Improved specificity of a probe-based real-time PCR for the detection of Dirofilaria immitis in canine blood

Improved specificity of a probe-based real-time PCR for the detection of Dirofilaria immitis in canine blood | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Improved specificity of a probe-based real-time PCR for the detection of Dirofilaria immitis in canine blood Maureen A. Kelly, Tiana L. Sanders, Alexa Starnes, Emily Orr, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8379526/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Background Dirofilaria immitis is a vector-borne filarioid nematode distributed worldwide and endemic across most of North America. In dogs, it is considered the most important parasite and a known cause of acquired cardiomyopathy. Clinically, canine heartworm disease can manifest acutely as caval syndrome and chronically as heart failure, often resulting in death. Different types of diagnostic tests, such as antigen-detection and microfilariae-detection tests (MFDTs), including modified Knott’s test and molecular assays, may be used to diagnose D. immitis infection. Although some molecular tools, such as qPCR, exhibit high sensitivity, cross-reactivity with other Dirofilaria species found in companion animals remains a concern. Following our lab’s previously published protocol, cross-reactivity was found with Dirofilaria striata isolated from a subcutaneous nodule of a cat from Texas. The objectives of this study were to (I) evaluate the performance of three newly designed probe-based qPCR assays for detecting D. immitis and (II) assess overall detection with the newly designed protocols compared with the previously published protocol and other diagnostic tests. Methods We designed three new probes using accessioned D. immitis cytochrome c subunit 1 sequences from various countries worldwide to increase specificity. These new probes were then tested with genomic DNA extracted from D. immitis and D. striata. Following this, we further assessed the performance of these newly designed probes and previously developed probe using 136 archival shelter dog samples previously found positive for D. immitis by at least one diagnostic test. Results Out of the three probes tested, two (probe 2 and probe 3) specifically detected D. immitis and showed no cross-reactivity with D. striata. Probe 3 showed the highest prevalence among all qPCR assays (68.4%; n = 93/136), followed by the original probe (66.9%; n = 91/136), with probe 2 (59.6%; n = 81/136) with the lowest. We analyzed agreement between probes using Cohen’s kappa (κ) statistic, which indicated almost perfect agreement between probe 3 and the previously published probe (κ = 0.86). We also evaluated other heartworm diagnostic methods performed on the shelter dog samples; these included the modified Knott’s test, which was positive for 61.0% (n = 83/136) of the positive samples, and the previously published qPCR, which was positive for 66.9% (n = 91/136) of samples. All samples were also tested in parallel with a commercially available antigen detection test (DiroCHEK®), yielding 80.1% positivity pre-heat treatment (n = 109/136) and 94.9% post-heat treatment (n = 129/136). The highest positivity of the molecular diagnostic tests was probe 3 paired with post-heat treatment (97.1%; n = 132/136). Conclusion This optimized probe-based qPCR assay (probe 3) provides an accurate and reliable method to detect D. immitis microfilariae in dogs and other carnivore hosts. Antigen detection Canine vector-borne diseases Dogs Dirofilaria immitis Heartworm disease Microfilariae detection test Real-time PCR Figures Figure 1 Figure 2 Background Dirofilariasis, which is caused by filarial nematodes of the genus Dirofilaria , is a growing concern for veterinary and medical communities. These parasites can result in zoonotic infections and are found worldwide [ 1 – 5 ]. With the Companion Animal Parasite Council (CAPC) and the American Heartworm Society (AHS) reporting a higher prevalence of dirofilariasis in the United States (US), accurate diagnostics for identifying infected dogs are essential [ 6 , 7 ]. Dirofilaria immitis (Spirurida: Onchocercidae) is the causative agent of canine heartworm disease and is the most significant filarial nematode in veterinary medicine, primarily infecting dogs [ 1 , 7 , 8 ]. Heartworm is now well-established across nearly the entire world, particularly in tropical and subtropical regions, where its prevalence is higher [ 7 – 16 ]. This vector-borne pathogen is transmitted by over 20 mosquito genera [ 10 , 17 – 20 ]. In the US, mosquitoes known to vector D. immitis include species in the genera Aedes , Anopheles , and Culex [ 14 , 21 – 24 ]. Studies also show that many other animals are susceptible hosts, including cats, ferrets, coyotes, and wolves [ 7 , 8 , 25 – 32 ]. Clinical signs of canine heartworm disease vary from subclinical or mild symptoms like coughing and activity intolerance to more severe clinical manifestations such as dyspnea, respiratory distress, and heart failure, which can potentially lead to fatalities [ 7 , 8 , 10 ]. Humans are considered accidental hosts and can develop pulmonary dirofilariasis, characterized by a “coin lesion” within the pulmonary artery [ 3 , 7 , 8 , 33 – 36 ]. The current recommendations for diagnosing D. immitis include performing two tests in parallel: a serology-based test and a microfilariae detection test (MFDT) [ 6 , 7 , 37 ]. Many commercially available serology tests target the antigen produced by the reproductive tract of adult females [ 7 , 38 – 40 ]. These tests are generally more sensitive than MFDT in large-scale screening studies for detecting the status of heartworm infection in canines [ 16 , 27 , 41 – 45 ]. However, false-negative results can occur when circulating antigens bind the dog’s antibodies, forming immune complexes that hinder detection by standard serological assays [ 46 – 53 ]. Heat treatment has been successful in immune-complex dissociation (ICD) for heartworm antigen detection [ 46 – 48 , 51 – 54 ]. However, it can cause cross-reactivity with other parasites such as Dirofilaria repens , Angiostrongylus vasorum , and Spirocerca lupi , which are known to infect dogs [ 55 – 58 ]. Microscopy-based techniques such as direct smears, modified Knott's tests, and microfilariae filtration tests are commonly used as MDFTs [ 7 ]. Of these, a direct smear can be most easily applied in a clinical setting [ 7 , 16 , 37 – 39 , 59 ]. Yet, many of these methods have disadvantages, including the need for extensive laboratory training to distinguish co-infection with multiple species, heavy labor intensity, and an increased risk of false negatives, especially when microfilariae may not be present in subclinical or early-stage infections [ 16 , 38 , 60 ]. The development of molecular diagnostics, such as conventional PCR (cPCR) and real-time PCR (qPCR), has significantly improved the detection of microfilariae, especially in suspected infections, subclinical cases, and large-scale epidemiological studies in dogs and cats [ 14 , 16 , 45 , 53 , 54 , 60 – 63 ]. This highlights the need to develop highly sensitive and specific molecular techniques for rapid detection and accurate identification of D. immitis microfilariae. Improved molecular tests can be easily integrated into screening studies for D. immitis and provide updated prevalence values in endemic and non-endemic regions. It would be ideal to conduct large-scale screening studies in companion animals to assess prevalence in endemic and non-endemic regions. To achieve this, we must ensure that molecular assays are specific enough to distinguish D. immitis from other filarial nematodes that may be present in the blood of both hosts, such as Dirofilaria striata. Therefore, the objectives of this study were to first evaluate the sensitivity and specificity of three newly designed qPCR probes for detecting D. immitis. Then, compare the overall detection of these new protocols alongside our previously published qPCR protocol [ 16 ] and other diagnostic tests commonly used for microfilariae and antigen detection. Methods Optimization of qPCR Dirofilaria striata sample collection Filarial nematode fragments were recovered from a 3-year-old male domestic short-haired cat at the Texas A&M Veterinary Medicine Diagnostic Laboratory. The fragments were collected from a wound in the interscapular area and preserved in formalin before being sent to the Texas A&M University Parasitology Diagnostic Laboratory. Once received, morphological identification was not possible; therefore, genomic DNA was extracted using the QIAamp ® DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Subsequently, DNA was screened with cPCR targeting the mitochondrial cytochrome c oxidase subunit 1 ( cox1 ) gene fragment [61]. The amplified products were purified using the Cycle Pure E.Z.N.A. ® Kit (Omega BioTek, Norcross, GA, USA) and then sent directly for Sanger sequencing (Eurofins, Louisville, Kentucky, USA), yielding both forward and reverse sequences. After confirming D. striata via sequence alignment in MEGA X, it was submitted to GenBank (Accession: PX315770) [64]. Design and development of three probes Recently, Negron et al. [16] optimized a probe developed as an alternative to the modified Knotts test [60]. The clinical sample described above was tested using the optimized protocol under standard cycling conditions [16] and exhibited cross-reactivity, requiring further optimization. We designed three TaqMan ® probes using Primer Express Software (ThermoFisher Scientific Inc., Waltham, Massachusetts, USA) within the same targeted cox1 region as the probe utilized in Negron et al. [16], which will be referred to as the “original probe” throughout. We then tested all four probes (i.e., original probe [16], probe 1, probe 2, and probe 3) in combination with forward and reverse primers designed by Laidoudi et al. [60] (Table 1). Each probe/primer set was tested using DNA from a D. immitis adult female specimen and from D. striata adult fragments. Probes that did not cross-react were further assessed by standard curve analysis to determine the limit of detection (LOD) for DNA from adult specimens and microfilariae-infected canine whole blood. This involved performing ten-fold dilutions using two D. immitis sample types: an adult female specimen (2600 pg/μL) and whole blood from an experimentally infected dog with high microfilariae levels (12000 pg/μL). Implementation of new probe-based qPCRs Sample collection To test the accuracy of the newly developed assays, frozen, archival whole blood samples (n=136) from domestic dogs ( Canis lupus familiaris ) collected between February 2020 and June 2023 were selected. All samples included in the study were collected from three shelters in Brazos County (n=133) and Harris County (n=3), Texas, USA. The collection method of these samples was described in Negron et al. [16]. The original qPCR probe, the modified Knott’s test, DiroCHEK ® pre-ICD, and DiroCHEK ® post-ICD were evaluated for each blood sample in the study by Negron et al., [16]. Each sample tested positive for at least one test. In addition to the newly designed qPCR probes, the only diagnostic repeated on the selected samples was the original qPCR probe optimized by Negron et al. at standard cycling conditions [16]. Genomic DNA extraction and qPCR Prior to DNA extraction, 200 μL of whole blood was placed in a thermomixer (37 °C) at 350 RPM overnight. Genomic DNA was extracted using the QIAamp ® DNA Mini Blood Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. All extracted DNA was stored at -20 °C until analysis. All samples (n=136) were screened for D. immitis using the original qPCR probe [16] along with the newly optimized probes. The assay target was a 166-bp fragment of the cox1 region, initially designed by Laidoudi et al. [60]. The layout of each plate included duplicate samples for each probe/primer combination tested (Additional file 1: Fig. S1). We also included positive and negative controls in single-well reactions, with duplicate no-template controls for each set. All reactions were performed in a 20 µL volume containing 3.5 µL of molecular-grade water, 0.5 µL (50 µM) of each primer, 0.5 µL (20 µM) of probe, 10 µL of 2x TaqMan ® Fast Advance Master Mix (Applied Biosystems, Waltham, MA, USA), and 5 µL of DNA template. All qPCR reactions were run on a QuantStudio™ 3 real-time PCR system (Applied Biosystems, Waltham, MA, USA). Each run included the following standard cycling conditions: a denaturation step at 95 °C for 2 minutes, followed by 40 cycles of two-step PCR with denaturation at 95 °C for 1 second and annealing at 60 °C for 20 seconds, with a total run time of 43 minutes. The positive control consisted of DNA extracted from an adult D. immitis specimen, confirmed both morphologically and molecularly. In contrast, the negative control contained whole blood DNA from a dog negative for D. immitis , as confirmed by microscopy and molecular testing. The no-template control was nuclease-free molecular water. The qPCR results were analyzed using Design & Analysis 2 software to determine the presence or absence of D. immitis within each well (Applied Biosystems, Waltham, MA, USA). Data Analysis Statistical analyses were conducted using STATA ® version 19.5 BE-Basic Edition (College Station, TX, USA). Descriptive statistics and analyses of positivity across all diagnostic tests were summarized in tables. The correlation between microfilariae counts in each modified Knott’s test and the cycle threshold (Ct) values of each qPCR protocol was evaluated. Additionally, Cohen’s Kappa (κ) was calculated for each pair of diagnostic tests to assess the level of agreement [65–67]. The agreement levels were classified as follows: κ≤0, no agreement; κ=0.01-0.2, slight agreement; κ=0.21-0.4, fair agreement; κ=0.41-0.6, moderate agreement; κ=0.61-0.8, substantial agreement; κ=0.81-1.0, almost perfect [65–67]. We applied Cochran’s Q test to evaluate whether there were differences in the proportions positive across the six diagnostic tests (probe 2, probe 3, the original qPCR probe, the modified Knott’s test, DiroCHEK ® pre-ICD, and DiroCHEK ® post-ICD). Probe 1 was not evaluated due to cross-reactivity. Subsequently, we performed Cochran’s Q test on all 15 combined diagnostic pairs and evaluated each set in parallel. Each test was followed by a post hoc analysis using McNemar’s test to compare diagnostic tests pairwise, with the Bonferroni correction applied to control for multiple comparisons. A p -value of ≤0.05 was considered statistically significant unless otherwise adjusted. Results Optimization of qPCR Following preliminary testing, the original qPCR protocol [16] cross-reacted with the D. striata specimen identified above. This led to the design of three new probes that were compatible with the same primer set. We then tested all three probes in duplicate and found that probe 1 detected both D. immitis and D. striata , whereas probes 2 and 3 detected only D. immitis . Following a ten-fold standard curve, the LOD of probe 2 and probe 3 was 1300 fg and 130 fg for adult specimens, respectively (Fig. 1). In contrast, in whole blood infected with D. immitis microfilariae, the LOD was 6000 fg for both P2 and P3 (Fig. 2). Probe 2 and probe 3 were selected to be utilized in the second objective of this study. Implementation of new probe-based qPCRs The results of each diagnostic test, individually and paired (positive in test 1, test 2, or both), are summarized in Table 2. Following the screening of previously tested whole blood DNA (n=136), the highest positivity was in probe 3 (n=93/136; 68.4%), followed by the original probe [16] (n=91/136; 66.9%), with the lowest positivity in probe 2 (n=81/136; 59.6%). No significant correlation was found between microfilariae counts and Ct values for any probes (Additional file 1: Figs. S2, S3, S4). The microfilariae of D. immitis ranged from 1 to 88,803 per mL, with an average of 15,698 mf/mL. In Table 3, Cohen’s Kappa showed almost perfect agreement between MFDTs, with the original probe + probe 3 (κ=0.86) followed by modified Knott’s/probe 2 (κ=0.84) and the original probe/ probe 2 (κ=0.84). We also found a substantial agreement between probe 2/probe 3 (κ=0.81), modified Knott’s/original probe (κ=0.68), and modified Knott’s/probe 3 (κ=0.67). We found a slight agreement when DiroCHEK ® post-ICD was compared with all three molecular MFDTs — the original probe (κ=0.11), probe 3 (κ=0.07), and probe 2 (κ=0.07) — and a poor agreement with the modified Knott’s test (-0.06). A significant difference was observed for the Cochran’s Q test comparing the six diagnostic tests ( p <0.001) (Table 4). In the post-hoc analysis with a Bonferroni correction, differences remained significant for multiple diagnostic comparisons, including the modified Knott’s/pre-ICD ( p <0.001) and modified Knott's/post-ICD ( p <0.001) (Table 5). We also found significant differences between the original probe/probe 2 (p=0.002) and between probe 2/probe 3 ( p <0.001). Finally, we observed a significant difference when each qPCR (original probe, probe 2, and probe 3) was evaluated with pre-ICD and post-ICD (Table 5). For paired diagnostic tests, Cochran’s Q test revealed that all 15 combinations were statistically significant ( p <0.001) (Table 6). Post hoc McNemar tests indicated that molecular MFDTs (i.e., the original probe, probe 2, and probe 3) were statistically significant when paired with an antigen detection test (pre- or post-ICD), as opposed to pairing with a microscopy-based MFDT (i.e., modified Knott’s test) (Table 7). Among all probes compared in this study, probe 3 consistently showed a significant difference when paired with an antigen detection test, especially with post-ICD applied, indicating a substantial difference in detecting D. immitis. Discussion We designed a highly sensitive and specific probe-based qPCR protocol capable of detecting D. immitis within whole blood, serving as an additional confirmatory test for MFDTs. Based on current recommendations, to determine if a dog is positive for D. immitis , two diagnostic modalities must be performed in parallel: an antigen detection test and MFDT [ 7 , 8 , 68 ]. This combined protocol increases diagnostic sensitivity and allows detection of infections that might otherwise be missed, including amicrofilaremic cases, infections with fewer than three females, infections with only juvenile females, male-only infections, and cases with antibody-antigen complex formations [ 7 , 8 , 68 ]. In this study, we further optimized a protocol initially designed by Laidoudi et al. [ 60 ] and subsequently refined with fast universal cycling parameters by Negron et al. [ 16 ]. Additionally, within Negron et al. [ 16 ], the original criteria for selecting shelter dog samples were the absence of preventive macrocyclic lactone use and an estimated age greater than 6 months. In the current study, we applied more specific inclusion criteria, requiring a positive result in at least one diagnostic test (modified Knotts, qPCR assay, DiroCHEK® pre-, DiroCHEK® post-ICD) previously performed. After incorporating the selected, newly designed probe (probe 3), our modified assay detected two additional positives (n = 93/136) that were initially missed by the original protocol (n = 91/136) [ 16 ]. This highlights that the new assay is reliable for detecting microfilariae in whole blood and can be utilized in future epidemiological investigations. Compared with the original probe [ 16 ], probe 3 showed nearly perfect agreement. However, when comparing the previously published protocol [ 16 ] to probe 2, they were statistically different. Overall, we found that probe 2 detected fewer positive samples than all other probes, suggesting it is not highly reliable for this optimized protocol when combined with antigen detection as recommended [ 6 , 7 , 8 ]. In contrast, probe 3 aligns more closely with the original protocol [ 16 ] while providing higher sensitivity for detecting D. immitis microfilariae DNA in blood, especially in suspected, inconclusive cases, without cross-reacting with other filarial nematodes. This would ultimately lead to false-positive results and require costly treatment for the owner and unnecessary discomfort for the dog. Upon closer examination of the sampled population, we identified a subset of dogs (n = 15) that tested negative with the modified Knotts test. However, this same subset was positive via qPCR with probe 3 (n = 15/15) and was also positive under the previous qPCR protocol (n = 11/15) [ 16 ]. It is also worth noting that, among these 15 samples, the majority tested positive for antigens both pre-ICD (n = 13/15) and post-ICD (n = 14/15). These results highlight how inconclusive and discordant results may arise in practice, potentially delaying treatment decisions or leading to undiagnosed infections [ 7 , 8 ]. Collectively, these findings suggest that incorporating DNA-based methodology in detecting D. immitis microfilariae is important, as they offer higher sensitivity and specificity, which are critical for accurate confirmation. Currently, heat treatment is not widely recommended due to the risk of false positives when detecting circulating antigens produced by other parasites, such as D. repens , A. vasorum , and S. lupi [ 55 – 58 ]. Additionally, new resources are constantly developed and updated to aid in determining when to use heat treatment for immune complex dissociation during annual D. immitis testing when an inconclusive result is determined [ 42 , 50 , 69 ]. However, in this study, the highest positive pairing of antigen and molecular based MFDT was observed with probe 3 + DiroCHEK® post-ICD (n = 132/136; 97.1%). This led to further evaluation of potential cross-reactivity with these parasites, which are known to produce false positives. We could not, however, assess this qPCR protocol due to limited DNA availability; instead, we evaluated it using bioinformatics in MEGA X [ 64 ] to assess potential amplification in this DNA-based test (Additional file 1: Fig. S5 ). Among these species, D. repens is the most likely to cross-react, as it is known to be co-endemic with D. immitis in regions such as Europe, Africa, Asia, and, more recently, South America, but has not yet been unequivocally confirmed in the US [ 8 , 45 , 70 – 75 ]. While adults of D. repens are found in subcutaneous tissues, microfilariae circulate in the blood, similar to D. immitis , requiring similar confirmation techniques [ 7 , 8 , 33 , 37 , 57 ]. Conversely, A. vasorum and S. lupi produce first-stage larvae and eggs, respectively, which can be identified by fecal tests, such as the Baermann technique or fecal flotation [ 37 ]. Recently, A. vasorum was locally acquired in a dog in Oregon, along with cases in wildlife such as red foxes, coyotes, and black bears [ 76 , 77 ]. Similarly, S. lupi was documented in domestic dogs and wild carnivores in the US, including Texas [ 78 , 79 , 80 , 81 ]. These biological and epidemiological factors further support the minimal likelihood of cross-reactivity with this qPCR assay. The two additional positives would not have been found if we had not also identified cross-reactivity with D. striata , a filarioid nematode commonly reported in the blood of wild felids [ 82 , 83 ]. Dirofilaria striata is a parasite documented in North America, but has limited biological and epidemiological information available. The life cycle is suspected to be similar to that of D. immitis , with mosquito species ( Anopheles quadrimaculatus ) required for transmission of the third-stage larvae [ 83 ]. This skin-dwelling filarial nematode has been associated with felids, specifically domestic cats in Florida [ 84 ] and bobcats in Louisiana and Texas [ 82 , 83 ]. There has been only one documented case of D. striata microfilariae found in a dog residing in Florida with travel history from Ohio [ 85 ]. Considering these factors, we improved the diagnostic sensitivity and specificity of this assay to avoid cross-reactivity with D. striata , enabling its potential use in large-scale epidemiological studies to determine the prevalence of D. immitis in both dogs, cats, and wild reservoir hosts. In a clinical setting, molecular assays, such as conventional and real-time PCR, may not be easily integrated, as each technique requires adequate personnel training, specialized reagents, and equipment. These requirements can be costly for clinics with limited funding sources and staffing difficulties. Therefore, this qPCR assay would be ideal for confirmatory testing when inconclusive results are obtained and can be performed by reference and diagnostic laboratories as a “send-out” option. Molecular assays can also be used to test D. immitis in other susceptible hosts, such as cats, wild animals, and marine life [ 26 , 30 , 86 – 91 ]. These hosts may play a role in transmitting the infection to surrounding definitive hosts, especially in high-risk areas [ 92 , 93 ]. The detection of microfilariae is not as easily confirmed in cats as in dogs; it is suspected that the cat’s immune system can control microfilariae and that they are unlikely to be detected using the same diagnostics as in dogs [ 8 , 28 , 94 , 95 ]. This aspect was not evaluated in the current study because we did not have microfilariae-positive blood from a cat during the optimization process. However, if this protocol was used and amplification was detected, it is crucial to follow the AHS feline guidelines [ 94 ]. As stated in these guidelines, it is recommended to perform additional testing, such as antigen detection with heat treatment and antibody detection, to confirm heartworm infection rather than treating it as a false-positive in a cat or suspecting a D. striata infection [ 8 , 32 , 54 , 94 – 98 ]. Another approach to incorporating this assay is in large-scale studies, where it can be combined with commercially available serology tests to perform antigen and MFDT testing in parallel [ 13 , 14 , 16 , 27 , 45 , 94 , 97 ]. This would allow the use of optimized, accurate MFDT in combination with a serology-based test, thereby increasing the likelihood of detecting low-level D. immitis infections. Molecular assays, such as probe-based qPCRs, are ideal for providing cost-effective, low-intensity, rapid results while facilitating easy implementation for inconclusive cases in reference laboratory facilities and large-scale research [ 16 , 30 , 45 , 60 , 63 ]. As highlighted in our study, there may be also disadvantages, including the potential for cross-reaction with other closely related nematode species. However, this can be avoided by incorporating in silico bioinformatics, combined with benchtop testing DNA of other filarioid nematodes, which enables real-time testing for specificity, depending on the availability of DNA. As with microscopy-based techniques, morphological characterization of microfilariae requires intensive training and extensive assessment. This is neither ideal nor possible within a clinical setting. An advantage of using molecular assays is the ability to include other molecular markers, such as Wolbachia , which enables the potential detection of D. immitis and co-infecting species (e.g., Acanthocheilonema reconditum and D. repens ) [ 60 , 100 ]. This will, in turn, require less sample collection, while providing results for other companion animal parasites that are less pathogenic but can cause health issues. Overall, we have provided an optimized protocol that can be used as an additional confirmatory MFDT and implemented in large-scale studies of both dogs and cats in combination with commonly performed serological-based tests. Conclusions In the present study, we improved a probe-based qPCR method previously published by our lab. We found that increased sensitivity enabled the detection of two additional positives that were not previously identified, while also limiting cross-reactivity with D. striata , a closely related filarioid nematode species. This protocol presents an additional microfilariae detection test and a confirmatory test for cases in which viable options are available in subclinical or inconclusive routine diagnostics and can be easily implemented in large-scale screening studies. Declarations Acknowledgements We want to thank Aggieland Humane Society, Bryan Animal Center, and Houston SPCA for providing the blood and serum samples used in this study. We also like to thank every student and technician who aided in sample collection, sample preparation, and data analysis. Author contributions MAK: Technical writing —original draft, data curation, formal analysis, laboratory optimization, methodology validation, and statistical analysis. TLS: Technical writing —review and editing, methodology validation, formal analysis. AS: Technical writing —review and editing, data curation. EO: Technical writing —review and editing, data curation, laboratory optimization. JLL: Technical writing —review and editing, data curation. CS: Technical writing —review and editing, data curation, formal analysis. HH: Technical writing —review and editing, data curation, formal analysis, laboratory optimization, supervision. PW: Technical writing —review and editing, data curation, formal analysis, laboratory optimization, supervision. CMB: statistical analysis, supervision, and technical writing. GGV: conceptualization, funding, supervision, technical writing —review and editing, visualization. Funding sources This study received no additional support. Data availability Data supporting the main objectives and conclusions are presented in the manuscript and supplementary files. Ethical approval and consent to participate All samples collected complied with the animal use protocols approved by Texas A&M University’s Institutional Animal Care and Use Committee under the number 2022-0261. Consent to publication All authors consent to publication. Competing interests The authors declare no competing interests. Author details 1 Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, 77843, USA. 2 Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, 19104, USA. 3 Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, 66506, USA. 4 Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, 77843, USA References Dantas-Torres F, Otranto D. Dirofilariosis in the Americas: a more virulent Dirofilaria immitis ? Parasit Vectors. 2013;6 1:288; doi: 10.1186/1756-3305-6-288. Genchi C, Kramer LH. The prevalence of Dirofilaria immitis and D. repens in the Old World. Vet Parasitol. 2020;280:108995; doi: 10.1016/j.vetpar.2019.108995. Perles L, Dantas-Torres F, Krücken J, Morchón R, Walochnik J, Otranto D. Zoonotic dirofilariases: one, no one, or more than one parasite. Trends Parasitol. 2024;40 3:257-70; doi: 10.1016/j.pt.2023.12.007. Wang D, Bowman DD, Brown HE, Harrington LC, Kaufman PE, Mckay T, Nelson CH, Sharp JL, Lund R. Factors influencing U.S. canine heartworm ( Dirofilaria immitis ) prevalence. Parasit Vectors. 2014;7 1:264; doi: 10.1186/1756-3305-7-264. Geary TG. New paradigms in research on Dirofilaria immitis . Parasit Vectors. 2023;16 1; doi: 10.1186/s13071-023-05762-9. Companion Animal Parasite Council: Canine Parasite Prevalence Maps (United States).https://capcvet.org/maps/#/ (2025). Accessed 11 August 2025. Nelson CT, McCall JW, Moorhead A, Starkey LA, Ames M: American Heartworm Society: Current canine guidelines for prevention, diagnosis, and management of heartworm ( Dirofilaria immitis ) infection in dogs.Available at: https://www.heartwormsociety.org/ (2024). Accessed June 14 2024. McCall JW, Genchi C, Kramer LH, Guerrero J, Venco L. Heartworm disease in animals and humans. Adv Parasitol. 2008;66:193-285; doi: 10.1016/s0065-308x(08)00204-2. Dantas-Torres F, Ketzis J, Mihalca AD, Baneth G, Otranto D, Tort GP, et al. TroCCAP recommendations for the diagnosis, prevention and treatment of parasitic infections in dogs and cats in the tropics. Vet Parasitol. 2020;283:109167; doi: 10.1016/j.vetpar.2020.109167. Bowman DD, Atkins CE. Heartworm Biology, Treatment, and Control. Vet Clin North Am Small Anim Pract. 2009;39 6:1127-58; doi: 10.1016/j.cvsm.2009.06.003. Rojas A, Rojas D, Montenegro VM, Baneth G. Detection of Dirofilaria immitis and other arthropod-borne filarioids by an HRM real-time qPCR, blood-concentrating techniques and a serological assay in dogs from Costa Rica. Parasit Vectors. 2015;8 1; doi: 10.1186/s13071-015-0783-8. Tahir D, Bittar F, Barré-Cardi H, Sow D, Dahmani M, Mediannikov O, et al. Molecular survey of Dirofilaria immitis and Dirofilaria repens by new real-time TaqMan(®) PCR assay in dogs and mosquitoes (Diptera: Culicidae) in Corsica (France). Vet Parasitol. 2017;235:1-7; doi: 10.1016/j.vetpar.2017.01.002. Torres-Chable OM, Baak-Baak CM, Cigarroa-Toledo N, Blitvich BJ, Brito-Argaez LG, Alvarado-Kantun YN, et al. Molecular detection of Dirofilaria immitis in dogs and mosquitoes in Tabasco, Mexico. J Vector Borne Dis. 2018;55 2:151-8; doi: 10.4103/0972-9062.242563. Scavo NA, Zecca IB, Sobotyk C, Saleh MN, Lane SK, Olson MF, et al. High prevalence of canine heartworm, Dirofilaria immitis , in pet dogs in south Texas, USA, with evidence of Aedes aegypti mosquitoes contributing to transmission. Parasit Vectors. 2022;15 1; doi: 10.1186/s13071-022-05514-1. Khouri NK, Singh S, Noble SAA, Kirlew TV, Golding MAJ, Ali I, et al. Prevalence of Dirofilaria immitis in dogs in Jamaica. Parasitol Res. 2024;123 12:411; doi: 10.1007/s00436-024-08434-4. Negron V, Saleh MN, Sobotyk C, Luksovsky JL, Harvey TV, Verocai GG. Probe-based qPCR as an alternative to modified Knott’s test when screening dogs for heartworm ( Dirofilaria immitis ) infection in combination with antigen detection tests. Parasit Vectors. 2022;15 1; doi: 10.1186/s13071-022-05372-x. Ledesma N, Harrington L. Mosquito vectors of dog heartworm in the United States: vector status and factors influencing transmission efficiency. Top Companion Anim Med. 2011;26 4:178-85; doi: 10.1053/j.tcam.2011.09.005. Ludlam KW, Jachowski LA, Jr., Otto GF. Potential vectors of Dirofilaria immitis . J Am Vet Med Assoc. 1970;157 10:1354-9. Noack S, Harrington J, Carithers D, S., Kaminsky R, Selzer P, M. Heartworm disease – Overview, intervention, and industry perspective. Int J Parasitol Drugs Drug Resist. 2021;16:65-89; doi: 10.1016/j.ijpddr.2021.03.004. Watts KJ, Courteny CH, Reddy GR. Development of a PCR- and probe-based test for the sensitive and specific detection of the dog heartworm, Dirofilaria immitis, in its mosquito intermediate host. Mol Cell Probes. 1999;13 6:425-30; doi: 10.1006/mcpr.1999.0270. Morchón R, Carretón E, González Miguel J, Mellado Hernández I. Heartworm disease ( Dirofilaria immitis ) and their vectors in Europe – new distribution trends. Front Physiol. 2012;3 - 2012; doi: 10.3389/fphys.2012.00196. Riahi SM, Yusuf MA, Azari-Hamidian S, Solgi R. Prevalence of Dirofilaria immitis in mosquitoes (Diptera) - systematic review and meta-analysis. J Nematol. 2021;53; doi: 10.21307/jofnem-2021-012. Tran TD, Nelms BM, Koschik ML, Scott JJ, Thiemann T. Prevalence of filarial parasites in field-caught mosquitoes in northwestern California. J Vector Ecol. 2022;47 1; doi: 10.52707/1081-1710-47.1.61. Spence Beaulieu MR, Federico JL, Reiskind MH. Mosquito diversity and dog heartworm prevalence in suburban areas. Parasit Vectors. 2020;13 1; doi: 10.1186/s13071-019-3874-0. Villanueva-Saz S, Giner J, Verde M, Yzuel A, Lacasta D, Ruíz H, Basurco A, González A, Marteles D, Fernández A. First serological study of Dirofilaria immitis antibodies in household domestic ferrets ( Mustela putorius furo ) in southern Spain – Short communication. Acta Vet Hung. 2022;70 4:282-6; doi: 10.1556/004.2022.00032. Moroni B, Rossi L, Meneguz PG, Orusa R, Zoppi S, Robetto S, Marucco F, Tizzani P. Dirofilaria immitis in wolves recolonizing northern Italy: are wolves competent hosts? Parasit Vectors. 2020;13 1; doi: 10.1186/s13071-020-04353-2. Barrantes Murillo DF, Moye A, Wang C. Heat Treatment Augments Antigen Detection of Dirofilaria immitis in Apparently Healthy Companion Dogs (3.8% to 7.3%): Insights from a Large-Scale Nationwide Survey across the United States. Pathogens. 2024;13(1):56. doi: 10.3390/pathogens13010056. Mosley IA, Zecca IB, Tyagi N, Harvey TV, Hamer SA, Verocai GG. Occurrence of Dirofilaria immitis infection in shelter cats in the lower Rio Grande Valley region in South Texas, United States, using integrated diagnostic approaches. Vet Parasitol Reg Stud Reports. 2023;41:100871; doi: 10.1016/j.vprsr.2023.100871. Nelson CT. Dirofilaria immitis in cats: diagnosis and management. Compend Contin Educ Vet. 2008;30 7:393-400; quiz Sobotyk C, Nguyen N, Negrón V, Varner A, Saleh MN, Hilton C, et al. Detection of Dirofilaria immitis via integrated serological and molecular analyses in coyotes from Texas, United States. Int J Parasitol Parasites Wildl. 2022;18:20-4; doi: 10.1016/j.ijppaw.2022.03.012. Dantas-Torres F, Otranto D. Overview on Dirofilaria immitis in the Americas, with notes on other filarial worms infecting dogs. Vet Parasitol. 2020;282:109113; doi: 10.1016/j.vetpar.2020.109113. Little SE, Raymond MR, Thomas JE, Gruntmeir J, Hostetler JA, Meinkoth JH, Blagburn BL. Heat treatment prior to testing allows detection of antigen of Dirofilaria immitis in feline serum. Parasit Vectors. 2014;7 1:1; doi: 10.1186/1756-3305-7-1. Mendoza-Roldan JA, Gabrielli S, Cascio A, Manoj RRS, Bezerra-Santos MA, Benelli G, Brianti E, Latrofa MS, Otranto D. Zoonotic Dirofilaria immitis and Dirofilaria repens infection in humans and an integrative approach to the diagnosis. Acta Trop. 2021;223:106083; doi: 10.1016/j.actatropica.2021.106083. Miterpáková M, Antolová D, Rampalová J, Undesser M, Krajčovič T, Víchová B. Dirofilaria immitis pulmonary dirofilariasis, Slovakia. Emerg Infect Dis. 2022;28 2:482-5; doi: 10.3201/eid2802.211963. Montoya-Alonso JA, Carretón E, Corbera JA, Juste MC, Mellado I, Morchón R, Simón F. Current prevalence of Dirofilaria immitis in dogs, cats and humans from the island of Gran Canaria, Spain. Vet Parasitol. 2011;176 4:291-4; doi: 10.1016/j.vetpar.2011.01.011. Simón F, Siles-Lucas M, Morchón R, González-Miguel J, Mellado I, Carretón E, Montoya-Alonso JA. Human and animal dirofilariasis: the emergence of a zoonotic mosaic. Clin Microbiol Rev. 2012;25 3:507-44; doi: 10.1128/cmr.00012-12. Zajac A, Conboy GA, Little SE, Reichard MV. Veterinary Clinical parasitology. Ninth edition. edn. Hoboken, N.J.: Wiley Blackwell; 2021. Pietrzak D, Łuczak JW, Wiśniewski M. Beyond Tradition: Exploring Cutting-Edge Approaches for Accurate Diagnosis of Human Filariasis. Pathogens. 2024;13 6; doi: 10.3390/pathogens13060447. Genchi C, Venco L, Genchi M. Guideline for the laboratory diagnosis of canine and feline Dirofilaria infections. 2007; 137-144. McCall JW, Supakorndej N, Donoghue A, Turnbull RK, Radecki S. Evaluation of the performance of canine heartworm antigen test kits licensed for use by veterinarians and canine heartworm antigen tests conducted by diagnostic laboratories. 2001; 97-104. Starkey LA, Bowles JV, Payton ME, Blagburn BL. Comparative evaluation of commercially available point-of-care heartworm antigen tests using well-characterized canine plasma samples. Parasit Vectors. 2017;10 Suppl 2:475; doi: 10.1186/s13071-017-2447-3. Murillo DFB, Wang C. Pre-treatment of canine plasma with heat, rather than acid, efficiently enhances Dirofilaria immitis antigen detection. Parasit Vectors. 2023;16 1; doi: 10.1186/s13071-023-06083-7. Torres-Chable OM, Brito-Argaez LG, Islas-Flores IR, Zaragoza-Vera CV, Zaragoza-Vera M, Arjona-Jimenez G, Baak-Baak CM, Cigarroa-Toledo N, Gonzalez-Garduño R, Machain-Williams CI, Garcia-Rejon JE. Dirofilaria immitis proteins recognized by antibodies from individuals living with microfilaremic dogs. J Infect Dev Ctries. 2020;14 12:1442-7; doi: 10.3855/jidc.12711. Rjeibi MR, Rouatbi M, Mabrouk M, Tabib I, Rekik M, Gharbi M. Molecular study of Dirofilaria immitis and Dirofilaria repens in dogs from Tunisia. Transbound Emerg Dis. 2017;64 5:1505-9; doi: 10.1111/tbed.12541. Smith R, Murillo DFB, Chenoweth K, Barua S, Kelly PJ, Starkey L, Blagburn B, Wood T, Wang C. Nationwide molecular survey of Dirofilaria immitis and Dirofilaria repens in companion dogs and cats, United States of America. Parasit Vectors. 2022;15 1:367; doi: 10.1186/s13071-022-05459-5. Beall MJ, Arguello-Marin A, Drexel J, Liu J, Chandrashekar R, Alleman AR. Validation of immune complex dissociation methods for use with heartworm antigen tests. Parasit Vectors. 2017;10 S2; doi: 10.1186/s13071-017-2442-8. Gruntmeir JM, Long MT, Blagburn BL, Walden HS. Canine heartworm and heat treatment: An evaluation using a well based enzyme-linked immunosorbent assay (ELISA) and canine sera with confirmed heartworm infection status. Vet Parasitol. 2020;283:109169; doi: 10.1016/j.vetpar.2020.109169. Little SE, Munzing C, Heise SR, Allen KE, Starkey LA, Johnson EM, Meinkoth J, Reichard MV. Pre-treatment with heat facilitates detection of antigen of Dirofilaria immitis in canine samples. Vet Parasitol. 2014;203 1-2:250-2; doi: 10.1016/j.vetpar.2014.01.007. Drake J, Gruntmeir J, Merritt H, Allen L, Little SE. False negative antigen tests in dogs infected with heartworm and placed on macrocyclic lactone preventives. Parasit Vectors. 2015;8 1:68; doi: 10.1186/s13071-015-0698-4. Little S, Saleh M, Wohltjen M, Nagamori Y. Prime detection of Dirofilaria immitis : understanding the influence of blocked antigen on heartworm test performance. Parasit Vectors. 2018;11 1; doi: 10.1186/s13071-018-2736-5. DiGangi BA, Dworkin C, Stull JW, O'Quin J, Elser M, Marsh AE, et al. Impact of heat treatment on Dirofilaria immitis antigen detection in shelter dogs. Parasit Vectors. 2017;10 Suppl 2:483; doi: 10.1186/s13071-017-2443-7. Carmichael J, McCall S, DiCosty U, Mansour A, Roycroft L. Evaluation of Dirofilaria immitis antigen detection comparing heated and unheated serum in dogs with experimental heartworm infections. Parasit Vectors. 2017;10 Suppl 2:486; doi: 10.1186/s13071-017-2445-5. Lane JN, Litster A, Little SE, Rodriguez JY, Mwacalimba KK, Sundstrom KD, Amirian ES, Guerios SD, Serrano MA, Hays KM, Levy JK. Optimizing heartworm diagnosis in dogs using multiple test combinations. Parasit Vectors. 2021;14 1; doi: 10.1186/s13071-021-04715-4. Hays KM, Rodriguez JY, Little SE, Litster AL, Mwacalimba KK, Sundstrom KD, Amondie DM, Serrano MA, Guerios SD, Lane JN, Levy JK. Heartworm prevalence in dogs versus cats: Multiple diagnostic modalities provide new insights. Vet Parasitol. 2020;277s:100027; doi: 10.1016/j.vpoa.2020.100027. Schnyder M, Deplazes P. Cross-reactions of sera from dogs infected with Angiostrongylus vasorum in commercially available Dirofilaria immitis test kits. Parasit Vectors. 2012;5:258; doi: 10.1186/1756-3305-5-258. Sobotyk C, Savadelis MD, Verocai GG. Detection and cross-reaction of Dirofilaria repens using a commercial heartworm antigen test kit. Vet Parasitol. 2021;289:109302; doi: 10.1016/j.vetpar.2020.109302. Venco L, Manzocchi S, Genchi M, Kramer LH. Heat treatment and false-positive heartworm antigen testing in ex vivo parasites and dogs naturally infected by Dirofilaria repens and Angiostrongylus vasorum . Parasit Vectors. 2017;10 Suppl 2:476; doi: 10.1186/s13071-017-2444-6. Aroch I, Rojas A, Slon P, Lavy E, Segev G, Baneth G. Serological cross-reactivity of three commercial in-house immunoassays for detection of Dirofilaria immitis antigens with Spirocerca lupi in dogs with benign esophageal spirocercosis. Vet Parasitol. 2015;211 3-4:303-5; doi: 10.1016/j.vetpar.2015.06.010. Magnis J, Lorentz S, Guardone L, Grimm F, Magi M, Naucke TJ, Deplazes P. Morphometric analyses of canine blood microfilariae isolated by the Knott’s test enables Dirofilaria immitis and D. repens species-specific and Acanthocheilonema (syn. Dipetalonema ) genus-specific diagnosis. Parasit Vectors. 2013;6 1:48; doi: 10.1186/1756-3305-6-48. Laidoudi Y, Davoust B, Varloud M, Niang EHA, Fenollar F, Mediannikov O. Development of a multiplex qPCR-based approach for the diagnosis of Dirofilaria immitis, D. repens and Acanthocheilonema reconditum . Parasit Vectors. 2020;13 1:319; doi: 10.1186/s13071-020-04185-0. Casiraghi M, Anderson TJC, Bandi C, Bazzocchi C, Genchi C. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of Wolbachia endosymbionts. Parasitol. 2001;122 1:93-103; doi: 10.1017/s0031182000007149. Favia G, Lanfrancotti A, della Torre A, Cancrini G, Coluzzi M. Advances in the identification of Dirofilaria repens and Dirofilaria immitis by a PCR-based approach. Parassitologia. 1997;39 4:401-2. Lau DC, Power RI, Šlapeta J. Exploring multiplex qPCR as a diagnostic tool for detecting microfilarial DNA in dogs infected with Dirofilaria immitis : A comparative analysis with the modified Knott's test. Vet Parasitol. 2024;325:110097; doi: 10.1016/j.vetpar.2023.110097. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 2018;35 6:1547-9; doi: 10.1093/molbev/msy096. Dohoo IR, Martin W, Stryhn H. Veterinary epidemiologic research. Second edition. edn. Charlotte, P.E.I.: VER, Inc.; 2009. McHugh ML. Interrater reliability: the kappa statistic. Biochem Med (Zagreb). 2012;22 3:276-82. Cohen J. A Coefficient of Agreement for Nominal Scales. Educational and Psychological Measurement. 1960;20 1:37-46; doi: 10.1177/001316446002000104. Dantas-Torres F, Ketzis J, Mihalca AD, Baneth G, Otranto D, Tort GP, Watanabe M, Linh BK, Inpankaeq T, Jimenez Castro PD, Borrás P, Arumugam S, Penzhorn BL, Ybañez AP, Irwin P, Traub RJ. TroCCAP recommmendations for the diagnosis, prevention and treatment of parasitic infections in dogs and cats in the tropics. Vet. Parasitol. 2020;283:109167; doi: 10.1016/j.vetpar.2020.109167. Murillo DFB, Wang C. Immune-complex dissociation for heatrworm diagnosis. 2024;14:September/October. Dimzas D, Aindelis G, Tamvakis A, Chatzoudi S, Chlichlia K, Panopoulou M, Diakou A. Dirofilaria immitis and Dirofilaria repens : Investigating the prevalence of zoonotic parasites in dogs and humans in a hyperenzootic areas, Animals (Basel). 2024;14(17):2529; doi: 10.3390/ani14172529. Cimpan AA, Baneth G, Nachum-Biala Y, Miron L, Rojas A. Dirofilaria repens predominates in shelter dogs from South Romania. Comp Immunol Microbio Infect Dis. 2022;84:101793; doi: 10.1016/j.cimid.2022.101793. Alsarraf M, Levytska V, Mierzajewska EJ, Poliukhovych V, Rodo A, Alsarraf M, Kavalevich D, Dwużnik-Szarek D, Behnke JM, Bajer A. Emerging of Dirofilaria spp. infection in Northeastern Europe: high prevalence of Dirofilria repens in sled dogs kennels from the Baltic countries. Sci Rep. 2021;11(1):1068; doi: 10.1038/s41598-020-80208-1. Fehr JE, Schnyder M, Joekel DE, Pantchev N, Sarkunas M, Torgerson P, Deplazes P. Estimated specific antibody-based true sero-prevalences of canine filariosis in dogs in Central Europe and the UK. Parasitol Res. 2022;121(12):3671-3680. Doi: 10.1007/s00436-022-07965-1. Ciuca L, Vismarra A, Lebon W, Beugnet F, Morchon R, Rinaldi L, Cringoli G, Kramer L, Genchi M. New insights into the biology, diagnosis and immune response to Dirofilaria repens in the canine host. Vet Parasitol X. 2020;5:4:100029; doi: 10.1016/j.vpoa.2020.100029. 75. Ballesteros N, Castañeda S, Muñoz M, Flórez A, Pinilla JC, Ramírez JD. The first report of Dirofilaria repens infection in dogs from Colombia. Parasitol Res. 2023;122(10)2445-2450; doi: 10.1007?s00436-023-07926-z. Riese K, Baker E, Dennis MM, Williamson R, Gerhold R. Corrigendum to “Two cases of Angiostrongylus vasorum , a cardiopulmonary nematode, in a black bear and coyotes of Tennessee” [Veterinary Parasitology: Regional Studies and Reports, Volume 54, September 2024, 101079]. Vet Parasitol Reg Stud Reports. 2024;55:101101; doi: 10.1016/j.vprsr.2024.101101. Williams LBA, Buswell ML, Perisho NA. First autochthonous case of Angiostrongylus vasorum in a domestic dog in the United States. J Am Vet Med Assoc. 2024;262(10):1-3; doi: 10.2460/javma.24.06.0408. Pence DB, Stone JE. Visceral lesions in wild carnivores naturally infected with Spirocerca lupi . Vet Pathol. 1978;15(3):332-31; doi: 10.1177/030098587801500306. Morrison EE, Gier HT. Parasitic infection of Filaroides osleri , Capillaria aerophila and Spirocerca lupi in coyotes from the Southwestern United States. J Wildl Dis. 1979;15(4):557-9; doi: 10.7589/0090-3558-15.4.557. van der Merwe LL, Kirberger RM, Clift S, Williams M, Keller N, Naidoo V. Spirocerca lupi infection in the dog: a review. Vet J. 2008;176(3):294-309; doi: 10.1016/j.tvjl.2007.02.032. Alfaro-Segura P, Robleto-Quesada J, Montenegro-Hidalgo VM, Molina-Mora JA, Baneth G, Verocai GG, Rodriguez-Vivas RI, Rojas A. Elucidating Spirocerca lupi spread in the Americas by using phylogenetic and phylogeographic analyses. Front. Parasitol. 2:1249593. doi: 10.3389/fpara.2023.1249593. Ramos RAN, Hakimi H, Salomon J, Busselman RE, Curtis-Robles R, Hodo CL, Hamer SA, Verocai GG. Dirofilaria immitis and Dirofilaria striata (Spirurifa: Onchocercidae) detected with wild carnivores from Texas, United States. Int J Parasitol Parasites Wildl. 2024;12:24:100954; doi: 10.1016/j.ijppaw.2024.100954. Orihel TC, Ash LR. Occurrence of Dirofilaria striata in the bobcat ( Lynx rufus ) in Louisiana with observations on its larval development. J Parasitol. 1964;50:590-1; Wyatt D, Santoro D, Deabold K, Gruntmeir J, Childress A, Craft WF, Walden HDS, Wellehan JFX. Subcutaneous nodules and dermatitis associated with non- imimitis non- repens dirofilariosis morphologically consistent with Dirofilaria striata in a 2-year-old male domestic cat in Florida, USA. Vet Q. 2020;40(1):215-222; doi: 10.1080/01652176.2020.1814972. Pacheco G, Tulloch GS. Microfilariae of Dirofilaria striata in a dog. J Parasitol. 1970;56(2):248; Gomes-de-Sá G, Santos-Silva S, Moreira AS, Barradas PF, Amorim I, Cardoso L, Mesquita JR. Dirofilaria immitis antigenemia and microfilariae in Iberian wolves and red foxes from Portugal. Parasit Vectors. 2022;15(1):119; doi: 10.1186/s13071-022-05170-5. Fagundes-Moreira R, Bezerra-Santos MA, May-Junior JA, Berger L, Baggio-Souza V, Souza UA, Bilhalva LC, Reis AO, Wagner PGC, Peters FB, Favarini MO, Albano APN, Sartorello L, Rampim LE, Tirelli FP, Otranto D, Soares JF. Correction to: Dirofilaria immitis and Onchocercidae spp. in wild felids from Brazil. Parasitol Res. 2024;123(5):220. doi: 10.1007/s00436-024-08235-9. Erratum for: Parasitol Res. 2024;123(4):195. doi: 10.1007/s00436-024-08209-x. Naletilić Š, Gagović E, Mihaljević Ž, Polkinghorne A, Beck A, Beck R. Detection of Dirofilaria immitis in golden jackals ( Canis aureus L.) but not in red foxes ( Vulpes vulpes L.) and European badgers ( Meles meles L.) in Croatia. Parasit Vectors. 2024;17(1):490. doi: 10.1186/s13071-024-06576-z. Alho AM, Marcelino I, Colella V, Flanagan C, Silva N, Correia JJ, Latrofa MS, Otranto D, Madeira de Carvalho L. Dirofilaria immitis in pinnipeds and a new host record. Parasit Vectors. 2017;10(1):142. doi: 10.1186/s13071-017-2073-0. Upton KE, Sobotyk C, Edwards EE, Verocai GG. Dirofilaria immitis in an Asian small-clawed otter ( Aonyx cinereus ) from southeastern Louisiana, United States. Vet Parasitol Reg Stud Reports. 2022;29:100703. doi: 10.1016/j.vprsr.2022.100703. Gregory TM, Livingston I, Hawkins EC, Loyola A, Cave A, Vaden SL, Deresienski D, Breen M, Riofrío-Lazo M, Lewbart GA, Páez-Rosas D. Dirofilaria immitis identified in Galapagos Sea Lions ( Zalophus wollebaeki ): A wildlife health and conservation concern. J Wildl Dis. 2023;59(3):487-494. doi: 10.7589/JWD-D-22-00119. Brown HE, Harrington LC, Kaufman PE, McKay T, Bowman DD, Nelson CT, Wang D, Lund R. Key factors influencing canine heartworm, Dirofilaria immitis , in the United States. Parasit Vectors. 2012;5:245. doi: 10.1186/1756-3305-5-245. Bowman DD, Liu Y, McMahan CS, Nordone SK, Yabsley MJ, Lund RB. Forecasting United States heartworm Dirofilaria immitis prevalence in dogs. Parasit Vectors. 2016;9(1):540. doi: 10.1186/s13071-016-1804-y. Nelson CT, McCall JW, Moorhead A, Starkey L, Ames M, Cousins WM. Feline heartworm guidelines. American Heartworm Society; 2024. Available at: https://www.heartwormsociety.org/veterinary-resources/american-heartworm-society-guidelines. Accessed September 25 2025. Murillo DFB, Starkey L, Wood T, Smith R, Blagburn B, Bowles J, Allen H, Lewis C, Shu Y, Wang C. A nationwide serological survey for Dirofilaria immitis in companion cats in the United States of America: 3.5% antibody and 0.3% antigen positivity. Parasit Vectors. 2023;16(1):296. doi: 10.1186/s13071-023-05829-7. Gruntmeir JM, Adolph CB, Thomas JE, Reichard MV, Blagburn BL, Little SE. Increased detection of Dirofilaria immitis antigen in cats after heat pretreatment of samples. J Feline Med Surg. 2017 Oct;19(10):1013-1016. doi: 10.1177/1098612X16670562. Hermesmeyer M, Limberg-Child RK, Murphy AJ, Mansfield LS. Prevalence of Dirofilaria immitis infection among shelter cats. J Am Vet Med Assoc. 2000 Jul 15;217(2):211-2. Villanueva-Saz S, Giner J, Verde M, Yzuel A, González A, Lacasta D, Marteles D, Fernández A. Prevalence of microfilariae, antigen and antibodies of feline dirofilariosis infection ( Dirofilaria immitis ) in the Zaragoza metropolitan area, Spain. Vet Parasitol Reg Stud Reports. 2021;23:100541. doi: 10.1016/j.vprsr.2021.100541. Upton KE, Budke CM, Verocai GG. Heartworm ( Dirofilaria immitis ) in carnivores kept in zoos in Texas, USA: risk perception, practices, and antigen detection. Parasit Vectors. 2023;16(1):150. doi: 10.1186/s13071-023-05750-z. Savadelis MD, Day KM, Bradner JL, Wolstenholme AJ, Dzimianski MT, Moorhead AR. Efficacy and side effects of doxycycline versus minocycline in the three-dose melarsomine canine adulticidal heartworm treatment protocol. Parasit Vectors. 2018 Dec 27;11(1):671. doi: 10.1186/s13071-018-3264-z. Tables Table 1. Primers and probes were designed for the amplification of the cytochrome c oxidase subunit 1 ( cox1 ) gene region of this study. Name Sequence (5´- 3´) Reference Primers Fil.COI.749-F CATCCTGAGGTTTATGTTATTATTTT 60 Fil.COI.914-R CWGTATACATATGATGRCCYCA 60 Probes Original Probe 6FAM-CGGTGTTTGGGATTGTTAGTG-MGB-NFQ 60 Probe 1 6FAM-GGTGTTTGGGATTGTTAGTGAA-MGB-NFQ Current Study Probe 2 6FAM-CCAGACTAGTATG-MGB-NFQ Current Study Probe 3 6FAM-TATTTGGATTGCTGTATTGGGG-MGB-NFQ Current Study Table 2. Positivity of all heartworm diagnostic tests performed both individually and paired within shelter dogs (n=136) from Texas. Diagnostic test(s) No. of positive dogs (%) 95% CI Individual test MK 83 (61.0) 52.2—69.2 PO 91 (66.9) 58.3—71.3 P2 81 (59.6) 50.8—67.8 P3 93 (68.4) 59.8—76.0 DiroCHEK ® pre-ICD 109 (80.1) 72.4—86.4 DiroCHEK ® post-ICD 129 (94.9) 89.6—97.9 Paired tests MK + DiroCHEK ® pre-ICD 116 (85.3) 78.2—90.8 MK + DiroCHEK ® post-ICD 135 (99.3) 86.0—100.0 PO + DiroCHEK ® pre-ICD 114 (83.8) 76.5—89.6 PO + DiroCHEK ® post-ICD 131 (96.3) 91.6—98.8 P2 + DiroCHEK ® pre-ICD 113 (83.1) 75.7—89.0 P2 + DiroCHEK ® post-ICD 131 (96.3) 91.6—98.8 P3 + DiroCHEK ® pre-ICD 115 (84.6) 77.4—90.2 P3 + DiroCHEK ® post-ICD 132 (97.1) 92.6—99.2 MK: modified Knott’s; PO: Original probe; P2: Probe #2; P3: Probe #3; DiroCHEK ® pre-ICD: Pre-Immune Complex Dissociation; DiroCHEK ® post-ICD: Post-Immune Complex Dissociation; Table 3. Summary of the level of agreement between diagnostic tests for heartworm detection. Comparison of two tests (Test 1/Test 2) a b c d Cohen’s Kappa (κ) Agreement Interpretation MK/PO 77 6 14 39 0.6822 Substantial MK/P2 77 6 4 49 0.8465 Almost Perfect MK/P3 78 5 15 38 0.6799 Substantial MK/Pre-ICD 76 7 33 20 0.3215 Fair MK/Post-ICD 77 6 52 1 -0.0634 Poor PO/P2 81 10 0 45 0.8428 Almost perfect PO/P3 88 3 5 40 0.8656 Almost perfect PO/Pre-ICD 86 5 23 22 0.4827 Moderate PO/Post-ICD 89 2 40 5 0.1133 Slight P2/P3 81 0 12 43 0.8102 Substantial P2/Pre-ICD 77 4 32 23 0.4016 Fair P2/Post-ICD 79 2 50 5 0.0770 Slight P3/Pre-ICD 87 6 22 21 0.4710 Moderate P3/Post-ICD 90 3 39 4 0.0784 Slight Pre-ICD/Post-ICD 108 1 21 6 0.2953 Fair ( MK : modified Knott’s; PO : Probe Original; P2 : Probe #2; P3 : Probe #3; DiroCHEK ® pre-ICD : Pre-Immune Complex Dissociation; DiroCHEK ® post-ICD : Post-Immune Complex Dissociation;) Table 4. Cochran’s Q test results for comparing six heartworm diagnostic tests individually. Comparison of individual methods Q statistic df p -value MK 117.0 5 <0.001 PO P2 P3 Pre-ICD Post-ICD Significant relationships ( p <0.05) are denoted by bold font ( df : degrees of freedom; MK : modified Knott’s; PO : Original probe; P2 : Probe #2; P3 : Probe #3; DiroCHEK ® pre-ICD : Pre-Immune Complex Dissociation; DiroCHEK ® post-ICD : Post-Immune Complex Dissociation;) Table 5. Post-hoc analysis of the Cochran’s Q test using a McNemar’s test for individual tests. Post hoc analysis p -value MK/PO 0.115 MK/P2 0.075 MK/P3 0.041 MK/Pre-ICD <0.001* MK/Post-ICD <0.001* PO/P2 0.002* PO/P3 0.726 PO/Pre-ICD <0.001* PO/Post-ICD <0.001* P2/P3 <0.001* P2/Pre-ICD <0.001* P2/Post-ICD <0.001* P3/Pre-ICD 0.003* P3/Post-ICD <0.001* Pre-ICD/Post-ICD <0.001* * Significant after Bonferroni correction (α=0.008) ( MK : modified Knott’s; PO : Original probe; P2 : Probe #2; P3 : Probe #3; DiroCHEK ® pre-ICD : Pre-Immune Complex Dissociation; DiroCHEK ® post-ICD : Post-Immune Complex Dissociation;) Table 6. Cochran’s Q test results for comparing paired diagnostic tests for heartworm detection. Combination Q statistic df p -value MK+PO (A) 340.519 14 <0.001 MK+P2 (B) MK+P3 (C) MK+Pre-ICD (D) MK+Post-ICD (E) PO+P2 (F) PO+P3 (G) PO+Pre-ICD (H) PO+Post-ICD (I) P2+P3 (J) P2+Pre-ICD (K) P2+Post-ICD (L) P3+Pre-ICD (M) P3+Post-ICD (N) Pre-ICD+Post-ICD (O) Significant relationships ( p <0.05) are denoted by bold font ( df : degrees of freedom; MK : modified Knott’s; PO : Original probe; P2 : Probe #2; P3 : Probe #3; DiroCHEK ® pre-ICD : Pre-Immune Complex Dissociation; DiroCHEK ® post-ICD : Post-Immune Complex Dissociation;) Table 7. Post-hoc analysis of the Cochran’s Q test using a McNemar’s test for paired heartworm diagnostic tests. Post hoc analysis p -value A/B 0.194 A/C 0.892 A/D 0.005 A/E <0.001** A/F 0.431 A/G 0.893 A/H 0.013 A/I <0.001** A/J 0.597 A/K 0.020 A/L <0.001** A/M 0.008 A/N <0.001** A/O <0.001** B/C 0.152 B/D <0.001** B/E <0.001** B/F 0.610 B/G 0.2448 B/H <0.001** B/I <0.001** B/J 0.441 B/K <0.001** B/L <0.001** B/M <0.001** B/N <0.001** B/O <0.001** C/D 0.007 C/E <0.001** C/F 0.356 C/G 0.788 C/H 0.019 C/I <0.001** C/J 0.507 C/K 0.029 C/L <0.001** C/M 0.012 C/N <0.001** C/O <0.001** D/E <0.001** D/F <0.001** D/G 0.003 D/H 0.737 D/I 0.001** D/J <0.001** D/K 0.618 D/L 0.001** D/M 0.865 D/N <0.001** D/O 0.003 E/F <0.001** E/G <0.001** E/H <0.001** E/I 0.098 E/J <0.001** E/K <0.001** E/L 0.098 E/M <0.001** E/N 0.185 E/O 0.055 F/G 0.513 F/H 0.001** F/I <0.001** F/J 0.795 F/K 0.002** F/L <0.001** F/M <0.001** F/N <0.001** F/O <0.001** G/H 0.009 G/I <0.001** G/J 0.692 G/K 0.014 G/L <0.001** G/M 0.005 G/N <0.001** G/O <0.001** H/I <0.001** H/J 0.002** H/K 0.870 H/L <0.001** H/M 0.868 H/N <0.001** H/O 0.001** I/J <0.001** I/K <0.001** I/L 1 I/M 0.001** I/N 0.734 I/O 0.758 J/K 0.004 J/L <0.001** J/M 0.001** J/N <0.001** J/O <0.001** K/L <0.001** K/M 0.741 K/N <0.001** K/O <0.001** L/M 0.001** L/N 0.734 L/O 0.758 M/N <0.001** M/O 0.002** N/O 0.519 ** Significant after Bonferroni correction (α=0.003) ( A : Modified Knott’s + Original Probe; B : Modified Knott’s + Probe 2; C : Modified Knott’s + Probe 3; D : Modified Knott’s + DiroCHEK ® pre-ICD: Pre-Immune Complex Dissociation; E : Modified Knott’s + DiroCHEK ® post-ICD: Post-Immune Complex Dissociation; F : Original Probe + Probe 2; G : Original Probe + Probe 3; H : Original Probe + DiroCHEK ® pre-ICD; I : Original Probe + DiroCHEK ® post-ICD J : Probe 2 + Probe 3; K : Probe 2 + DiroCHEK ® pre-ICD; L : Probe 2 + DiroCHEK ® post-ICD; M : Probe 3 + DiroCHEK ® pre-ICD: Pre-Immune complex dissociation; N : Probe 3 + DiroCHEK ® post-ICD: Post-Immune complex dissociation; O : DiroCHEK ® pre-ICD: Pre-Immune complex dissociation + DiroCHEK ® pre-ICD: Post-Immune complex dissociation;) Additional Declarations No competing interests reported. Supplementary Files HWqPCRTXFig.S411425.jpeg HWqPCRTXSupplementaryFileFigureS1S2S3S4andS5Titles.docx HWqPCRTXFig.S211425.jpeg HWqPCRTXFig.S311425.jpeg HWqPCRTXFig.S111425.jpeg HWqPCRTXFig.S511425.jpeg Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 13 Jan, 2026 Reviews received at journal 13 Jan, 2026 Reviews received at journal 09 Jan, 2026 Reviewers agreed at journal 20 Dec, 2025 Reviewers agreed at journal 18 Dec, 2025 Reviewers agreed at journal 17 Dec, 2025 Reviewers invited by journal 17 Dec, 2025 Editor assigned by journal 17 Dec, 2025 Submission checks completed at journal 16 Dec, 2025 First submitted to journal 16 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8379526","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":562455108,"identity":"b9f0184c-ea12-4179-94e0-862f9e641c25","order_by":0,"name":"Maureen A. Kelly","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Maureen","middleName":"A.","lastName":"Kelly","suffix":""},{"id":562455109,"identity":"283cf14a-061b-4ea9-9239-b1ffd304c3ff","order_by":1,"name":"Tiana L. Sanders","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Tiana","middleName":"L.","lastName":"Sanders","suffix":""},{"id":562455110,"identity":"6af7d0f2-0f43-4b97-be34-d31c12fd206f","order_by":2,"name":"Alexa Starnes","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Alexa","middleName":"","lastName":"Starnes","suffix":""},{"id":562455111,"identity":"f6e1ce97-52b7-465c-8564-7049ce38cd81","order_by":3,"name":"Emily Orr","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Emily","middleName":"","lastName":"Orr","suffix":""},{"id":562455112,"identity":"a83c70f8-04fe-4232-8bb9-c5150af4e6ed","order_by":4,"name":"Joe L. Luksovsky","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Joe","middleName":"L.","lastName":"Luksovsky","suffix":""},{"id":562455113,"identity":"290bf793-0184-40b5-920f-9692f8ad7507","order_by":5,"name":"Caroline Sobotyk","email":"","orcid":"","institution":"University of Pennsylvania","correspondingAuthor":false,"prefix":"","firstName":"Caroline","middleName":"","lastName":"Sobotyk","suffix":""},{"id":562455114,"identity":"5595fe51-2cf5-4b46-af7a-7be40001f4c2","order_by":6,"name":"Hassan Hakimi","email":"","orcid":"","institution":"Kansas State University","correspondingAuthor":false,"prefix":"","firstName":"Hassan","middleName":"","lastName":"Hakimi","suffix":""},{"id":562455115,"identity":"bfb435ab-59f7-404e-8825-457befac4bc2","order_by":7,"name":"Pabasara Weerarathne","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Pabasara","middleName":"","lastName":"Weerarathne","suffix":""},{"id":562455116,"identity":"94eee30b-85ba-4554-be44-9015fb510a3c","order_by":8,"name":"Christine M. Budke","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Christine","middleName":"M.","lastName":"Budke","suffix":""},{"id":562455117,"identity":"80f76cdb-4b03-4f1a-8823-6a42be9b76cc","order_by":9,"name":"Guilherme G. Verocai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYBADHn5kngRRWiQbQFQCCVoYDA4Qq0U+IvnYhw81djLGx8+YbmD8YRdtcID54G0ePFoMb6Qlz5xxLJnH7EyO2Q2GhOTcDQfYkq3xauk5Y8zM28DMY3aDLQ2ohRmohcdMGr+W85+BWup5jGeAtdQDtfB/w6tFnr2HGajlMI+BBPMxoJbDIFvY8GoxYG8zZpxx7DiPxJnkYzcS0o7nzjzMZmw5B58tzcyPGT7UVNvztx9su/HBpjq373jzwxtv8NlyAJmXACKY8SgH29JAQMEoGAWjYBSMAgYAzcpJWcloeIoAAAAASUVORK5CYII=","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":true,"prefix":"","firstName":"Guilherme","middleName":"G.","lastName":"Verocai","suffix":""}],"badges":[],"createdAt":"2025-12-16 20:08:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8379526/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8379526/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98627913,"identity":"93dc1963-0a34-42a1-b7ae-74522d8f303d","added_by":"auto","created_at":"2025-12-19 17:10:47","extension":"jpeg","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":601468,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.111425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/e666c5d3e482c5ceecd9fcca.jpeg"},{"id":98604298,"identity":"9529d1b3-1179-450b-b396-d14b0af70457","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":598933,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.211425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/9cf22a7ba91cf9f3bf7c0d8f.jpeg"},{"id":98628604,"identity":"c2df1c61-c5c0-4781-bfbe-85e02837fab9","added_by":"auto","created_at":"2025-12-19 17:11:50","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":74036,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXMS121625CLEAN.docx","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/7c9b838cd03be29f0bec302e.docx"},{"id":98628295,"identity":"bf45e230-189f-4589-9144-4a4a077eb236","added_by":"auto","created_at":"2025-12-19 17:11:14","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46414,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXTables121025v3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/1fa062f5dce6b8055ef3b3de.docx"},{"id":98628869,"identity":"2ff1b3f9-afa6-4fa5-9f01-81c8fd6b4813","added_by":"auto","created_at":"2025-12-19 17:12:42","extension":"json","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12858,"visible":true,"origin":"","legend":"","description":"","filename":"d83de704a61c4fc4b938128ec9f038d7.json","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/b35ed892220645d7f01f6602.json"},{"id":98629372,"identity":"7ac6ac24-95c7-4c52-a883-63c92f5e6e80","added_by":"auto","created_at":"2025-12-19 17:13:43","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1658157,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S111425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/e1697c81baad5dbbb4855f3c.jpeg"},{"id":98604299,"identity":"874ca78b-18af-41dd-90a6-cb50e484d30b","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139988,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S211425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/cc3d7c20ac234abebcfd7edd.jpeg"},{"id":98604305,"identity":"a2070627-e4b4-48c6-be12-d3f35bff7c5b","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138102,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S311425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/960739924d827b6d7d538687.jpeg"},{"id":98629205,"identity":"6964cf6f-8eb4-40c4-8e8f-204854ac5180","added_by":"auto","created_at":"2025-12-19 17:13:25","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134363,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S411425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/9733b268d4d77f403df0aa31.jpeg"},{"id":98604313,"identity":"4ceb029a-ddaa-4d52-bbff-8d81fa8ef652","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5920173,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S511425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/3b7ab4106d39feb34e8cca5b.jpeg"},{"id":98604301,"identity":"14d10cd9-0850-4616-823f-4a1ddc2b9a56","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15094,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXSupplementaryFileFigureS1S2S3S4andS5Titles.docx","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/be47922364233315520cd9d6.docx"},{"id":98628897,"identity":"abb987ef-c337-4297-8a30-f80aaa732282","added_by":"auto","created_at":"2025-12-19 17:12:45","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":276890,"visible":true,"origin":"","legend":"","description":"","filename":"d83de704a61c4fc4b938128ec9f038d71enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/c6f976839226c1d30a1cf58e.xml"},{"id":98604304,"identity":"0a1955b4-5b79-42ca-88c7-020faa9d12b4","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":601468,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.111425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/908675629ac77b41c020b458.jpeg"},{"id":98629361,"identity":"e6669f87-1296-4b44-b64f-115e1ec5c56d","added_by":"auto","created_at":"2025-12-19 17:13:40","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":598933,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.211425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/1a0986a14766bce19f2241e0.jpeg"},{"id":98629384,"identity":"9318a8a0-ac16-4b67-a1df-323986630f40","added_by":"auto","created_at":"2025-12-19 17:13:47","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":198462,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineHWqPCRTXFig.111425.png","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/87fa2d9c77e4f63f122e3b95.png"},{"id":98604312,"identity":"c78f1717-a7d5-4328-b4d1-03a738df7e8f","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":195335,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineHWqPCRTXFig.211425.png","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/ebf5d56b1228927626c68833.png"},{"id":98604310,"identity":"30367f3f-96b4-49f8-95a3-3c5660aa8c81","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":276131,"visible":true,"origin":"","legend":"","description":"","filename":"d83de704a61c4fc4b938128ec9f038d71structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/c9329c6a6f76718d2b6d8e70.xml"},{"id":98604307,"identity":"4c48636f-a32f-4b51-8f23-500a624d8e9b","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"html","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":301201,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/71255f251dbe8f967c310f8c.html"},{"id":98604288,"identity":"a1818a40-bbb9-4008-b279-8071406fb623","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":635026,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e. Standard curve of qPCR for the detection of \u003cem\u003eDirofilaria immitis \u003c/em\u003efor Probe 2. This was created by plotting the average CT values of triplicates using a 10-fold serial dilution of adult specimen genomic DNA. \u003cstrong\u003eb.\u003c/strong\u003e Standard curve of qPCR for the detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in Probe 3. This was created by plotting the average CT values of triplicates using a 10-fold serial dilution of adult specimen genomic DNA.\u003c/p\u003e","description":"","filename":"HWqPCRTXFig.111425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/0070c66a7f6653facf58bab8.jpeg"},{"id":98604290,"identity":"13a48712-816c-4a1c-9aa5-a28ae5521ca7","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":619243,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea. \u003c/strong\u003eStandard curve of qPCR for the detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003emicrofilariae in whole blood of experimentally infected dog sample using Probe 2. This was created by plotting the average CT values from triplicate samples using a 10-fold serial dilution of the microfilariae genomic DNA within each sample. \u003cstrong\u003eb. \u003c/strong\u003eStandard curve of qPCR for the detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e microfilariae in whole blood of experimentally infected dog sample using Probe 3. This was created by plotting the average CT values from triplicate samples using a 10-fold serial dilution of the microfilariae genomic DNA within each sample.\u003c/p\u003e","description":"","filename":"HWqPCRTXFig.211425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/73ac1fdafc4ea49af66bc820.jpeg"},{"id":98632162,"identity":"a346dc75-ae6f-42ce-a5b8-a1fd5c9c2705","added_by":"auto","created_at":"2025-12-19 17:21:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2610231,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/b46cf916-9715-466e-902a-43f111aa716a.pdf"},{"id":98629037,"identity":"383a4fd4-279b-4ee2-8353-10a969356c77","added_by":"auto","created_at":"2025-12-19 17:13:06","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":134363,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S411425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/cb701131ffa2ba459e57e2e3.jpeg"},{"id":98604294,"identity":"f2c94e53-a14c-4542-8e42-d4a973154679","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":15094,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXSupplementaryFileFigureS1S2S3S4andS5Titles.docx","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/4bee6e3896b8e10cf48b2cd5.docx"},{"id":98628665,"identity":"a8656231-700a-494e-94b6-5825c2a3fa73","added_by":"auto","created_at":"2025-12-19 17:12:01","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":139988,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S211425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/8f0a6cdb527e8c2a3396b39d.jpeg"},{"id":98604295,"identity":"d12a1622-0ff0-43c3-9b84-319be879cac5","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":138102,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S311425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/23ac91988e88158c72a63aa0.jpeg"},{"id":98629411,"identity":"61861462-206b-4f30-a3e2-52681e0cb517","added_by":"auto","created_at":"2025-12-19 17:13:52","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1658157,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S111425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/1df4d8cfbe9a86cfc7410417.jpeg"},{"id":98604308,"identity":"ceb0676a-3a27-4649-8580-bca38b867c2a","added_by":"auto","created_at":"2025-12-19 13:17:59","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":5920173,"visible":true,"origin":"","legend":"","description":"","filename":"HWqPCRTXFig.S511425.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8379526/v1/c89b1a61341377cdcf3ff9e2.jpeg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Improved specificity of a probe-based real-time PCR for the detection of Dirofilaria immitis in canine blood","fulltext":[{"header":"Background","content":"\u003cp\u003eDirofilariasis, which is caused by filarial nematodes of the genus \u003cem\u003eDirofilaria\u003c/em\u003e, is a growing concern for veterinary and medical communities. These parasites can result in zoonotic infections and are found worldwide [\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. With the Companion Animal Parasite Council (CAPC) and the American Heartworm Society (AHS) reporting a higher prevalence of dirofilariasis in the United States (US), accurate diagnostics for identifying infected dogs are essential [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. \u003cem\u003eDirofilaria immitis\u003c/em\u003e (Spirurida: Onchocercidae) is the causative agent of canine heartworm disease and is the most significant filarial nematode in veterinary medicine, primarily infecting dogs [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Heartworm is now well-established across nearly the entire world, particularly in tropical and subtropical regions, where its prevalence is higher [\u003cspan additionalcitationids=\"CR8 CR9 CR10 CR11 CR12 CR13 CR14 CR15\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This vector-borne pathogen is transmitted by over 20 mosquito genera [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In the US, mosquitoes known to vector \u003cem\u003eD. immitis\u003c/em\u003e include species in the genera \u003cem\u003eAedes\u003c/em\u003e, \u003cem\u003eAnopheles\u003c/em\u003e, and \u003cem\u003eCulex\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Studies also show that many other animals are susceptible hosts, including cats, ferrets, coyotes, and wolves [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan additionalcitationids=\"CR26 CR27 CR28 CR29 CR30 CR31\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Clinical signs of canine heartworm disease vary from subclinical or mild symptoms like coughing and activity intolerance to more severe clinical manifestations such as dyspnea, respiratory distress, and heart failure, which can potentially lead to fatalities [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Humans are considered accidental hosts and can develop pulmonary dirofilariasis, characterized by a \u0026ldquo;coin lesion\u0026rdquo; within the pulmonary artery [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe current recommendations for diagnosing \u003cem\u003eD. immitis\u003c/em\u003e include performing two tests in parallel: a serology-based test and a microfilariae detection test (MFDT) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Many commercially available serology tests target the antigen produced by the reproductive tract of adult females [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. These tests are generally more sensitive than MFDT in large-scale screening studies for detecting the status of heartworm infection in canines [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan additionalcitationids=\"CR42 CR43 CR44\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. However, false-negative results can occur when circulating antigens bind the dog\u0026rsquo;s antibodies, forming immune complexes that hinder detection by standard serological assays [\u003cspan additionalcitationids=\"CR47 CR48 CR49 CR50 CR51 CR52\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Heat treatment has been successful in immune-complex dissociation (ICD) for heartworm antigen detection [\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan additionalcitationids=\"CR52 CR53\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. However, it can cause cross-reactivity with other parasites such as \u003cem\u003eDirofilaria repens\u003c/em\u003e, \u003cem\u003eAngiostrongylus vasorum\u003c/em\u003e, and \u003cem\u003eSpirocerca lupi\u003c/em\u003e, which are known to infect dogs [\u003cspan additionalcitationids=\"CR56 CR57\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMicroscopy-based techniques such as direct smears, modified Knott's tests, and microfilariae filtration tests are commonly used as MDFTs [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Of these, a direct smear can be most easily applied in a clinical setting [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Yet, many of these methods have disadvantages, including the need for extensive laboratory training to distinguish co-infection with multiple species, heavy labor intensity, and an increased risk of false negatives, especially when microfilariae may not be present in subclinical or early-stage infections [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. The development of molecular diagnostics, such as conventional PCR (cPCR) and real-time PCR (qPCR), has significantly improved the detection of microfilariae, especially in suspected infections, subclinical cases, and large-scale epidemiological studies in dogs and cats [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan additionalcitationids=\"CR61 CR62\" citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. This highlights the need to develop highly sensitive and specific molecular techniques for rapid detection and accurate identification of \u003cem\u003eD. immitis\u003c/em\u003e microfilariae. Improved molecular tests can be easily integrated into screening studies for \u003cem\u003eD. immitis\u003c/em\u003e and provide updated prevalence values in endemic and non-endemic regions.\u003c/p\u003e \u003cp\u003eIt would be ideal to conduct large-scale screening studies in companion animals to assess prevalence in endemic and non-endemic regions. To achieve this, we must ensure that molecular assays are specific enough to distinguish \u003cem\u003eD. immitis\u003c/em\u003e from other filarial nematodes that may be present in the blood of both hosts, such as \u003cem\u003eDirofilaria striata.\u003c/em\u003e Therefore, the objectives of this study were to first evaluate the sensitivity and specificity of three newly designed qPCR probes for detecting \u003cem\u003eD. immitis.\u003c/em\u003e Then, compare the overall detection of these new protocols alongside our previously published qPCR protocol [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and other diagnostic tests commonly used for microfilariae and antigen detection.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eOptimization of qPCR\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDirofilaria striata sample collection\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFilarial nematode fragments were recovered from a 3-year-old male domestic short-haired cat at the Texas A\u0026amp;M Veterinary Medicine Diagnostic Laboratory. The fragments were collected from a wound in the interscapular area and preserved in formalin before being sent to the Texas A\u0026amp;M University Parasitology Diagnostic Laboratory. Once received, morphological identification was not possible; therefore, genomic DNA was extracted using the QIAamp\u003csup\u003e\u0026reg;\u003c/sup\u003e DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer\u0026rsquo;s instructions. Subsequently, DNA was screened with cPCR targeting the mitochondrial cytochrome \u003cem\u003ec\u003c/em\u003e oxidase subunit 1 (\u003cem\u003ecox1\u003c/em\u003e) gene fragment [61]. The amplified products were purified using the Cycle Pure E.Z.N.A.\u003csup\u003e\u0026reg;\u003c/sup\u003e Kit (Omega BioTek, Norcross, GA, USA) and then sent directly for Sanger sequencing (Eurofins, Louisville, Kentucky, USA), yielding both forward and reverse sequences. After confirming \u003cem\u003eD. striata\u003c/em\u003e via sequence alignment in MEGA X, it was submitted to GenBank (Accession: PX315770) [64].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDesign and development of three probes\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eRecently, Negron et al. [16] optimized a probe developed as an alternative to the modified Knotts test [60]. The clinical sample described above was tested using the optimized protocol under standard cycling conditions [16] and exhibited cross-reactivity, requiring further optimization. We designed three TaqMan\u003csup\u003e\u0026reg;\u003c/sup\u003e probes using Primer Express Software (ThermoFisher Scientific Inc., Waltham, Massachusetts, USA) within the same targeted \u003cem\u003ecox1\u003c/em\u003e region as the probe utilized in Negron et al. [16], which will be referred to as the \u0026ldquo;original probe\u0026rdquo; throughout. We then tested all four probes (i.e., original probe [16], probe 1, probe 2, and probe 3) in combination with forward and reverse primers designed by Laidoudi et al. [60] (Table 1). Each probe/primer set was tested using DNA from a \u003cem\u003eD. immitis\u003c/em\u003e adult female specimen and\u003cem\u003e\u0026nbsp;\u003c/em\u003efrom\u003cem\u003e\u0026nbsp;D. striata\u0026nbsp;\u003c/em\u003eadult fragments. Probes that did not cross-react were further assessed by standard curve analysis to determine the limit of detection (LOD) for DNA from adult specimens and microfilariae-infected canine whole blood. This involved performing ten-fold dilutions using two \u003cem\u003eD. immitis\u003c/em\u003e sample types: an adult female specimen (2600 pg/\u0026mu;L) and whole blood from an experimentally infected dog with high microfilariae levels (12000 pg/\u0026mu;L).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eImplementation of new probe-based qPCRs\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSample collection\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo test the accuracy of the newly developed assays, frozen, archival whole blood samples (n=136) from domestic dogs (\u003cem\u003eCanis lupus familiaris\u003c/em\u003e)\u003cem\u003e\u0026nbsp;\u003c/em\u003ecollected between February 2020 and June 2023 were selected. All samples included in the study were collected from three shelters in Brazos County (n=133) and Harris County (n=3), Texas, USA. The collection method of these samples was described in Negron et al. [16]. The original qPCR probe, the modified Knott\u0026rsquo;s test, DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD, and DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD were evaluated for each blood sample in the study by Negron et al., [16]. Each sample tested positive for at least one test. In addition to the newly designed qPCR probes, the only diagnostic repeated on the selected samples was the original qPCR probe optimized by Negron et al. at standard cycling conditions [16].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGenomic DNA extraction and qPCR\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePrior to DNA extraction, 200 \u0026mu;L of whole blood was placed in a thermomixer (37 \u0026deg;C) at 350 RPM overnight. Genomic DNA was extracted using the QIAamp\u003csup\u003e\u0026reg;\u003c/sup\u003e DNA Mini Blood Kit (QIAGEN, Hilden, Germany) following the manufacturer\u0026rsquo;s instructions. All extracted DNA was stored at -20 \u0026deg;C until analysis.\u003c/p\u003e\n\u003cp\u003eAll samples (n=136) were screened for \u003cem\u003eD. immitis\u003c/em\u003e using the original qPCR probe [16] along with the newly optimized probes. The assay target was a 166-bp fragment of the \u003cem\u003ecox1\u0026nbsp;\u003c/em\u003eregion, initially designed by Laidoudi et al. [60]. The layout of each plate included duplicate samples for each probe/primer combination tested (Additional file 1: Fig. S1). We also included positive and negative controls in single-well reactions, with duplicate no-template controls for each set. All reactions were performed in a 20 \u0026micro;L volume containing 3.5 \u0026micro;L of molecular-grade water, 0.5 \u0026micro;L (50 \u0026micro;M) of each primer, 0.5 \u0026micro;L (20 \u0026micro;M) of probe, 10 \u0026micro;L of 2x TaqMan\u003csup\u003e\u0026reg;\u003c/sup\u003e Fast Advance Master Mix (Applied Biosystems, Waltham, MA, USA), and 5 \u0026micro;L of DNA template. All qPCR reactions were run on a QuantStudio\u0026trade; 3 real-time PCR system (Applied Biosystems, Waltham, MA, USA). Each run included the following standard cycling conditions: a denaturation step at 95 \u0026deg;C for 2 minutes, followed by 40 cycles of two-step PCR with denaturation at 95 \u0026deg;C for 1 second and annealing at 60 \u0026deg;C for 20 seconds, with a total run time of 43 minutes. The positive control consisted of DNA extracted from an adult \u003cem\u003eD. immitis\u003c/em\u003e specimen, confirmed both morphologically and molecularly. In contrast, the negative control contained whole blood DNA from a dog negative for \u003cem\u003eD. immitis\u003c/em\u003e, as confirmed by microscopy and molecular testing. The no-template control was nuclease-free molecular water. The qPCR results were analyzed using Design \u0026amp; Analysis 2 software to determine the presence or absence of \u003cem\u003eD. immitis\u003c/em\u003e within each well (Applied Biosystems, Waltham, MA, USA).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eData Analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses were conducted using STATA\u003csup\u003e\u0026reg;\u003c/sup\u003e version 19.5 BE-Basic Edition (College Station, TX, USA). Descriptive statistics and analyses of positivity across all diagnostic tests were summarized in tables. The correlation between microfilariae counts in each modified Knott\u0026rsquo;s test and the cycle threshold (Ct) values of each qPCR protocol was evaluated. Additionally, Cohen\u0026rsquo;s Kappa (\u0026kappa;) was calculated for each pair of diagnostic tests to assess the level of agreement [65\u0026ndash;67]. The agreement levels were classified as follows: \u0026kappa;\u0026le;0, no agreement; \u0026kappa;=0.01-0.2, slight agreement; \u0026kappa;=0.21-0.4, fair agreement; \u0026kappa;=0.41-0.6, moderate agreement; \u0026kappa;=0.61-0.8, substantial agreement; \u0026kappa;=0.81-1.0, almost perfect [65\u0026ndash;67].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe applied Cochran\u0026rsquo;s Q test to evaluate whether there were differences in the proportions positive across the six diagnostic tests (probe 2, probe 3, the original qPCR probe, the modified Knott\u0026rsquo;s test, DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD, and DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD). Probe 1 was not evaluated due to cross-reactivity. Subsequently, we performed Cochran\u0026rsquo;s Q test on all 15 combined diagnostic pairs and evaluated each set in parallel. Each test was followed by a post hoc analysis using McNemar\u0026rsquo;s test to compare diagnostic tests pairwise, with the Bonferroni correction applied to control for multiple comparisons. A \u003cem\u003ep\u003c/em\u003e-value of \u0026le;0.05 was considered statistically significant unless otherwise adjusted.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eOptimization of qPCR\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing preliminary testing, the original qPCR protocol [16] cross-reacted with the \u003cem\u003eD. striata\u003c/em\u003e specimen identified above. This led to the design of three new probes that were compatible with the same primer set. We then tested all three probes in duplicate and found that probe 1 detected both \u003cem\u003eD. immitis\u003c/em\u003e and \u003cem\u003eD. striata\u003c/em\u003e, whereas probes 2 and 3 detected only \u003cem\u003eD. immitis\u003c/em\u003e. Following a ten-fold standard curve, the LOD of probe 2 and probe 3 was 1300 fg and 130 fg for adult specimens, respectively (Fig. 1). In contrast, in whole blood infected with \u003cem\u003eD. immitis\u003c/em\u003e microfilariae, the LOD was 6000 fg for both P2 and P3 (Fig. 2). Probe 2 and probe 3 were selected to be utilized in the second objective of this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eImplementation of new probe-based qPCRs\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of each diagnostic test, individually and paired (positive in test 1, test 2, or both), are summarized in Table 2. Following the screening of previously tested whole blood DNA (n=136), the highest positivity was in probe 3 (n=93/136; 68.4%), followed by the original probe [16] (n=91/136; 66.9%), with the lowest positivity in probe 2 (n=81/136; 59.6%). No significant correlation was found between microfilariae counts and Ct values for any probes (Additional file 1: Figs. S2, S3, S4). The microfilariae of \u003cem\u003eD. immitis\u0026nbsp;\u003c/em\u003eranged from 1 to 88,803 per mL, with an average of 15,698 mf/mL.\u003c/p\u003e\n\u003cp\u003eIn Table 3, Cohen\u0026rsquo;s Kappa showed almost perfect agreement between MFDTs, with the original probe + probe 3 (\u0026kappa;=0.86) followed by modified Knott\u0026rsquo;s/probe 2 (\u0026kappa;=0.84) and the original probe/ probe 2 (\u0026kappa;=0.84). We also found a substantial agreement between probe 2/probe 3 (\u0026kappa;=0.81), modified Knott\u0026rsquo;s/original probe (\u0026kappa;=0.68), and modified Knott\u0026rsquo;s/probe 3 (\u0026kappa;=0.67). We found a slight agreement when DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epost-ICD was compared with all three molecular MFDTs \u0026mdash; the original probe (\u0026kappa;=0.11), probe 3 (\u0026kappa;=0.07), and probe 2 (\u0026kappa;=0.07) \u0026mdash; and a poor agreement with the modified Knott\u0026rsquo;s test (-0.06).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA significant difference was observed for the Cochran\u0026rsquo;s Q test comparing the six diagnostic tests (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001) (Table 4). In the post-hoc analysis with a Bonferroni correction, differences remained significant for multiple diagnostic comparisons, including the modified Knott\u0026rsquo;s/pre-ICD (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001) and modified Knott\u0026apos;s/post-ICD (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001) (Table 5). We also found significant differences between the original probe/probe 2 (p=0.002) and between probe 2/probe 3 (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001). Finally, we observed a significant difference when each qPCR (original probe, probe 2, and probe 3) was evaluated with pre-ICD and post-ICD (Table 5).\u003c/p\u003e\n\u003cp\u003eFor paired diagnostic tests, Cochran\u0026rsquo;s Q test revealed that all 15 combinations were statistically significant (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001) (Table 6). Post hoc McNemar tests indicated that molecular MFDTs (i.e., the original probe, probe 2, and probe 3) were statistically significant when paired with an antigen detection test (pre- or post-ICD), as opposed to pairing with a microscopy-based MFDT (i.e., modified Knott\u0026rsquo;s test) (Table 7). Among all probes compared in this study, probe 3 consistently showed a significant difference when paired with an antigen detection test, especially with post-ICD applied, indicating a substantial difference in detecting \u003cem\u003eD. immitis.\u003c/em\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe designed a highly sensitive and specific probe-based qPCR protocol capable of detecting \u003cem\u003eD. immitis\u003c/em\u003e within whole blood, serving as an additional confirmatory test for MFDTs. Based on current recommendations, to determine if a dog is positive for \u003cem\u003eD. immitis\u003c/em\u003e, two diagnostic modalities must be performed in parallel: an antigen detection test and MFDT [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. This combined protocol increases diagnostic sensitivity and allows detection of infections that might otherwise be missed, including amicrofilaremic cases, infections with fewer than three females, infections with only juvenile females, male-only infections, and cases with antibody-antigen complex formations [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. In this study, we further optimized a protocol initially designed by Laidoudi et al. [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e] and subsequently refined with fast universal cycling parameters by Negron et al. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Additionally, within Negron et al. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], the original criteria for selecting shelter dog samples were the absence of preventive macrocyclic lactone use and an estimated age greater than 6 months. In the current study, we applied more specific inclusion criteria, requiring a positive result in at least one diagnostic test (modified Knotts, qPCR assay, DiroCHEK\u0026reg; pre-, DiroCHEK\u0026reg; post-ICD) previously performed. After incorporating the selected, newly designed probe (probe 3), our modified assay detected two additional positives (n\u0026thinsp;=\u0026thinsp;93/136) that were initially missed by the original protocol (n\u0026thinsp;=\u0026thinsp;91/136) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This highlights that the new assay is reliable for detecting microfilariae in whole blood and can be utilized in future epidemiological investigations.\u003c/p\u003e \u003cp\u003eCompared with the original probe [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], probe 3 showed nearly perfect agreement. However, when comparing the previously published protocol [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] to probe 2, they were statistically different. Overall, we found that probe 2 detected fewer positive samples than all other probes, suggesting it is not highly reliable for this optimized protocol when combined with antigen detection as recommended [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In contrast, probe 3 aligns more closely with the original protocol [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] while providing higher sensitivity for detecting \u003cem\u003eD. immitis\u003c/em\u003e microfilariae DNA in blood, especially in suspected, inconclusive cases, without cross-reacting with other filarial nematodes. This would ultimately lead to false-positive results and require costly treatment for the owner and unnecessary discomfort for the dog.\u003c/p\u003e \u003cp\u003eUpon closer examination of the sampled population, we identified a subset of dogs (n\u0026thinsp;=\u0026thinsp;15) that tested negative with the modified Knotts test. However, this same subset was positive via qPCR with probe 3 (n\u0026thinsp;=\u0026thinsp;15/15) and was also positive under the previous qPCR protocol (n\u0026thinsp;=\u0026thinsp;11/15) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. It is also worth noting that, among these 15 samples, the majority tested positive for antigens both pre-ICD (n\u0026thinsp;=\u0026thinsp;13/15) and post-ICD (n\u0026thinsp;=\u0026thinsp;14/15). These results highlight how inconclusive and discordant results may arise in practice, potentially delaying treatment decisions or leading to undiagnosed infections [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Collectively, these findings suggest that incorporating DNA-based methodology in detecting \u003cem\u003eD. immitis\u003c/em\u003e microfilariae is important, as they offer higher sensitivity and specificity, which are critical for accurate confirmation.\u003c/p\u003e \u003cp\u003eCurrently, heat treatment is not widely recommended due to the risk of false positives when detecting circulating antigens produced by other parasites, such as \u003cem\u003eD. repens\u003c/em\u003e, \u003cem\u003eA. vasorum\u003c/em\u003e, and \u003cem\u003eS. lupi\u003c/em\u003e [\u003cspan additionalcitationids=\"CR56 CR57\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Additionally, new resources are constantly developed and updated to aid in determining when to use heat treatment for immune complex dissociation during annual \u003cem\u003eD. immitis\u003c/em\u003e testing when an inconclusive result is determined [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. However, in this study, the highest positive pairing of antigen and molecular based MFDT was observed with probe 3\u0026thinsp;+\u0026thinsp;DiroCHEK\u0026reg; post-ICD (n\u0026thinsp;=\u0026thinsp;132/136; 97.1%). This led to further evaluation of potential cross-reactivity with these parasites, which are known to produce false positives. We could not, however, assess this qPCR protocol due to limited DNA availability; instead, we evaluated it using bioinformatics in MEGA X [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e] to assess potential amplification in this DNA-based test (Additional file 1: Fig. \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e). Among these species, \u003cem\u003eD. repens\u003c/em\u003e is the most likely to cross-react, as it is known to be co-endemic with \u003cem\u003eD. immitis\u003c/em\u003e in regions such as Europe, Africa, Asia, and, more recently, South America, but has not yet been unequivocally confirmed in the US [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan additionalcitationids=\"CR71 CR72 CR73 CR74\" citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. While adults of \u003cem\u003eD. repens\u003c/em\u003e are found in subcutaneous tissues, microfilariae circulate in the blood, similar to \u003cem\u003eD. immitis\u003c/em\u003e, requiring similar confirmation techniques [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Conversely, \u003cem\u003eA. vasorum\u003c/em\u003e and \u003cem\u003eS. lupi\u003c/em\u003e produce first-stage larvae and eggs, respectively, which can be identified by fecal tests, such as the Baermann technique or fecal flotation [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Recently, \u003cem\u003eA. vasorum\u003c/em\u003e was locally acquired in a dog in Oregon, along with cases in wildlife such as red foxes, coyotes, and black bears [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. Similarly, \u003cem\u003eS. lupi\u003c/em\u003e was documented in domestic dogs and wild carnivores in the US, including Texas [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e, \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e, \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e, \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]. These biological and epidemiological factors further support the minimal likelihood of cross-reactivity with this qPCR assay.\u003c/p\u003e \u003cp\u003eThe two additional positives would not have been found if we had not also identified cross-reactivity with \u003cem\u003eD. striata\u003c/em\u003e, a filarioid nematode commonly reported in the blood of wild felids [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e, \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]. \u003cem\u003eDirofilaria striata\u003c/em\u003e is a parasite documented in North America, but has limited biological and epidemiological information available. The life cycle is suspected to be similar to that of \u003cem\u003eD. immitis\u003c/em\u003e, with mosquito species (\u003cem\u003eAnopheles quadrimaculatus\u003c/em\u003e) required for transmission of the third-stage larvae [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]. This skin-dwelling filarial nematode has been associated with felids, specifically domestic cats in Florida [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e] and bobcats in Louisiana and Texas [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e, \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]. There has been only one documented case of \u003cem\u003eD. striata\u003c/em\u003e microfilariae found in a dog residing in Florida with travel history from Ohio [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e]. Considering these factors, we improved the diagnostic sensitivity and specificity of this assay to avoid cross-reactivity with \u003cem\u003eD. striata\u003c/em\u003e, enabling its potential use in large-scale epidemiological studies to determine the prevalence of \u003cem\u003eD. immitis\u003c/em\u003e in both dogs, cats, and wild reservoir hosts.\u003c/p\u003e \u003cp\u003eIn a clinical setting, molecular assays, such as conventional and real-time PCR, may not be easily integrated, as each technique requires adequate personnel training, specialized reagents, and equipment. These requirements can be costly for clinics with limited funding sources and staffing difficulties. Therefore, this qPCR assay would be ideal for confirmatory testing when inconclusive results are obtained and can be performed by reference and diagnostic laboratories as a \u0026ldquo;send-out\u0026rdquo; option. Molecular assays can also be used to test \u003cem\u003eD. immitis\u003c/em\u003e in other susceptible hosts, such as cats, wild animals, and marine life [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan additionalcitationids=\"CR87 CR88 CR89 CR90\" citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e]. These hosts may play a role in transmitting the infection to surrounding definitive hosts, especially in high-risk areas [\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e, \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e]. The detection of microfilariae is not as easily confirmed in cats as in dogs; it is suspected that the cat\u0026rsquo;s immune system can control microfilariae and that they are unlikely to be detected using the same diagnostics as in dogs [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e, \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e]. This aspect was not evaluated in the current study because we did not have microfilariae-positive blood from a cat during the optimization process. However, if this protocol was used and amplification was detected, it is crucial to follow the AHS feline guidelines [\u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e]. As stated in these guidelines, it is recommended to perform additional testing, such as antigen detection with heat treatment and antibody detection, to confirm heartworm infection rather than treating it as a false-positive in a cat or suspecting a \u003cem\u003eD. striata\u003c/em\u003e infection [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan additionalcitationids=\"CR95 CR96 CR97\" citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e98\u003c/span\u003e]. Another approach to incorporating this assay is in large-scale studies, where it can be combined with commercially available serology tests to perform antigen and MFDT testing in parallel [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e, \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e97\u003c/span\u003e]. This would allow the use of optimized, accurate MFDT in combination with a serology-based test, thereby increasing the likelihood of detecting low-level \u003cem\u003eD. immitis\u003c/em\u003e infections.\u003c/p\u003e \u003cp\u003eMolecular assays, such as probe-based qPCRs, are ideal for providing cost-effective, low-intensity, rapid results while facilitating easy implementation for inconclusive cases in reference laboratory facilities and large-scale research [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. As highlighted in our study, there may be also disadvantages, including the potential for cross-reaction with other closely related nematode species. However, this can be avoided by incorporating in silico bioinformatics, combined with benchtop testing DNA of other filarioid nematodes, which enables real-time testing for specificity, depending on the availability of DNA. As with microscopy-based techniques, morphological characterization of microfilariae requires intensive training and extensive assessment. This is neither ideal nor possible within a clinical setting. An advantage of using molecular assays is the ability to include other molecular markers, such as \u003cem\u003eWolbachia\u003c/em\u003e, which enables the potential detection of \u003cem\u003eD. immitis\u003c/em\u003e and co-infecting species (e.g., \u003cem\u003eAcanthocheilonema reconditum\u003c/em\u003e and \u003cem\u003eD. repens\u003c/em\u003e) [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e100\u003c/span\u003e]. This will, in turn, require less sample collection, while providing results for other companion animal parasites that are less pathogenic but can cause health issues. Overall, we have provided an optimized protocol that can be used as an additional confirmatory MFDT and implemented in large-scale studies of both dogs and cats in combination with commonly performed serological-based tests.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn the present study, we improved a probe-based qPCR method previously published by our lab. We found that increased sensitivity enabled the detection of two additional positives that were not previously identified, while also limiting cross-reactivity with \u003cem\u003eD. striata\u003c/em\u003e, a closely related filarioid nematode species. This protocol presents an additional microfilariae detection test and a confirmatory test for cases in which viable options are available in subclinical or inconclusive routine diagnostics and can be easily implemented in large-scale screening studies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe want to thank Aggieland Humane Society, Bryan Animal Center, and Houston SPCA for providing the blood and serum samples used in this study. We also like to thank every student and technician who aided in sample collection, sample preparation, and data analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMAK: Technical writing \u0026mdash;original draft, data curation, formal analysis, laboratory optimization, methodology validation, and statistical analysis. TLS: Technical writing \u0026mdash;review and editing, methodology validation, formal analysis. AS: Technical writing \u0026mdash;review and editing, data curation. EO: Technical writing \u0026mdash;review and editing, data curation, laboratory optimization. JLL: Technical writing \u0026mdash;review and editing, data curation. CS: Technical writing \u0026mdash;review and editing, data curation, formal analysis. HH: Technical writing \u0026mdash;review and editing, data curation, formal analysis, laboratory optimization, supervision. PW: Technical writing \u0026mdash;review and editing, data curation, formal analysis, laboratory optimization, supervision. CMB: statistical analysis, supervision, and technical writing. GGV: conceptualization, funding, supervision, technical writing \u0026mdash;review and editing, visualization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding sources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study received no additional support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData supporting the main objectives and conclusions are presented in the manuscript and supplementary files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll samples collected complied with the animal use protocols approved by Texas A\u0026amp;M University\u0026rsquo;s Institutional Animal Care and Use Committee under the number 2022-0261.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors consent to publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eDepartment of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A\u0026amp;M University, College Station, TX, 77843, USA. \u003csup\u003e2\u003c/sup\u003eDepartment of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, 19104, USA. \u003csup\u003e3\u003c/sup\u003eDepartment of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, 66506, USA. \u003csup\u003e4\u003c/sup\u003eDepartment of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A\u0026amp;M University, College Station, TX, 77843, USA\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDantas-Torres F, Otranto D. Dirofilariosis in the Americas: a more virulent \u003cem\u003eDirofilaria immitis\u003c/em\u003e? Parasit Vectors.\u003cem\u003e \u003c/em\u003e2013;6 1:288; doi: 10.1186/1756-3305-6-288.\u003c/li\u003e\n\u003cli\u003eGenchi C, Kramer LH. The prevalence of \u003cem\u003eDirofilaria immitis\u003c/em\u003e and\u003cem\u003e D. repens\u003c/em\u003e in the Old World. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2020;280:108995; doi: 10.1016/j.vetpar.2019.108995.\u003c/li\u003e\n\u003cli\u003ePerles L, Dantas-Torres F, Kr\u0026uuml;cken J, Morch\u0026oacute;n R, Walochnik J, Otranto D. Zoonotic dirofilariases: one, no one, or more than one parasite. Trends Parasitol.\u003cem\u003e \u003c/em\u003e2024;40 3:257-70; doi: 10.1016/j.pt.2023.12.007.\u003c/li\u003e\n\u003cli\u003eWang D, Bowman DD, Brown HE, Harrington LC, Kaufman PE, Mckay T, Nelson CH, Sharp JL, Lund R. Factors influencing U.S. canine heartworm (\u003cem\u003eDirofilaria immitis\u003c/em\u003e) prevalence. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2014;7 1:264; doi: 10.1186/1756-3305-7-264.\u003c/li\u003e\n\u003cli\u003eGeary TG. New paradigms in research on \u003cem\u003eDirofilaria immitis\u003c/em\u003e. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2023;16 1; doi: 10.1186/s13071-023-05762-9.\u003c/li\u003e\n\u003cli\u003eCompanion Animal Parasite Council: Canine Parasite Prevalence Maps (United States).https://capcvet.org/maps/#/ (2025). Accessed 11 August 2025.\u003c/li\u003e\n\u003cli\u003eNelson CT, McCall JW, Moorhead A, Starkey LA, Ames M: American Heartworm Society: Current canine guidelines for prevention, diagnosis, and management of heartworm (\u003cem\u003eDirofilaria immitis\u003c/em\u003e) infection in dogs.Available at: https://www.heartwormsociety.org/ (2024). Accessed June 14 2024.\u003c/li\u003e\n\u003cli\u003eMcCall JW, Genchi C, Kramer LH, Guerrero J, Venco L. Heartworm disease in animals and humans. Adv Parasitol.\u003cem\u003e \u003c/em\u003e2008;66:193-285; doi: 10.1016/s0065-308x(08)00204-2.\u003c/li\u003e\n\u003cli\u003eDantas-Torres F, Ketzis J, Mihalca AD, Baneth G, Otranto D, Tort GP, et al. TroCCAP recommendations for the diagnosis, prevention and treatment of parasitic infections in dogs and cats in the tropics. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2020;283:109167; doi: 10.1016/j.vetpar.2020.109167.\u003c/li\u003e\n\u003cli\u003eBowman DD, Atkins CE. Heartworm Biology, Treatment, and Control. Vet Clin North Am Small Anim Pract.\u003cem\u003e \u003c/em\u003e2009;39 6:1127-58; doi: 10.1016/j.cvsm.2009.06.003. \u003c/li\u003e\n\u003cli\u003eRojas A, Rojas D, Montenegro VM, Baneth G. Detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e and other arthropod-borne filarioids by an HRM real-time qPCR, blood-concentrating techniques and a serological assay in dogs from Costa Rica. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2015;8 1; doi: 10.1186/s13071-015-0783-8. \u003c/li\u003e\n\u003cli\u003eTahir D, Bittar F, Barr\u0026eacute;-Cardi H, Sow D, Dahmani M, Mediannikov O, et al. Molecular survey of \u003cem\u003eDirofilaria immitis\u003c/em\u003e and \u003cem\u003eDirofilaria repens\u003c/em\u003e by new real-time TaqMan(\u0026reg;) PCR assay in dogs and mosquitoes (Diptera: Culicidae) in Corsica (France). Vet Parasitol.\u003cem\u003e \u003c/em\u003e2017;235:1-7; doi: 10.1016/j.vetpar.2017.01.002.\u003c/li\u003e\n\u003cli\u003eTorres-Chable OM, Baak-Baak CM, Cigarroa-Toledo N, Blitvich BJ, Brito-Argaez LG, Alvarado-Kantun YN, et al. Molecular detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in dogs and mosquitoes in Tabasco, Mexico. J Vector Borne Dis.\u003cem\u003e \u003c/em\u003e2018;55 2:151-8; doi: 10.4103/0972-9062.242563.\u003c/li\u003e\n\u003cli\u003eScavo NA, Zecca IB, Sobotyk C, Saleh MN, Lane SK, Olson MF, et al. High prevalence of canine heartworm, \u003cem\u003eDirofilaria immitis\u003c/em\u003e, in pet dogs in south Texas, USA, with evidence of \u003cem\u003eAedes aegypti\u003c/em\u003e mosquitoes contributing to transmission. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2022;15 1; doi: 10.1186/s13071-022-05514-1.\u003c/li\u003e\n\u003cli\u003eKhouri NK, Singh S, Noble SAA, Kirlew TV, Golding MAJ, Ali I, et al. Prevalence of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in dogs in Jamaica. Parasitol Res.\u003cem\u003e \u003c/em\u003e2024;123 12:411; doi: 10.1007/s00436-024-08434-4.\u003c/li\u003e\n\u003cli\u003eNegron V, Saleh MN, Sobotyk C, Luksovsky JL, Harvey TV, Verocai GG. Probe-based qPCR as an alternative to modified Knott\u0026rsquo;s test when screening dogs for heartworm (\u003cem\u003eDirofilaria immitis\u003c/em\u003e) infection in combination with antigen detection tests. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2022;15 1; doi: 10.1186/s13071-022-05372-x.\u003c/li\u003e\n\u003cli\u003eLedesma N, Harrington L. Mosquito vectors of dog heartworm in the United States: vector status and factors influencing transmission efficiency. Top Companion Anim Med.\u003cem\u003e \u003c/em\u003e2011;26 4:178-85; doi: 10.1053/j.tcam.2011.09.005.\u003c/li\u003e\n\u003cli\u003eLudlam KW, Jachowski LA, Jr., Otto GF. Potential vectors of \u003cem\u003eDirofilaria immitis\u003c/em\u003e. J Am Vet Med Assoc.\u003cem\u003e \u003c/em\u003e1970;157 10:1354-9.\u003c/li\u003e\n\u003cli\u003eNoack S, Harrington J, Carithers D, S., Kaminsky R, Selzer P, M. Heartworm disease \u0026ndash; Overview, intervention, and industry perspective. Int J Parasitol Drugs Drug Resist.\u003cem\u003e \u003c/em\u003e2021;16:65-89; doi: 10.1016/j.ijpddr.2021.03.004.\u003c/li\u003e\n\u003cli\u003eWatts KJ, Courteny CH, Reddy GR. Development of a PCR- and probe-based test for the sensitive and specific detection of the dog heartworm, \u003cem\u003eDirofilaria immitis, \u003c/em\u003ein its mosquito intermediate host. Mol Cell Probes.\u003cem\u003e \u003c/em\u003e1999;13 6:425-30; doi: 10.1006/mcpr.1999.0270.\u003c/li\u003e\n\u003cli\u003eMorch\u0026oacute;n R, Carret\u0026oacute;n E, Gonz\u0026aacute;lez Miguel J, Mellado Hern\u0026aacute;ndez I. Heartworm disease (\u003cem\u003eDirofilaria immitis\u003c/em\u003e) and their vectors in Europe \u0026ndash; new distribution trends. Front Physiol.\u003cem\u003e \u003c/em\u003e2012;3 - 2012; doi: 10.3389/fphys.2012.00196. \u003c/li\u003e\n\u003cli\u003eRiahi SM, Yusuf MA, Azari-Hamidian S, Solgi R. Prevalence of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in mosquitoes (Diptera) - systematic review and meta-analysis. J Nematol.\u003cem\u003e \u003c/em\u003e2021;53; doi: 10.21307/jofnem-2021-012.\u003c/li\u003e\n\u003cli\u003eTran TD, Nelms BM, Koschik ML, Scott JJ, Thiemann T. Prevalence of filarial parasites in field-caught mosquitoes in northwestern California. J Vector Ecol.\u003cem\u003e \u003c/em\u003e2022;47 1; doi: 10.52707/1081-1710-47.1.61.\u003c/li\u003e\n\u003cli\u003eSpence Beaulieu MR, Federico JL, Reiskind MH. Mosquito diversity and dog heartworm prevalence in suburban areas. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2020;13 1; doi: 10.1186/s13071-019-3874-0.\u003c/li\u003e\n\u003cli\u003eVillanueva-Saz S, Giner J, Verde M, Yzuel A, Lacasta D, Ru\u0026iacute;z H, Basurco A, Gonz\u0026aacute;lez A, Marteles D, Fern\u0026aacute;ndez A. First serological study of \u003cem\u003eDirofilaria immitis \u003c/em\u003eantibodies in household domestic ferrets (\u003cem\u003eMustela putorius furo\u003c/em\u003e) in southern Spain \u0026ndash; Short communication. Acta Vet Hung.\u003cem\u003e \u003c/em\u003e2022;70 4:282-6; doi: 10.1556/004.2022.00032.\u003c/li\u003e\n\u003cli\u003eMoroni B, Rossi L, Meneguz PG, Orusa R, Zoppi S, Robetto S, Marucco F, Tizzani P. \u003cem\u003eDirofilaria immitis\u003c/em\u003e in wolves recolonizing northern Italy: are wolves competent hosts? Parasit Vectors.\u003cem\u003e \u003c/em\u003e2020;13 1; doi: 10.1186/s13071-020-04353-2.\u003c/li\u003e\n\u003cli\u003eBarrantes Murillo DF, Moye A, Wang C. Heat Treatment Augments Antigen Detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in Apparently Healthy Companion Dogs (3.8% to 7.3%): Insights from a Large-Scale Nationwide Survey across the United States. Pathogens. 2024;13(1):56. doi: 10.3390/pathogens13010056.\u003c/li\u003e\n\u003cli\u003eMosley IA, Zecca IB, Tyagi N, Harvey TV, Hamer SA, Verocai GG. Occurrence of \u003cem\u003eDirofilaria immitis\u003c/em\u003e infection in shelter cats in the lower Rio Grande Valley region in South Texas, United States, using integrated diagnostic approaches. Vet Parasitol Reg Stud Reports.\u003cem\u003e \u003c/em\u003e2023;41:100871; doi: 10.1016/j.vprsr.2023.100871.\u003c/li\u003e\n\u003cli\u003eNelson CT. \u003cem\u003eDirofilaria immitis\u003c/em\u003e in cats: diagnosis and management. Compend Contin Educ Vet.\u003cem\u003e \u003c/em\u003e2008;30 7:393-400; quiz \u003c/li\u003e\n\u003cli\u003eSobotyk C, Nguyen N, Negr\u0026oacute;n V, Varner A, Saleh MN, Hilton C, et al. Detection of \u003cem\u003eDirofilaria immitis \u003c/em\u003evia integrated serological and molecular analyses in coyotes from Texas, United States. Int J Parasitol Parasites Wildl.\u003cem\u003e \u003c/em\u003e2022;18:20-4; doi: 10.1016/j.ijppaw.2022.03.012.\u003c/li\u003e\n\u003cli\u003eDantas-Torres F, Otranto D. Overview on \u003cem\u003eDirofilaria immitis\u003c/em\u003e in the Americas, with notes on other filarial worms infecting dogs. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2020;282:109113; doi: 10.1016/j.vetpar.2020.109113.\u003c/li\u003e\n\u003cli\u003eLittle SE, Raymond MR, Thomas JE, Gruntmeir J, Hostetler JA, Meinkoth JH, Blagburn BL. Heat treatment prior to testing allows detection of antigen of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in feline serum. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2014;7 1:1; doi: 10.1186/1756-3305-7-1. \u003c/li\u003e\n\u003cli\u003eMendoza-Roldan JA, Gabrielli S, Cascio A, Manoj RRS, Bezerra-Santos MA, Benelli G, Brianti E, Latrofa MS, Otranto D. Zoonotic \u003cem\u003eDirofilaria immitis\u003c/em\u003e and \u003cem\u003eDirofilaria repens\u003c/em\u003e infection in humans and an integrative approach to the diagnosis. Acta Trop.\u003cem\u003e \u003c/em\u003e2021;223:106083; doi: 10.1016/j.actatropica.2021.106083.\u003c/li\u003e\n\u003cli\u003eMiterp\u0026aacute;kov\u0026aacute; M, Antolov\u0026aacute; D, Rampalov\u0026aacute; J, Undesser M, Krajčovič T, V\u0026iacute;chov\u0026aacute; B. \u003cem\u003eDirofilaria immitis\u003c/em\u003e pulmonary dirofilariasis, Slovakia. Emerg Infect Dis.\u003cem\u003e \u003c/em\u003e2022;28 2:482-5; doi: 10.3201/eid2802.211963.\u003c/li\u003e\n\u003cli\u003eMontoya-Alonso JA, Carret\u0026oacute;n E, Corbera JA, Juste MC, Mellado I, Morch\u0026oacute;n R, Sim\u0026oacute;n F. Current prevalence of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in dogs, cats and humans from the island of Gran Canaria, Spain. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2011;176 4:291-4; doi: 10.1016/j.vetpar.2011.01.011.\u003c/li\u003e\n\u003cli\u003eSim\u0026oacute;n F, Siles-Lucas M, Morch\u0026oacute;n R, Gonz\u0026aacute;lez-Miguel J, Mellado I, Carret\u0026oacute;n E, Montoya-Alonso JA. Human and animal dirofilariasis: the emergence of a zoonotic mosaic. Clin Microbiol Rev.\u003cem\u003e \u003c/em\u003e2012;25 3:507-44; doi: 10.1128/cmr.00012-12.\u003c/li\u003e\n\u003cli\u003eZajac A, Conboy GA, Little SE, Reichard MV. Veterinary Clinical parasitology. Ninth edition. edn. Hoboken, N.J.: Wiley Blackwell; 2021.\u003c/li\u003e\n\u003cli\u003ePietrzak D, Łuczak JW, Wiśniewski M. Beyond Tradition: Exploring Cutting-Edge Approaches for Accurate Diagnosis of Human Filariasis. Pathogens.\u003cem\u003e \u003c/em\u003e2024;13 6; doi: 10.3390/pathogens13060447.\u003c/li\u003e\n\u003cli\u003eGenchi C, Venco L, Genchi M. Guideline for the laboratory diagnosis of canine and feline \u003cem\u003eDirofilaria\u003c/em\u003e infections. 2007; 137-144.\u003c/li\u003e\n\u003cli\u003eMcCall JW, Supakorndej N, Donoghue A, Turnbull RK, Radecki S. Evaluation of the performance of canine heartworm antigen test kits licensed for use by veterinarians and canine heartworm antigen tests conducted by diagnostic laboratories. 2001; 97-104.\u003c/li\u003e\n\u003cli\u003eStarkey LA, Bowles JV, Payton ME, Blagburn BL. Comparative evaluation of commercially available point-of-care heartworm antigen tests using well-characterized canine plasma samples. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2017;10 Suppl 2:475; doi: 10.1186/s13071-017-2447-3.\u003c/li\u003e\n\u003cli\u003eMurillo DFB, Wang C. Pre-treatment of canine plasma with heat, rather than acid, efficiently enhances \u003cem\u003eDirofilaria immitis\u003c/em\u003e antigen detection. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2023;16 1; doi: 10.1186/s13071-023-06083-7.\u003c/li\u003e\n\u003cli\u003eTorres-Chable OM, Brito-Argaez LG, Islas-Flores IR, Zaragoza-Vera CV, Zaragoza-Vera M, Arjona-Jimenez G, Baak-Baak CM, Cigarroa-Toledo N, Gonzalez-Gardu\u0026ntilde;o R, Machain-Williams CI, Garcia-Rejon JE. \u003cem\u003eDirofilaria immitis\u003c/em\u003e proteins recognized by antibodies from individuals living with microfilaremic dogs. J Infect Dev Ctries.\u003cem\u003e \u003c/em\u003e2020;14 12:1442-7; doi: 10.3855/jidc.12711.\u003c/li\u003e\n\u003cli\u003eRjeibi MR, Rouatbi M, Mabrouk M, Tabib I, Rekik M, Gharbi M. Molecular study of \u003cem\u003eDirofilaria immitis\u003c/em\u003e and \u003cem\u003eDirofilaria repens\u003c/em\u003e in dogs from Tunisia. Transbound Emerg Dis.\u003cem\u003e \u003c/em\u003e2017;64 5:1505-9; doi: 10.1111/tbed.12541.\u003c/li\u003e\n\u003cli\u003eSmith R, Murillo DFB, Chenoweth K, Barua S, Kelly PJ, Starkey L, Blagburn B, Wood T, Wang C. Nationwide molecular survey of \u003cem\u003eDirofilaria immitis\u003c/em\u003e and \u003cem\u003eDirofilaria repens\u003c/em\u003e in companion dogs and cats, United States of America. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2022;15 1:367; doi: 10.1186/s13071-022-05459-5.\u003c/li\u003e\n\u003cli\u003eBeall MJ, Arguello-Marin A, Drexel J, Liu J, Chandrashekar R, Alleman AR. Validation of immune complex dissociation methods for use with heartworm antigen tests. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2017;10 S2; doi: 10.1186/s13071-017-2442-8.\u003c/li\u003e\n\u003cli\u003eGruntmeir JM, Long MT, Blagburn BL, Walden HS. Canine heartworm and heat treatment: An evaluation using a well based enzyme-linked immunosorbent assay (ELISA) and canine sera with confirmed heartworm infection status. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2020;283:109169; doi: 10.1016/j.vetpar.2020.109169.\u003c/li\u003e\n\u003cli\u003eLittle SE, Munzing C, Heise SR, Allen KE, Starkey LA, Johnson EM, Meinkoth J, Reichard MV. Pre-treatment with heat facilitates detection of antigen of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in canine samples. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2014;203 1-2:250-2; doi: 10.1016/j.vetpar.2014.01.007.\u003c/li\u003e\n\u003cli\u003eDrake J, Gruntmeir J, Merritt H, Allen L, Little SE. False negative antigen tests in dogs infected with heartworm and placed on macrocyclic lactone preventives. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2015;8 1:68; doi: 10.1186/s13071-015-0698-4. \u003c/li\u003e\n\u003cli\u003eLittle S, Saleh M, Wohltjen M, Nagamori Y. Prime detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e: understanding the influence of blocked antigen on heartworm test performance. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2018;11 1; doi: 10.1186/s13071-018-2736-5. \u003c/li\u003e\n\u003cli\u003eDiGangi BA, Dworkin C, Stull JW, O\u0026apos;Quin J, Elser M, Marsh AE, et al. Impact of heat treatment on\u003cem\u003e Dirofilaria immitis\u003c/em\u003e antigen detection in shelter dogs. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2017;10 Suppl 2:483; doi: 10.1186/s13071-017-2443-7.\u003c/li\u003e\n\u003cli\u003eCarmichael J, McCall S, DiCosty U, Mansour A, Roycroft L. Evaluation of \u003cem\u003eDirofilaria immitis\u003c/em\u003e antigen detection comparing heated and unheated serum in dogs with experimental heartworm infections. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2017;10 Suppl 2:486; doi: 10.1186/s13071-017-2445-5.\u003c/li\u003e\n\u003cli\u003eLane JN, Litster A, Little SE, Rodriguez JY, Mwacalimba KK, Sundstrom KD, Amirian ES, Guerios SD, Serrano MA, Hays KM, Levy JK. Optimizing heartworm diagnosis in dogs using multiple test combinations. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2021;14 1; doi: 10.1186/s13071-021-04715-4.\u003c/li\u003e\n\u003cli\u003eHays KM, Rodriguez JY, Little SE, Litster AL, Mwacalimba KK, Sundstrom KD, Amondie DM, Serrano MA, Guerios SD, Lane JN, Levy JK. Heartworm prevalence in dogs versus cats: Multiple diagnostic modalities provide new insights. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2020;277s:100027; doi: 10.1016/j.vpoa.2020.100027.\u003c/li\u003e\n\u003cli\u003eSchnyder M, Deplazes P. Cross-reactions of sera from dogs infected with \u003cem\u003eAngiostrongylus vasorum\u003c/em\u003e in commercially available \u003cem\u003eDirofilaria immitis\u003c/em\u003e test kits. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2012;5:258; doi: 10.1186/1756-3305-5-258.\u003c/li\u003e\n\u003cli\u003eSobotyk C, Savadelis MD, Verocai GG. Detection and cross-reaction of \u003cem\u003eDirofilaria repens \u003c/em\u003eusing a commercial heartworm antigen test kit. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2021;289:109302; doi: 10.1016/j.vetpar.2020.109302.\u003c/li\u003e\n\u003cli\u003eVenco L, Manzocchi S, Genchi M, Kramer LH. Heat treatment and false-positive heartworm antigen testing in ex vivo parasites and dogs naturally infected by \u003cem\u003eDirofilaria repens\u003c/em\u003e and \u003cem\u003eAngiostrongylus vasorum\u003c/em\u003e. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2017;10 Suppl 2:476; doi: 10.1186/s13071-017-2444-6.\u003c/li\u003e\n\u003cli\u003eAroch I, Rojas A, Slon P, Lavy E, Segev G, Baneth G. Serological cross-reactivity of three commercial in-house immunoassays for detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e antigens with \u003cem\u003eSpirocerca lupi\u003c/em\u003e in dogs with benign esophageal spirocercosis. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2015;211 3-4:303-5; doi: 10.1016/j.vetpar.2015.06.010.\u003c/li\u003e\n\u003cli\u003eMagnis J, Lorentz S, Guardone L, Grimm F, Magi M, Naucke TJ, Deplazes P. Morphometric analyses of canine blood microfilariae isolated by the Knott\u0026rsquo;s test enables \u003cem\u003eDirofilaria immitis\u003c/em\u003e and \u003cem\u003eD. repens\u003c/em\u003e species-specific and \u003cem\u003eAcanthocheilonema\u003c/em\u003e (syn.\u003cem\u003e Dipetalonema\u003c/em\u003e) genus-specific diagnosis. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2013;6 1:48; doi: 10.1186/1756-3305-6-48.\u003c/li\u003e\n\u003cli\u003eLaidoudi Y, Davoust B, Varloud M, Niang EHA, Fenollar F, Mediannikov O. Development of a multiplex qPCR-based approach for the diagnosis of \u003cem\u003eDirofilaria immitis, D. repens\u003c/em\u003e and \u003cem\u003eAcanthocheilonema reconditum\u003c/em\u003e. Parasit Vectors.\u003cem\u003e \u003c/em\u003e2020;13 1:319; doi: 10.1186/s13071-020-04185-0. \u003c/li\u003e\n\u003cli\u003eCasiraghi M, Anderson TJC, Bandi C, Bazzocchi C, Genchi C. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of \u003cem\u003eWolbachia\u003c/em\u003e endosymbionts. Parasitol.\u003cem\u003e \u003c/em\u003e2001;122 1:93-103; doi: 10.1017/s0031182000007149.\u003c/li\u003e\n\u003cli\u003eFavia G, Lanfrancotti A, della Torre A, Cancrini G, Coluzzi M. Advances in the identification of \u003cem\u003eDirofilaria repens\u003c/em\u003e and\u003cem\u003e Dirofilaria immitis\u003c/em\u003e by a PCR-based approach. Parassitologia.\u003cem\u003e \u003c/em\u003e1997;39 4:401-2.\u003c/li\u003e\n\u003cli\u003eLau DC, Power RI, \u0026Scaron;lapeta J. Exploring multiplex qPCR as a diagnostic tool for detecting microfilarial DNA in dogs infected with \u003cem\u003eDirofilaria immitis\u003c/em\u003e: A comparative analysis with the modified Knott\u0026apos;s test. Vet Parasitol.\u003cem\u003e \u003c/em\u003e2024;325:110097; doi: 10.1016/j.vetpar.2023.110097.\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 2018;35 6:1547-9; doi: 10.1093/molbev/msy096.\u003c/li\u003e\n\u003cli\u003eDohoo IR, Martin W, Stryhn H. Veterinary epidemiologic research. Second edition. edn. Charlotte, P.E.I.: VER, Inc.; 2009.\u003c/li\u003e\n\u003cli\u003eMcHugh ML. Interrater reliability: the kappa statistic. Biochem Med (Zagreb).\u003cem\u003e \u003c/em\u003e2012;22 3:276-82.\u003c/li\u003e\n\u003cli\u003eCohen J. A Coefficient of Agreement for Nominal Scales. Educational and Psychological Measurement.\u003cem\u003e \u003c/em\u003e1960;20 1:37-46; doi: 10.1177/001316446002000104. \u003c/li\u003e\n\u003cli\u003eDantas-Torres F, Ketzis J, Mihalca AD, Baneth G, Otranto D, Tort GP, Watanabe M, Linh BK, Inpankaeq T, Jimenez Castro PD, Borr\u0026aacute;s P, Arumugam S, Penzhorn BL, Yba\u0026ntilde;ez AP, Irwin P, Traub RJ. TroCCAP recommmendations for the diagnosis, prevention and treatment of parasitic infections in dogs and cats in the tropics. Vet. Parasitol. 2020;283:109167; doi: 10.1016/j.vetpar.2020.109167.\u003c/li\u003e\n\u003cli\u003eMurillo DFB, Wang C. Immune-complex dissociation for heatrworm diagnosis. 2024;14:September/October. \u003c/li\u003e\n\u003cli\u003eDimzas D, Aindelis G, Tamvakis A, Chatzoudi S, Chlichlia K, Panopoulou M, Diakou A. \u003cem\u003eDirofilaria immitis\u003c/em\u003e and \u003cem\u003eDirofilaria repens\u003c/em\u003e: Investigating the prevalence of zoonotic parasites in dogs and humans in a hyperenzootic areas, Animals (Basel). 2024;14(17):2529; doi: 10.3390/ani14172529.\u003c/li\u003e\n\u003cli\u003eCimpan AA, Baneth G, Nachum-Biala Y, Miron L, Rojas A. \u003cem\u003eDirofilaria repens\u003c/em\u003e predominates in shelter dogs from South Romania. Comp Immunol Microbio Infect Dis. 2022;84:101793; doi: 10.1016/j.cimid.2022.101793.\u003c/li\u003e\n\u003cli\u003eAlsarraf M, Levytska V, Mierzajewska EJ, Poliukhovych V, Rodo A, Alsarraf M, Kavalevich D, Dwużnik-Szarek D, Behnke JM, Bajer A. Emerging of \u003cem\u003eDirofilaria \u003c/em\u003espp. infection in Northeastern Europe: high prevalence of \u003cem\u003eDirofilria repens\u003c/em\u003e in sled dogs kennels from the Baltic countries. Sci Rep. 2021;11(1):1068; doi: 10.1038/s41598-020-80208-1.\u003c/li\u003e\n\u003cli\u003eFehr JE, Schnyder M, Joekel DE, Pantchev N, Sarkunas M, Torgerson P, Deplazes P. Estimated specific antibody-based true sero-prevalences of canine filariosis in dogs in Central Europe and the UK. Parasitol Res. 2022;121(12):3671-3680. Doi: 10.1007/s00436-022-07965-1. \u003c/li\u003e\n\u003cli\u003eCiuca L, Vismarra A, Lebon W, Beugnet F, Morchon R, Rinaldi L, Cringoli G, Kramer L, Genchi M. New insights into the biology, diagnosis and immune response to \u003cem\u003eDirofilaria repens\u003c/em\u003e in the canine host. Vet Parasitol X. 2020;5:4:100029; doi: 10.1016/j.vpoa.2020.100029.\u003c/li\u003e\n\u003cli\u003e75. Ballesteros N, Casta\u0026ntilde;eda S, Mu\u0026ntilde;oz M, Fl\u0026oacute;rez A, Pinilla JC, Ram\u0026iacute;rez JD. The first report of \u003cem\u003eDirofilaria repens\u003c/em\u003e infection in dogs from Colombia. Parasitol Res. 2023;122(10)2445-2450; doi: 10.1007?s00436-023-07926-z. \u003c/li\u003e\n\u003cli\u003eRiese K, Baker E, Dennis MM, Williamson R, Gerhold R. Corrigendum to \u0026ldquo;Two cases of \u003cem\u003eAngiostrongylus vasorum\u003c/em\u003e, a cardiopulmonary nematode, in a black bear and coyotes of Tennessee\u0026rdquo; [Veterinary Parasitology: Regional Studies and Reports, Volume 54, September 2024, 101079]. Vet Parasitol Reg Stud Reports. 2024;55:101101; doi: 10.1016/j.vprsr.2024.101101.\u003c/li\u003e\n\u003cli\u003eWilliams LBA, Buswell ML, Perisho NA. First autochthonous case of \u003cem\u003eAngiostrongylus vasorum \u003c/em\u003ein a domestic dog in the United States. J Am Vet Med Assoc. 2024;262(10):1-3; doi: 10.2460/javma.24.06.0408.\u003c/li\u003e\n\u003cli\u003ePence DB, Stone JE. Visceral lesions in wild carnivores naturally infected with \u003cem\u003eSpirocerca lupi\u003c/em\u003e. Vet Pathol. 1978;15(3):332-31; doi: 10.1177/030098587801500306.\u003c/li\u003e\n\u003cli\u003eMorrison EE, Gier HT. Parasitic infection of \u003cem\u003eFilaroides osleri\u003c/em\u003e, \u003cem\u003eCapillaria aerophila\u003c/em\u003e and \u003cem\u003eSpirocerca lupi\u003c/em\u003e in coyotes from the Southwestern United States. J Wildl Dis. 1979;15(4):557-9; doi: 10.7589/0090-3558-15.4.557.\u003c/li\u003e\n\u003cli\u003evan der Merwe LL, Kirberger RM, Clift S, Williams M, Keller N, Naidoo V. \u003cem\u003eSpirocerca lupi\u003c/em\u003e infection in the dog: a review. Vet J. 2008;176(3):294-309; doi: 10.1016/j.tvjl.2007.02.032.\u003c/li\u003e\n\u003cli\u003eAlfaro-Segura P, Robleto-Quesada J, Montenegro-Hidalgo VM, Molina-Mora JA, Baneth G, Verocai GG, Rodriguez-Vivas RI, Rojas A. Elucidating \u003cem\u003eSpirocerca lupi\u003c/em\u003e spread in the Americas by using phylogenetic and phylogeographic analyses. Front. Parasitol. 2:1249593. doi: 10.3389/fpara.2023.1249593.\u003c/li\u003e\n\u003cli\u003eRamos RAN, Hakimi H, Salomon J, Busselman RE, Curtis-Robles R, Hodo CL, Hamer SA, Verocai GG. \u003cem\u003eDirofilaria immitis\u003c/em\u003e and \u003cem\u003eDirofilaria striata\u003c/em\u003e (Spirurifa: Onchocercidae) detected with wild carnivores from Texas, United States. Int J Parasitol Parasites Wildl. 2024;12:24:100954; doi: 10.1016/j.ijppaw.2024.100954.\u003c/li\u003e\n\u003cli\u003eOrihel TC, Ash LR. Occurrence of \u003cem\u003eDirofilaria striata\u003c/em\u003e in the bobcat (\u003cem\u003eLynx rufus\u003c/em\u003e) in Louisiana with observations on its larval development. J Parasitol. 1964;50:590-1;\u003c/li\u003e\n\u003cli\u003eWyatt D, Santoro D, Deabold K, Gruntmeir J, Childress A, Craft WF, Walden HDS, Wellehan JFX. Subcutaneous nodules and dermatitis associated with non-\u003cem\u003eimimitis\u003c/em\u003e non-\u003cem\u003erepens\u003c/em\u003e dirofilariosis morphologically consistent with \u003cem\u003eDirofilaria striata \u003c/em\u003ein a 2-year-old male domestic cat in Florida, USA. Vet Q. 2020;40(1):215-222; doi: 10.1080/01652176.2020.1814972.\u003c/li\u003e\n\u003cli\u003ePacheco G, Tulloch GS. Microfilariae of \u003cem\u003eDirofilaria striata \u003c/em\u003ein a dog. J Parasitol. 1970;56(2):248; \u003c/li\u003e\n\u003cli\u003eGomes-de-S\u0026aacute; G, Santos-Silva S, Moreira AS, Barradas PF, Amorim I, Cardoso L, Mesquita JR. \u003cem\u003eDirofilaria immitis\u003c/em\u003e antigenemia and microfilariae in Iberian wolves and red foxes from Portugal. Parasit Vectors. 2022;15(1):119; doi: 10.1186/s13071-022-05170-5. \u003c/li\u003e\n\u003cli\u003eFagundes-Moreira R, Bezerra-Santos MA, May-Junior JA, Berger L, Baggio-Souza V, Souza UA, Bilhalva LC, Reis AO, Wagner PGC, Peters FB, Favarini MO, Albano APN, Sartorello L, Rampim LE, Tirelli FP, Otranto D, Soares JF. Correction to: \u003cem\u003eDirofilaria immitis\u003c/em\u003e and Onchocercidae spp. in wild felids from Brazil. Parasitol Res. 2024;123(5):220. doi: 10.1007/s00436-024-08235-9. Erratum for: Parasitol Res. 2024;123(4):195. doi: 10.1007/s00436-024-08209-x.\u003c/li\u003e\n\u003cli\u003eNaletilić \u0026Scaron;, Gagović E, Mihaljević Ž, Polkinghorne A, Beck A, Beck R. Detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e in golden jackals (\u003cem\u003eCanis aureus\u003c/em\u003e L.) but not in red foxes (\u003cem\u003eVulpes vulpes\u003c/em\u003e L.) and European badgers (\u003cem\u003eMeles meles\u003c/em\u003e L.) in Croatia. Parasit Vectors. 2024;17(1):490. doi: 10.1186/s13071-024-06576-z. \u003c/li\u003e\n\u003cli\u003eAlho AM, Marcelino I, Colella V, Flanagan C, Silva N, Correia JJ, Latrofa MS, Otranto D, Madeira de Carvalho L. \u003cem\u003eDirofilaria immitis\u003c/em\u003e in pinnipeds and a new host record. Parasit Vectors. 2017;10(1):142. doi: 10.1186/s13071-017-2073-0.\u003c/li\u003e\n\u003cli\u003eUpton KE, Sobotyk C, Edwards EE, Verocai GG. \u003cem\u003eDirofilaria immitis\u003c/em\u003e in an Asian small-clawed otter (\u003cem\u003eAonyx cinereus\u003c/em\u003e) from southeastern Louisiana, United States. Vet Parasitol Reg Stud Reports. 2022;29:100703. doi: 10.1016/j.vprsr.2022.100703.\u003c/li\u003e\n\u003cli\u003eGregory TM, Livingston I, Hawkins EC, Loyola A, Cave A, Vaden SL, Deresienski D, Breen M, Riofr\u0026iacute;o-Lazo M, Lewbart GA, P\u0026aacute;ez-Rosas D. \u003cem\u003eDirofilaria immitis\u003c/em\u003e identified in Galapagos Sea Lions (\u003cem\u003eZalophus wollebaeki\u003c/em\u003e): A wildlife health and conservation concern. J Wildl Dis. 2023;59(3):487-494. doi: 10.7589/JWD-D-22-00119.\u003c/li\u003e\n\u003cli\u003eBrown HE, Harrington LC, Kaufman PE, McKay T, Bowman DD, Nelson CT, Wang D, Lund R. Key factors influencing canine heartworm, \u003cem\u003eDirofilaria immitis\u003c/em\u003e, in the United States. Parasit Vectors. 2012;5:245. doi: 10.1186/1756-3305-5-245. \u003c/li\u003e\n\u003cli\u003eBowman DD, Liu Y, McMahan CS, Nordone SK, Yabsley MJ, Lund RB. Forecasting United States heartworm \u003cem\u003eDirofilaria immitis\u003c/em\u003e prevalence in dogs. Parasit Vectors. 2016;9(1):540. doi: 10.1186/s13071-016-1804-y.\u003c/li\u003e\n\u003cli\u003eNelson CT, McCall JW, Moorhead A, Starkey L, Ames M, Cousins WM. Feline heartworm guidelines. American Heartworm Society; 2024. Available at: https://www.heartwormsociety.org/veterinary-resources/american-heartworm-society-guidelines. Accessed September 25 2025.\u003c/li\u003e\n\u003cli\u003eMurillo DFB, Starkey L, Wood T, Smith R, Blagburn B, Bowles J, Allen H, Lewis C, Shu Y, Wang C. A nationwide serological survey for \u003cem\u003eDirofilaria immitis\u003c/em\u003e in companion cats in the United States of America: 3.5% antibody and 0.3% antigen positivity. Parasit Vectors. 2023;16(1):296. doi: 10.1186/s13071-023-05829-7.\u003c/li\u003e\n\u003cli\u003eGruntmeir JM, Adolph CB, Thomas JE, Reichard MV, Blagburn BL, Little SE. Increased detection of \u003cem\u003eDirofilaria immitis\u003c/em\u003e antigen in cats after heat pretreatment of samples. J Feline Med Surg. 2017 Oct;19(10):1013-1016. doi: 10.1177/1098612X16670562. \u003c/li\u003e\n\u003cli\u003eHermesmeyer M, Limberg-Child RK, Murphy AJ, Mansfield LS. Prevalence of \u003cem\u003eDirofilaria immitis\u003c/em\u003e infection among shelter cats. J Am Vet Med Assoc. 2000 Jul 15;217(2):211-2.\u003c/li\u003e\n\u003cli\u003eVillanueva-Saz S, Giner J, Verde M, Yzuel A, Gonz\u0026aacute;lez A, Lacasta D, Marteles D, Fern\u0026aacute;ndez A. Prevalence of microfilariae, antigen and antibodies of feline dirofilariosis infection (\u003cem\u003eDirofilaria immitis\u003c/em\u003e) in the Zaragoza metropolitan area, Spain. Vet Parasitol Reg Stud Reports. 2021;23:100541. doi: 10.1016/j.vprsr.2021.100541.\u003c/li\u003e\n\u003cli\u003eUpton KE, Budke CM, Verocai GG. Heartworm (\u003cem\u003eDirofilaria immitis\u003c/em\u003e) in carnivores kept in zoos in Texas, USA: risk perception, practices, and antigen detection. Parasit Vectors. 2023;16(1):150. doi: 10.1186/s13071-023-05750-z. \u003c/li\u003e\n\u003cli\u003eSavadelis MD, Day KM, Bradner JL, Wolstenholme AJ, Dzimianski MT, Moorhead AR. Efficacy and side effects of doxycycline versus minocycline in the three-dose melarsomine canine adulticidal heartworm treatment protocol. Parasit Vectors. 2018 Dec 27;11(1):671. doi: 10.1186/s13071-018-3264-z.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Primers and probes were designed for the amplification of the cytochrome c oxidase subunit 1 (\u003cem\u003ecox1\u003c/em\u003e) gene region of this study.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"775\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 331px;\"\u003e\n \u003cp\u003e\u0026nbsp;Sequence (5\u0026acute;- 3\u0026acute;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 279px;\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" style=\"width: 775px;\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eFil.COI.749-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 331px;\"\u003e\n \u003cp\u003eCATCCTGAGGTTTATGTTATTATTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 279px;\"\u003e\n \u003cp\u003e60\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eFil.COI.914-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 331px;\"\u003e\n \u003cp\u003eCWGTATACATATGATGRCCYCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 279px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" style=\"width: 775px;\"\u003e\n \u003cp\u003eProbes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eOriginal Probe\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 331px;\"\u003e\n \u003cp\u003e6FAM-CGGTGTTTGGGATTGTTAGTG-MGB-NFQ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 279px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eProbe 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 331px;\"\u003e\n \u003cp\u003e6FAM-GGTGTTTGGGATTGTTAGTGAA-MGB-NFQ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 279px;\"\u003e\n \u003cp\u003eCurrent Study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eProbe 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 331px;\"\u003e\n \u003cp\u003e6FAM-CCAGACTAGTATG-MGB-NFQ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 279px;\"\u003e\n \u003cp\u003eCurrent Study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eProbe 3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 331px;\"\u003e\n \u003cp\u003e6FAM-TATTTGGATTGCTGTATTGGGG-MGB-NFQ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 279px;\"\u003e\n \u003cp\u003eCurrent Study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Positivity of all heartworm diagnostic tests performed both individually and paired within shelter dogs (n=136) from Texas.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"608\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eDiagnostic test(s)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003eNo. of positive dogs (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e95% CI\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" style=\"width: 608px;\"\u003e\n \u003cp\u003eIndividual test\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eMK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e83 (61.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e52.2\u0026mdash;69.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003ePO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e91 (66.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e58.3\u0026mdash;71.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e81 (59.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e50.8\u0026mdash;67.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eP3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e93 (68.4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e59.8\u0026mdash;76.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eDiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e109 (80.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e72.4\u0026mdash;86.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eDiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epost-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e129 (94.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e89.6\u0026mdash;97.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003ePaired tests\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eMK + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e116 (85.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 111px;\"\u003e\n \u003cp\u003e78.2\u0026mdash;90.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eMK + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epost-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e135 (99.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e86.0\u0026mdash;100.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003ePO + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e114 (83.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e76.5\u0026mdash;89.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003ePO + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epost-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e131 (96.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e91.6\u0026mdash;98.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eP2 + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e113 (83.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e75.7\u0026mdash;89.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eP2 + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epost-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e131 (96.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e91.6\u0026mdash;98.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eP3 + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e115 (84.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e77.4\u0026mdash;90.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 219px;\"\u003e\n \u003cp\u003eP3 + DiroCHEK\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003epost-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003e132 (97.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e92.6\u0026mdash;99.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eMK: modified Knott\u0026rsquo;s; PO: Original probe; P2: Probe #2; P3: Probe #3; DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD: Pre-Immune Complex Dissociation; DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD: Post-Immune Complex Dissociation;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3.\u0026nbsp;\u003c/strong\u003eSummary of the level of agreement between diagnostic tests for heartworm detection.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"668\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eComparison of two tests\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(Test 1/Test 2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003ec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003ed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003eCohen\u0026rsquo;s Kappa\u003c/p\u003e\n \u003cp\u003e(\u0026kappa;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eAgreement Interpretation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eMK/PO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.6822\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eSubstantial\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eMK/P2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.8465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eAlmost Perfect\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eMK/P3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.6799\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eSubstantial\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eMK/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.3215\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eFair\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eMK/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e-0.0634\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003ePoor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003ePO/P2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.8428\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eAlmost perfect\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003ePO/P3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.8656\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eAlmost perfect\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003ePO/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.4827\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eModerate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003ePO/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.1133\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eSlight\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eP2/P3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.8102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eSubstantial\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eP2/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.4016\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eFair\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eP2/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.0770\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eSlight\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eP3/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.4710\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eModerate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003eP3/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e90\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.0784\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eSlight\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 199px;\"\u003e\n \u003cp\u003ePre-ICD/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 80px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e0.2953\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 148px;\"\u003e\n \u003cp\u003eFair\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e(\u003cem\u003eMK\u003c/em\u003e: modified Knott\u0026rsquo;s; \u003cem\u003ePO\u003c/em\u003e: Probe Original; \u003cem\u003eP2\u003c/em\u003e: Probe #2; \u003cem\u003eP3\u003c/em\u003e: Probe #3; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD\u003c/em\u003e: Pre-Immune Complex Dissociation; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD\u003c/em\u003e: Post-Immune Complex Dissociation;)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4.\u003c/strong\u003e Cochran\u0026rsquo;s Q test results for comparing six heartworm diagnostic tests individually.\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 220px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eComparison of individual methods\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 262px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eQ statistic\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003edf\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 220px;\"\u003e\n \u003cp\u003eMK\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"6\" style=\"width: 262px;\"\u003e\n \u003cp\u003e117.0\u003c/p\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 220px;\"\u003e\n \u003cp\u003ePO\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 220px;\"\u003e\n \u003cp\u003eP2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 220px;\"\u003e\n \u003cp\u003eP3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 220px;\"\u003e\n \u003cp\u003ePre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 220px;\"\u003e\n \u003cp\u003ePost-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eSignificant relationships (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05) are denoted by bold font\u003c/p\u003e\n\u003cp\u003e(\u003cem\u003edf\u003c/em\u003e: degrees of freedom; \u003cem\u003eMK\u003c/em\u003e: modified Knott\u0026rsquo;s; \u003cem\u003ePO\u003c/em\u003e: Original probe; \u003cem\u003eP2\u003c/em\u003e: Probe #2; \u003cem\u003eP3\u003c/em\u003e: Probe #3; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD\u003c/em\u003e: Pre-Immune Complex Dissociation; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD\u003c/em\u003e: Post-Immune Complex Dissociation;)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 5.\u003c/strong\u003e Post-hoc analysis of the Cochran\u0026rsquo;s Q test using a McNemar\u0026rsquo;s test for individual tests.\u0026nbsp;\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"255\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003ePost hoc analysis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eMK/PO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e0.115\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eMK/P2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e0.075\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eMK/P3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e0.041\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eMK/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eMK/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003ePO/P2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.002*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003ePO/P3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e0.726\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003ePO/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003ePO/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eP2/P3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eP2/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eP2/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eP3/Pre-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.003*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003eP3/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 156px;\"\u003e\n \u003cp\u003ePre-ICD/Post-ICD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 99px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e*\u003c/strong\u003eSignificant after Bonferroni correction (\u0026alpha;=0.008)\u003c/p\u003e\n\u003cp\u003e(\u003cem\u003eMK\u003c/em\u003e: modified Knott\u0026rsquo;s; \u003cem\u003ePO\u003c/em\u003e: Original probe; \u003cem\u003eP2\u003c/em\u003e: Probe #2; \u003cem\u003eP3\u003c/em\u003e: Probe #3; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD\u003c/em\u003e: Pre-Immune Complex Dissociation; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD\u003c/em\u003e: Post-Immune Complex Dissociation;)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 6.\u003c/strong\u003e Cochran\u0026rsquo;s Q test results for comparing paired diagnostic tests for heartworm detection.\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCombination\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eQ statistic\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003edf\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eMK+PO (A)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"15\" style=\"width: 208px;\"\u003e\n \u003cp\u003e340.519\u003c/p\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eMK+P2 (B)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eMK+P3 (C)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eMK+Pre-ICD (D)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eMK+Post-ICD (E)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003ePO+P2 (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003ePO+P3 (G)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003ePO+Pre-ICD (H)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003ePO+Post-ICD (I)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eP2+P3 (J)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eP2+Pre-ICD (K)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eP2+Post-ICD (L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eP3+Pre-ICD (M)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003eP3+Post-ICD (N)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 208px;\"\u003e\n \u003cp\u003ePre-ICD+Post-ICD (O)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eSignificant relationships (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05) are denoted by bold font\u003c/p\u003e\n\u003cp\u003e(\u003cem\u003edf\u003c/em\u003e: degrees of freedom; \u003cem\u003eMK\u003c/em\u003e: modified Knott\u0026rsquo;s; \u003cem\u003ePO\u003c/em\u003e: Original probe; \u003cem\u003eP2\u003c/em\u003e: Probe #2; \u003cem\u003eP3\u003c/em\u003e: Probe #3; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD\u003c/em\u003e: Pre-Immune Complex Dissociation; \u003cem\u003eDiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD\u003c/em\u003e: Post-Immune Complex Dissociation;)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 7.\u0026nbsp;\u003c/strong\u003ePost-hoc analysis of the Cochran\u0026rsquo;s Q test using a McNemar\u0026rsquo;s test for paired heartworm diagnostic tests.\u0026nbsp;\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"204\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003ePost hoc analysis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.194\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.892\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/D\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.005\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.431\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.893\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/H\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.013\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.597\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.020\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.008\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eA/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.152\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/D\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.610\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.2448\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/H\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.441\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eB/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/D\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.007\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.356\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.788\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/H\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.507\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.029\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.012\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eC/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/H\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.737\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.618\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.865\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eD/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/H\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.098\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.098\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.185\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eE/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.055\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.513\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/H\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.795\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.002**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eF/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/H\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.009\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.692\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.014\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.005\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eG/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eH/I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eH/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.002**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eH/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.870\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eH/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eH/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.868\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eH/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eH/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eI/J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eI/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eI/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eI/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eI/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.734\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eI/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.758\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eJ/K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.004\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eJ/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eJ/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eJ/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eJ/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eK/L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eK/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.741\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eK/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eK/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eL/M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eL/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.734\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eL/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.758\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eM/N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eM/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.002**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 118px;\"\u003e\n \u003cp\u003eN/O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e0.519\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e**\u003c/strong\u003eSignificant after Bonferroni correction (\u0026alpha;=0.003)\u003c/p\u003e\n\u003cp\u003e(\u003cem\u003eA\u003c/em\u003e: Modified Knott\u0026rsquo;s + Original Probe; \u003cem\u003eB\u003c/em\u003e: Modified Knott\u0026rsquo;s + Probe 2; \u003cem\u003eC\u003c/em\u003e: Modified Knott\u0026rsquo;s + Probe 3; \u003cem\u003eD\u003c/em\u003e: Modified Knott\u0026rsquo;s + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD: Pre-Immune Complex Dissociation; \u003cem\u003eE\u003c/em\u003e: Modified Knott\u0026rsquo;s + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD: Post-Immune Complex Dissociation; \u003cem\u003eF\u003c/em\u003e: Original Probe + Probe 2; \u003cem\u003eG\u003c/em\u003e: Original Probe + Probe 3;\u003cem\u003e\u0026nbsp;H\u003c/em\u003e: Original Probe + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD; \u003cem\u003eI\u003c/em\u003e: Original Probe + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD \u003cem\u003eJ\u003c/em\u003e: Probe 2 + Probe 3; \u003cem\u003eK\u003c/em\u003e: Probe 2 + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD; \u003cem\u003eL\u003c/em\u003e: Probe 2 + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD;\u003cem\u003e\u0026nbsp;M\u003c/em\u003e: Probe 3 + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD: Pre-Immune complex dissociation; \u003cem\u003eN\u003c/em\u003e: Probe 3 + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e post-ICD: Post-Immune complex dissociation; \u003cem\u003eO\u003c/em\u003e: DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD: Pre-Immune complex dissociation + DiroCHEK\u003csup\u003e\u0026reg;\u003c/sup\u003e pre-ICD: Post-Immune complex dissociation;)\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Antigen detection, Canine vector-borne diseases, Dogs, Dirofilaria immitis, Heartworm disease, Microfilariae detection test, Real-time PCR","lastPublishedDoi":"10.21203/rs.3.rs-8379526/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8379526/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eDirofilaria immitis\u003c/em\u003e is a vector-borne filarioid nematode distributed worldwide and endemic across most of North America. In dogs, it is considered the most important parasite and a known cause of acquired cardiomyopathy. Clinically, canine heartworm disease can manifest acutely as caval syndrome and chronically as heart failure, often resulting in death. Different types of diagnostic tests, such as antigen-detection and microfilariae-detection tests (MFDTs), including modified Knott\u0026rsquo;s test and molecular assays, may be used to diagnose \u003cem\u003eD. immitis\u003c/em\u003e infection. Although some molecular tools, such as qPCR, exhibit high sensitivity, cross-reactivity with other \u003cem\u003eDirofilaria\u003c/em\u003e species found in companion animals remains a concern. Following our lab\u0026rsquo;s previously published protocol, cross-reactivity was found with \u003cem\u003eDirofilaria striata\u003c/em\u003e isolated from a subcutaneous nodule of a cat from Texas. The objectives of this study were to (I) evaluate the performance of three newly designed probe-based qPCR assays for detecting \u003cem\u003eD. immitis\u003c/em\u003e and (II) assess overall detection with the newly designed protocols compared with the previously published protocol and other diagnostic tests.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe designed three new probes using accessioned \u003cem\u003eD. immitis\u003c/em\u003e cytochrome c subunit 1 sequences from various countries worldwide to increase specificity. These new probes were then tested with genomic DNA extracted from \u003cem\u003eD. immitis\u003c/em\u003e and \u003cem\u003eD. striata.\u003c/em\u003e Following this, we further assessed the performance of these newly designed probes and previously developed probe using 136 archival shelter dog samples previously found positive for \u003cem\u003eD. immitis\u003c/em\u003e by at least one diagnostic test.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOut of the three probes tested, two (probe 2 and probe 3) specifically detected \u003cem\u003eD. immitis\u003c/em\u003e and showed no cross-reactivity with \u003cem\u003eD. striata.\u003c/em\u003e Probe 3 showed the highest prevalence among all qPCR assays (68.4%; n\u0026thinsp;=\u0026thinsp;93/136), followed by the original probe (66.9%; n\u0026thinsp;=\u0026thinsp;91/136), with probe 2 (59.6%; n\u0026thinsp;=\u0026thinsp;81/136) with the lowest. We analyzed agreement between probes using Cohen\u0026rsquo;s kappa (κ) statistic, which indicated almost perfect agreement between probe 3 and the previously published probe (κ\u0026thinsp;=\u0026thinsp;0.86). We also evaluated other heartworm diagnostic methods performed on the shelter dog samples; these included the modified Knott\u0026rsquo;s test, which was positive for 61.0% (n\u0026thinsp;=\u0026thinsp;83/136) of the positive samples, and the previously published qPCR, which was positive for 66.9% (n\u0026thinsp;=\u0026thinsp;91/136) of samples. All samples were also tested in parallel with a commercially available antigen detection test (DiroCHEK\u0026reg;), yielding 80.1% positivity pre-heat treatment (n\u0026thinsp;=\u0026thinsp;109/136) and 94.9% post-heat treatment (n\u0026thinsp;=\u0026thinsp;129/136). The highest positivity of the molecular diagnostic tests was probe 3 paired with post-heat treatment (97.1%; n\u0026thinsp;=\u0026thinsp;132/136).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThis optimized probe-based qPCR assay (probe 3) provides an accurate and reliable method to detect \u003cem\u003eD. immitis\u003c/em\u003e microfilariae in dogs and other carnivore hosts.\u003c/p\u003e","manuscriptTitle":"Improved specificity of a probe-based real-time PCR for the detection of Dirofilaria immitis in canine blood","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-19 13:17:50","doi":"10.21203/rs.3.rs-8379526/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-13T22:58:05+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-13T14:01:00+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-09T20:20:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"79277937322966841601062807767305253220","date":"2025-12-20T07:28:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"320632038146349036220232592079348060177","date":"2025-12-18T14:27:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"174521218877554765653000543228239365226","date":"2025-12-17T15:17:30+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-17T14:26:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-17T14:08:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-17T04:37:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasites \u0026 Vectors","date":"2025-12-16T19:59:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f45ddaeb-7f21-4544-9ec3-6b81df7ecd61","owner":[],"postedDate":"December 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-02-17T14:42:07+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-19 13:17:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8379526","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8379526","identity":"rs-8379526","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}