHeath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 125:189\u0026ndash;198. https://doi.org/10.1016/0003-9861(68)90654-1.\u003c/li\u003e\n\u003cli\u003eHosseini MS, Samsampour D, Ebrahimi M, et al (2018) Effect of drought stress on growth parameters, osmolyte contents, antioxidant enzymes and glycyrrhizin synthesis in licorice (\u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e L.) grown in the field. Phytochemistry 156:124\u0026ndash;134. https://doi.org/10.1016/j.phytochem.2018.08.018.\u003c/li\u003e\n\u003cli\u003eHumbal A, Pathak B (2023) Influence of Exogenous Elicitors on the Production of Secondary Metabolite in Plants: A review (\u0026apos; \u0026ldquo;VSI: Secondary Metabolites\u0026rdquo;\u0026rsquo;). Plant Stress 100166. https://doi.org/10.1016/j.stress.2023.100166.\u003c/li\u003e\n\u003cli\u003eJain A, Singh S (2015) Effect of growth regulators and elicitors for the enhanced production of solasodine in hairy root culture of \u003cem\u003eSolanum melongena\u003c/em\u003e (L.). J Indian Bot Soc 94:23\u0026ndash;39. https://doi.org/10.1093/pcp/pcg054.\u003c/li\u003e\n\u003cli\u003eJavier Guti\u0026eacute;rrez Ma\u0026ntilde;ero F, Algar E, Mart\u0026iacute;n G\u0026oacute;mez MS, et al (2012) Elicitation of secondary metabolism in \u003cem\u003eHypericum perforatum\u003c/em\u003e by rhizosphere bacteria and derived elicitors in seedlings and shoot cultures. Pharm Biol 50:1201\u0026ndash;1209. https://doi.org/10.3109/13880209.2012.664150.\u003c/li\u003e\n\u003cli\u003eJeyasri R, Muthuramalingam P, Karthick K, et al (2023) Methyl jasmonate and salicylic acid as powerful elicitors for enhancing the production of secondary metabolites in medicinal plants: an updated review. Plant Cell, Tissue Organ Cult 153:447\u0026ndash;458. https://doi.org/10.3109/13880209.2012.664150.\u003c/li\u003e\n\u003cli\u003eKhan S, Qureshi MI, Alam T, Abdin MZ (2007) Protocol for isolation of genomic DNA from dry and fresh roots of medicinal plants suitable for RAPD and restriction digestion. African J Biotechnol 6:175.\u003c/li\u003e\n\u003cli\u003eKeswani C, Singh SP, Garc\u0026iacute;a‐Estrada C, et al (2022) Biosynthesis and beneficial effects of microbial gibberellins on crops for sustainable agriculture. Journal of Applied Microbiology. 132, 1597\u0026ndash;1615. https://doi.org/10.1111/jam.15348.\u003c/li\u003e\n\u003cli\u003eLe K-C, Im W-T, Paek K-Y, Park S-Y (2018a) Biotic elicitation of ginsenoside metabolism of mutant adventitious root culture in \u003cem\u003ePanax ginseng\u003c/em\u003e. Appl Microbiol Biotechnol 102:1687\u0026ndash;1697. https://doi.org/10.1007/s00253-018-8751-9.\u003c/li\u003e\n\u003cli\u003eLe A V, Parks SE, Nguyen MH, Roach PD (2018b) Optimisation of the microwave-assisted ethanol extraction of saponins from Gac (\u003cem\u003eMomordica cochinchinensis\u003c/em\u003e Spreng.) seeds. Medicines 5:70. https://doi.org/10.3390/medicines5030070.\u003c/li\u003e\n\u003cli\u003eLeon-Reyes A, Spoel SH, De Lange ES, et al (2009) Ethylene modulates the role of nonexpressor of pathogenesis-related genes1 in cross talk between salicylate and jasmonate signaling. Plant Physiol 149:1797\u0026ndash;1809. https://doi.org/10.1104/pp.108.133926.\u003c/li\u003e\n\u003cli\u003eLi W, Asada Y, Yoshikawa T (1998) Antimicrobial flavonoids from\u003cem\u003e Glycyrrhiza glabra\u003c/em\u003e hairy root cultures. Planta Med 64:746\u0026ndash;747. https://doi.org/10.1055/s-2006-957571.\u003c/li\u003e\n\u003cli\u003eLi J, Wang J, Li J, et al (2016a) Protein elicitor isolated from \u003cem\u003eEscherichia coli\u003c/em\u003e induced bioactive compound biosynthesis as well as gene expression in \u003cem\u003eGlycyrrhiza uralensis\u003c/em\u003e Fisch adventitious roots. RSC Adv. 6(112):111622\u0026ndash;111631. https://doi.org/10.1039/C6RA16903A.\u003c/li\u003e\n\u003cli\u003eLi Y, Yu C, Qiao J, et al (2016b) Effect of exogenous phytohormones treatment on glycyrrhizic acid accumulation and preliminary exploration of the chemical control network based on glycyrrhizic acid in root of \u003cem\u003eGlycyrrhiza uralensis\u003c/em\u003e. Rev Bras Farmacogn 26:490\u0026ndash;496. https://doi.org/10.1016/j.bjp.2016.02.009.\u003c/li\u003e\n\u003cli\u003eLiang Z, Ma Y, Xu T, et al (2013) Effects of abscisic acid, gibberellin, ethylene and their interactions on production of phenolic acids in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e Bunge hairy roots. PLoS One 8:e72806. https://doi.org/10.1371/journal.pone.0072806.\u003c/li\u003e\n\u003cli\u003eLu J, Liang W, Wei K, et al (2019) Induction of signal molecules and expression of functional genes after Pichia pastoris stimulation in \u003cem\u003eGlycyrrhiza uralensis\u003c/em\u003e Fisch adventitious roots. J Food Biochem 43(4), e12798. https://doi.org/10.1111/jfbc.12798\u003c/li\u003e\n\u003cli\u003eMa\u0026ntilde;ero FJG, Algar E, Martin Gomez MS, et al (2012) Elicitation of secondary metabolism in \u003cem\u003eHypericum perforatum\u003c/em\u003e by rhizosphere bacteria and derived elicitors in seedlings and shoot cultures. Pharm Biol 50:1201\u0026ndash;1209. https://doi.org/10.3109/13880209.2012.664150.\u003c/li\u003e\n\u003cli\u003eManzoor MM, Goyal P, Gupta AP, et al (2020) Chemical and real-time based analysis revealed active gene machinery of glycyrrhizin biosynthesis and its accumulation in the aerial tissues of in-vitro regenerated \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e L. Plant Growth Regul 92:263\u0026ndash;271. https://doi.org/10.1007/s10725-022-00933-7.\u003c/li\u003e\n\u003cli\u003eMatkowski A, Zielińska S, Oszmiański J, Lamer-Zarawska E (2008) Antioxidant activity of extracts from leaves and roots of \u003cem\u003eSalvia iltiorrhiza\u003c/em\u003e Bunge, \u003cem\u003eS. przewalskii\u003c/em\u003e Maxim., and \u003cem\u003eS. verticillata\u003c/em\u003e L. Bioresour Technol 99:7892\u0026ndash;7896. https://doi.org/10.1016/j.biortech.2008.02.013.\u003c/li\u003e\n\u003cli\u003eMehrotra S, Kukreja AK, Khanuja SPS, Mishra BN (2008) Genetic transformation studies and scale up of hairy root culture of \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e in bioreactor. Electron J Biotechnol. 11(2), 69\u0026ndash;75. https://doi.org/10.2225/vol11-issue2-fulltext-6.\u003c/li\u003e\n\u003cli\u003eMen\u0026eacute;ndez E, D\u0026iacute;ez-M\u0026eacute;ndez A, Marcos-Garc\u0026iacute;a M, et al (2016) \u003cem\u003eRhizobium\u003c/em\u003e symbiotic enzyme cellulase CelC2: Properties and Applications. In: New and Future Developments in Microbial Biotechnology and Bioengineering. Elsevier, pp 81\u0026ndash;89. https://doi.org/10.1016/B978-0-444-63507-5.00008-3.\u003c/li\u003e\n\u003cli\u003eMeng X, Zhou J, Sui N (2018) Mechanisms of salt tolerance in halophytes: Current understanding and recent advances. Open life Sci 13:149\u0026ndash;154. https://doi.org/10.1515/biol-2018-0020.\u003c/li\u003e\n\u003cli\u003eNakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant cell Physiol 22:867\u0026ndash;880. https://doi.org/10.1093/oxfordjournals.pcp.a076232.\u003c/li\u003e\n\u003cli\u003eNascimento MHM do, de Ara\u0026uacute;jo DR (2022) Exploring the pharmacological potential of glycyrrhizic acid: From therapeutic applications to trends in nanomedicine. Futur Pharmacol 2:1\u0026ndash;15. https://doi.org/10.3390/futurepharmacol2010001.\u003c/li\u003e\n\u003cli\u003eNasrollahi V, Mirzaie-Asl A, Piri K, et al (2014) The effect of drought stress on the expression of key genes involved in the biosynthesis of triterpenoid saponins in liquorice (\u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e). Phytochemistry 103:32\u0026ndash;37. https://doi.org/10.1016/j.phytochem.2014.03.004.\u003c/li\u003e\n\u003cli\u003eOno NN, Tian L (2011) The multiplicity of hairy root cultures: prolific possibilities. Plant Sci 180:439\u0026ndash;446. https://doi.org/10.1016/j.plantsci.2010.11.012.\u003c/li\u003e\n\u003cli\u003ePastorino G, Cornara L, Soares S, et al (2018) Liquorice (\u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e): A phytochemical and pharmacological review. Phyther Res 32:2323\u0026ndash;2339. https://doi.org/10.1002/ptr.6178. \u003c/li\u003e\n\u003cli\u003ePauwels L, Inz\u0026eacute; D, Goossens A (2009) Jasmonate-inducible gene: what does it mean? Trends Plant Sci 14:87\u0026ndash;91. https://doi.org/10.1016/j.tplants.2008.11.005.\u003c/li\u003e\n\u003cli\u003ePlanchamp C, Glauser G, Mauch-Mani B (2015) Root inoculation with \u003cem\u003ePseudomonas putida\u003c/em\u003e KT2440 induces transcriptional and metabolic changes and systemic resistance in maize plants. Front. Plant Sci. 5:719. https://doi.org/10.3389/fpls.2014.00719.\u003c/li\u003e\n\u003cli\u003eRamirez-Estrada K, Vidal-Limon H, Hidalgo D, et al (2016) Elicitation, an effective strategy for the biotechnological production of bioactive high-added value compounds in plant cell factories. Molecules 21:. https://doi.org/10.3390/molecules21020182.\u003c/li\u003e\n\u003cli\u003eRudrappa T, Neelwarne B, Lakshmanan V, et al (2006) Elicitation of peroxidase activity in genetically transformed root cultures of \u003cem\u003eBeta vulgaris\u003c/em\u003e L. Electron J Biotechnol 9(5):0. https://doi.org/10.4067/S0717-34582006000500006.\u003c/li\u003e\n\u003cli\u003eRuiz-May E, De-la-Pena C, Galaz-Avalos RM, et al (2011) Methyl jasmonate induces ATP biosynthesis deficiency and accumulation of proteins related to secondary metabolism in \u003cem\u003eCatharanthus roseus\u003c/em\u003e (L.) G. hairy roots. Plant cell Physiol 52:1401\u0026ndash;1421. https://doi.org/10.1093/pcp/pcr086.\u003c/li\u003e\n\u003cli\u003eSagisaka S (1976) The occurrence of peroxide in a perennial plant, \u003cem\u003ePopulus gelrica\u003c/em\u003e. Plant Physiol 57:308\u0026ndash;309. https://doi.org/10.1104/pp.57.2.308.\u003c/li\u003e\n\u003cli\u003eSajjalaguddam RR, Paladugu A (2016) Influence of \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e strains and elicitation on hairy root induction and glycyrrhizin production from \u003cem\u003eAbrus precatorius\u003c/em\u003e. J Pharm Sci Res 8:1353\u0026ndash;1357. https://doi.org/10.4103/0973-1296.90411.\u003c/li\u003e\n\u003cli\u003eSeki H, Sawai S, Ohyama K, et al (2011) Triterpene functional genomics in licorice for identification of \u003cem\u003eCYP72A154\u003c/em\u003e involved in the biosynthesis of glycyrrhizin. Plant Cell 23:4112\u0026ndash;4123. https://doi.org/10.1105/tpc.110.082685.\u003c/li\u003e\n\u003cli\u003eSeki H, Tamura K, Muranaka T (2015) P450s and UGTs: key players in the structural diversity of triterpenoid saponins. Plant Cell Physiol 56:1463\u0026ndash;1471. https://doi.org/10.1093/pcp/pcv062.\u003c/li\u003e\n\u003cli\u003eSelyutina OY, Polyakov NE (2019) Glycyrrhizic acid as a multifunctional drug carrier\u0026ndash;From physicochemical properties to biomedical applications: A modern insight on the ancient drug. Int J Pharm 559:271\u0026ndash;279. https://doi.org/10.1016/j.ijpharm.2019.01.047.\u003c/li\u003e\n\u003cli\u003eShabani L, Ehsanpour AA, Asghari G, Emami J (2009) Glycyrrhizin production by in vitro cultured \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e elicited by methyl jasmonate and salicylic acid1. Russ J Plant Physiol 56:621\u0026ndash;626. https://doi.org/10.1134/S1021443709050069\u003c/li\u003e\n\u003cli\u003eSharma K, Kaur R, Kumar S, et al (2023) Saponins: A concise review on food related aspects, applications and health implications. Food Chem Adv 2:100191. https://doi.org/10.1016/j.focha.2023.100191.\u003c/li\u003e\n\u003cli\u003eShirazi Z, Aalami A, Tohidfar M, Sohani MM (2019) Triterpenoid gene expression and phytochemical content in Iranian licorice under salinity stress. Protoplasma 256:827\u0026ndash;837. https://doi.org/10.1007/s00709-018-01340-4\u003c/li\u003e\n\u003cli\u003eShirazi Z, Aalami A, Tohidfar M, Sohani MM (2018) Metabolic Engineering of Glycyrrhizin Pathway by Over-Expression of Beta-amyrin 11-Oxidase in Transgenic Roots of \u003cem\u003eGlycyrrhiza glabra.\u003c/em\u003e Mol Biotechnol 60:412\u0026ndash;419. https://doi.org/10.1007/s12033-018-0082-7.\u003c/li\u003e\n\u003cli\u003eShkryl YN, Veremeichik GN, Bulgakov VP, et al (2008) Individual and combined effects of the rolA, B, and C genes on anthraquinone production in \u003cem\u003eRubia cordifolia\u003c/em\u003e transformed calli. Biotechnol Bioeng 100:118\u0026ndash;125. https://doi.org/10.1002/bit.21727.\u003c/li\u003e\n\u003cli\u003eSingh R, Kamal S, Rani D, et al (2014) Development of hairy root culture system of \u003cem\u003ePhlogacanthus thyrsiflorus \u003c/em\u003eNees. J Appl Res Med Aromat Plants 1:107\u0026ndash;112. https://doi.org/10.1016/j.jarmap.2014.08.001.\u003c/li\u003e\n\u003cli\u003eSomboon T, Chayjarung P, Pilaisangsuree V, et al (2019) Methyl jasmonate and cyclodextrin-mediated defense mechanism and protective effect in response to paraquat-induced stress in peanut hairy root. Phytochemistry 163:11\u0026ndash;22. https://doi.org/10.1016/j.phytochem.2019.03.017.\u003c/li\u003e\n\u003cli\u003eSrivastava M, Misra P (2017) Enhancement of medicinally important bioactive compounds in hairy root cultures of\u003cem\u003e Glycyrrhiza\u003c/em\u003e, \u003cem\u003eRauwolfia\u003c/em\u003e, and \u003cem\u003eSolanum\u003c/em\u003e through in vitro stress application. Prod Plant Deriv Nat Compd through Hairy Root Cult 117\u0026ndash;132. https://doi.org/10.1007/978-3-319-69769-7_6.\u003c/li\u003e\n\u003cli\u003eSrivastava M, Singh G, Sharma S, et al (2019) Elicitation Enhanced the Yield of Glycyrrhizin and Antioxidant Activities in Hairy Root Cultures of Glycyrrhiza glabra L. J Plant Growth Regul 38:373\u0026ndash;384. https://doi.org/10.1007/s00344-018-9847-2\u003c/li\u003e\n\u003cli\u003eSujatha G, Zdravković-Korać S, Ćalić D, et al (2013) High-efficiency \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e-mediated genetic transformation in \u003cem\u003eArtemisia vulgaris\u003c/em\u003e: hairy root production and essential oil analysis. Ind Crops Prod 44:643\u0026ndash;652. https://doi.org/10.1016/j.indcrop.2012.09.007.\u003c/li\u003e\n\u003cli\u003eTamura K, Seki H, Suzuki H, et al (2017) CYP716A179 functions as a triterpene C-28 oxidase in tissue-cultured stolons of \u003cem\u003eGlycyrrhiza uralensis\u003c/em\u003e. Plant Cell Rep 36:437\u0026ndash;445. https://doi.org/10.1007/s00299-016-2092-x\u003c/li\u003e\n\u003cli\u003eTavassoli P, Safipour Afshar A (2018) Influence of different \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e strains on hairy root induction and analysis of phenolic and flavonoid compounds in marshmallow (\u003cem\u003eAlthaea officinalis\u003c/em\u003e L.). 3 Biotech 8:1\u0026ndash;8. https://doi.org/10.1007/s13205-018-1375-z.\u003c/li\u003e\n\u003cli\u003eThakur M, Bhattacharya S, Khosla PK, Puri S (2019) Improving production of plant secondary metabolites through biotic and abiotic elicitation. J Appl Res Med Aromat Plants 12:1\u0026ndash;12. https://doi.org/10.1016/j.jarmap.2018.11.004.\u003c/li\u003e\n\u003cli\u003eThwe A, Arasu MV, Li X, et al (2016) Effect of different \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e strains on hairy root induction and phenylpropanoid biosynthesis in tartary buckwheat (\u003cem\u003eFagopyrum tataricum\u003c/em\u003e Gaertn). Front Microbiol 7:1\u0026ndash;10. https://doi.org/10.3389/fmicb.2016.00318.\u003c/li\u003e\n\u003cli\u003eTiwari RK, Trivedi M, Guang ZC, et al (2007) Genetic transformation of \u003cem\u003eGentiana macrophylla\u003c/em\u003e with \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e: growth and production of secoiridoid glucoside gentiopicroside in transformed hairy root cultures. Plant Cell Rep 26:199\u0026ndash;210. https://doi.org/10.1007/s00299-006-0236-0.\u003c/li\u003e\n\u003cli\u003eTohma HS, Gul\u0026ccedil;in I (2010) Antioxidant and radical scavenging activity of aerial parts and roots of Turkish liquorice (\u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e L.). Int J Food Prop 13:657\u0026ndash;671. https://doi.org/10.1080/10942911003773916.\u003c/li\u003e\n\u003cli\u003eWang R, Wang H-L, Tang R-P, et al (2020) \u003cem\u003ePseudomonas putida\u003c/em\u003e represses JA-and SA-mediated defense pathways in rice and promotes an alternative defense mechanism possibly through ABA signaling. Plants 9:1641. https://doi.org/10.3390/plants9121641.\u003c/li\u003e\n\u003cli\u003eWongwicha W, Tanaka H, Shoyama Y, Putalun W (2011) Methyl jasmonate elicitation enhances glycyrrhizin production in glycyrrhiza inflata hairy roots cultures. Zeitschrift fur Naturforsch - Sect C J Biosci 66(7-8) https://doi.org/10.1515/znc-2011-7-815.\u003c/li\u003e\n\u003cli\u003eWu J-Y, Ng J, Shi M, Wu S-J (2007) Enhanced secondary metabolite (tanshinone) production of S\u003cem\u003ealvia miltiorrhiza\u003c/em\u003e hairy roots in a novel root\u0026ndash;bacteria coculture process. Appl Microbiol Biotechnol 77:543\u0026ndash;550. https://doi.org/10.1007/s00253-007-1192-5.\u003c/li\u003e\n\u003cli\u003eXing B, Yang D, Liu L, et al (2018) Phenolic acid production is more effectively enhanced than tanshinone production by methyl jasmonate in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots. Plant Cell, Tissue Organ Cult 134:119\u0026ndash;129. https://doi.org/10.1007/s11240-018-1405-x.\u003c/li\u003e\n\u003cli\u003eYan Q, Shi M, Ng J, Wu JY (2006) Elicitor-induced rosmarinic acid accumulation and secondary metabolism enzyme activities in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e hairy roots. Plant Sci 170:853\u0026ndash;858. https://doi.org/10.1016/j.plantsci.2005.12.004.\u003c/li\u003e\n\u003cli\u003eYang Ying YY, Zheng Hui ZH, He Feng HF, et al (2008) The effects of methyl jasmonate on the flavonoids synthesis in cell suspension culture of \u003cem\u003eGlycyrrhiza inflata\u003c/em\u003e (Leguminosae). Plant Divers 30, 586\u0026ndash;592. https://doi.org/10.3724 SP.J.1143.2008.07326.\u003c/li\u003e\n\u003cli\u003eYousefian S, Lohrasebi T, Farhadpour M, Haghbeen K (2020a) Effect of methyl jasmonate on phenolic acids accumulation and the expression profile of their biosynthesis-related genes in \u003cem\u003eMentha spicata\u003c/em\u003e hairy root cultures. Plant Cell Tissue Organ Cult 142(2):285\u0026ndash;197. https://doi.org/10.1007/s11240-020-01856-9.\u003c/li\u003e\n\u003cli\u003eYousefian S, Lohrasebi T, Farhadpour M, Haghbeen K (2020b) Production of phenolic acids in hairy root cultures of medicinal plant \u003cem\u003eMentha spicata\u003c/em\u003e L. in response to elicitors. Mol Biol Res Commun 9:23\u0026ndash;34. https://doi.org/10.22099/mbrc.2020.36031.1475\u003c/li\u003e\n\u003cli\u003eYousefian Z, Golkar P, Mirjalili MH (2021) Production enhancement of medicinally active coumarin and phenolic compounds in hairy root cultures of \u003cem\u003ePelargonium sidoides\u003c/em\u003e: the effect of elicitation and sucrose. J Plant Growth Regul 40:628\u0026ndash;641. https://doi.org/10.1007/s00344-020-10127-y.\u003c/li\u003e\n\u003cli\u003eYuan M, Ngou BPM, Ding P, Xin X-F (2021) PTI-ETI crosstalk: an integrative view of plant immunity. Curr Opin Plant Biol 62:102030. https://doi.org/10.1016/j.pbi.2021.102030.\u003c/li\u003e\n\u003cli\u003eYuan Y, Huang L, Cui GH, et al (2008) Effect of gibberellins and its synthetic inhibitor on metabolism of tanshinones. Chin J Exp Tradit Med Formulae 14:6\u0026ndash;8. https://doi.org/10.1371/journal.pone.0072806.\u003c/li\u003e\n\u003cli\u003eZehra A, Raytekar NA, Meena M, Swapnil P (2021) Efficiency of microbial bio-agents as elicitors in plant defense mechanism under biotic stress: A review. Curr Res Microb Sci 2:100054. https://doi.org/10.1016/j.crmicr.2021.100054.\u003c/li\u003e\n\u003cli\u003eZhang HC, Liu JM, Lu HY, Gao SL (2009) Enhanced flavonoid production in hairy root cultures of \u003cem\u003eGlycyrrhiza uralensis\u003c/em\u003e Fisch by combining the over-expression of chalcone isomerase gene with the elicitation treatment. Plant Cell Rep 28:12.05\u0026ndash;1213. https://doi.org/10.1007/s00299-009-0721-3.\u003c/li\u003e\n\u003cli\u003eZhang YS, Ye HC, Liu BY, et al (2005) Exogenous GA3 and flowering induce the conversion of artemisinic acid to artemisinin in \u003cem\u003eArtemisia annua\u003c/em\u003e plants. Russ J Plant Physiol 52:58\u0026ndash;62. https://doi.org/10.1007/s11183-005-0009-6.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Licorice, Glycyrrhizin, RT‒PCR, Rhizobium leguminosarum, Pseudomonas putida, PCA-biplot","lastPublishedDoi":"10.21203/rs.3.rs-5241404/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5241404/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eGlycyrrhiza glabra\u003c/em\u003e (licorice) is a valuable and endangered medicinal plant recognized for its rich saponin content, particularly glycyrrhizin. Hairy root culture offers a sustainable alternative for continuous glycyrrhizin production while preserving the species' biodiversity. This study aimed to determine the most effective \u003cem\u003eAgrobacterium rhizogenes\u003c/em\u003e strain (ATCC 15834, A4, and A13) for hairy root induction and to assess the influence of \u003cem\u003eRhizobium leguminosarum\u003c/em\u003e (R) and \u003cem\u003ePseudomonas putida\u003c/em\u003e (P) on glycyrrhizin and saponin production. Additionally, the combined effects of the most efficient biotic elicitor with methyl jasmonate (MeJA) and gibberellin (GA) on the phytochemical and physiological responses of licorice hairy roots were investigated. The expression of genes related to glycyrrhizin biosynthesis was also analyzed. The hairy root transformation was confirmed in all strains through \u003cem\u003erolB\u003c/em\u003e gene amplification, with strain A13 identified as the most efficient. \u003cem\u003eR. leguminosarum\u003c/em\u003e was more effective than \u003cem\u003eP. putida\u003c/em\u003e in increasing glycyrrhizin and saponin content. Treatments with \u003cem\u003eRhizobium\u003c/em\u003e, MeJA, and GA increased oxidative stress markers, membrane damage, and the activity of enzymatic and non-enzymatic antioxidants. The highest glycyrrhizin and saponin levels were found in the MeJA\u0026times;R and R treatments, respectively. RT‒PCR analysis demonstrated that the gene expression of \u003cem\u003ebAS\u003c/em\u003e, \u003cem\u003eCYP88D6\u003c/em\u003e, and \u003cem\u003eCYP72A154\u003c/em\u003e elevated under MeJA\u0026times;R treatment compared to the control. The PCA-biplot analysis showed that DPPH (IC\u003csub\u003e50\u003c/sub\u003e) and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e levels had the most difference in assayed traits. In summary, the MeJA\u0026times;R combination may activate a complex signaling network that scavenges ROS, leading to higher glycyrrhizin accumulation and upregulation of its biosynthetic pathway in licorice hairy roots.\u003c/p\u003e","manuscriptTitle":"Phytohormones and microbial elicitation on glycyrrhizin production and gene expression in the hairy root of Glycyrrhiza glabra L.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-21 10:01:33","doi":"10.21203/rs.3.rs-5241404/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-10-17T18:08:40+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-17T16:58:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-17T09:22:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Cell, Tissue and Organ Culture (PCTOC)","date":"2024-10-14T14:56:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"f202c6c5-fdb7-4974-952d-dd5300494549","owner":[],"postedDate":"October 21st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-23T16:07:49+00:00","versionOfRecord":{"articleIdentity":"rs-5241404","link":"https://doi.org/10.1007/s11240-024-02941-z","journal":{"identity":"plant-cell-tissue-and-organ-culture-pctoc","isVorOnly":false,"title":"Plant Cell, Tissue and Organ Culture (PCTOC)"},"publishedOn":"2024-12-18 15:57:59","publishedOnDateReadable":"December 18th, 2024"},"versionCreatedAt":"2024-10-21 10:01:33","video":"","vorDoi":"10.1007/s11240-024-02941-z","vorDoiUrl":"https://doi.org/10.1007/s11240-024-02941-z","workflowStages":[]},"version":"v1","identity":"rs-5241404","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5241404","identity":"rs-5241404","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.