Tamoxifen, associated to the conservative CKD treatment, promoted additional antifibrotic effects on experimental hypertensive nephrosclerosis

Tamoxifen, associated to the conservative CKD treatment, promoted additional antifibrotic effects on experimental hypertensive nephrosclerosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Tamoxifen, associated to the conservative CKD treatment, promoted additional antifibrotic effects on experimental hypertensive nephrosclerosis Camilla Fanelli, Felipe M Ornellas, Giovanna A Celestrino, Danielly N Carmagnani, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2188031/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Aug, 2023 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract CKD progression depends on the activation of an intricate set of hemodynamic and inflammatory mechanisms, promoting renal leukocyte infiltration, inflammation and fibrosis, leading to renal function loss. There are currently no specific drugs to detain renal fibrogenesis, which is a common end-point for different nephropathies. Clinical therapy for CKD is mostly based on the management of hypertension and proteinuria, partially achieved with renin-angiotensin-aldosterone system (RAAS) blockers, and the control of inflammation by immunosuppressive drugs. The aim of the present study was to verify if the administration of tamoxifen (TAM), an estrogen receptor modulator, clinically employed in the treatment of breast cancer and predicted to exert antifibrotic effects, would promote additional benefits when associated to a currently used therapeutic scheme for the conservative management of experimental CKD. Wistar rats underwent the NAME model of hypertensive nephrosclerosis, obtained by daily oral administration of a nitric oxide synthesis inhibitor, associated to dietary sodium overload. The therapeutic association of TAM to losartan (LOS), and mofetil mycophenolate (MMF) effectively reduced the severe hypertension, marked albuminuria and glomerular damage exhibited by NAME animals. Moreover, the association also succeeded in limiting renal inflammation in this model, and promoted further reduction of ECM interstitial accumulation and renal fibrosis, compared to the monotherapies. According to our results, the association of TAM to the currently used conservative treatment of CKD added significant antifibrotic effects both in vivo and in vitro , and may represent an alternative to slow the progression of chronic nephropathy. Biological sciences/Physiology Biological sciences/Drug discovery Biological sciences/Drug discovery/Target identification Biological sciences/Drug discovery/Target validation Health sciences/Nephrology Health sciences/Nephrology/Kidney diseases Health sciences/Diseases Health sciences/Diseases/Kidney diseases Health sciences/Diseases/Kidney diseases/Chronic kidney disease Health sciences/Diseases/Kidney diseases/Nephrosclerosis Health sciences/Diseases/Kidney diseases/Renal fibrosis Chronic kidney disease tamoxifen fibrosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction The pathogenesis of CKD involves an intricate process of both hemodynamic and inflammatory mechanisms that leads to renal fibrosis and progressive loss of function. Glomerular and systemic hypertension, increased production of cytokines and growth factors, renal infiltration of inflammatory cells, inordinate fibroblast proliferation and transdifferentiation into myofibroblasts have been described in different human nephropathies and experimental CKD models [ 1 – 4 ]. It is widely known that overactivation of both systemic and intrarenal renin-angiotensin-aldosterone system (RAAS) contributes to the progression of CKD [ 5 , 6 ]. Once bound to its specific receptor (AT1), the active peptide Angiotensin II (AII) promotes renal and systemic vasoconstriction and tubular sodium conservation, leading to the elevation of blood pressure [ 1 , 2 , 6 ]. Moreover, AII also exerts proinflammatory effects, once it stimulates cell proliferation, fibroblast activation and further accumulation of extracellular matrix (ECM). Actually, since the discovery of the angiotensin ii converting enzyme inhibitors (ACEi) and the AT1 receptor blockers (ARB), such as losartan (LOS), RAAS suppression remains to be the best option available to slow the progression of CKD, although this strategy does not fully halt the progression of renal fibrosis and loss of function [ 7 – 10 ]. It is well known that inflammation and increased ECM production exert an important pathogenic role to the development and progression of CKD, regardless of its etiology. Accordingly, we have previously demonstrated that treatment with anti-inflammatory drugs such as mycophenolate mofetil (MMF), which promotes antiproliferative effects on T-cells, presented effective renoprotection in experimental CKD, in the hypertensive nephrosclerosis model obtained by chronic inhibition of Nitric Oxide (NO) synthesis (NAME model), in the 5/6 nephrectomy (Nx) and in the streptozotocin-induced diabetes [ 11 – 13 ]. Moreover, Nx rats treated with an association of MMF + LOS presented significantly less severe CKD when compared to animals receiving the respective monotherapies [ 14 ]. Considering that renal fibrosis with tissue scarring is the final common pathway of CKD, therapeutic interventions with antifibrotic drugs could represent an attractive choice of therapy to arrest fibrogenesis in progressive nephropathies. In this context, tamoxifen (TAM), an estrogen receptor modulator clinically used in the treatment of breast cancer, has been demonstrated to also be effective in treating abnormal healing disorders, such as retroperitoneal fibrosis, sclerosing encapsulated peritonitis, fibrosing mediastinitis, among other fibroproliferative conditions [ 15 – 18 ]. Moreover, we have recently shown that TAM treatment prevented the development of glomerulosclerosis and interstitial expansion in rats submitted to NO inhibition, even having no effects on the marked hypertension characteristic of this model [ 19 ]. Motivated by the positive responses achieved by each employed monotherapy in the treatment of progressive nephropathy associated to the NAME model of CKD, in the present study, we sought to verify if the administration of an association of LOS + MMF + TAM could promote additional renoprotection compared to the respective monotherapies, once the mechanisms of action of each drug are different and somehow complementary. Results Association of LOS + MMF + TAM was effective in reducing blood pressure and albuminuria As expected, rats receiving L-NAME exhibited severe hypertension when compared to Control (213 ± 5 vs. 130 ± 3 mmHg). LOS or MMF as monotherapies, as well as the association of LOS+MMF+TAM promoted reduction in the blood pressure levels (183 ± 12, 173 ± 9 and 173 ± 3 mmHg, respectively), as shown in Figure 1 A. NAME animals also developed marked albuminuria (147.3 ± 30.5 vs. 1.1 ± 0.4 mg/24h in the Control group), which was significantly reduced with all the employed monotherapies; LOS (14.2 ± 4.4 mg/24h), MMF (11.1 ± 7.8 mg/24h) and TAM (24.1 ± 4.6 mg/24h). It is worth mentioning that the treatment with the association of LOS+MMF+TAM promoted the most prominent reduction of this parameter, reaching values similar to the control group (4.1 ± 1.3 mg/24h), as presented in Figure 1 B. Treatment with the association of LOS + MMF + TAM averted the development of glomerulosclerosis and glomerular collapse in NAME rats Glomerular structural alterations, characterized by the development of glomerulosclerosis and by the presence of collapsed glomeruli, were accessed by PAS staining. Illustrative micrographs of samples of each experimental group are represented in Fig. 2 . Untreated NAME rats exhibited prominent structural alterations, which were averted by all the employed therapeutic schemes. Bar graphs of the respective quantitative analysis of the percentage of sclerotic and collapsed glomeruli are shown in Fig. 3 . Accordingly, NAME animals shown significant glomerulosclerosis and glomerular collapse, compared to Control rats (2.6 ± 0.7 and 17.3 ± 3.0 vs. 0.3 ± 0.3 and 1.6 ±0.5 %, respectively). LOS, MMF and TAM monotherapies at least partially averted the development of both glomerulosclerosis and glomerular collapse in NAME rats (0.5 ± 0.2 and 4.1± 1.1 %, 1.6 ± 0.7 and 12 ± 0.8 %, 1.1 ± 0.3 and5.1 ± 0.7 %), and the association of LOS + MMF + TAM promoted further protection against these glomerular structural alterations (0.4 ± 0.3 ad 0.9 ± 0.5 %). Figure 2 . Representative micrographs of glomerulosclerosis (left) and collapsed glomeruli (right) , accessed in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups by PAS staining. Combined LOS+MMF+TAM ameliorated interstitial fibrosis in animals submitted to the L-NAME CKD model As can be seen in Fig. 4 , NAME animals exhibited severe renal interstitial fibrosis, evaluated in Masson trichrome stained renal slides, as well as abundant interstitial α-SMA expression, which indicates the presence of myofibroblasts in the renal cortex. Overexpression of collagen 1 and fibronectin, ECM proteins related to renal fibrosis, was also observed in NAME rats, compared to the Control. Bar graphs of the quantitative analysis of these parameters were presented in Fig. 5 . According to these quantifications, NAME animals exhibited significant renal fibrosis, evidenced by the positivity for Masson staining (1.7 ± 0.3 vs. 0.3 ± 01 % in Control), as well as marked α-SMA accumulation (16.2 ± 3.5 vs. 0.4 ±0.1 % in Control), compared to Control rats. Both Masson positivity and the presence of interstitial myofibroblasts were equally limited by all the employed therapies, both monotherapies with LOS (0.8 ± 0.2 and 5.7± 1.0 %), MMF (0.5 ± 0.4 and 72 ± 1.0 %) and TAM (0.3 ± 0.1 and6.4 ± 0.7 %), and the association of drugs (0.4 ± 0.1 ad 5.2 ± 1.2 %). Interstitial collagen 1 and fibronectin percentages were also abnormally increased in untreated NAME rats compared to Control animals (21 ± 2 and 16 ± 1 vs. 1 ± 2 and 7 ± 1 %, respectively). While the interstitial accumulation of collagen 1 was only subtly prevented by TAM monotherapy and the association of LOS + MMF + TAM 16 ± 2 and 17 ± 2 %), interstitial fibronectin percentage was considerably averted by these treatments, especially by the combined theray (11 ± 1 and 7 ± 2 %). The association of LOS+MMF+TAM abrogated renal inflammation and reversed interstitial cell proliferation in NAME animals Illustrative microphotographs of immunohistochemistry for the detection of renal infiltration by macrophages and T-cells and for the evaluation of renal interstitial cell proliferation, in renal sections of animals from each experimental group, can be seen in Fig. 6 . Immunohistochemistry analysis demonstrated that untreated rats submitted to the CKD model induced by L-NAME administration presented marked renal inflammation, characterized by intense cortical infiltration by macrophages and T-lymphocytes, and increased interstitial cell proliferation, evidenced by the presence of interstitial PCNA + cells. The inflammatory cells were detected mainly in the renal interstitium, but were also observed infiltrating glomeruli and in the perivascular area. According to the quantification of these cells, presented in Fig. 7 , untreated NAME rats exhibited significant interstitial macrophage (163 ± 24 cell/mm 2 ) and T-cell (127 ± 20 cell/mm 2 ) infiltration, compared to the Control (14 ± 5 and 25 ± 5 cell/mm 2 ). LOS, MMF and TAM monotherapies statistically reduced these cells (84 ± 17 and 84 ± 11 cell/mm 2 , 50 ± 9 and 42 ± 9 cell/mm 2 and 82 ± 7 and 38 ± 7 cell/mm 2 , respectively). LOS + MMF + TAM association achieved the numerically lowest values of both macrophage and lymphocyte interstitial infiltration cells (40 ± 6 and 27 ± 5 cell/mm 2 ). Similar results were obtained regarding renal cortical cells proliferation. NAME group presented significant increase in PCNA + interstitial cells, compared to Control (142 ± 24 vs. 15 ± 5 cell/mm 2 ). All the employed monotherapies reduced cell proliferation in this experimental nephrosclerosis model (LOS: 43 ± 16, MMF: 29 ± 12 and TAM: 31 ± 8 cell/mm 2 ), and once more, the lowest number of positive cells were observed with the association of LOS + MMF + TAM (16 ± 6 cell/mm 2 ), in which group the interstitial cell proliferation rate was comparable to the observed in the Control. TAM in monotherapy or associated to LOS effectively inhibited fibroblasts activation and ECM overproduction in cultured NRK-49F cells In order to establish an in vitro model of activated fibroblasts, which may mimic the subpopulation of renal fibroblasts of our in vivo experimental nephrosclerosis model, we stimulate rat renal immortalized fibroblasts from a commercially available cell line (NRK-49F) with IL-1β + AngII. As shown in Fig. 8 , after this stimulus, NRK-49F continued to express vimentin, a cytoskeleton type III intermediate filament, constitutively present in both fibroblasts and myofibroblasts, but also began to express α-SMA, indicating the effective fibroblast activation and differentiation of part of these cells to myofibroblast. The results of RT-qPCR analysis of gene expression of pro and antifibrotic factors in NRK-49F cells are shown in Fig. 9 . IL-1β + AngII stimulus upregulated the expression of SAMD3 and SMAD7, as well as the expression of fibronectin, collagen I and collagen III in NRK-49F cells. While LOS treatment only reverted partially the overexpression of SMAD3, both TAM and associated LOS + TAM significantly normalized the expression of fibronectin, collagen I and collagen III, and reduced SMAD3 expression to levels lower than the observed in Control NRK49F cells. Additional illustrative immunocytochemistry for fibronectin and collagen I performed in cultured NRK-49F cells are shown in Fig. 10 , in which is it possible to verify that, untreated IL-1β + AngII-stimulated NRK-49F and LOS-treated cells exhibited exuberant positivity for fibronectin, suggesting fibronectin assembly and ECM overproduction, compared with the unstimulated NRK-49F or to the TAM and LOS + TAM-treated cells. Discussion In the present study we investigated the potential renoprotective effects of the therapeutic association of LOS + MMF + TAM on an experimental model of hypertensive nephrosclerosis, based on the chronic inhibition of NO synthesis, induced by L-NAME administration. The main aim of our research was to verify whether the combination of TAM, a selective estrogen receptor modulator, recommended for the treatment of positive estrogen receptor (ER+) breast cancer, to the currently employed conservative CKD treatment, here represented by RAAS blockade and immunosuppression, would promote additional anti-inflammatory and/or antifibrotic beneficial effects, when compared to the respective monotherapies. Corroborating previous data, rats submitted to the L-NAME model of CKD developed severe hypertension, probably caused by glomerular and systemic vasoconstriction due to the lack of physiological vasodilatory effects of NO. Systemic hypertension and CKD are closely related conditions with an intricate cause/effect relationship. The decline of kidney function usually leads to high blood pressure, due to both a decreased ability of the kidneys to remove salt from the bloodstream, and an increased release of renal vasoconstrictive hormones. On the other hand, systemic hypertension sustained for long periods leads to the damage of multiple target organs, including the kidneys [ 7 , 8 ]. Hypertensive nephrosclerosis is one of the main causes of end-stage renal failure. High blood pressure also contributes to the aggravation of CKD, regardless of its etiology [ 1 ]. Accordingly, the clinical management of hypertension is currently one of the most employed strategies to control CKD progression [ 7 , 8 ]. According to our results, systemic hypertension induced by L-NAME administration was only partially reduced by the monotherapies with both LOS or MMF, and equally by the association of LOS + MMF + TAM. There was no synergistic effect of the combination of drugs as regards lowering blood pressure. The poor hemodynamic effect of therapeutic schemes may have limited the potential effects of the therapeutic association on the maintenance of renal function. Along with the hypertension, NAME animals also exhibited a markedly increased urine albumin excretion rate, a clear evidence of renal impairment. Because of its strong predictive power for cardiovascular and renal events, albuminuria is one of the most important biomarkers of CKD progression, particularly in patients with hypertension or diabetes mellitus. Moreover, the reduction of albuminuria is the most important goal to prevent the progression of kidney disease in CKD patients. Usually, in this regard, significant benefits are achieved by the therapeutic treatment with RAAS inhibitors. According to our results, although all the tested monotherapies significantly limited the development of albuminuria in NAME animals, the antiproteinuric effect obtained with the combined treatment was noteworthy. Is spite of the severe sustained hypertension, LOS + MMF + TAM association completely averted the development of albuminuria in this CKD model. The increased urinary albumin excretion is directly related to the disruption of one or more components of the glomerular filtration barrier, and with glomerular structural damage, generally caused or worsened by renal inflammation. Histological glomerular alterations are a common feature in most human and experimental nephropathies. Accordingly, severe glomerulosclerosis and glomerular collapse were observed in untreated NAME animals, and the association of LOS + MMF + TAM significantly prevented the development of glomerular histological damage, probably reflecting the effects of LOS (for glomerulosclerosis) and MMF (for collapsed glomeruli), thus evidencing that TAM did not exerted antagonism, blockade or inhibition upon the pharmacological effects of both LOS and MMF, and did not diminish the renoprotective effects observed with these drugs. Kidney infiltration by inflammatory leukocytes has been demonstrated in a variety of non-immune mediated nephropathies, such as the hypertensive nephrosclerosis [ 4 , 19 ]. The recruitment of circulating monocytes, as well as the activation of resident renal macrophages often correlates positively with the worsening of renal function loss, in both human and experimental CKD [ 2 ]. Accordingly, in the present study, NAME animals showed exuberant renal inflammation, characterized by inordinate tubulointerstitial cell proliferation and massive infiltration of kidneys by both macrophages and lymphocytes. Surprisingly, similarly to the observed with LOS and MMF monotherapies, expected to exert inhibitory effects on macrophage and lymphocyte renal infiltration, as well as on interstitial proliferation rate, TAM monotherapy also exhibited independent significant anti-inflammatory proprieties. Therefore, the association of LOS + MMF + TAM seems to combine different mechanisms of action to abrogate renal inflammation. Inhibition of macrophage activity by TAM treatment has been demonstrated in both in vitro and in vivo studies, in which Tamoxifen promoted significant reduction in the transcription of important cell surface receptors, such as the fatty acid-binding proteins (FABPs) and the scavenger receptor class B member 3 (SCARB3 / CD36), which are involved in the monocyte/macrophage activation processes, and play a pivotal role in foam cell formation and in the development of atherosclerosis [ 25 ]. The anti-proliferative effects of RAAS blockade, associated with the reduction of IL1, IL6 and IL10 macrophage release, possibly achieved with the MMF treatment, may have boosted the anti-inflammatory effects of TAM. A synergetic effect among the tested drugs could also be plausible in this case. However, additional studies focused on the intracellular mechanisms of action of each employed drug and in the possible chemical interactions among them should be carried out to speculate this hypothesis. Along with renal inflammation, the overproduction of ECM and the renal interstitial collagen accumulation are important histological features, commonly related to the worsening of CKD. In the present study renal cortical interstitial fibrosis, evidenced by the high percentage of Masson + interstitial staining, myofibroblasts infiltration, as well as collagen I and fibronectin interstitial deposition, accompanied the progression of hypertensive nephrosclerosis in untreated NAME rats. All the tested therapies were effective in preventing renal fibrosis and α-SMA accumulation, while only TAM and the association of LOS + MMF + TAM significantly reduced collagen I and fibronectin accumulation in this CKD model, suggesting that TAM promoted additional antifibrotic effect to the therapeutic scheme, with no impairment of renoprotective action of LOS and MMF, when associated to these drugs. The suppressive effects of tamoxifen on fibrogenesis were first described in the early nineties, when Clark and collaborators described the drug to be effective and safe in the treatment of two patients with severe retroperitoneal fibrosis. Its effectiveness for the treatment of encapsulating peritoneal sclerosis, where than demonstrated, eight years later, by Allaria and co-authors. Based on these observations, Dellê and collaborators, from our research group, showed for the first time that TAM could exert protective effects on experimental progressive chronic kidney disease, in 2003. [ 26 , 18 , 27 ]. More recently, TAM was described to exert important antifibrotic effects in the experimental model of unilateral ureteral obstruction (UUO) in mice. Similarly, to the observed in the present study, TAM treatment reduced the production and deposition of ECM proteins in UUO kidneys, as well as the renal deposition of fibronectin and collagen [ 28 , 29 ]. Although the exact mechanisms involved in the anti-inflammatory and antifibrotic effects of TAM are still poorly known, it exerts undoubted suppressive effects on fibroblast proliferation, activation and ECM secretion, evidenced in our in vitro results, which corroborate the current literature [ 30 ]. Since MMF, employed as an immunosuppressive drug in our in vivo protocol, is in fact a prodrug, which must be ingested and then metabolized into the pharmacologically active drug (mycophenolic acid), we were not able to perform in vitro studies with the full LOS + MMF + TAM association. However, we combined LOS to TAM is our analysis and clearly demonstrated that LOS did not impaired the suppressive effects of TAM on cultured fibroblasts, thus corroborating the idea that this drug combination may be safe and effective. In summary, although further studies employing different CKD models are still required to confirm the efficacy and safety of the association of LOS + MMF + TAM, in the present paper we provided strong evidence that this therapeutic scheme can be potentially useful to slow the progression of chronic nephropathy, since it lowered systolic blood pressure, prevented albuminuria, glomerular structural damage, and renal inflammation and promoted additional antifibrotic effect to the traditional conservative treatment of CKD, in the NAME model of hypertensive nephrosclerosis. In conclusion, our pre-clinical observations suggested that the association of TAM to the conservative treatment of CKD, employing LOS and MMF, was safe and promoted additional renoprotective, anti-inflammatory and antifibrotic effect in a model of hypertensive nephrosclerosis in rats. Material And Methods In vivo Experimental Groups and Protocol The present experimental protocol was approved by the local Research Ethics Committee (Comissão de Ética para Análise de Projetos de Pesquisa – CAPPesq) and was developed in strict conformity with the international standards for care and manipulation of laboratory animals. Thirty-five male Wistar rats aged between 7 and 8 weeks were kept under controlled temperature (23 ± 1°C), on a 12/12 hours’ light/dark cycle with ad libitum access to tap water and HS diet (3.12% Na, Nuvital, Brazil). After 2 weeks of adaptation to HS diet, 30 of these animals were submitted to the NAME experimental model: As previously described, these model of hypertensive nephrosclerosis was induced by the chronic inhibition of endogenous NO, thus stimulating peripheral vasoconstriction [ 4 ]. NO synthesis blockage was obtained by oral daily administration of 70 mg/kg/d of Nꙍ-nitro-L-arginin metil-ester (L-NAME - Sigma Chemical CO, St. Louis, USA), a L-arginine analogue, diluted on drinking water, associated to the HS diet. NAME rats were divided among the following 5 groups: NAME : Animals submitted to the NAME model and keep untreated; LOS : NAME animals treated with 50 mg/Kg/d of losartan (LOS) diluted in drinking water; MMF : NAME rats treated with 10 mg/Kg/d of Micofenolate Mofetil (MMF) administered daily by gavage; TAM : NAME animals receiving 10 mg/Kg/d of Tamoxifen (TAM) and LOS + MMF + TAM : NAME rats treated with LOS, MMF and TAM simultaneously. Five additional animals received only HS and were used as Control . An illustrative flow-chart depicting the study design and groups can be seen in Supplemental Material section, on Supplementary Fig. 1A . All groups were followed for 30 days. Body weight was monitored weekly and at the end of this period, blood pressure was evaluated by the tail-cuff pressure method, using a noninvasive system (RTBP 2045; Kent Scientific). Additionally, 24-hour urinary albumin excretion rate (24h-UAE) was analyzed by radial immunodiffusion, as described elsewhere [ 4 , 20 ]. Animals were anesthetized with an intraperitoneal (IP) injection of 60 mg/kg of sodium pentobarbital and submitted to total nephrectomy followed by euthanasia through overdose of sodium pentobarbital, 80 mg/kg IP. Histological Analysis As described elsewhere [ 4 ], kidneys obtained from total nephrectomy were cut in two midcoronal renal slices and pre-fixed with Duboscq-Brazil for 30 minutes, followed by 24-hour post-fixation in buffered 4% formaldehyde. Tissue samples were embedded in paraffin, through conventional techniques, renal tissue sections of 4-µm thickness were obtained and submitted to histological analysis for the assessment of glomerular and tubulointerstitial alterations. The percentage of glomerulosclerosis and collapsed glomeruli were evaluated in periodic Acid-Schiff (PAS) staining samples, through the analysis of at least 50 randomly sampled glomerular tuft profiles per rat. The criteria used to define sclerotic glomeruli was the presence of segmental hyalinosis lesions, usually with adhesion to Bowman´s capsule. Collapsed glomeruli were defined by their reduced size, wrinkling basement membrane and collapsed capillary loops. Interstitial fibrosis was quantitatively evaluated in Masson-stained sections by a point counting technique [ 4 , 21 ]. Immunohistochemical Analysis Immunohistochemistry (IHC) assays were performed to identify interstitial macrophage and T-cell infiltration in renal sections, as well as to evaluate tubulointerstitial cell proliferation and to quantify the percentage of tubulointerstitial area occupied by α-smooth muscle actin (α-SMA), possibly indicating the presence of myofibroblasts in the renal cortex [ 2 ], collagen I and fibronectin. A mouse monoclonal anti-ED1 antibody (Serotec, Oxford, UK) was used to identify macrophages through the APAAP (alkaline phosphatase anti-alkaline phosphatase) technique. Monoclonal mouse anti-CD3 (Dako, ‎Glostrup, ‎Denmark) and anti-α-SMA (Sigma Chemical CO, St. Louis, USA) antibodies were used, to identify T- cells and myofibroblast, respectively, through a streptavidin-biotin-alkaline phosphatase (Strep-AP) IHC technique. In both APAAP and Strep-AP techniques, the reactions were developed with a fast-red dye solution. Tubulointerstitial cell proliferation was detected by a monoclonal mouse anti-PCNA antibody (Dako, ‎Glostrup, ‎Denmark), while collagen I and fibronectin positivity were detected with polyclonal anti-collagen I (Rockland Immunochemicals, Inc., NY, USA) and anti-fibronectin (Sigma Chemical CO, St. Louis, USA) primary antibodies, using a streptavidin-biotin-horseradish peroxidase (Strep-HRP) IHC technique. Samples were developed with a DAB dye solution. In vitro Experiments In order to verify the specific antifibrotic activity of TAM alone, and also to investigate if this activity would be somehow inhibited or impaired by the association with other drugs, we performed cell culture experiments using a rat renal fibroblast cell line (NRK-49F; American Type Culture Collection, Manassas, VA). For this purpose, 1x10 5 NRK-49F cells were cultured under 37°C and 5% CO 2 in plastic culture plates with Dulbecco’s Modified Eagle Medium (DMEM-Low glucose, Invitrogen, USA) containing 5% inactivated fetal bovine serum (FBS; Gibco, Carlsbad, MO, USA), 100 units/mL penicillin, and 100 mg/mL streptomycin antibiotic solution (Gibco). Once cells reached 80% of confluence, the culture medium was replaced by DMEM-Low with 100 units/mL penicillin, and 100 mg/mL streptomycin antibiotic solution, plus the specific stimuli, as follows; Control , NRK-49 cells receiving no additional stimuli or treatment diluted in the culture medium, IL-1β + AngII , NRK-49 cells whose culture medium was supplemented with 400 pg/mL of recombinant human IL-1β (PeproTech, Cranbury, NJ, USA) and 1x10 − 7 M human Angiotensin II acetate (Sigma), LOS , IL-1β + AngII cells whose culture medium was further supplemented with 10 µM of Losartan, TAM , IL-1β + AngII cells whose culture medium was further supplemented with 5µM of Tamoxifen citrate (Sigma) and LOS + TAM , NRK-49 cells receiving all the above mentioned supplements. Cells were kept under the described treatments for 24h. An illustrative flow-chart of in vitro experiments can be seen in Supplemental Material section, on Supplementary Fig. 1B . Immunocytochemistry Immunocytochemistry (ICC) assays were performed to characterize the constitutive expression of vimentin in NRK-49 cells, using a mouse monoclonal anti-vimentin primary antibody (Sigma Chemical CO, St. Louis, USA). The activation of fibroblasts after IL-1β + AngII stimulus, was evaluated through the positivity of these cells for α-SMA, with a mouse monoclonal anti-α-SMA antibody (Sigma Chemical CO, St. Louis, USA). Moreover, ICC was also employed to analyze the expression of collagen I and fibronectin in NRK-49 cells submitted to the different treatments, employing, respectively, the rabbit polyclonal anti-collagen I (Rockland Immunochemicals, Inc., NY, USA) and anti-fibronectin (Sigma Chemical CO, St. Louis, USA) primary antibodies. Vimentin, collagen I and fibronectin ICC were performed through a streptavidin-biotin-alkaline phosphatase (Strep-AP) technique. Reactions were developed with a fast-red dye solution. α-SMA was detected through a streptavidin-biotin-horseradish peroxidase (Strep-HRP) ICC technique, developed with a DAB dye solution. Real time RT-PCR Quantitative real-time polymerase chain reaction (PCR) of cultured NRK-49F cells was performed to measure the relative gene expression of TGFβ, SMAD3, SMAD7, Collagen type I, collagen type III and Fibronectin, using Actinβ as a housekeeping control, as previously described. Total NRK-49F cells RNA extraction was carried out with RNeasy Plus Kit (Qiagen, MD, EUA), following the instructions of the manufacturer. Reverse transcription (RT) was performed with M-MLV enzyme kit (Promega) and qPCR was conducted with the Syber GreenER qPCR Super Mix Universal (Invitrogen), in the StepOne Plus equipment (Applied Biosystetems - Life Technologies). Quantitative comparisons were obtained using the ΔΔCT method (Applied Biosystems, Singapore, Singapore). Primer sequences for amplifying target genes were: Tgfb1 NM_021578.2, left primer: GCTGAACCAAGGAGACGGAA, right primer: CATGAGGAGCAGGAAGGGTC, Smad3 NM_013095.3 left primer: GAGACATTCCACGCTTCACA, right primer: AAAGACCTCCCCTCCAATGT, Smad7 NM_030858.2 left primer: TCTCCCCCTCCTCCTTACTC, right primer: CAGGCTCCAGAAGAAGTTGG, Coll1a1 NM_053304.1 left primer: AGCTGGTGCTAAGGGTGAAG, right primer: GCAATACCAGGAGCACCATT, Coll3a1 NM_053304.1 left primer: AGCTGGTGCTAAGGGTGAAG, right primer: GCAATACCAGGAGCACCATT, Fn1 NM_019143.2 left primer CTCCCGGAACAGATGCAATG, right primer ATCCAGCTGAAGCACTCTGT and Actb NM_031144.3 left primer: AGGGAAATCGTGCGTGACAT, right primer: CCATACCCAGGAAGGAAGGC. Statistical Analysis Results were presented as mean ± SEM. Differences among all groups were analyzed by one-way ANOVA with Dunnet’s multiple comparison post-test. Means were considered statistically different when p < 0.05 [ 22 ]. All statistical analyses were realized using the Graph-Pad Prism™ 5.01 software. Declarations Acknowledgments The present research was financially supported by São Paulo Research Foundation (Process FAPESP - 03/05405-7). Author contributions C.F. was responsible for in vivo data acquisition (animal care, biochemical, histological and part of immunohistochemical analysis), analyzed and interpreted the results obtained with the experiments and wrote the manuscript. F.M.O. and G.A.C. were responsible for in vitro data acquisition (cell culture and treatments, RT-qPCR and immunocytochemistry). D.C.N. and A.L.R.F. performed the immunohistochemical analysis for collagen and fibronectin, took the tissue slides photomicrographs and assembled the panels for figures 2 and 4. I.L.N. conceived and designed the research project, interpreted and discussed all results obtained and substantially contributed with intellectual content of the manuscript. Data availability All data generated in the present study are included in this published article. Disclosure of Potential Conflicts of Interest The authors have no conflicts of interest to declare Ethical approval The present experimental protocol was approved by the local Research Ethics Committee (Comissão de Ética para Análise de Projetos de Pesquisa – CAPPesq) and was developed in strict conformity with the international standards for care and manipulation of laboratory animals. Statement of adherence to The ARRIVE Guidelines The present experimental study was reported in accordance with The ARRIVE guidelines 2.0, https://doi.org/10.1371/journal.pbio.3000411, following the ARRIVE Essential 10 requirements. References Romagnani, P. et al. Chronic kidney disease. Nat Rev Dis Primers. 23 ( 3 ), (2017):17088. doi: 10.1038/nrdp.2017.88 . Noronha, I.L., Fujihara, C.K., Zatz, R. The inflammatory component in progressive renal disease - Are interventions possible? Nephrol Dial Transplant. 17 ( 3 ), (2002): 363-8. DOI: 10.1093/ndt/17.3.363 Zeisberg, M., Neilson, E.G. Mechanisms of tubulointerstitial fibrosis. J Am Soc Nephrol. 21 ( 11 ), (2010): 1819-34. DOI: 10.1681/ASN.2010080793 Fanelli, C., Dellê, H., Cavaglieri, R.C., Dominguez, W.V., Noronha, I.L. Gender Differences in the Progression of Experimental Chronic Kidney Disease Induced by Chronic Nitric Oxide Inhibition. Biomed Res Int. (2017):159739. DOI: 10.1155/2017/2159739 Graciano, M.L., Cavaglieri, R.C., Dellê, H., Casarini, D.E., Malheiros, D.M.A.C. Intrarenal renin-angiotensin system is upregulated in experimental model of progressive renal disease induced by chronic inhibition of nitric oxide synthesis. J Am Soc Nephrol. 15 ( 7 ), (2004):1805-15. DOI: 10.1097/01.asn.0000131528.00773.a9 Rüster, C., Wolf, G. Renin-angiotensin-aldosterone system and progression of renal disease. J Am Soc Nephrol. 17 ( 11 ), (2006):2985–91 DOI: 10.1681/ASN.2006040356 Judd, E., Calhoun, D.A. Management of Hypertension in CKD: Beyond the Guidelines. Adv Chronic Kidney Dis . 22 ( 2 ), (2015):116 – 22. DOI: 10.1053/j.ackd.2014.12.001 Townsend, R.R., Taler, S.J. Management of hypertension in chronic kidney disease. Nat Rev Nephrol . 11 ( 9 ), (2015):555 – 63. DOI: 10.1038/nrneph.2015.114 Arias, S.C.A. et al. Regression of albuminuria and hypertension and arrest of severe renal injury by a losartan-hydrochlorothiazide association in a model of very advanced nephropathy. PLoS One . 2013: 8 ( 2 ), (2013):e56215. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0056215 Fanelli, C. et al. Effects of losartan, in monotherapy or in association with hydrochlorothiazide, in chronic nephropathy resulting from losartan treatment during lactation. Am J Physiol Renal Physiol. 301 ( 3 ), (2011):F580-7. DOI: 10.1152/ajprenal.00042.2011 Fujihara, C.K., Malheiros, D.M.A.C.; Zatz, R.; Noronha I.L. Mycophenolate mofetil attenuates renal injury in the rat remnant kidney. Kidney Int. 54 ( 5 ), (1998):1510-9. DOI: 10.1046/j.1523-1755.1998.00138.x Fujihara, C.K., Malheiros, D.M.A.C., Noronha, I.L., de Nucci, G., Zatz, R. Mycophenolate Mofetil Reduces Renal Injury in the Chronic Nitric Oxide Synthase Inhibition Model. Hypertension. 37 ( 1 ), (2001):170–175. DOI: 10.1161/01.hyp.37.1.170 Utimura, R. et al. Mycophenolate mofetil prevents the development of glomerular injury in experimental diabetes. Kidney Int. 63 ( 1 ), (2003):209 – 16. DOI: 10.1046/j.1523-1755.2003.00736.x Fujihara, C.K. et al. Combined mycophenolate mofetil and losartan therapy arrests established injury in the remnant kidney. J Am Soc Nephrol . 11 ( 2 ), (2000):283 – 90. DOI: 10.1681/ASN.V112283 Van Bommel, E.F.H., Pelkmans, L.G., Van Damme, H., Hendriksz, T.R. Long-term safety and efficacy of a tamoxifen-based treatment strategy for idiopathic retroperitoneal fibrosis. Eur J Intern Med. 24 ( 5 ), (2013):444–50. DOI: 10.1016/j.ejim.2012.11.010 Moustafellos, P. et al. Tamoxifen Therapy in Encapsulating Sclerosing Peritonitis in Patients After Kidney Transplantation. Transplant Proc. 38 ( 9 ), (2006):2913-4. DOI: 10.1016/j.transproceed.2006.08.179 Loffeld, R.J., Van Weel, T.F., Tamoxifen for retroperitoneal fibrosis. Lancet. 6:341(8841), (1993):382. DOI: 10.1016/0140-6736(93)90195-m Allaria, P.M., Giangrande, A., Gandini, E., Pisoni, I.B. Continuous ambulatory peritoneal dialysis and sclerosing encapsulating peritonitis: tamoxifen as a new therapeutic agent? J Nephrol. 12 ( 6 ), (1999):395-7. Dellê, H., Cavaglieri, R.C., Vieira Jr, J.M., Malheiros, D.M.A.C., Noronha, I.L. Antifibrotic effect of tamoxifen in a model of progressive renal disease. J Am Soc Nephrol. 23 ( 1 ), (2012):37–48. DOI: 10.1681/ASN.2011010046 Mancini, GA., Carbonaro, J.F. Immunochemical quantitation of antigen by single radial immunodiffusion. Immunochemistry. 2 ( 3 ), (1965):235 – 54. DOI: 10.1016/0019-2791(65)90004-2 Jepsen, L.F. Mortensen, P.B. Interstitial fibrosis of the renal cortex in minimal change lesion and its correlation with renal function: a quantitative study. Virchows Arch A Pathol Anat Histol . 23;383(3), (1979):265 – 70. DOI: 10.1007/BF00430245 Wallenstein, S., Zucker, C.L., Fleiss, J.L. Some statistical methods useful in circulation research. Circ Res. 47 ( 1 ), (1980):1–9. DOI: 10.1161/01.res.47.1.1 Teles, F. et al. (2015) Brazilian red propolis attenuates hypertension and renal damage in 5/6 renal ablation model. PLoS One . 21 ; 10 ( 1 ), (2015):e0116535. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0116535 Fanelli, C. et al. Innate And Adaptive Immunity are Progressively Activated in Parallel with Renal Injury in the 5/6 Renal Ablation Model. Sci Rep. 9 ; 7 ( 1 ), (2016):3192. DOI: 10.1038/s41598-017-02915-6 Yu, M. et al. Inhibition of Macrophage CD36 Expression and Cellular Oxidized Low Density Lipoprotein (oxLDL) Accumulation by Tamoxifen. J Biol Chem . 12;291(33), (2016):16977-89. DOI: 10.1074/jbc.M116.740092 Clark, C.P 1.; Vanderpool, D.; Preskitt, J.T.The response of retroperitoneal fibrosis to tamoxifen Surgery. 109 ( 4 ), (1991):502–6. Dellê, H., Rocha, J.R.C., Malheiros, D.M.A.C., Vieira, Jr J.M., Noronha, I.L. Tamoxifen has protective effect preventing renal damage in chronic progressive renal disease. In: World Congress of Nephrology, 2003, Berlin. Nephrol Dial Transp 18 , (2003):592. DOI: 10.1681/ASN.2011010046 Kim, C.S. et al. Tamoxifen ameliorates obstructive nephropathy through Src and the PI3K/Akt/mTOR pathway. Biol Cell. Jan;111(1), (2019):18–27. DOI: 10.1111/boc.201800040 Tingskov, S.J. et al. Tamoxifen attenuates renal fibrosis in human kidney slices and rats subjected to unilateral ureteral obstruction. Biomedicine & Pharmacotherapy, 133 , (2021):111003. DOI: 10.1016/j.biopha.2020.111003 Silva, FMO. et al. Tamoxifen and bone morphogenic protein-7 modulate fibrosis and inflammation in the peritoneal fibrosis model developed in uremic rats. Molecular Medicine 25 , (2019):41. https://molmed.biomedcentral.com/articles/ 10.1186/s10020-019-0110-5 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.docx Cite Share Download PDF Status: Published Journal Publication published 26 Aug, 2023 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Major revision 21 Nov, 2022 Reviews received at journal 15 Nov, 2022 Reviewers agreed at journal 09 Nov, 2022 Reviewers agreed at journal 07 Nov, 2022 Reviewers agreed at journal 05 Nov, 2022 Reviewers invited by journal 02 Nov, 2022 Editor assigned by journal 02 Nov, 2022 Editor invited by journal 02 Nov, 2022 Submission checks completed at journal 02 Nov, 2022 First submitted to journal 20 Oct, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2188031","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":148846447,"identity":"858fa8f7-a2e6-4f96-9835-e7a9c8743791","order_by":0,"name":"Camilla Fanelli","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5klEQVRIie3QoQvCQBTH8R9csDy8ekn/hRuCmvRfOTGsbDKbIKjNaNX/YmA1TAwGN1YXB4JJwWj0NhE0bDMa7psegw/v7QCT6U8LUg+oLfSUeqKRfWGVREmAAj0pKVo/EXwQDBZVhC9PA72lB6pF+1TJru3HUcDGu2IiQtfXZAii0VDqw1w/GSm2vhQTiZww9OG0xYuQZPmZRYTfMjIH8WvnoYkt47CCiHzLASScdvZiSgZOORFJvuVIJK6t7DBro//lsC4hfOVu7/fJtEHcsfQwa9bjaH/2Ssg7+pp/AMXcZDKZTMATZrJQeIqFXMYAAAAASUVORK5CYII=","orcid":"","institution":"Genética e Molecular Faculdade de Medicina da Universidade de São Paulo","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Camilla","middleName":"","lastName":"Fanelli","suffix":""},{"id":148846448,"identity":"92988451-b612-4208-a13a-bfd40f8abc4a","order_by":1,"name":"Felipe M Ornellas","email":"","orcid":"","institution":"Genética e Molecular Faculdade de Medicina da Universidade de São Paulo","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Felipe","middleName":"M","lastName":"Ornellas","suffix":""},{"id":148846449,"identity":"dcd0316e-ef6b-45b2-a69f-a1e476c410d4","order_by":2,"name":"Giovanna A Celestrino","email":"","orcid":"","institution":"Genética e Molecular Faculdade de Medicina da Universidade de São Paulo","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Giovanna","middleName":"A","lastName":"Celestrino","suffix":""},{"id":148846450,"identity":"bf92c572-bdc1-461f-adcb-f556a9bdf406","order_by":3,"name":"Danielly N Carmagnani","email":"","orcid":"","institution":"Genética e Molecular Faculdade de Medicina da Universidade de São Paulo","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Danielly","middleName":"N","lastName":"Carmagnani","suffix":""},{"id":148846451,"identity":"b7bd11ec-2424-4bba-9aed-53d77bb870d6","order_by":4,"name":"Ana LR Francini","email":"","orcid":"","institution":"Genética e Molecular Faculdade de Medicina da Universidade de São Paulo","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ana","middleName":"LR","lastName":"Francini","suffix":""},{"id":148846452,"identity":"1dfec9fb-f5f1-4609-a56e-e2192b569c78","order_by":5,"name":"Irene L Noronha","email":"","orcid":"","institution":"Genética e Molecular Faculdade de Medicina da Universidade de São Paulo","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Irene","middleName":"L","lastName":"Noronha","suffix":""}],"badges":[],"createdAt":"2022-10-20 18:59:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2188031/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2188031/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-023-39299-9","type":"published","date":"2023-08-26T15:01:18+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":28766219,"identity":"aca245e5-29f0-4fb9-856f-831177ecab2b","added_by":"auto","created_at":"2022-11-07 19:18:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":20761,"visible":true,"origin":"","legend":"\u003cp\u003eBar graph representation of blood pressure, measured by tail cuff pressure, (mmHg) \u003cstrong\u003e(A)\u003c/strong\u003e and urinary albumin excretion rate (UAE, mg/24h) \u003cstrong\u003e(B)\u003c/strong\u003e in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups.\u003c/p\u003e","description":"","filename":"F1.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/ddfe68f86d43ea12d96a1de4.png"},{"id":28767133,"identity":"5716896b-1eaf-44e2-8aec-8ea04bf82529","added_by":"auto","created_at":"2022-11-07 19:26:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":970307,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative micrographs of glomerulosclerosis (left) and collapsed glomeruli (right), accessed in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups by PAS staining.\u003c/p\u003e","description":"","filename":"F2.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/7864a5cf44ce341de06eec75.png"},{"id":28766213,"identity":"ad475b2c-0d4d-466d-9690-15d7135dc0bf","added_by":"auto","created_at":"2022-11-07 19:18:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":17861,"visible":true,"origin":"","legend":"\u003cp\u003eBar graph representation of the percentage of glomerulosclerosis (A) and collapsed glomeruli (B) in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups.\u003c/p\u003e","description":"","filename":"F3.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/9e10e2ac58088d311579f8cb.png"},{"id":28768097,"identity":"a84968de-7713-4755-9cb0-9082d1e08950","added_by":"auto","created_at":"2022-11-07 19:34:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1482120,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative micrographs of renal cortical Interstitial fibrosis, evaluated in Masson’s Trichrome stained slides, interstitial α-SMA, collagen I and fibronectin accumulation, accessed by immunohistochemistry in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups.\u003c/p\u003e","description":"","filename":"F4.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/1352acdb2ca7ba26bb6ecad1.png"},{"id":28768799,"identity":"b04daaa9-17e8-4692-afcd-fdba8d254c79","added_by":"auto","created_at":"2022-11-07 19:42:37","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":40105,"visible":true,"origin":"","legend":"\u003cp\u003eBar graphs show quantification of percentage of cortical interstitial fibrosis \u003cstrong\u003e(A)\u003c/strong\u003e, interstitial α-SMA accumulation \u003cstrong\u003e(B)\u003c/strong\u003e, interstitial collagen I \u003cstrong\u003e(C)\u003c/strong\u003e, and fibronectin \u003cstrong\u003e(D)\u003c/strong\u003e, in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups.\u003c/p\u003e","description":"","filename":"F5.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/d92011cb5333d741fca5bf84.png"},{"id":28767135,"identity":"8478cc78-14e3-4d81-a8f7-9b2e82b47bd6","added_by":"auto","created_at":"2022-11-07 19:26:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1163332,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative micrographs of renal cortical interstitial infiltration of macrophages, lymphocytes (T-Cells) and PCNA\u003csup\u003e+\u003c/sup\u003e cells, accessed by immunohistochemistry in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups.\u003c/p\u003e","description":"","filename":"F6.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/c7825bae35c01d45e92ea2c9.png"},{"id":28768096,"identity":"65c9e70a-5f49-4ead-a088-3d38168ba935","added_by":"auto","created_at":"2022-11-07 19:34:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":25712,"visible":true,"origin":"","legend":"\u003cp\u003eBar graphs show interstitial infiltration of macrophage \u003cstrong\u003e(A)\u003c/strong\u003e, T-Cell \u003cstrong\u003e(B)\u003c/strong\u003e and PCNA\u003csup\u003e+\u003c/sup\u003e cells \u003cstrong\u003e(C)\u003c/strong\u003e in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups.\u003c/p\u003e","description":"","filename":"F7.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/c5c70a2533883a6431d8510c.png"},{"id":28766221,"identity":"418f799a-9800-481e-bf59-e288d76deec0","added_by":"auto","created_at":"2022-11-07 19:18:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":596355,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative micrographs of immunocytochemistry of untreated (Control) and IL-1b+AngII-stimulated NRK49F cells, stained for both a constitutive (vimentin) and a fibroblast activation-related (α-SMA) protein.\u003c/p\u003e","description":"","filename":"F8.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/f11c84a1db5dfdc52837dd3f.png"},{"id":28766217,"identity":"20a74e5a-b1b8-4e36-bb9f-0ab1c1ebc586","added_by":"auto","created_at":"2022-11-07 19:18:37","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":44091,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative RT-PCR of cultured NRK49F cells, submitted to the different treatments. RNA expression of pro and anti-fibrotic signaling factors; TGFb \u003cstrong\u003e(A)\u003c/strong\u003e, SMAD3 \u003cstrong\u003e(B)\u003c/strong\u003e and SMAD7 \u003cstrong\u003e(C)\u003c/strong\u003e, as well as for the ECM proteins; collagen I \u003cstrong\u003e(D)\u003c/strong\u003ecollagen III \u003cstrong\u003e(E) \u003c/strong\u003eand fibronectin \u003cstrong\u003e(F)\u003c/strong\u003e, were presented as bar graphs.\u003c/p\u003e","description":"","filename":"F9.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/08750d0f150a1d4f176d9bc4.png"},{"id":28767138,"identity":"6688d082-1fda-421c-a438-9ff38ad7e823","added_by":"auto","created_at":"2022-11-07 19:26:37","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":884129,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative micrographs of immunocytochemistry of NRK49F cells, stained for collagen I and fibronectin.\u003c/p\u003e","description":"","filename":"F10.png","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/fbe48117346c096ba43479e5.png"},{"id":42781298,"identity":"285937ff-9c7f-4648-b20c-b05c32258925","added_by":"auto","created_at":"2023-09-07 15:09:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5579922,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/fe9cbf07-d859-4018-ae7d-9a963b243c03.pdf"},{"id":28766223,"identity":"a374121a-4ea6-4f35-b527-9aaff86e6c40","added_by":"auto","created_at":"2022-11-07 19:18:37","extension":"docx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":205654,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1.docx","url":"https://assets-eu.researchsquare.com/files/rs-2188031/v1/087037f7e1578f266327d853.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tamoxifen, associated to the conservative CKD treatment, promoted additional antifibrotic effects on experimental hypertensive nephrosclerosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe pathogenesis of CKD involves an intricate process of both hemodynamic and inflammatory mechanisms that leads to renal fibrosis and progressive loss of function. Glomerular and systemic hypertension, increased production of cytokines and growth factors, renal infiltration of inflammatory cells, inordinate fibroblast proliferation and transdifferentiation into myofibroblasts have been described in different human nephropathies and experimental CKD models [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is widely known that overactivation of both systemic and intrarenal renin-angiotensin-aldosterone system (RAAS) contributes to the progression of CKD [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Once bound to its specific receptor (AT1), the active peptide Angiotensin II (AII) promotes renal and systemic vasoconstriction and tubular sodium conservation, leading to the elevation of blood pressure [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Moreover, AII also exerts proinflammatory effects, once it stimulates cell proliferation, fibroblast activation and further accumulation of extracellular matrix (ECM). Actually, since the discovery of the angiotensin ii converting enzyme inhibitors (ACEi) and the AT1 receptor blockers (ARB), such as losartan (LOS), RAAS suppression remains to be the best option available to slow the progression of CKD, although this strategy does not fully halt the progression of renal fibrosis and loss of function [\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is well known that inflammation and increased ECM production exert an important pathogenic role to the development and progression of CKD, regardless of its etiology. Accordingly, we have previously demonstrated that treatment with anti-inflammatory drugs such as mycophenolate mofetil (MMF), which promotes antiproliferative effects on T-cells, presented effective renoprotection in experimental CKD, in the hypertensive nephrosclerosis model obtained by chronic inhibition of Nitric Oxide (NO) synthesis (NAME model), in the 5/6 nephrectomy (Nx) and in the streptozotocin-induced diabetes [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Moreover, Nx rats treated with an association of MMF\u0026thinsp;+\u0026thinsp;LOS presented significantly less severe CKD when compared to animals receiving the respective monotherapies [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConsidering that renal fibrosis with tissue scarring is the final common pathway of CKD, therapeutic interventions with antifibrotic drugs could represent an attractive choice of therapy to arrest fibrogenesis in progressive nephropathies. In this context, tamoxifen (TAM), an estrogen receptor modulator clinically used in the treatment of breast cancer, has been demonstrated to also be effective in treating abnormal healing disorders, such as retroperitoneal fibrosis, sclerosing encapsulated peritonitis, fibrosing mediastinitis, among other fibroproliferative conditions [\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMoreover, we have recently shown that TAM treatment prevented the development of glomerulosclerosis and interstitial expansion in rats submitted to NO inhibition, even having no effects on the marked hypertension characteristic of this model [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMotivated by the positive responses achieved by each employed monotherapy in the treatment of progressive nephropathy associated to the NAME model of CKD, in the present study, we sought to verify if the administration of an association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM could promote additional renoprotection compared to the respective monotherapies, once the mechanisms of action of each drug are different and somehow complementary.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAssociation of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM was effective in reducing blood pressure and albuminuria\u003c/h2\u003e \u003cp\u003e As expected, rats receiving L-NAME exhibited severe hypertension when compared to Control (213 \u0026plusmn; 5 vs. 130 \u0026plusmn; 3 mmHg). LOS or MMF as monotherapies, as well as the association of LOS+MMF+TAM promoted reduction in the blood pressure levels (183 \u0026plusmn; 12, 173 \u0026plusmn; 9 and 173 \u0026plusmn; 3 mmHg, respectively), as shown in Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. NAME animals also developed marked albuminuria (147.3 \u0026plusmn; 30.5 vs. 1.1 \u0026plusmn; 0.4 mg/24h in the Control group), which was significantly reduced with all the employed monotherapies; LOS (14.2 \u0026plusmn; 4.4 mg/24h), MMF (11.1 \u0026plusmn; 7.8 mg/24h) and TAM (24.1 \u0026plusmn; 4.6 mg/24h). It is worth mentioning that the treatment with the association of LOS+MMF+TAM promoted the most prominent reduction of this parameter, reaching values similar to the control group (4.1 \u0026plusmn; 1.3 mg/24h), as presented in Figure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eB.\u003c/p\u003e \u003cp\u003e \u003cem\u003eTreatment with the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM averted the development of glomerulosclerosis and glomerular collapse in NAME rats\u003c/em\u003e \u003c/p\u003e \u003cp\u003eGlomerular structural alterations, characterized by the development of glomerulosclerosis and by the presence of collapsed glomeruli, were accessed by PAS staining. Illustrative micrographs of samples of each experimental group are represented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Untreated NAME rats exhibited prominent structural alterations, which were averted by all the employed therapeutic schemes. Bar graphs of the respective quantitative analysis of the percentage of sclerotic and collapsed glomeruli are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Accordingly, NAME animals shown significant glomerulosclerosis and glomerular collapse, compared to Control rats (2.6 \u0026plusmn; 0.7 and 17.3 \u0026plusmn; 3.0 vs. 0.3 \u0026plusmn; 0.3 and 1.6 \u0026plusmn;0.5 %, respectively). LOS, MMF and TAM monotherapies at least partially averted the development of both glomerulosclerosis and glomerular collapse in NAME rats (0.5 \u0026plusmn; 0.2 and 4.1\u0026plusmn; 1.1 %, 1.6 \u0026plusmn; 0.7 and 12 \u0026plusmn; 0.8 %, 1.1 \u0026plusmn; 0.3 and5.1 \u0026plusmn; 0.7 %), and the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM promoted further protection against these glomerular structural alterations (0.4 \u0026plusmn; 0.3 ad 0.9 \u0026plusmn; 0.5 %).\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Representative micrographs of glomerulosclerosis \u003cb\u003e(left)\u003c/b\u003e and collapsed glomeruli \u003cb\u003e(right)\u003c/b\u003e, accessed in the Control, NAME, LOS, MMF, TAM and LOS+MMF+TAM groups by PAS staining.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCombined LOS+MMF+TAM ameliorated interstitial fibrosis in animals submitted to the L-NAME CKD model\u003c/em\u003e \u003c/p\u003e \u003cp\u003eAs can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e, NAME animals exhibited severe renal interstitial fibrosis, evaluated in Masson trichrome stained renal slides, as well as abundant interstitial α-SMA expression, which indicates the presence of myofibroblasts in the renal cortex. Overexpression of collagen 1 and fibronectin, ECM proteins related to renal fibrosis, was also observed in NAME rats, compared to the Control. Bar graphs of the quantitative analysis of these parameters were presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e. According to these quantifications, NAME animals exhibited significant renal fibrosis, evidenced by the positivity for Masson staining (1.7 \u0026plusmn; 0.3 vs. 0.3 \u0026plusmn; 01 % in Control), as well as marked α-SMA accumulation (16.2 \u0026plusmn; 3.5 vs. 0.4 \u0026plusmn;0.1 % in Control), compared to Control rats. Both Masson positivity and the presence of interstitial myofibroblasts were equally limited by all the employed therapies, both monotherapies with LOS (0.8 \u0026plusmn; 0.2 and 5.7\u0026plusmn; 1.0 %), MMF (0.5 \u0026plusmn; 0.4 and 72 \u0026plusmn; 1.0 %) and TAM (0.3 \u0026plusmn; 0.1 and6.4 \u0026plusmn; 0.7 %), and the association of drugs (0.4 \u0026plusmn; 0.1 ad 5.2 \u0026plusmn; 1.2 %). Interstitial collagen 1 and fibronectin percentages were also abnormally increased in untreated NAME rats compared to Control animals (21 \u0026plusmn; 2 and 16 \u0026plusmn; 1 vs. 1 \u0026plusmn; 2 and 7 \u0026plusmn; 1 %, respectively). While the interstitial accumulation of collagen 1 was only subtly prevented by TAM monotherapy and the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM 16 \u0026plusmn; 2 and 17 \u0026plusmn; 2 %), interstitial fibronectin percentage was considerably averted by these treatments, especially by the combined theray (11 \u0026plusmn; 1 and 7 \u0026plusmn; 2 %).\u003c/p\u003e \u003cp\u003e \u003cem\u003eThe association of LOS+MMF+TAM abrogated renal inflammation and reversed interstitial cell proliferation in NAME animals\u003c/em\u003e \u003c/p\u003e \u003cp\u003eIllustrative microphotographs of immunohistochemistry for the detection of renal infiltration by macrophages and T-cells and for the evaluation of renal interstitial cell proliferation, in renal sections of animals from each experimental group, can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Immunohistochemistry analysis demonstrated that untreated rats submitted to the CKD model induced by L-NAME administration presented marked renal inflammation, characterized by intense cortical infiltration by macrophages and T-lymphocytes, and increased interstitial cell proliferation, evidenced by the presence of interstitial PCNA\u003csup\u003e+\u003c/sup\u003e cells. The inflammatory cells were detected mainly in the renal interstitium, but were also observed infiltrating glomeruli and in the perivascular area. According to the quantification of these cells, presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003e, untreated NAME rats exhibited significant interstitial macrophage (163 \u0026plusmn; 24 cell/mm\u003csup\u003e2\u003c/sup\u003e) and T-cell (127 \u0026plusmn; 20 cell/mm\u003csup\u003e2\u003c/sup\u003e) infiltration, compared to the Control (14 \u0026plusmn; 5 and 25 \u0026plusmn; 5 cell/mm\u003csup\u003e2\u003c/sup\u003e). LOS, MMF and TAM monotherapies statistically reduced these cells (84 \u0026plusmn; 17 and 84 \u0026plusmn; 11 cell/mm\u003csup\u003e2\u003c/sup\u003e, 50 \u0026plusmn; 9 and 42 \u0026plusmn; 9 cell/mm\u003csup\u003e2\u003c/sup\u003e and 82 \u0026plusmn; 7 and 38 \u0026plusmn; 7 cell/mm\u003csup\u003e2\u003c/sup\u003e, respectively). LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM association achieved the numerically lowest values of both macrophage and lymphocyte interstitial infiltration cells (40 \u0026plusmn; 6 and 27 \u0026plusmn; 5 cell/mm\u003csup\u003e2\u003c/sup\u003e). Similar results were obtained regarding renal cortical cells proliferation. NAME group presented significant increase in PCNA\u003csup\u003e+\u003c/sup\u003e interstitial cells, compared to Control (142 \u0026plusmn; 24 vs. 15 \u0026plusmn; 5 cell/mm\u003csup\u003e2\u003c/sup\u003e). All the employed monotherapies reduced cell proliferation in this experimental nephrosclerosis model (LOS: 43 \u0026plusmn; 16, MMF: 29 \u0026plusmn; 12 and TAM: 31 \u0026plusmn; 8 cell/mm\u003csup\u003e2\u003c/sup\u003e), and once more, the lowest number of positive cells were observed with the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM (16 \u0026plusmn; 6 cell/mm\u003csup\u003e2\u003c/sup\u003e), in which group the interstitial cell proliferation rate was comparable to the observed in the Control.\u003c/p\u003e \u003cp\u003e \u003cem\u003eTAM in monotherapy or associated to LOS effectively inhibited fibroblasts activation and ECM overproduction in cultured NRK-49F cells\u003c/em\u003e \u003c/p\u003e \u003cp\u003eIn order to establish an \u003cem\u003ein vitro\u003c/em\u003e model of activated fibroblasts, which may mimic the subpopulation of renal fibroblasts of our \u003cem\u003ein vivo\u003c/em\u003e experimental nephrosclerosis model, we stimulate rat renal immortalized fibroblasts from a commercially available cell line (NRK-49F) with IL-1β\u0026thinsp;+\u0026thinsp;AngII. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e8\u003c/span\u003e, after this stimulus, NRK-49F continued to express vimentin, a cytoskeleton type III intermediate filament, constitutively present in both fibroblasts and myofibroblasts, but also began to express α-SMA, indicating the effective fibroblast activation and differentiation of part of these cells to myofibroblast.\u003c/p\u003e \u003cp\u003eThe results of RT-qPCR analysis of gene expression of pro and antifibrotic factors in NRK-49F cells are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003e. IL-1β\u0026thinsp;+\u0026thinsp;AngII stimulus upregulated the expression of SAMD3 and SMAD7, as well as the expression of fibronectin, collagen I and collagen III in NRK-49F cells. While LOS treatment only reverted partially the overexpression of SMAD3, both TAM and associated LOS\u0026thinsp;+\u0026thinsp;TAM significantly normalized the expression of fibronectin, collagen I and collagen III, and reduced SMAD3 expression to levels lower than the observed in Control NRK49F cells. Additional illustrative immunocytochemistry for fibronectin and collagen I performed in cultured NRK-49F cells are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e10\u003c/span\u003e, in which is it possible to verify that, untreated IL-1β\u0026thinsp;+\u0026thinsp;AngII-stimulated NRK-49F and LOS-treated cells exhibited exuberant positivity for fibronectin, suggesting fibronectin assembly and ECM overproduction, compared with the unstimulated NRK-49F or to the TAM and LOS\u0026thinsp;+\u0026thinsp;TAM-treated cells.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study we investigated the potential renoprotective effects of the therapeutic association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM on an experimental model of hypertensive nephrosclerosis, based on the chronic inhibition of NO synthesis, induced by L-NAME administration. The main aim of our research was to verify whether the combination of TAM, a selective estrogen receptor modulator, recommended for the treatment of positive estrogen receptor (ER+) breast cancer, to the currently employed conservative CKD treatment, here represented by RAAS blockade and immunosuppression, would promote additional anti-inflammatory and/or antifibrotic beneficial effects, when compared to the respective monotherapies.\u003c/p\u003e \u003cp\u003eCorroborating previous data, rats submitted to the L-NAME model of CKD developed severe hypertension, probably caused by glomerular and systemic vasoconstriction due to the lack of physiological vasodilatory effects of NO. Systemic hypertension and CKD are closely related conditions with an intricate cause/effect relationship. The decline of kidney function usually leads to high blood pressure, due to both a decreased ability of the kidneys to remove salt from the bloodstream, and an increased release of renal vasoconstrictive hormones. On the other hand, systemic hypertension sustained for long periods leads to the damage of multiple target organs, including the kidneys [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Hypertensive nephrosclerosis is one of the main causes of end-stage renal failure. High blood pressure also contributes to the aggravation of CKD, regardless of its etiology [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Accordingly, the clinical management of hypertension is currently one of the most employed strategies to control CKD progression [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. According to our results, systemic hypertension induced by L-NAME administration was only partially reduced by the monotherapies with both LOS or MMF, and equally by the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM. There was no synergistic effect of the combination of drugs as regards lowering blood pressure. The poor hemodynamic effect of therapeutic schemes may have limited the potential effects of the therapeutic association on the maintenance of renal function.\u003c/p\u003e \u003cp\u003eAlong with the hypertension, NAME animals also exhibited a markedly increased urine albumin excretion rate, a clear evidence of renal impairment. Because of its strong predictive power for cardiovascular and renal events, albuminuria is one of the most important biomarkers of CKD progression, particularly in patients with hypertension or diabetes mellitus. Moreover, the reduction of albuminuria is the most important goal to prevent the progression of kidney disease in CKD patients. Usually, in this regard, significant benefits are achieved by the therapeutic treatment with RAAS inhibitors. According to our results, although all the tested monotherapies significantly limited the development of albuminuria in NAME animals, the antiproteinuric effect obtained with the combined treatment was noteworthy. Is spite of the severe sustained hypertension, LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM association completely averted the development of albuminuria in this CKD model.\u003c/p\u003e \u003cp\u003eThe increased urinary albumin excretion is directly related to the disruption of one or more components of the glomerular filtration barrier, and with glomerular structural damage, generally caused or worsened by renal inflammation. Histological glomerular alterations are a common feature in most human and experimental nephropathies. Accordingly, severe glomerulosclerosis and glomerular collapse were observed in untreated NAME animals, and the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM significantly prevented the development of glomerular histological damage, probably reflecting the effects of LOS (for glomerulosclerosis) and MMF (for collapsed glomeruli), thus evidencing that TAM did not exerted antagonism, blockade or inhibition upon the pharmacological effects of both LOS and MMF, and did not diminish the renoprotective effects observed with these drugs.\u003c/p\u003e \u003cp\u003eKidney infiltration by inflammatory leukocytes has been demonstrated in a variety of non-immune mediated nephropathies, such as the hypertensive nephrosclerosis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The recruitment of circulating monocytes, as well as the activation of resident renal macrophages often correlates positively with the worsening of renal function loss, in both human and experimental CKD [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Accordingly, in the present study, NAME animals showed exuberant renal inflammation, characterized by inordinate tubulointerstitial cell proliferation and massive infiltration of kidneys by both macrophages and lymphocytes. Surprisingly, similarly to the observed with LOS and MMF monotherapies, expected to exert inhibitory effects on macrophage and lymphocyte renal infiltration, as well as on interstitial proliferation rate, TAM monotherapy also exhibited independent significant anti-inflammatory proprieties. Therefore, the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM seems to combine different mechanisms of action to abrogate renal inflammation. Inhibition of macrophage activity by TAM treatment has been demonstrated in both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e studies, in which Tamoxifen promoted significant reduction in the transcription of important cell surface receptors, such as the fatty acid-binding proteins (FABPs) and the scavenger receptor class B member 3 (SCARB3 / CD36), which are involved in the monocyte/macrophage activation processes, and play a pivotal role in foam cell formation and in the development of atherosclerosis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The anti-proliferative effects of RAAS blockade, associated with the reduction of IL1, IL6 and IL10 macrophage release, possibly achieved with the MMF treatment, may have boosted the anti-inflammatory effects of TAM. A synergetic effect among the tested drugs could also be plausible in this case. However, additional studies focused on the intracellular mechanisms of action of each employed drug and in the possible chemical interactions among them should be carried out to speculate this hypothesis.\u003c/p\u003e \u003cp\u003eAlong with renal inflammation, the overproduction of ECM and the renal interstitial collagen accumulation are important histological features, commonly related to the worsening of CKD. In the present study renal cortical interstitial fibrosis, evidenced by the high percentage of Masson\u003csup\u003e+\u003c/sup\u003e interstitial staining, myofibroblasts infiltration, as well as collagen I and fibronectin interstitial deposition, accompanied the progression of hypertensive nephrosclerosis in untreated NAME rats. All the tested therapies were effective in preventing renal fibrosis and α-SMA accumulation, while only TAM and the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM significantly reduced collagen I and fibronectin accumulation in this CKD model, suggesting that TAM promoted additional antifibrotic effect to the therapeutic scheme, with no impairment of renoprotective action of LOS and MMF, when associated to these drugs. The suppressive effects of tamoxifen on fibrogenesis were first described in the early nineties, when Clark and collaborators described the drug to be effective and safe in the treatment of two patients with severe retroperitoneal fibrosis. Its effectiveness for the treatment of encapsulating peritoneal sclerosis, where than demonstrated, eight years later, by Allaria and co-authors. Based on these observations, Dell\u0026ecirc; and collaborators, from our research group, showed for the first time that TAM could exert protective effects on experimental progressive chronic kidney disease, in 2003. [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. More recently, TAM was described to exert important antifibrotic effects in the experimental model of unilateral ureteral obstruction (UUO) in mice. Similarly, to the observed in the present study, TAM treatment reduced the production and deposition of ECM proteins in UUO kidneys, as well as the renal deposition of fibronectin and collagen [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Although the exact mechanisms involved in the anti-inflammatory and antifibrotic effects of TAM are still poorly known, it exerts undoubted suppressive effects on fibroblast proliferation, activation and ECM secretion, evidenced in our \u003cem\u003ein vitro\u003c/em\u003e results, which corroborate the current literature [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Since MMF, employed as an immunosuppressive drug in our \u003cem\u003ein vivo\u003c/em\u003e protocol, is in fact a prodrug, which must be ingested and then metabolized into the pharmacologically active drug (mycophenolic acid), we were not able to perform \u003cem\u003ein vitro\u003c/em\u003e studies with the full LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM association. However, we combined LOS to TAM is our analysis and clearly demonstrated that LOS did not impaired the suppressive effects of TAM on cultured fibroblasts, thus corroborating the idea that this drug combination may be safe and effective.\u003c/p\u003e \u003cp\u003eIn summary, although further studies employing different CKD models are still required to confirm the efficacy and safety of the association of LOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM, in the present paper we provided strong evidence that this therapeutic scheme can be potentially useful to slow the progression of chronic nephropathy, since it lowered systolic blood pressure, prevented albuminuria, glomerular structural damage, and renal inflammation and promoted additional antifibrotic effect to the traditional conservative treatment of CKD, in the NAME model of hypertensive nephrosclerosis. In conclusion, our pre-clinical observations suggested that the association of TAM to the conservative treatment of CKD, employing LOS and MMF, was safe and promoted additional renoprotective, anti-inflammatory and antifibrotic effect in a model of hypertensive nephrosclerosis in rats.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo Experimental Groups and Protocol\u003c/h2\u003e \u003cp\u003e The present experimental protocol was approved by the local Research Ethics Committee (Comiss\u0026atilde;o de \u0026Eacute;tica para An\u0026aacute;lise de Projetos de Pesquisa \u0026ndash; CAPPesq) and was developed in strict conformity with the international standards for care and manipulation of laboratory animals.\u003c/p\u003e \u003cp\u003eThirty-five male Wistar rats aged between 7 and 8 weeks were kept under controlled temperature (23\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C), on a 12/12 hours\u0026rsquo; light/dark cycle with \u003cem\u003ead libitum\u003c/em\u003e access to tap water and HS diet (3.12% Na, Nuvital, Brazil). After 2 weeks of adaptation to HS diet, 30 of these animals were submitted to the NAME experimental model: As previously described, these model of hypertensive nephrosclerosis was induced by the chronic inhibition of endogenous NO, thus stimulating peripheral vasoconstriction [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. NO synthesis blockage was obtained by oral daily administration of 70 mg/kg/d of Nꙍ-nitro-L-arginin metil-ester (L-NAME - Sigma Chemical CO, St. Louis, USA), a L-arginine analogue, diluted on drinking water, associated to the HS diet.\u003c/p\u003e \u003cp\u003eNAME rats were divided among the following 5 groups: \u003cb\u003eNAME\u003c/b\u003e: Animals submitted to the NAME model and keep untreated; \u003cb\u003eLOS\u003c/b\u003e: NAME animals treated with 50 mg/Kg/d of losartan (LOS) diluted in drinking water; \u003cb\u003eMMF\u003c/b\u003e: NAME rats treated with 10 mg/Kg/d of Micofenolate Mofetil (MMF) administered daily by gavage; \u003cb\u003eTAM\u003c/b\u003e: NAME animals receiving 10 mg/Kg/d of Tamoxifen (TAM) and \u003cb\u003eLOS\u0026thinsp;+\u0026thinsp;MMF\u0026thinsp;+\u0026thinsp;TAM\u003c/b\u003e: NAME rats treated with LOS, MMF and TAM simultaneously. Five additional animals received only HS and were used as \u003cb\u003eControl\u003c/b\u003e. An illustrative flow-chart depicting the study design and groups can be seen in Supplemental Material section, on \u003cb\u003eSupplementary Fig.\u0026nbsp;1A\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eAll groups were followed for 30 days. Body weight was monitored weekly and at the end of this period, blood pressure was evaluated by the tail-cuff pressure method, using a noninvasive system (RTBP 2045; Kent Scientific). Additionally, 24-hour urinary albumin excretion rate (24h-UAE) was analyzed by radial immunodiffusion, as described elsewhere [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Animals were anesthetized with an intraperitoneal (IP) injection of 60 mg/kg of sodium pentobarbital and submitted to total nephrectomy followed by euthanasia through overdose of sodium pentobarbital, 80 mg/kg IP.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eHistological Analysis\u003c/h2\u003e \u003cp\u003eAs described elsewhere [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], kidneys obtained from total nephrectomy were cut in two midcoronal renal slices and pre-fixed with Duboscq-Brazil for 30 minutes, followed by 24-hour post-fixation in buffered 4% formaldehyde. Tissue samples were embedded in paraffin, through conventional techniques, renal tissue sections of 4-\u0026micro;m thickness were obtained and submitted to histological analysis for the assessment of glomerular and tubulointerstitial alterations.\u003c/p\u003e \u003cp\u003eThe percentage of glomerulosclerosis and collapsed glomeruli were evaluated in periodic Acid-Schiff (PAS) staining samples, through the analysis of at least 50 randomly sampled glomerular tuft profiles per rat. The criteria used to define sclerotic glomeruli was the presence of segmental hyalinosis lesions, usually with adhesion to Bowman\u0026acute;s capsule. Collapsed glomeruli were defined by their reduced size, wrinkling basement membrane and collapsed capillary loops. Interstitial fibrosis was quantitatively evaluated in Masson-stained sections by a point counting technique [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemical Analysis\u003c/h2\u003e \u003cp\u003eImmunohistochemistry (IHC) assays were performed to identify interstitial macrophage and T-cell infiltration in renal sections, as well as to evaluate tubulointerstitial cell proliferation and to quantify the percentage of tubulointerstitial area occupied by α-smooth muscle actin (α-SMA), possibly indicating the presence of myofibroblasts in the renal cortex [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], collagen I and fibronectin. A mouse monoclonal anti-ED1 antibody (Serotec, Oxford, UK) was used to identify macrophages through the APAAP (alkaline phosphatase anti-alkaline phosphatase) technique. Monoclonal mouse anti-CD3 (Dako, \u0026lrm;Glostrup, \u0026lrm;Denmark) and anti-α-SMA (Sigma Chemical CO, St. Louis, USA) antibodies were used, to identify T- cells and myofibroblast, respectively, through a streptavidin-biotin-alkaline phosphatase (Strep-AP) IHC technique. In both APAAP and Strep-AP techniques, the reactions were developed with a fast-red dye solution. Tubulointerstitial cell proliferation was detected by a monoclonal mouse anti-PCNA antibody (Dako, \u0026lrm;Glostrup, \u0026lrm;Denmark), while collagen I and fibronectin positivity were detected with polyclonal anti-collagen I (Rockland Immunochemicals, Inc., NY, USA) and anti-fibronectin (Sigma Chemical CO, St. Louis, USA) primary antibodies, using a streptavidin-biotin-horseradish peroxidase (Strep-HRP) IHC technique. Samples were developed with a DAB dye solution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro Experiments\u003c/h2\u003e \u003cp\u003eIn order to verify the specific antifibrotic activity of TAM alone, and also to investigate if this activity would be somehow inhibited or impaired by the association with other drugs, we performed cell culture experiments using a rat renal fibroblast cell line (NRK-49F; American Type Culture Collection, Manassas, VA). For this purpose, 1x10\u003csup\u003e5\u003c/sup\u003e NRK-49F cells were cultured under 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e in plastic culture plates with Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM-Low glucose, Invitrogen, USA) containing 5% inactivated fetal bovine serum (FBS; Gibco, Carlsbad, MO, USA), 100 units/mL penicillin, and 100 mg/mL streptomycin antibiotic solution (Gibco). Once cells reached 80% of confluence, the culture medium was replaced by DMEM-Low with 100 units/mL penicillin, and 100 mg/mL streptomycin antibiotic solution, plus the specific stimuli, as follows; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eControl\u003c/span\u003e, NRK-49 cells receiving no additional stimuli or treatment diluted in the culture medium, \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eIL-1β\u0026thinsp;+\u0026thinsp;AngII\u003c/span\u003e, NRK-49 cells whose culture medium was supplemented with 400 pg/mL of recombinant human IL-1β (PeproTech, Cranbury, NJ, USA) and 1x10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003eM human Angiotensin II acetate (Sigma), \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eLOS\u003c/span\u003e, IL-1β\u0026thinsp;+\u0026thinsp;AngII cells whose culture medium was further supplemented with 10 \u0026micro;M of Losartan, \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAM\u003c/span\u003e, IL-1β\u0026thinsp;+\u0026thinsp;AngII cells whose culture medium was further supplemented with 5\u0026micro;M of Tamoxifen citrate (Sigma) and \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eLOS\u0026thinsp;+\u0026thinsp;TAM\u003c/span\u003e, NRK-49 cells receiving all the above mentioned supplements. Cells were kept under the described treatments for 24h. An illustrative flow-chart of \u003cem\u003ein vitro\u003c/em\u003e experiments can be seen in Supplemental Material section, on \u003cb\u003eSupplementary Fig.\u0026nbsp;1B\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunocytochemistry\u003c/h2\u003e \u003cp\u003eImmunocytochemistry (ICC) assays were performed to characterize the constitutive expression of vimentin in NRK-49 cells, using a mouse monoclonal anti-vimentin primary antibody (Sigma Chemical CO, St. Louis, USA). The activation of fibroblasts after IL-1β\u0026thinsp;+\u0026thinsp;AngII stimulus, was evaluated through the positivity of these cells for α-SMA, with a mouse monoclonal anti-α-SMA antibody (Sigma Chemical CO, St. Louis, USA). Moreover, ICC was also employed to analyze the expression of collagen I and fibronectin in NRK-49 cells submitted to the different treatments, employing, respectively, the rabbit polyclonal anti-collagen I (Rockland Immunochemicals, Inc., NY, USA) and anti-fibronectin (Sigma Chemical CO, St. Louis, USA) primary antibodies. Vimentin, collagen I and fibronectin ICC were performed through a streptavidin-biotin-alkaline phosphatase (Strep-AP) technique. Reactions were developed with a fast-red dye solution. α-SMA was detected through a streptavidin-biotin-horseradish peroxidase (Strep-HRP) ICC technique, developed with a DAB dye solution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eReal time RT-PCR\u003c/h2\u003e \u003cp\u003eQuantitative real-time polymerase chain reaction (PCR) of cultured NRK-49F cells was performed to measure the relative gene expression of TGFβ, SMAD3, SMAD7, Collagen type I, collagen type III and Fibronectin, using Actinβ as a housekeeping control, as previously described. Total NRK-49F cells RNA extraction was carried out with RNeasy Plus Kit (Qiagen, MD, EUA), following the instructions of the manufacturer. Reverse transcription (RT) was performed with M-MLV enzyme kit (Promega) and qPCR was conducted with the Syber GreenER qPCR Super Mix Universal (Invitrogen), in the StepOne Plus equipment (Applied Biosystetems - Life Technologies). Quantitative comparisons were obtained using the ΔΔCT method (Applied Biosystems, Singapore, Singapore). Primer sequences for amplifying target genes were: Tgfb1 NM_021578.2, left primer: GCTGAACCAAGGAGACGGAA, right primer: CATGAGGAGCAGGAAGGGTC, Smad3 NM_013095.3 left primer: GAGACATTCCACGCTTCACA, right primer: AAAGACCTCCCCTCCAATGT, Smad7 NM_030858.2 left primer: TCTCCCCCTCCTCCTTACTC, right primer: CAGGCTCCAGAAGAAGTTGG, Coll1a1 NM_053304.1 left primer: AGCTGGTGCTAAGGGTGAAG, right primer: GCAATACCAGGAGCACCATT, Coll3a1 NM_053304.1 left primer: AGCTGGTGCTAAGGGTGAAG, right primer: GCAATACCAGGAGCACCATT, Fn1 NM_019143.2 left primer CTCCCGGAACAGATGCAATG, right primer ATCCAGCTGAAGCACTCTGT and Actb NM_031144.3 left primer: AGGGAAATCGTGCGTGACAT, right primer: CCATACCCAGGAAGGAAGGC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eResults were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Differences among all groups were analyzed by one-way ANOVA with Dunnet\u0026rsquo;s multiple comparison post-test. Means were considered statistically different when p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. All statistical analyses were realized using the Graph-Pad Prism\u0026trade; 5.01 software.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present research was financially supported by S\u0026atilde;o Paulo Research Foundation (Process FAPESP - 03/05405-7).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC.F.\u003c/strong\u003e was responsible for \u003cem\u003ein vivo\u003c/em\u003e data acquisition (animal care, biochemical, histological and part of immunohistochemical analysis), analyzed and interpreted the results obtained with the experiments and wrote the manuscript. \u003cstrong\u003eF.M.O.\u003c/strong\u003e and \u003cstrong\u003eG.A.C.\u003c/strong\u003e were responsible for \u003cem\u003ein vitro\u003c/em\u003e data acquisition (cell culture and treatments, RT-qPCR and immunocytochemistry). \u003cstrong\u003eD.C.N.\u003c/strong\u003e and \u003cstrong\u003eA.L.R.F.\u003c/strong\u003e performed the immunohistochemical analysis for collagen and fibronectin, took the tissue slides photomicrographs and assembled the panels for figures 2 and 4. \u003cstrong\u003eI.L.N.\u003c/strong\u003e conceived and designed the research project, interpreted and discussed all results obtained and substantially contributed with intellectual content of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated in the present study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure of Potential Conflicts of Interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to declare\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present experimental protocol was approved by the local Research Ethics Committee (Comiss\u0026atilde;o de \u0026Eacute;tica para An\u0026aacute;lise de Projetos de Pesquisa \u0026ndash; CAPPesq) and was developed in strict conformity with the international standards for care and manipulation of laboratory animals.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatement of adherence to The ARRIVE Guidelines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present experimental study was reported in accordance with The ARRIVE guidelines 2.0, https://doi.org/10.1371/journal.pbio.3000411, following the ARRIVE Essential 10 requirements.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRomagnani, P. et al. Chronic kidney disease. \u003cem\u003eNat Rev Dis Primers.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e(\u003cb\u003e3\u003c/b\u003e), (2017):17088. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrdp.2017.88\u003c/span\u003e\u003cspan address=\"10.1038/nrdp.2017.88\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoronha, I.L., Fujihara, C.K., Zatz, R. The inflammatory component in progressive renal disease - Are interventions possible? \u003cem\u003eNephrol Dial Transplant.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e(\u003cb\u003e3\u003c/b\u003e), (2002): 363-8. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ndt/17.3.363\u003c/span\u003e\u003cspan address=\"10.1093/ndt/17.3.363\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeisberg, M., Neilson, E.G. Mechanisms of tubulointerstitial fibrosis. \u003cem\u003eJ Am Soc Nephrol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e(\u003cb\u003e11\u003c/b\u003e), (2010): 1819-34. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1681/ASN.2010080793\u003c/span\u003e\u003cspan address=\"10.1681/ASN.2010080793\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFanelli, C., Dell\u0026ecirc;, H., Cavaglieri, R.C., Dominguez, W.V., Noronha, I.L. Gender Differences in the Progression of Experimental Chronic Kidney Disease Induced by Chronic Nitric Oxide Inhibition. Biomed Res Int. (2017):159739. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2017/2159739\u003c/span\u003e\u003cspan address=\"10.1155/2017/2159739\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGraciano, M.L., Cavaglieri, R.C., Dell\u0026ecirc;, H., Casarini, D.E., Malheiros, D.M.A.C. Intrarenal renin-angiotensin system is upregulated in experimental model of progressive renal disease induced by chronic inhibition of nitric oxide synthesis. \u003cem\u003eJ Am Soc Nephrol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e(\u003cb\u003e7\u003c/b\u003e), (2004):1805-15. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/01.asn.0000131528.00773.a9\u003c/span\u003e\u003cspan address=\"10.1097/01.asn.0000131528.00773.a9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR\u0026uuml;ster, C., Wolf, G. Renin-angiotensin-aldosterone system and progression of renal disease. J Am Soc Nephrol. \u003cb\u003e17\u003c/b\u003e(\u003cb\u003e11\u003c/b\u003e), (2006):2985\u0026ndash;91 DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1681/ASN.2006040356\u003c/span\u003e\u003cspan address=\"10.1681/ASN.2006040356\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJudd, E., Calhoun, D.A. Management of Hypertension in CKD: Beyond the Guidelines. \u003cem\u003eAdv Chronic Kidney Dis\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e(\u003cb\u003e2\u003c/b\u003e), (2015):116 \u0026ndash; 22. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/j.ackd.2014.12.001\u003c/span\u003e\u003cspan address=\"10.1053/j.ackd.2014.12.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTownsend, R.R., Taler, S.J. Management of hypertension in chronic kidney disease. \u003cem\u003eNat Rev Nephrol\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e(\u003cb\u003e9\u003c/b\u003e), (2015):555 \u0026ndash; 63. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrneph.2015.114\u003c/span\u003e\u003cspan address=\"10.1038/nrneph.2015.114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArias, S.C.A. et al. Regression of albuminuria and hypertension and arrest of severe renal injury by a losartan-hydrochlorothiazide association in a model of very advanced nephropathy. \u003cem\u003ePLoS One\u003c/em\u003e. 2013:\u003cb\u003e8\u003c/b\u003e(\u003cb\u003e2\u003c/b\u003e), (2013):e56215. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://journals.plos.org/plosone/article?id=10.1371/journal.pone.0056215\u003c/span\u003e\u003cspan address=\"https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0056215\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFanelli, C. et al. Effects of losartan, in monotherapy or in association with hydrochlorothiazide, in chronic nephropathy resulting from losartan treatment during lactation. Am J Physiol Renal Physiol. \u003cb\u003e301\u003c/b\u003e(\u003cb\u003e3\u003c/b\u003e), (2011):F580-7. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/ajprenal.00042.2011\u003c/span\u003e\u003cspan address=\"10.1152/ajprenal.00042.2011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujihara, C.K., Malheiros, D.M.A.C.; Zatz, R.; Noronha I.L. Mycophenolate mofetil attenuates renal injury in the rat remnant kidney. \u003cem\u003eKidney Int.\u003c/em\u003e \u003cb\u003e54\u003c/b\u003e(\u003cb\u003e5\u003c/b\u003e), (1998):1510-9. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1046/j.1523-1755.1998.00138.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1523-1755.1998.00138.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujihara, C.K., Malheiros, D.M.A.C., Noronha, I.L., de Nucci, G., Zatz, R. Mycophenolate Mofetil Reduces Renal Injury in the Chronic Nitric Oxide Synthase Inhibition Model. \u003cem\u003eHypertension.\u003c/em\u003e \u003cb\u003e37\u003c/b\u003e(\u003cb\u003e1\u003c/b\u003e), (2001):170\u0026ndash;175. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/01.hyp.37.1.170\u003c/span\u003e\u003cspan address=\"10.1161/01.hyp.37.1.170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUtimura, R. et al. Mycophenolate mofetil prevents the development of glomerular injury in experimental diabetes. \u003cem\u003eKidney Int.\u003c/em\u003e \u003cb\u003e63\u003c/b\u003e(\u003cb\u003e1\u003c/b\u003e), (2003):209 \u0026ndash; 16. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1046/j.1523-1755.2003.00736.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1523-1755.2003.00736.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujihara, C.K. et al. Combined mycophenolate mofetil and losartan therapy arrests established injury in the remnant kidney. \u003cem\u003eJ Am Soc Nephrol\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e(\u003cb\u003e2\u003c/b\u003e), (2000):283 \u0026ndash; 90. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1681/ASN.V112283\u003c/span\u003e\u003cspan address=\"10.1681/ASN.V112283\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Bommel, E.F.H., Pelkmans, L.G., Van Damme, H., Hendriksz, T.R. Long-term safety and efficacy of a tamoxifen-based treatment strategy for idiopathic retroperitoneal fibrosis. Eur J Intern Med. \u003cb\u003e24\u003c/b\u003e(\u003cb\u003e5\u003c/b\u003e), (2013):444\u0026ndash;50. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejim.2012.11.010\u003c/span\u003e\u003cspan address=\"10.1016/j.ejim.2012.11.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoustafellos, P. et al. Tamoxifen Therapy in Encapsulating Sclerosing Peritonitis in Patients After Kidney Transplantation. \u003cem\u003eTransplant Proc.\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e(\u003cb\u003e9\u003c/b\u003e), (2006):2913-4. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.transproceed.2006.08.179\u003c/span\u003e\u003cspan address=\"10.1016/j.transproceed.2006.08.179\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoffeld, R.J., Van Weel, T.F., Tamoxifen for retroperitoneal fibrosis. Lancet. 6:341(8841), (1993):382. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0140-6736(93)90195-m\u003c/span\u003e\u003cspan address=\"10.1016/0140-6736(93)90195-m\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllaria, P.M., Giangrande, A., Gandini, E., Pisoni, I.B. Continuous ambulatory peritoneal dialysis and sclerosing encapsulating peritonitis: tamoxifen as a new therapeutic agent? \u003cem\u003eJ Nephrol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e(\u003cb\u003e6\u003c/b\u003e), (1999):395-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDell\u0026ecirc;, H., Cavaglieri, R.C., Vieira Jr, J.M., Malheiros, D.M.A.C., Noronha, I.L. Antifibrotic effect of tamoxifen in a model of progressive renal disease. J Am Soc Nephrol. \u003cb\u003e23\u003c/b\u003e(\u003cb\u003e1\u003c/b\u003e), (2012):37\u0026ndash;48. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1681/ASN.2011010046\u003c/span\u003e\u003cspan address=\"10.1681/ASN.2011010046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMancini, GA., Carbonaro, J.F. Immunochemical quantitation of antigen by single radial immunodiffusion. \u003cem\u003eImmunochemistry.\u003c/em\u003e \u003cb\u003e2\u003c/b\u003e(\u003cb\u003e3\u003c/b\u003e), (1965):235 \u0026ndash; 54. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0019-2791(65)90004-2\u003c/span\u003e\u003cspan address=\"10.1016/0019-2791(65)90004-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJepsen, L.F. Mortensen, P.B. Interstitial fibrosis of the renal cortex in minimal change lesion and its correlation with renal function: a quantitative study. \u003cem\u003eVirchows Arch A Pathol Anat Histol\u003c/em\u003e. 23;383(3), (1979):265 \u0026ndash; 70. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/BF00430245\u003c/span\u003e\u003cspan address=\"10.1007/BF00430245\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWallenstein, S., Zucker, C.L., Fleiss, J.L. Some statistical methods useful in circulation research. \u003cem\u003eCirc Res.\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e(\u003cb\u003e1\u003c/b\u003e), (1980):1\u0026ndash;9. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/01.res.47.1.1\u003c/span\u003e\u003cspan address=\"10.1161/01.res.47.1.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeles, F. et al. (2015) Brazilian red propolis attenuates hypertension and renal damage in 5/6 renal ablation model. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e21\u003c/b\u003e;\u003cb\u003e10\u003c/b\u003e(\u003cb\u003e1\u003c/b\u003e), (2015):e0116535. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://journals.plos.org/plosone/article?id=10.1371/journal.pone.0116535\u003c/span\u003e\u003cspan address=\"https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0116535\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFanelli, C. et al. Innate And Adaptive Immunity are Progressively Activated in Parallel with Renal Injury in the 5/6 Renal Ablation Model. \u003cem\u003eSci Rep.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e;\u003cb\u003e7\u003c/b\u003e(\u003cb\u003e1\u003c/b\u003e), (2016):3192. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-017-02915-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-02915-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu, M. et al. Inhibition of Macrophage CD36 Expression and Cellular Oxidized Low Density Lipoprotein (oxLDL) Accumulation by Tamoxifen. \u003cem\u003eJ Biol Chem\u003c/em\u003e. 12;291(33), (2016):16977-89. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M116.740092\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M116.740092\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClark, C.P 1.; Vanderpool, D.; Preskitt, J.T.The response of retroperitoneal fibrosis to tamoxifen Surgery. \u003cb\u003e109\u003c/b\u003e(\u003cb\u003e4\u003c/b\u003e), (1991):502\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDell\u0026ecirc;, H., Rocha, J.R.C., Malheiros, D.M.A.C., Vieira, Jr J.M., Noronha, I.L. Tamoxifen has protective effect preventing renal damage in chronic progressive renal disease. In: World Congress of Nephrology, 2003, Berlin. Nephrol Dial Transp \u003cb\u003e18\u003c/b\u003e, (2003):592. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1681/ASN.2011010046\u003c/span\u003e\u003cspan address=\"10.1681/ASN.2011010046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, C.S. et al. Tamoxifen ameliorates obstructive nephropathy through Src and the PI3K/Akt/mTOR pathway. Biol Cell. Jan;111(1), (2019):18\u0026ndash;27. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/boc.201800040\u003c/span\u003e\u003cspan address=\"10.1111/boc.201800040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTingskov, S.J. et al. Tamoxifen attenuates renal fibrosis in human kidney slices and rats subjected to unilateral ureteral obstruction. Biomedicine \u0026amp; Pharmacotherapy, \u003cb\u003e133\u003c/b\u003e, (2021):111003. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2020.111003\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2020.111003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva, FMO. et al. Tamoxifen and bone morphogenic protein-7 modulate fibrosis and inflammation in the peritoneal fibrosis model developed in uremic rats. Molecular Medicine \u003cb\u003e25\u003c/b\u003e, (2019):41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://molmed.biomedcentral.com/articles/\u003c/span\u003e\u003cspan address=\"https://molmed.biomedcentral.com/articles/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s10020-019-0110-5\u003c/span\u003e\u003cspan address=\"10.1186/s10020-019-0110-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Chronic kidney disease, tamoxifen, fibrosis ","lastPublishedDoi":"10.21203/rs.3.rs-2188031/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2188031/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCKD progression depends on the activation of an intricate set of hemodynamic and inflammatory mechanisms, promoting renal leukocyte infiltration, inflammation and fibrosis, leading to renal function loss. There are currently no specific drugs to detain renal fibrogenesis, which is a common end-point for different nephropathies. Clinical therapy for CKD is mostly based on the management of hypertension and proteinuria, partially achieved with renin-angiotensin-aldosterone system (RAAS) blockers, and the control of inflammation by immunosuppressive drugs. The aim of the present study was to verify if the administration of tamoxifen (TAM), an estrogen receptor modulator, clinically employed in the treatment of breast cancer and predicted to exert antifibrotic effects, would promote additional benefits when associated to a currently used therapeutic scheme for the conservative management of experimental CKD. Wistar rats underwent the NAME model of hypertensive nephrosclerosis, obtained by daily oral administration of a nitric oxide synthesis inhibitor, associated to dietary sodium overload. The therapeutic association of TAM to losartan (LOS), and mofetil mycophenolate (MMF) effectively reduced the severe hypertension, marked albuminuria and glomerular damage exhibited by NAME animals. Moreover, the association also succeeded in limiting renal inflammation in this model, and promoted further reduction of ECM interstitial accumulation and renal fibrosis, compared to the monotherapies. According to our results, the association of TAM to the currently used conservative treatment of CKD added significant antifibrotic effects both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e, and may represent an alternative to slow the progression of chronic nephropathy.\u003c/p\u003e","manuscriptTitle":"Tamoxifen, associated to the conservative CKD treatment, promoted additional antifibrotic effects on experimental hypertensive nephrosclerosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-11-07 19:18:32","doi":"10.21203/rs.3.rs-2188031/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-11-21T10:17:56+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-11-15T09:46:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"c62f74d2-a8a4-4b13-9306-f0d9a2c9add7","date":"2022-11-09T15:55:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"f930e5f2-d5c0-4814-ba05-fd6c81c13311","date":"2022-11-07T09:26:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"191ba0dd-7d0f-47f7-96fb-c9875cd0e712","date":"2022-11-05T10:58:36+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-11-02T09:01:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-11-02T08:59:36+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2022-11-02T08:58:07+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-11-02T08:45:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2022-10-20T18:47:39+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cb194598-c54a-4dab-bd46-da9ce997509d","owner":[],"postedDate":"November 7th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":16664286,"name":"Biological sciences/Physiology"},{"id":16664287,"name":"Biological sciences/Drug discovery"},{"id":16664288,"name":"Biological sciences/Drug discovery/Target identification"},{"id":16664289,"name":"Biological sciences/Drug discovery/Target validation"},{"id":16664290,"name":"Health sciences/Nephrology"},{"id":16664291,"name":"Health sciences/Nephrology/Kidney diseases"},{"id":16664292,"name":"Health sciences/Diseases"},{"id":16664293,"name":"Health sciences/Diseases/Kidney diseases"},{"id":16664294,"name":"Health sciences/Diseases/Kidney diseases/Chronic kidney disease"},{"id":16664295,"name":"Health sciences/Diseases/Kidney diseases/Nephrosclerosis"},{"id":16664296,"name":"Health sciences/Diseases/Kidney diseases/Renal fibrosis"}],"tags":[],"updatedAt":"2023-09-07T15:07:38+00:00","versionOfRecord":{"articleIdentity":"rs-2188031","link":"https://doi.org/10.1038/s41598-023-39299-9","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2023-08-26 15:01:18","publishedOnDateReadable":"August 26th, 2023"},"versionCreatedAt":"2022-11-07 19:18:32","video":"","vorDoi":"10.1038/s41598-023-39299-9","vorDoiUrl":"https://doi.org/10.1038/s41598-023-39299-9","workflowStages":[]},"version":"v1","identity":"rs-2188031","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2188031","identity":"rs-2188031","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}