Wntless interacts with Notch signaling to balance the generation of neurons and gliocytes in vertebrate dorsal diencephalon

Wntless interacts with Notch signaling to balance the generation of neurons and gliocytes in vertebrate dorsal diencephalon | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Wntless interacts with Notch signaling to balance the generation of neurons and gliocytes in vertebrate dorsal diencephalon Shu-Heng Lin , He-Yen Pan , Bo-Tsung Wu , Joe Sakamoto , Chun-Hsiu Wu , Atsuko Shimada , View ORCID Profile Yasuhiro Kamei , Hiroyuki Takeda , Yung-Shu Kuan doi: https://doi.org/10.1101/2025.08.06.668881 Shu-Heng Lin 1 Institute of Biochemical Sciences, College of Life Science, National Taiwan University , Taipei 10617, Taiwan 2 Institute of Biological Chemistry , Academia Sinica, Academic Road, Taipei 11529, Taiwan Find this author on Google Scholar Find this author on PubMed Search for this author on this site He-Yen Pan 1 Institute of Biochemical Sciences, College of Life Science, National Taiwan University , Taipei 10617, Taiwan 2 Institute of Biological Chemistry , Academia Sinica, Academic Road, Taipei 11529, Taiwan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Bo-Tsung Wu 1 Institute of Biochemical Sciences, College of Life Science, National Taiwan University , Taipei 10617, Taiwan 2 Institute of Biological Chemistry , Academia Sinica, Academic Road, Taipei 11529, Taiwan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Joe Sakamoto 3 National Institute for Basic Biology , Okazaki, Aichi 444-8585, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Chun-Hsiu Wu 2 Institute of Biological Chemistry , Academia Sinica, Academic Road, Taipei 11529, Taiwan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Atsuko Shimada 4 Department of Biological Sciences, Graduate School of Science, The University of Tokyo , Tokyo 113-0033, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yasuhiro Kamei 3 National Institute for Basic Biology , Okazaki, Aichi 444-8585, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Yasuhiro Kamei Hiroyuki Takeda 4 Department of Biological Sciences, Graduate School of Science, The University of Tokyo , Tokyo 113-0033, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yung-Shu Kuan 1 Institute of Biochemical Sciences, College of Life Science, National Taiwan University , Taipei 10617, Taiwan 2 Institute of Biological Chemistry , Academia Sinica, Academic Road, Taipei 11529, Taiwan 5 Center for Developmental Biology and Regeneration Medicine, National Taiwan University , Taipei 10617, Taiwan 6 Neuroscience Program, Academia Sinica, Academic Road , Taipei 11529, Taiwan Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: yskuan{at}ntu.edu.tw Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Wnt chaperon Wntless (Wls) mediates the intracellular transport of Wnts and plays important roles in early vertebrate brain development. Spatially restricted induction of Wls denotes the earliest differentiation of non-telencephalic cells in human brain organoids. In zebrafish developing diencephalon, loss-of-Wls reduces the formation of habenula (HA) neurons but how Wls influences HA neurogenesis is unclear and whether Wls regulates gliocyte development is unknown. Here we report that the formations of cholinergic, substance P-ergic or glutamatergic neurons in HA are reduced differentially but the generation of gliocyte-derived choroid plexus (ChP) epithelia is increased in wls null mutants. At earlier stage, three-dimensional gene expression analyses revealed that while neurog1 expressions in HA progenitor zones are reduced, the expressions of Notch downstream effector her6 are increased and expanded into HA progenitor zones in wls mutants. Over-expressing Her6 in neurog1 -positive cells reduced neurog1 expressions in HA progenitor zones. These results indicate that Wls restricts the expressions of Notch effector her6 to promote the specification of neurog1 proneurons and demotes the generation of ChP epithelia in zebrafish embryonic dorsal diencephalon. Background The developing dorsal diencephalon (or epithalamus) in vertebrate brain contains two major neuronal clusters, the habenular nuclei (HA) plus pineal organ (P), and one gliocyte (glial cell) containing cluster, the choroid plexus (ChP) (Liu, Zhou et al., 2018). In zebrafish, HA are situated bilaterally to the pineal organ and extend their axons to the interpeduncular nucleus (IPN) to construct one of the conserved forebrain to midbrain conduction systems which modulates aversive response and reward processing in vertebrate brain. Defects in HA-IPN circuitry are implicated in a variety of behavior and neurological disorders such as elevated anxiety, depression or schizophrenia (Beretta, Dross et al., 2012, Bianco & Wilson, 2009 , Fore & Yaksi, 2019 , Kinoshita & Okamoto, 2023 , Roberson & Halpern, 2018 ) ( Figure 1A ). The ChP comprises a polarized epithelial cell layer (ChPe) derived from glial cells and blood vessels derived from mesodermal endothelial cells. In humans and rodents, ChP develop at four sites in the roof of the neural tube shortly after its closure, in the order fourth, lateral and third ventricles ( Hunter & Dymecki, 2007 , Kompanikova & Bryja, 2022 , Lun, Monuki et al., 2015, MacDonald, Lu et al., 2021). In zebrafish, the third ventricle ChP in dorsal diencephalon is located right anterior to the pineal organ and can be clearly identified in larvae at 3-4 days post-fertilization (Garcia-Lecea, Kondrychyn et al., 2008, Henson, Parupalli et al., 2014) ( Figure 1A ). The functions of ChP include producing cerebrospinal fluid (CSF), forming the essential blood-CSF barriers which render mechanical support, providing a route for some nutrients, and removing by-products of metabolism and synaptic activity (Kaur, Rathnasamy et al., 2016, Kompanikova & Bryja, 2022 , Kratzer, Ek et al., 2020, Lun et al., 2015 ). Despite their importance, little is known about how these essential structures develop. Download figure Open in new tab Figure 1. Habenular neuronal fates are changed in wls mutants. (A) The schematic cartoon indicating the locations of diencephalic or hindbrain ChPs (dChP or hChP in green), pineal (in gray), left or right HA (LHA or RHA in blue), eyes and optic tectum (O-Tectum). (B-G’) Dorsal views of representative Z-projection images from slc18a3b + cpd2 (B, B’, E, E’), tac3a + cpd2 (C, C’, F, F’), or vglut2 + cpd2 (D, D’, G, G’) double mRNA in situ labeling in HA of 96h WT (B-D’) or wls (E-G’) larva. (H-O’) Dorsal or anterior views of representative snapshots from virtual 3D map showing aligned and averaged Z-stacks of slc18a2b + cpd2 genes (H to I’, in blue and grey), tac3a + cpd2 genes (J to K’, in green and grey) or vglut2 + cpd2 genes (L to M’, in red and grey) in WT (H-H’, J-J’, L-L’) or wls mutants (I-I’, K-K’, M-M’). (N-O’) Snapshots from merged virtual 3D map of all four genes. Scale bar = 30μm. (P-S’) Snapshots showing overlapped domains for slc18a3b + tac3a ( s + t ; P, P’), slc18a3b + vglut2 ( s + v ; Q, Q’), tac3a + vglut2 ( t + v ; R, R’), or slc18a3b + tac3a + vglut2 ( s + t + v ; S, S’) gene transcripts from WT (P-S) or wls (P’-S’) larvae. (T-V) Averaged expression volumes (Vol.) or percentage (%) of all four genes in WT or wls larvae. (W) Expression Vol. or % of overlapped domains in WT or wls larvae. Confidence p value ( p ) is denoted by “*”. “****” means P <0.0001; “***” means P <0.001; “**” means P <0.01; “*” means P <0.05 in t-test. (See Supplemental Figure 1 and Table1 for numeric data) Wnt and Notch signaling molecules each play their own roles in regulating the generation of HA and ChPs during vertebrate brain development. In mice, Wnt1 and Wnt component Tcf7l2 are involved in HA neuronal differentiation and HA neuronal wiring whereas WNT5a, Wls, beta-Catenin and Notch1 play essential roles in ChP epithelia morphogenesis and proliferation (Carpenter, Rao et al., 2010, Company, Moreno-Cerda et al., 2021, Hunter & Dymecki, 2007 , Kaiser, Jang et al., 2021, Langford, O’Leary et al., 2020, Lee, Yoon et al., 2017, Parichha, Suresh et al., 2022). In zebrafish, Wnt components such as axin1 , tcf7l2 , wls , and Notch activator mindbomb ( mib ) modulate the left-right patterning and neurogenesis of HA (Aizawa, Goto et al., 2007, Beretta, Dross et al., 2013, Carl, Bianco et al., 2007, Husken, Stickney et al., 2014, Kuan, Roberson et al., 2015, Roberson & Halpern, 2017 ). In comparison, no Wnt component has been studied for a role in ChPe development in zebrafish but studies showed that Shh is required for the synchronized outgrowth of ChPe and fenestrated vasculature, depletion of either delta a ( dla ) delta d ( dld ) or notch1b increases ChPe growth, and depletion of mib causes defects in specifying ChPe (Bill, Balciunas et al., 2008, Huang, Ketova et al., 2009). Nevertheless, a clear picture of how regional Wnt or Notch activities are established and whether any regulatory mechanism exists to integrate the generation of HA neurons and ChP epithelia is unknown. Wntless (Wls) encodes a transmembrane protein which is responsible for the secretions of some members of Wnt proteins (WNTs) (Banziger, Soldini et al., 2006, Bartscherer, Pelte et al., 2006, Ching, Hang et al., 2008, Wolf & Boutros, 2023 , Wu, Wen et al., 2015). Functional analyses indicated that WLS physically interact with WNTs and escort WNTs from ER, Golgi to plasma membrane where they hand off WNTs to their extracellular carriers such as secreted FZD-related proteins and WNT inhibitory factor 1 (Das, Yu et al., 2012, de Almeida Magalhaes, Liu et al., 2024, Wolf & Boutros, 2023 ). Study of human brain organoids indicated that spatially restricted induction of WLS marks the earliest emergence of non-telencephalic brain regions, and study with Wnt1-Cre-mediated WLS knockout showed that WLS plays a role in the generation of ChPe in mice but complete WLS knockout caused axis formation defects and early death of the affected animals before ChP formation ( Carpenter et al., 2010 , Fu, Jiang et al., 2009, Jain, Gut et al., 2025). In zebrafish, maternal deposited wls transcripts and Wls proteins can help null mutants to bypass the early axis developmental defects and further studies indicate that Wls modulates the development of HA by controlling the expression of neurog1 in proneurons in the developing diencephalon ( Kuan et al., 2015 , Wu et al., 2015 ). Wls also has been shown to interact with Fgf signaling to modulate the development of jaw cartilages through fine-turning the expression gradient of fgf3 transcripts ( Wu et al., 2015 ). However, whether Wls involves in the development of zebrafish ChP and how Wls modulates the development of HA neurons and their progenitors are still unknown. Here through three-dimensional (3D) gene expression analyses we report that the formations of cholinergic, substance P-ergic and glutamatergic HA neurons at 96 hpf (hours post-fertilization) are differentially reduced in wls mutants. Conversely, clusterin ( clu ) gene expression domains in the ChPe are expanded in wls mutants at 72 and 96 hpf, suggesting that loss-of-Wls caused an expansion of gliocyte-lineages in diencephalic ChP. We also found that the reduction of neurog1 signals in wls mutants is caused by failed accumulation of neurog1 transcripts at 48 hpf and that some diencephalic neurog1 -positive cells are HA neuronal progenitors. Interestingly, 3D gene expression analyses showed that while neurog1 expressions are reduced, the expressions of Notch effector her6 are increased and expanded into HA progenitor zones in wls mutants at 48 hpf. Ectopically over-expressing Her6 in neurog1 -positive cells caused partial reduction of neurog1 expressions in HA progenitor zones. These results indicate that Wls restricts the expressions of Notch effector her6 to promote the specification of neurog1 proneurons but Wls demotes the generation of ChPe during the development of embryonic dorsal diencephalon. Results Habenular neuronal fates are changed in wls mutants Prior study indicated that loss of Wls activity resulted in complete loss of ventral habenular neurons because the expressions of two HA markers, the vachtb ( slc18a3b ) and ano2 were either greatly ( vachtb ) or completely ( ano2 ) gone from the chromogenic ISH staining experiments ( Kuan et al., 2015 ). However, it is unclear whether each neuronal lineage showed equal reduction rate in the absence of Wls. To better demonstrate the spatial distribution of different neuronal lineages and the spectrum of gene expression changes in HA of wild-type (WT, including wls /+) or wls larvae, double fluorescent mRNA in situ hybridization (FISH) stainings were performed with larvae staged at 96 hours post-fertilization (hpf) (Wang, Pan et al., 2021). Three antisense probes of vachtb ( slc18a3b ), tac3a or vglut2a ( slc17a6b ) genes were adopted to mark the cholinergic, substance-Pergic or glutamatergic HA neurons, respectively (Biran, Palevitch et al., 2012, Hong, Santhakumar et al., 2013, Thisse, 2005). Another antisense probe of cpd2 gene was adopted to mark the majority of HA cells, and to align all the confocal Z-stacks acquired from the WT or wls mutant samples ( Wang et al., 2021 ). The representative Z-projection images from double FISH of vachtb + cpd2 , tac3a + cpd2 , or vglut2 + cpd2 were showed in Figure 1B to 1G ’. As can be seen, the staining of all four HA markers were apparently reduced at different levels in the wls mutants ( Figure 1E-G ’). Two three-dimensional (3D) four-gene expression maps were generated to show the aligned and averaged gene expression domains of vachtb ( slc18a3b ), tac3a , vglut2 and cpd2 in the HA of WT (32 Z-stacks aligned) or wls mutants (24 Z-stacks aligned)( Figure 1H to S ’, Supplemental Figure 1 and Supplemental Table 1A-B). In Figure 1H to S ’, the differential expression changes of each HA markers or their overlapped regions in wls mutants are clearly shown along both the X-Y (1H to 1O) and X-Z (1H’ to 1O’) axes. Quantification analyses of each gene expression volumes (vol., in µm 3 ) indicated that while the averaged expressions of cpd2 in both LHA and RHA in wls mutants remained around 50% (48.32% and 50.07%) to their WT siblings, the expressions of vachtb ( slc18a3b ), tac3a or vglut2 each in LHA and RHA in wls mutants remained 32.15% and 22.36%; 4.66% and 27.08% or 18.22% and 24.4% respectively to their WT siblings ( Figure 1T to W , Supplemental Table 1C-E). These discoveries suggest that there are different levels of cell-lineage alternations of each these three types of HA neurons. In addition, while the left-right (L-R) ratio of averaged cpd2 expressions in wls samples was highly similar to their WT siblings (WT or wls =124.6% or 120.2%), there are apparent changes of L-R ratios for the expressions of vachtb (WT or wls = 37.0% or 53.2%), tac3a (WT or wls = 18.5% or 3.2 %) and vglut2 (WT or wls =159.9% or 119.5%)(Supplemental Table 1F). These results also demonstrated that 3D gene expression analyses can reveal differences of L-R gene expression ratios between WT and wls mutants that were overlooked by prior report utilizing chromogenic gene expression analyses ( Kuan et al., 2015 ). The changes of HA neuronal cell fates in wls mutants suggested that either cell proliferation rate or cell-fate decision, or both factors are affected upon loss of Wls activity. However, whether cell fates in other diencephalic domains are changed has never been examined before. Expression domains of clu in choroid plexus are expanded in wls mutants Because complete WLS knockout caused early death of the affected animals before ChP formation ( Carpenter et al., 2010 , Fu et al., 2009 , Jain et al., 2025 ), we examined whether loss-of-Wls in zebrafish affects the development of diencephalic ChP (dChP). Utilizing clusterin ( clu ) trancripts to mark ChP epithelila (ChPe) at 72 and 96 hpf (Jiao, Dai et al., 2011), FISH staining were performed along with gng8 , another HA marker, to distinguish the wls mutants from their WT siblings ( Kuan et al., 2015 ). Our results demonstrated that the expressions of clu were increased in both the diencephalic and hindbrain ChPs (dChP and hChP) ( Figure 2A-F ). Quantification of clu and gng8 expressions in HA of WT and wls mutant samples indicated that the increases of clu and the decreases of gng8 expressions in wls mutants at 72 and 96 hpf are statistically significant ( Figure 2G-H , Supplemental Table 2A-D). Apparent increases of clu expressions in the dChP at both 72 and 96 hpf in the wls mutants are better demonstrated in the 3D virtual maps generated using gng8 signals for image alignment. ( Figure 2I-L , Supplemental Figure 2 and Supplemental Table 2E-H). These results are very interesting because they showed a kind of ChP developmental defects that is opposite to those above-mentioned defects resulted from individual Wnt signaling knockout or gain-of-function animals ( Carpenter et al., 2010 , Kaiser et al., 2021 , Langford et al., 2020 , Parichha et al., 2022 ). These results also suggest that Wls may play a role in promoting neuronal cell fate specification because specification of ChP epithelia from neuroepithelial cells seems to require the repression of neural cell fate ( Lun et al., 2015 ). Download figure Open in new tab Figure 2. Expression domains of clu in choroid plexus are expanded in wls mutants. (A-F) Representative images showing clu (green, labeling choroid plexus) or gng8 (red, labeling HA) expressions in WT (A-C) or wls mutants (D-F) at 96 hours post-fertilization (h). ChP = choroid plexus, arrows indicate the 3 rd ventricle ChP, arrow heads indicate the 4 th ventricle ChP. (G-H) Statistical charts of the clu (G) or gng8 (H) expression volumes (vol.) of WT or wls mutant samples at 72h or 96h. Confidence p value ( p ) is denoted by “*”. “****” means P< 0.0001; “***” means P< 0.001; “**” means P< 0.01 and “*” means P<0.05 in t-test. (I-L) Merged virtual 3D expression maps of clu and gng8 from samples of 72h (I-J) and 96h (K-L). (See Supplemental Figure 3 and Supplemental Table 2 for details) Diencephalic neurog1- positive neural progenitors developed into HA neurons Prior studies reported that neuronal progenitors located ventral to the developing pineal contribute to HA neurons, neurog1 expressing in the HA progenitor zones in wls mutants is decreased, and combined loss of neurog1 and neurod4 caused HA neurogenesis defects (Concha, Russell et al., 2003, Halluin, Madelaine et al., 2016, Kuan et al., 2015 ). However, whether reduction of neurog1 expression in HA progenitor zone in wls mutants is reflecting a decrease of neurog1 transcripts or a decrease of neurog1 -expressing proneurons and whether HA neurons can derive from the neurog1 -positive proneurons has never been experimentally demonstrated before. To verify the location and the extent of neurog1 expression reduction in HA progenitor zones in wls mutant embryos, FISH staining utilizing mixed neurog1 plus fgf8 (distinguish WT or wls mutants) antisense probes and anti-EGFP (for labeling pineal complex) antibody labeling were performed, then double-colored confocal Z-stacks were collected. Consistent with the previous results, the expressions of neurog1 in both left and right sub-ventricular zones (SVZ, the HA progenitor zones) were reduced apparently ( Figure 3A and 3D , Supplemental Figure 4A-F). The reductions of neurog1 expressions in left and right HA progenitor zones in wls embryos are better visualized in the virtual 3D maps, while the averaged neurog1 expressions in the middle domain along the midline were highly similar between the WT and wls samples ( Figure 3B-C , 3E-F, Supplemental Figure 3). Quantification of neurog1 expressions in the left and right HA progenitor zones indicated that the differences between WT siblings and the wls mutants are statistically significant ( Figure 3G , Supplemental Table 3C-D). Because the development of pineal complex (anti-EGFP labeled) in wls is comparable to that in their WT siblings ( Kuan et al., 2015 ), we aligned and merged all the Z-stacks of WT (21 stacks) and wls (14 stacks) embryos using EGFP channel (35 Z-stacks) to generate one virtual 3D map for visualizing the averaged neurog1 expressions simultaneously ( Figure 3H-I ). Apparent differences and locations of neurog1 expressions in the HA progenitor zones are clearly seen in this combined 3D model as well. In addition, we introduced neurog1 : egfp transgene into the mutant carriers ( wls /+ males and females) and found that the EGFP expressions driven by the endogenous neurog1 promoter were no different in the WT siblings and wls mutants at 24 and 48 hpf (Supplemental Figure 4G-R). Therefore, the reduction of neurog1 signals reflects a decrease of neurog1 transcripts in the HA progenitor zone. Because neurog1 : egfp generated EGFP signals are present in HA at 72 and 96 hpf despite that the endogenous neurog1 mRNAs were not detectable in HA at all ( Figure 3J -K, 3L-M), it suggested that the EGFP-positive HA neurons may derive from the neurog1 -positive progenitors. To confirm this hypothesis, we adopted two cell-labeling techniques, the photo-convertible fluorescent protein Kaede and the infrared laser-evoked gene operator (IR-LEGO), to trace the developmental destination of neurog1 -positive cells in the HA progenitor zones ( Figure 3O ) (Ando, Hama et al., 2002, Deguchi, Itoh et al., 2009, Kamei, Suzuki et al., 2009, Shimada, Kawanishi et al., 2013). Kaede-mediated cell-tracing demonstrated that some of the neurog1 -positive cells in the HA progenitor zones indeed became HA neurons (Supplemental Figure 4S-X), and IR-LEGO-mediated cell-tracing demonstrated that some of the neurog1 -positive cells in the HA progenitor zones would became HA neurons ( Figure 3P-S ). All these results indicate that Wls activities are required to specify the neurog1 -expressing cells rather than to produce the cells which express neurog1 in the HA progenitor zones, and dorsal diencephalic neurog1- positive proneurons are HA neuronal progenitors. Download figure Open in new tab Figure 3. Diencephalic ngn1- positive progenitors developed into HA neurons. (A-I) Images showing ngn1 -expressing cells labeled by antisense ngn1 mRNA probes (in red) in WT (A) or wls (D) embryos at 48h. foxD3 :GFP signal is utilized to locate the pineal and parapineal (in green). Aligned and averaged virtual 3D ngn1 expression maps for WT (B, C) or wls (E, F) embryos. (G) Statistical chart for the volumes (vol.) of ngn1 expression domains in left (L), right (R) or middle (M) diencephalic regions. Confidence p value ( p ) is denoted by “*”. “****” means P< 0.0001, “n.s.” means no statistical difference in t-test. (H-I) Merged virtual 3D ngn1 expression maps from B and E (H) or C and F (I). (J-N) Images showing ngn1 -positive cells (promoter-driven GFP) contribute to HA neurons at 72 (J, L) or 96 hpf (K, M) in the WT (J-K) or wls mutant (L-M) embryos. “*” indicates pineal; brackets indicate the left and right HA. (N) Statistical chart for the vol. of GFP-positive cells in LHA or RHA. (O) Diagram showing how IR-LEGO (Infrared-Laser Evoked Gene Over-expression) was conducted to label ngn1 -positive progenitors in dorsal diencephalon at 48h. “P” indicates pineal; “Pp” indicates parapineal. Lighting sign indicates the laser entry site. Dotted circle indicates the left eye. (P-S) Images showing ngn1 -expressing cells (P) labeled by heatshock-induced mCherry (Q) developed into HA neurons at 72 h (S). Dotted circles indicate the pineal (P), LHA or RHA. (Also see Supplementary Figure 4, 5 and Table 3 and 4) Loss-of-Wls caused expansion of her6 expression domains in dorsal diencephalon Because the neuronal fates were changed in the remaining HA in wls mutants at 96 hpf ( Figure 1 ) and the cells that should express neurog1 in the HA progenitor zone were still present in the wls mutant embryos at 48 hpf despite neurog1 transcripts were low or absent in those cells (Supplemental Figure 4G-R), these suggest that those cells might adopt different cell fates in the wls mutants. Previous studies indicated that neurog1 plays roles downstream to flh , her6 or pax6a in the neurogenesis of pineal, thalamus or HA, respectively during zebrafish embryonic brain development ( Cau & Wilson, 2003 , Halluin et al., 2016 , Scholpp, Delogu et al., 2009). Because the expressions of flh and pax6a were shown to be normal in wls mutants and the ChP developmental defect in wls mutants resembles the defect in Notch signaling perturbed larvae, we decided to examine the expression of her6 in wls mutants ( Bill et al., 2008 , Kuan et al., 2015 ). The results showed that her6 expressions were markedly increased in wls mutants at 48 hpf, suggesting it plays a role in Wls-mediated specification of neurog1 progenitors or a role in ChPe development. ( Figure 4A-F , Supplemental Figure 5A-H and Supplemental Table 5A-B). Quantification of her6 expression domains in the left and right hemispheres demonstrated that the differences between WT siblings and wls mutants are statistically significant ( Figure 4G-I , Supplemental Table 5C-D). The positional relationships between the neurog1 and her6 expression domains were clearly demonstrated in the virtual 3D maps in Figure 4J-M , in which the neurog1 and her6 are expressed in adjacent but separate domains in the developing dorsal diencephalon ( Figure 4J-K ). In comparison, in the virtual 3D map combing image stacks from both WT and mutant samples, the her6 expression domains are larger and expanded into the normal neurog1 expression domains in the left and right hemispheres in wls mutants ( Figure 4L -M). Because prior report indicated that presence or absence of her6 promote Ascl1-mediated GABAergic or neurog1 -mediated glutamatergic neuronal generation respectively during thalamus development ( Scholpp et al., 2009 ), our observations therefore strongly suggest a model that Wls is required either to promote neurog1 -mediated her6 expression suppression or to de-repress her6 -mediated neurog1 expression suppression during the development of HA neurons. Download figure Open in new tab Figure 4. Loss-of-Wls causes expansion of her6 expression domains in dorsal diencephalon. (A-F) Images showing her6 -expressing cells labeled by antisense her6 mRNA probes in WT (A) or wls (D) embryos at 48h. foxD3 :GFP transgenic line was utilized to locate the pineal and parapineal in each sample. Aligned and averaged virtual 3D ngn1 expression maps (B, C, E, F) for WT (B-C) or wls (E-F) embryos were generated for samples from 48h. (G) Statistical chart for the volumes (vol.) of her6 expression domains in left (L), right (R) or middle (M) diencephalic regions (see the insert drawing). (H-I) Merged virtual 3D her6 expression maps from B and E (H) or C and F (I). (J-M) Merged virtual 3D ngn1 plus her6 expression maps aligned using Pineal (GFP positive) of 48h embryos from WT groups (J-K) or from WT (for ngn1 expression) plus wls (for her6 expression) groups. Arrows in (M) indicate the expansion of her6 expression domains into the HA progenitor zones. (See Supplemental Figure 6 and Supplemental Table 5, 6 for details) Over-expressing her6 suppresses neurog1 expressions in the HA progenitor zones In order to understand the regulatory relationships between neurog1 and her6 , we generated neurog1 : her6 plasmid which can express full-length her6 mRNA ectopically under the control of neurog1 promoter ( Figure 5A ). Transiently inducing her6 expressions in the neurog1 expressing cells through plasmid injections caused apparent reduction of neurog1 expressions in the HA progenitor zones ( Figure 5B-C , E-J, Supplemental Figure 6). Quantification of neurog1 expression volumes in control and neurog1 : her6 plasmid-injected samples demonstrated that the differences in left and right HA progenitor zones are statistically significant whereas the neurog1 expressions in the middle domains are not significant ( Figure 5D , Supplemental Table 7). This result strongly supports our notion that Wls-mediated suppression of her6 expression plays a role in specifying some of the neurog1 -positive neurons during the development of HA. Because there is no increase of apoptosis ( Kuan et al., 2015 ) and there are incorrect cell fate specifications in the HA progenitor zones in the wls mutants ( Figure 1 , 3, 4), those indicate that the neuronal generation and specification defects in HA at 96 hpf ( Figure 1 ) are resulted from incorrect cell specification at earlier developmental stages and slightly reduced cell proliferation ( Figure 3 and 4 , Supplemental Figure 7). This notion is consistent with the previous statement that, as a protein controlling the secretions of diverse Wnt molecules, Wls plays distinct roles in regulating the generation and specification of HA neurons and its laterality ( Kuan et al., 2015 ). Download figure Open in new tab Figure 5. Over-expressing her6 suppresses ngn1 expressions in HA progenitor zones. (A) Schematic drawing of the ngn1 promoter-controlled her6 -expressing plasmid. (B-C) Images showing ngn1 -expressing cells labeled by antisense ngn1 mRNA probes in WT (B) or wls (C) embryos at 48h. foxD3 :GFP transgenic line was utilized to locate the pineal and parapineal (in grey) in each sample. (D) Statistical chart for the volumes (vol.) of ngn1 expression domains in left (L), right (R) or middle (M) diencephalic region. Confidence p value ( p ) is denoted by “*”. “*” means P< 0.05, “n.s.” means no statistical difference in t-test. (E-J) Images showing averaged expression vol. of ngn1 in samples from injection control group (E, H) or ngn1 : her6 plasmid-injected group (F, I). Merged images (G-J) from (E-F) and (H-I) utilizing pineal-signal-guided image alignment. (See Supplemental Figure 7 and Supplemental Table 7 for details) Discussion In this report, we have unraveled the regulatory relationships between wls , her6 and neurog1 that have never been demonstrated before during the generation and specification of HA neurons in developing vertebrate diencephalon. In addition, we found that the interaction between Wls and Notch signaling guides the development of HA neurons and ChP gliocytes in opposite directions. Utilizing FISH and 3D gene expression analyses, we found that loss of Wls activity caused uneven reductions of cholinergic, substance-Pergic or glutamatergic neurons in the developing HA, despite that an overall reduction of neurons is 50% in both left and right HA ( Figure 1T , 1U and 1V). Our observation that a steady and continuous cell proliferation reduction exists in the wls mutant embryos (Supplemental Figure 7) may explain that the evenly reduced generation of cpd2 neurons in the L-R HA is resulted from reduced cell proliferation. Nonetheless, the uneven reductions of different types of neurons in the HA of wls mutants suggest that cell fate changes during the development of HA progenitors may account for the alterations of neuronal ratios when Wls activities are depleted. These cell fate alterations are apparently not caused by abnormal cell migration because none of the four tested HA neuronal markers showed any relocation outside the main cpd2 expression domains. This conclusion is consistent to what was reported before using the other HA markers such as f-spondin , nrp1a , lov and ron ( Kuan et al., 2015 ). In addition, through introducing neurog1 : egfp transgene into wls mutants we are able to clarify that reduced ISH signals from neurog1 mRNA staining in the wls mutants is caused by decreased accumulation of neurog1 mRNAs, indicating that Wls activity is required to promote the expression of neurog1 in the HA progenitor zone. This is important for our subsequent experiments which proofed the first time that some neurog1 -positive cells in the HA progenitor zones indeed are HA neuronal progenitors ( Figure 3O-S and Supplemental Figure 4S-X). One very interesting observation is that we found the sizes of both diencephalic and hindbrain ChPs are significantly increased in the wls mutants ( Figure 2 ). Because this ChP phenotype resembles to the developmental defects seen in the Notch signaling-perturbed larvae ( Bill et al., 2008 , Hunter & Dymecki, 2007 ), we hypothesized that loss-of-Wls might perturb the Notch signaling activities which led to ChP size increase in 72 and 96 hpf wls mutants. Subsequently we found another interesting discovery that the expressions of her6 , the Notch-dependant transcription factor, were apparently increased in the dorsal diencephalon of wls mutants at 48 hpf ( Figure 4 ). This result may reflect the cause of the ChP size increases seen in the Notch signaling-perturbed embryos ( Bill et al., 2008 , Hunter & Dymecki, 2007 ). Because either increasing ( dld or dla morphants, or Notch1 constitutively activation) or reducing (DAPT-treatment, notch1b morphants) Notch signaling activities could cause size increases of ChP, it suggests that fine-tuning Notch receptor activities by antagonizing each other may play a key role in ChP development. Therefore, deciphering the relationships between the specificity of each Notch component on her6 expressions and the role of her6 expression on ChP development will be the keys to reveal the molecular mechanisms of how Wls interacts with Notch signaling component to simultaneously control the development of HA neurons and glial-derived ChP epithelial cells. Because ectopically expressing Her6 can suppress the expressions of neurog1 in the HA progenitors ( Figure 5 ), this indicates that Wls-mediated suppression of her6 expression is required for specifying the neurog1 -positive progenitors of HA neurons and may be required to down-regulate the generation of glial cells. In addition, because previous studies indicated that the expressions of pax6a were normal in the wls mutants and neurog1 plays downstream to pax6a in promoting the neurogenesis of HA ( Halluin et al., 2016 , Kuan et al., 2015 ), suggesting that pax6a -mediated HA development may account for the remaining neurog1 -positive HA progenitors and neurons seen in the wls mutants (see our model below). In order to sum up a model of how wls , her6 and neurog1 interact with each others during the development of HA and ChP in the embryonic dorsal diencephalon, we evaluated their expression positional relationships in 3D at 48 hpf. Using the pineal organ (P, marked by EGFP) as the image aligning landmark from three WT samples each also labeled with either her6 , neurog1 or wls antisense mRNA probes ( Figure 6A-C ), we found that wls expressing domains are situated ventral to the her6 expressing domains near the ventricular zone where most of the neural stem cells are generated. And, the her6 expressing domains are situated ventral to the neurog1 expressing domains where the HA progenitors are generated. The spatial relationships between wls , her6 , neurog1 and HA along with the fact that pax6a expression is not affected by loss-of-Wls all pointed out the existences of Wls-dependant and Wls-independent formation of neurog1 -positive HA progenitors that later on may rely on Wls activities to proliferate and differentiate into mature HA neurons ( Kuan et al., 2015 ). Because loss of Wls caused an expression elevation of Notch signaling component her6 in the developing dorsal diencephalon, a model therefore is emerged that Wls-mediated Wnt secretions interact with Notch signaling to govern the proper generation of ChPe cells and HA neurons simultaneously, suggesting that Wls plays a key and early role in neuronal-glial cell fate determination during the development of both ChPe and HA. This model of us well echoes the facts that the generation of ChPe from neuroepithelial cells requires the repression of neural cell fate and misexpression of Hes protein family member significantly increased the population of glial cells at the expense of neurons [9, 51]. Additionally, because some Wnt signaling molecules such as Wnt1, WNT5A and beta-catenin are playing positive roles in the ChP development in mice ( Kaiser et al., 2021 , Langford et al., 2020 , Parichha et al., 2022 ), it suggests that Wls-dependant Wnt secretions exist to either repress the elevation of Notch signaling directly or indirectly by repressing the other signaling (another Wnt?) which normally keeps the Notch signaling in check. Download figure Open in new tab Figure 6. Wls interacts with Notch signaling to control early neural-glial cell fates and promotes the specification and proliferation of HA progenitors. (A-C) Representative Z-projection snapshots showing the expressions of her6 (A), ngn1 (B) and wls (C) transcripts in the Tg(Foxd3:GFP) embryos at 48 hours post-fertilization (48h). Anti-GFP labeling indicated the pineal and parapineal in these samples. Dorsal means dorsal view, ventral means ventral view. (D-F) Snapshots generated in Amira software showing fragmented and thresholded isosurface views for GFP (in D, E) or GFP plus her6 , ngn1 and wls signals (in F) from the image stacks of (A), (B) and (C), before image alignment. GFP-A, GFP-B, GFP-C represent the pineal and parapineal from figure 6A , 6B and 6C, respectively. (G-O) Snapshots generated in Amira software showing fragmented and thresholded surface views for images of (A), (B) and (C), after image alignment. (P) Models of the expression relationship between her6 , ngn1 and wls in the dorsal diencephalon (D-Dien) near the third ventricle in zebrafish embryonic brain at 48h. (Q) Summary of our model for the roles of Wls and Notch on early neural or glial cell fate determination and how Wls guides the specification and proliferation of HA progenitors during zebrafish embryonic brain development. Conclusions Our results have revealed a novel regulatory relationship between Wls and Notch signaling on balancing the generation of neurons and gliocytes during the development of HA and ChPe in dorsal diencephalon. This well echoes to the recent discovery that a spatially restricted induction of Wls denotes the earliest differentiation of non-telencephalic cells in human brain organoids ( Jain et al., 2025 ). Because the early developmental defects seen in mouse mutants have hindered functional studies of Wls after axis-formation ( Carpenter et al., 2010 , Fu et al., 2009 , Wu et al., 2015 ), our report therefore has demonstrated that Zebrafish loss-of-Wls embryos or larvae carrying maternally deposited wls proteins and transcripts are excellent conditional wls mutants to decipher the function of Wls on the development of vertebrate brain or the pathogenesis of brain defects. Methods Fish Maintenance and Sample Collection AB (wildtype) strain zebrafish were obtained from Taiwan Zebrafish Core Facility (TZCF) in Academic Sinica. The lines of wls /+ ( fh252 allele) and Tg( foxD3 : GFP ) were obtained from Drs. C.B. Moens (Fred Hutch Cancer Center, Seattle, WA, U.S.A.) and M. E. Halpern (Carnegie Inst. for Science, Baltimore, MD, U.S.A.) (Barth, Miklosi et al., 2005, Kuan et al., 2015 ). ZFIN fish IDs for AB, wls /+ and Tg( foxD3 : GFP ) are ZDB-GENO-960809-7, ZDB-ALT-071019-5 and ZDB-TGCONSTRCT-070117-95, respectively. The two fish lines of Tg( neurog1 : egfp ) and Tg( hsp70 : mCherry - CMV : gfp - nanos 3’UTR) were generated based on the articles by Blader et al. and Evans et al., 2005 (Blader, Lam et al., 2004, Evans, Yamamoto et al., 2005). All fishes were maintained and bred according to standard procedures described on ZFIN ( http://zfin.org ). All larva were collected from natural spawning and reared/staged in 0.003% PTU (Sigma P7629). Except for those utilized in live images, staged embryos and larva will be fixed at 36, 48, 72, 84 or 96 hours post-fertilization (hpf) in 4% paraformaldehyde (PFA, Sigma P6148) in PBS overnight at 4°C then stored in 100% MeOH (Merck 1070182511) at −20°C until processed for RNA in situ hybridization or immunohistochemical (IHC) staining. All animal procedures were performed in accordance with the protocol approved by the Institutional Animal Care and Use Committee (IACUC) at Academia Sinica and National Taiwan University (Protocol #20-12-1618 and #113-00145). Transgene constructions and DNA microinjection The neurog1 :EGFP transgenic plasmid was generated based on the article by Blader et al. ( Blader et al., 2004 ). The gene name “ neurog1 ” was previously called “ ngn1 ” in the article by Blader et al.. Basically we utilized a modified Tol2 vector (obtained from Dr. Koichi Kawakami, NIG, Shizuoka, Japan) to generate the final plasmid containing a 7.4kb upstream fragment of neurog1 gene locus 5’ to the egfp -SV40 expression cassette inside the Tol2 arms (primer pair A A C T C G A G A C T A G T T T T T G G A C T G T T A T C a n d A A G G A T C C T G T T G ATAACCTGGAGAAATT) (Kawakami, Takeda et al., 2004, Urasaki, Morvan et al., 2006). Tg( hsp70 : mCherry -CMV : GFP - nanos 3’UTR) transgenic construct was generated by inserting P C R a m p l i f i e d 1 . 5 K b h s p 7 0 p r o m o t e r f r a g m e n t (p r i m e r p a i r T T G T C G A C A C G T G A A T G G T T T G T G A G C A C a n d CCGGATCCGATTGATTTCAAGAAACTGCA) ( Evans et al., 2005 ), mCherry fragment (p r i m e r p a i r A C G G A T C C A A T G G T G A G C A A G G G C G A G a n d T T A T C G A TCCCGGGTTACTTGTACAGCTCGTCCATG) and enzyme digested CMV: GFPnaos 3’UTR fragment (SalI at 5’ and XbaI at the 3’ ends) into the Tol2 vector. The pME- mCherry and pCS2-CMV: egfp-naos3’UTR plasmids were obtained from Taiwan Zebrafish Core Facility (TZCF) and Dr. Marnie Halpern (Embryology Dept., Carnegie Institute for Science, Baltimore, USA), respectively. The neurog1 : Kaede transgenic construct was generated by replacing the egfp of neurog1 : egfp with PCR amplified DNA fragment of pKaede-S1 plasmid (MBL international corporation, Woburn, MA, USA). The neurog1 : her6 transgenic construct was generated by replacing the egfp fragment with PCR amplified DNA fragment of her6 ORF plus its 3’UTR (ZFIN: ZDB-TSCRIPT-090929-15349) from cDNAs generated from 48 hpf total RNAs. DNA microinjections were performed as described before ( Kawakami et al., 2004 , Urasaki et al., 2006 ). In this report, we injected 25-40pg of plasmids plus 25pg of transposase mRNAs (generated from pCS-TP obtained from Dr. Koichi Kawakami, NIG, Shizuoka, Japan) into each embryos at 1-2 cell stages. Fluorescent mRNA in situ hybridization and immunohistochemical staining Digoxigenin (DIG, Roche 11277073910)-labeled cpd2, gng8, neurog1 , her6 , fgf3 or wls probes, or fluorescein (FLU, Roche 11685619910)-labeled vachtb ( slc18a3b ), tac3a, vglut2a or clu RNA probes were generated according to previously described procedures ( Wang et al., 2021 ). We introduced fgf3 antisense probes along with the neurog1 antisense probes to perform the FISH staining with 48 hpf samples because reduction of fgf3 staining signals in the developing pharyngeal pouches was an evident feature of wls mutants at 36 and 48 hpf (Supplemental Figure 4A-F) ( Wu et al., 2015 ). ZFIN (Zebrafish Information Network) Gene IDs for cpd2, vachtb , tac3a, vglut2a, gng8, neurog1 , her6 , fgf3 , wls or clu are ZDB-GENE-030903-1, ZDB-GENE-040426-1410, ZDB-GENE-090313-253, ZDB-GENE-030616-554, ZDB-GENE-050522-312, ZDB-GENE-990415-174, ZDB-GENE-980526-144, ZDB-GENE-980526-178, ZDB-GENE-040426-2161, ZDB-GENE-040426-1774, respectively. The two-color whole mount fluorescent RNA in situ hybridization (FISH) was carried out as previously described by Wang et al. with minor modifications ( Wang et al., 2021 ). One-color FISH plus one-color immunohistochemical staining (IHC) was conducted basically similar to the two-color FISH except that 1 to 200 dilutions of rabbit anti-EGPF (Torrey Pines TP401, USA) or anti-Wls antibodies were co-incubated with anti-DIG-POD or anti-FLU-POD antibodies (Roche 11207733910 and Roche 11426346910), followed by Tyrimide substrate stainining (Perkin Elmer NEL753001 Kit) for 60 minutes then followed by incubating with 1 to 200 dilutions of goat anti-Rabbit IgG Alexa-488 or goat anti-Rabbit IgG Alexa-568 (ThermoFisher/Invitrogen A-11008 or A-11011) ( Wu et al., 2015 ). Image Acquisition, Processing, visualization and quantification FISH or FISH plus IHC staining samples were incubated overnight in 50% glycerol containing 2 % PFA then imaged with Leica TCS SP5 or SP8 (IR-LEGO data) confocal systems (Leica GmbH, Germany) using a 10x ( Figure 3 ) or 20X ( Figure 1 - 2 , 4-7) air objectives with 0.3 or 0.5 N.A. Each samples were scanned only once with 2x ( Figure 4-7 ), 3x ( Figure 1 - 2 ) or 4x ( Figure 3 ) zooming factors, and recorded as 512 x 512 pixels and Z-step of 3.0 or 4.0 μm ( Figure 3 or Figure 1 - 2 , 4-7) for 24 ( Figure 1 ), 31 ( Figure 2 ), 27 ( Figure 3 ), 34 ( Figure 4-7 ) steps (final 25, 32, 28 or 35 frames) at 200 Hz. The resulted voxel size of our images are 0.76 x 0.76 x 3.0 ( Figure 1 ), 0.76 x 0.76 x 4.0 ( Figure 2 ) or 0.76 x 0.76 x 3.0 ( Figure 3-7 ) μm 3 . For presentation, Z-projection images were first obtained using “3D projection” function in Leica’s LAS AF software then they were directly exported as TIF files then some of these images were cropped to proper size using Photoshop CS5 (Adobe Inc., USA). Rigid image registrations, Correlation Factors (CFs, image similarities) or gene expression volumes (vol.) were calculated as previously described utilizing Amira 5.6 software (FEI, OR, USA) ( Wang et al., 2021 ). Intensity threshold values (0-255) adopted for gene expression vol. calculation and image visualization (Iso-surface views) were listed in each related supplemental figure legends (Supplemental Figure 1, 2, 3, 5, 6). Signals from each samples were taken once only to avoid the bleaching effects that were obviously affecting the vol. calculations for the signals emitted from FLU-conjugated Tyrimides (green channel) ( Wang et al., 2021 ). Images exhibiting different viewing angles of the virtual 3D maps were exported as JPG files from viewer window using the Snapshot function placed in Amira software, then JPG images were cropped to proper size using Photoshop CS5 (Adobe Inc., USA). 3D proliferating cell counting was conducted manually utilizing the Cell Counter Plug-In of Fiji-ImageJ (Supplemental Figure 7) (Schindelin, Arganda-Carreras et al., 2012). Infrared laser-mediated or Kaede-mediated cell tracing Infrared laser-evoked gene operator (IR-LEGO) was conducted following previously reported protocols with some modifications ( Deguchi et al., 2009 , Kamei et al., 2009 , Shimada et al., 2013 ). Basically utilizing transient expression of neurog1 : egfp in the hsp70 :mCherry transgenic embryos through plasmid injection (25 pg/egg), we first identified the neurog1 -positive cells (EGFP-positive) in the HA progenitor zones at 48 hpf. Then we labeled 1-2 cells by laser-mediated heatshock induction (IR-LEGO) of mCherry expressions under an 20x objective lens (NA=0.75, laser power received is 18-21.8mW) installed at the inverted microscope IX80 (Olympus, Japan) and trace where the EGFP-mCherry double-positive cells would be at 72 hpf by taking image Z-stacks of HA regions with Leica SP8 confocal microscope system utilizing 20x objective. The Kaede-mediated cell-tracing experiments were conducted based on published methods (Gfrerer, Dougherty et al., 2013). One to two nanoliters (nl) of Tol2- neurog1 : kaede plasmid (25 pg/egg) was injected into AB eggs at the one-cell stage. Injected embryos exhibiting mosaic green Kaede signals in the HA progenitor zones were quickly harvested and anesthetize in egg water with 0.015% Tricaine for 5 min then mounted with 1 % low melting agarose gel (with 0.015% Tricaine). Mounted 36hpf embryos then were subjected to photo-conversion by UV laser (<405 nm) exposure for 200 msec. Z-stack confocal images of treated embryos were taken right before and 12 or 24 hours after UV exposure with Leica SP5 confocal microscope system (Leica GmbH, Germany). Statistical Analysis Statistics for gene expression volume averaging, standard deviation (SD) calculation and heatmap generation were performed utilizing Prism 7 software (Graphpad, CA, USA). Unpaired Student’s t-test (two tailed) was utilized to determine significance at the P value that is smaller than 0.05. Confidence for P value ( p ) is denoted by “*” that equals to p < 0.05 and “**” that equals to p < 0.01. Availability of data and materials The materials generated or datasets used during the current study are available from the corresponding author on reasonable request (Material Transfer Agreements may be required.). Competing interests The authors declared no conflict of interests. Funding This work has been supported by JSPS KAKENHI Grant #20K22572, #20H05886 and #23H01817 to Yasuhiro Kamei; NIBB Collaborative Research Program Grant #21-404 and #24NIBB505 to Yung-Shu Kuan and NSTC Grant #111-2311-B-002-027, #112-2311-B-002-010 and #113-2311-B-002-014 to Yung-Shu Kuan. Authors’ contributions S-H Lin and Y-S Kuan designed the experiments. S-H Lin, H-Y Pan, B-T Wu, C-H Wu, J Sakamoto, A Shimada and Y-S Kuan performed the experiments. Y Kamei, H Takeda and Y-S Kuan provided the reagents. S-H Lin, H-Y Pan and Y-S Kuan analyzed the data. Y-S Kuan wrote the manuscript with the inputs from Y Kamei and H Takeda. Acknowledgements We thank Taiwan Zebrafish Core Facility funded by National Science and Technology Council, (NSTC, Taiwan, R.O.C.) Grant #113-2740-B-400-001 for fish line maintenance and reagents. We also thank Drs. Sheng-Ping L. Hwang, Ya-Hui Chou (ICOB, Academia Sinica, Taiwan) and Bon-Chu Chung (IMB, Academia Sinica, Taiwan) for critical discussion; Drs. C.B. Moens (Fred Hutch Cancer Center, Seattle, WA, U.S.A.), M. E. Halpern (Carnegie Inst. for Science, Baltimore, MD, U.S.A.) and Koichi Kawakami, (NIG, Shizuoka, Japan) for reagents; Ms. Chie Kinoshita (NIBB, Okazaki, Japan), Ms. Misako Saida (NIBB, Okazaki, Japan), Mr. Bo-Hung Lin (ICOB, Academia Sinica, Taiwan) and Dr. Sheng-Wei Lin (IBC, Academia Sinica, Taiwan) for technical supports. Funder Information Declared JSPS KAKENHI , 20K22572 , 20H05886 , 23H01817 NIBB Collaborative Research Program , 21-404 , 24NIBB505 National Science and Technology Council, Taiwan , 111-2311-B-002-027 , 112-2311-B-002-010 , 113-2311-B-002-014 References Aizawa H , Goto M , Sato T , Okamoto H ( 2007 ) Temporally regulated asymmetric neurogenesis causes left-right difference in the zebrafish habenular structures . Developmental cell 12 : 87 – 98 OpenUrl CrossRef PubMed Web of Science Ando R , Hama H , Yamamoto-Hino M , Mizuno H , Miyawaki A ( 2002 ) An optical marker based on the UV-induced green-to-red photoconversion of a fluorescent protein . Proceedings of the National Academy of Sciences of the United States of America 99 : 12651 – 6 OpenUrl Abstract / FREE Full Text Banziger C , Soldini D , Schutt C , Zipperlen P , Hausmann G , Basler K ( 2006 ) Wntless, a conserved membrane protein dedicated to the secretion of Wnt proteins from signaling cells . Cell 125 : 509 – 22 OpenUrl CrossRef PubMed Web of Science Barth KA , Miklosi A , Watkins J , Bianco IH , Wilson SW , Andrew RJ ( 2005 ) fsi zebrafish show concordant reversal of laterality of viscera, neuroanatomy, and a subset of behavioral responses . Curr Biol 15 : 844 – 50 OpenUrl CrossRef PubMed Web of Science Bartscherer K , Pelte N , Ingelfinger D , Boutros M ( 2006 ) Secretion of Wnt ligands requires Evi, a conserved transmembrane protein . Cell 125 : 523 – 33 OpenUrl CrossRef PubMed Web of Science Beretta CA , Dross N , Bankhead P , Carl M ( 2013 ) The ventral habenulae of zebrafish develop in prosomere 2 dependent on Tcf7l2 function . Neural Dev 8 : 19 OpenUrl PubMed Beretta CA , Dross N , Guiterrez-Triana JA , Ryu S , Carl M ( 2012 ) Habenula circuit development: past, present, and future . Frontiers in neuroscience 6 : 51 OpenUrl PubMed ↵ Bianco IH , Wilson SW ( 2009 ) The habenular nuclei: a conserved asymmetric relay station in the vertebrate brain. Philosophical transactions of the Royal Society of London Series B , Biological sciences 364 : 1005 – 20 OpenUrl ↵ Bill BR , Balciunas D , McCarra JA , Young ED , Xiong T , Spahn AM , Garcia-Lecea M , Korzh V , Ekker SC , Schimmenti LA ( 2008 ) Development and Notch signaling requirements of the zebrafish choroid plexus . PLoS One 3 : e3114 OpenUrl CrossRef PubMed Biran J , Palevitch O , Ben-Dor S , Levavi-Sivan B ( 2012 ) Neurokinin Bs and neurokinin B receptors in zebrafish-potential role in controlling fish reproduction . Proceedings of the National Academy of Sciences of the United States of America 109 : 10269 – 74 OpenUrl Abstract / FREE Full Text ↵ Blader P , Lam CS , Rastegar S , Scardigli R , Nicod JC , Simplicio N , Plessy C , Fischer N , Schuurmans C , Guillemot F , Strahle U ( 2004 ) Conserved and acquired features of neurogenin1 regulation . Development 131 : 5627 – 37 OpenUrl Abstract / FREE Full Text Carl M , Bianco IH , Bajoghli B , Aghaallaei N , Czerny T , Wilson SW ( 2007 ) Wnt/Axin1/beta-catenin signaling regulates asymmetric nodal activation, elaboration, and concordance of CNS asymmetries . Neuron 55 : 393 – 405 OpenUrl CrossRef PubMed ↵ Carpenter AC , Rao S , Wells JM , Campbell K , Lang RA ( 2010 ) Generation of mice with a conditional null allele for Wntless . Genesis 48 : 554 – 8 OpenUrl CrossRef PubMed Web of Science ↵ Cau E , Wilson SW ( 2003 ) Ash1a and Neurogenin1 function downstream of Floating head to regulate epiphysial neurogenesis . Development 130 : 2455 – 66 OpenUrl Abstract / FREE Full Text Ching W , Hang HC , Nusse R ( 2008 ) Lipid-independent secretion of a Drosophila Wnt protein . The Journal of biological chemistry 283 : 17092 – 8 OpenUrl Abstract / FREE Full Text Company V , Moreno-Cerda A , Andreu-Cervera A , Murcia-Ramon R , Almagro-Garcia F , Echevarria D , Martinez S , Puelles E ( 2021 ) Wnt1 Role in the Development of the Habenula and the Fasciculus Retroflexus . Front Cell Dev Biol 9 : 755729 OpenUrl PubMed Concha ML , Russell C , Regan JC , Tawk M , Sidi S , Gilmour DT , Kapsimali M , Sumoy L , Goldstone K , Amaya E , Kimelman D , Nicolson T , Grunder S , Gomperts M , Clarke JD , Wilson SW ( 2003 ) Local tissue interactions across the dorsal midline of the forebrain establish CNS laterality . Neuron 39 : 423 – 38 OpenUrl CrossRef PubMed Web of Science Das S , Yu S , Sakamori R , Stypulkowski E , Gao N ( 2012 ) Wntless in Wnt secretion: molecular, cellular and genetic aspects . Front Biol (Beijing ) 7 : 587 – 593 OpenUrl PubMed de Almeida Magalhaes T , Liu J , Chan C , Borges KS , Zhang J , Kane AJ , Wierbowski BM , Ge Y , Liu Z , Mannam P , Zeve D , Weiss R , Breault DT , Huang P , Salic A ( 2024 ) Extracellular carriers control lipid-dependent secretion, delivery, and activity of WNT morphogens . Developmental cell 59 : 244 – 261 e6 OpenUrl CrossRef PubMed ↵ Deguchi T , Itoh M , Urawa H , Matsumoto T , Nakayama S , Kawasaki T , Kitano T , Oda S , Mitani H , Takahashi T , Todo T , Sato J , Okada K , Hatta K , Yuba S , Kamei Y ( 2009 ) Infrared laser-mediated local gene induction in medaka, zebrafish and Arabidopsis thaliana . Dev Growth Differ 51 : 769 – 75 OpenUrl CrossRef PubMed Web of Science ↵ Evans TG , Yamamoto Y , Jeffery WR , Krone PH ( 2005 ) Zebrafish Hsp70 is required for embryonic lens formation . Cell Stress Chaperones 10 : 66 – 78 OpenUrl CrossRef PubMed Web of Science ↵ Fore S , Yaksi E ( 2019 ) Habenula: A Role in Brain State Transitions during Coping Behavior . Curr Biol 29 : R692 – R694 OpenUrl PubMed ↵ Fu J , Jiang M , Mirando AJ , Yu HM , Hsu W ( 2009 ) Reciprocal regulation of Wnt and Gpr177/mouse Wntless is required for embryonic axis formation . Proceedings of the National Academy of Sciences of the United States of America 106 : 18598 – 603 OpenUrl Abstract / FREE Full Text Garcia-Lecea M , Kondrychyn I , Fong SH , Ye ZR , Korzh V ( 2008 ) In vivo analysis of choroid plexus morphogenesis in zebrafish . PLoS One 3 : e3090 OpenUrl CrossRef PubMed Gfrerer L , Dougherty M , Liao EC ( 2013 ) Visualization of craniofacial development in the sox10: kaede transgenic zebrafish line using time-lapse confocal microscopy . J Vis Exp: e 50525 ↵ Halluin C , Madelaine R , Naye F , Peers B , Roussigne M , Blader P ( 2016 ) Habenular Neurogenesis in Zebrafish Is Regulated by a Hedgehog, Pax6 Proneural Gene Cascade . PLoS One 11 : e0158210 OpenUrl CrossRef PubMed Henson HE , Parupalli C , Ju B , Taylor MR ( 2014 ) Functional and genetic analysis of choroid plexus development in zebrafish . Frontiers in neuroscience 8 : 364 OpenUrl PubMed Hong E , Santhakumar K , Akitake CA , Ahn SJ , Thisse C , Thisse B , Wyart C , Mangin JM , Halpern ME ( 2013 ) Cholinergic left-right asymmetry in the habenulo-interpeduncular pathway . Proceedings of the National Academy of Sciences of the United States of America 110 : 21171 – 6 OpenUrl Abstract / FREE Full Text Huang X , Ketova T , Fleming JT , Wang H , Dey SK , Litingtung Y , Chiang C ( 2009 ) Sonic hedgehog signaling regulates a novel epithelial progenitor domain of the hindbrain choroid plexus . Development 136 : 2535 – 43 OpenUrl Abstract / FREE Full Text ↵ Hunter NL , Dymecki SM ( 2007 ) Molecularly and temporally separable lineages form the hindbrain roof plate and contribute differentially to the choroid plexus . Development 134 : 3449 – 60 OpenUrl Abstract / FREE Full Text Husken U , Stickney HL , Gestri G , Bianco IH , Faro A , Young RM , Roussigne M , Hawkins TA , Beretta CA , Brinkmann I , Paolini A , Jacinto R , Albadri S , Dreosti E , Tsalavouta M , Schwarz Q , Cavodeassi F , Barth AK , Wen L , Zhang B et al. ( 2014 ) Tcf7l2 is required for left-right asymmetric differentiation of habenular neurons . Curr Biol 24 : 2217 – 27 OpenUrl CrossRef PubMed ↵ Jain A , Gut G , Sanchis-Calleja F , Tschannen R , He Z , Luginbuhl N , Zenk F , Chrisnandy A , Streib S , Harmel C , Okamoto R , Santel M , Seimiya M , Holtackers R , Rohland JK , Jansen SMJ , Lutolf MP , Camp JG , Treutlein B ( 2025 ) Morphodynamics of human early brain organoid development . Nature Jiao S , Dai W , Lu L , Liu Y , Zhou J , Li Y , Korzh V , Duan C ( 2011 ) The conserved clusterin gene is expressed in the developing choroid plexus under the regulation of notch but not IGF signaling in zebrafish . Endocrinology 152 : 1860 – 71 OpenUrl CrossRef PubMed ↵ Kaiser K , Jang A , Kompanikova P , Lun MP , Prochazka J , Machon O , Dani N , Prochazkova M , Laurent B , Gyllborg D , van Amerongen R , Fame RM , Gupta S , Wu F , Barker RA , Bukova I , Sedlacek R , Kozmik Z , Arenas E , Lehtinen MK et al. ( 2021 ) MEIS-WNT5A axis regulates development of fourth ventricle choroid plexus . Development 148 ↵ Kamei Y , Suzuki M , Watanabe K , Fujimori K , Kawasaki T , Deguchi T , Yoneda Y , Todo T , Takagi S , Funatsu T , Yuba S ( 2009 ) Infrared laser-mediated gene induction in targeted single cells in vivo . Nat Methods 6 : 79 – 81 OpenUrl CrossRef PubMed Web of Science Kaur C , Rathnasamy G , Ling EA ( 2016 ) The Choroid Plexus in Healthy and Diseased Brain . J Neuropathol Exp Neurol 75 : 198 – 213 OpenUrl PubMed ↵ Kawakami K , Takeda H , Kawakami N , Kobayashi M , Matsuda N , Mishina M ( 2004 ) A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish . Developmental cell 7 : 133 – 44 OpenUrl CrossRef PubMed Web of Science ↵ Kinoshita M , Okamoto H ( 2023 ) Acetylcholine potentiates glutamate transmission from the habenula to the interpeduncular nucleus in losers of social conflict . Curr Biol 33 : 2121 – 2135 e4 OpenUrl CrossRef PubMed ↵ Kompanikova P , Bryja V ( 2022 ) Regulation of choroid plexus development and its functions . Cell Mol Life Sci 79 : 304 OpenUrl CrossRef PubMed Kratzer I , Ek J , Stolp H ( 2020 ) The molecular anatomy and functions of the choroid plexus in healthy and diseased brain . Biochim Biophys Acta Biomembr 1862 : 183430 OpenUrl CrossRef ↵ Kuan YS , Roberson S , Akitake CM , Fortuno L , Gamse J , Moens C , Halpern ME ( 2015 ) Distinct requirements for Wntless in habenular development . Developmental biology 406 : 117 – 128 OpenUrl CrossRef PubMed ↵ Langford MB , O’Leary CJ , Veeraval L , White A , Lanoue V , Cooper HM ( 2020 ) WNT5a Regulates Epithelial Morphogenesis in the Developing Choroid Plexus . Cereb Cortex 30 : 3617 – 3631 OpenUrl PubMed Lee M , Yoon J , Song H , Lee B , Lam DT , Yoon J , Baek K , Clevers H , Jeong Y ( 2017 ) Tcf7l2 plays crucial roles in forebrain development through regulation of thalamic and habenular neuron identity and connectivity . Developmental biology 424 : 62 – 76 OpenUrl CrossRef PubMed Liu B , Zhou K , Wu X , Zhao C ( 2018 ) Foxg1 deletion impairs the development of the epithalamus . Molecular brain 11 : 5 OpenUrl PubMed ↵ Lun MP , Monuki ES , Lehtinen MK ( 2015 ) Development and functions of the choroid plexus-cerebrospinal fluid system . Nat Rev Neurosci 16 : 445 – 57 OpenUrl CrossRef PubMed MacDonald A , Lu B , Caron M , Caporicci-Dinucci N , Hatrock D , Petrecca K , Bourque G , Stratton JA ( 2021 ) Single Cell Transcriptomics of Ependymal Cells Across Age, Region and Species Reveals Cilia-Related and Metal Ion Regulatory Roles as Major Conserved Ependymal Cell Functions . Front Cell Neurosci 15 : 703951 OpenUrl CrossRef PubMed ↵ Parichha A , Suresh V , Chatterjee M , Kshirsagar A , Ben-Reuven L , Olender T , Taketo MM , Radosevic V , Bobic-Rasonja M , Trnski S , Holtzman MJ , Jovanov-Milosevic N , Reiner O , Tole S ( 2022 ) Constitutive activation of canonical Wnt signaling disrupts choroid plexus epithelial fate . Nat Commun 13 : 633 OpenUrl CrossRef PubMed ↵ Roberson S , Halpern ME ( 2017 ) Convergence of signaling pathways underlying habenular formation and axonal outgrowth in zebrafish . Development 144 : 2652 – 2662 OpenUrl Abstract / FREE Full Text ↵ Roberson S , Halpern ME ( 2018 ) Development and connectivity of the habenular nuclei . Seminars in cell & developmental biology 78 : 107 – 115 OpenUrl CrossRef PubMed Schindelin J , Arganda-Carreras I , Frise E , Kaynig V , Longair M , Pietzsch T , Preibisch S , Rueden C , Saalfeld S , Schmid B , Tinevez JY , White DJ , Hartenstein V , Eliceiri K , Tomancak P , Cardona A ( 2012 ) Fiji : an open-source platform for biological-image analysis . Nat Methods 9 : 676 – 82 OpenUrl CrossRef PubMed Web of Science ↵ Scholpp S , Delogu A , Gilthorpe J , Peukert D , Schindler S , Lumsden A ( 2009 ) Her6 regulates the neurogenetic gradient and neuronal identity in the thalamus . Proceedings of the National Academy of Sciences of the United States of America 106 : 19895 – 900 OpenUrl Abstract / FREE Full Text ↵ Shimada A , Kawanishi T , Kaneko T , Yoshihara H , Yano T , Inohaya K , Kinoshita M , Kamei Y , Tamura K , Takeda H ( 2013 ) Trunk exoskeleton in teleosts is mesodermal in origin . Nat Commun 4 : 1639 OpenUrl CrossRef PubMed Thisse C , and Thisse , B. ( 2005 ) High Throughput Expression Analysis of ZF-Models Consortium Clones. ZFIN Direct Data Submission ↵ Urasaki A , Morvan G , Kawakami K ( 2006 ) Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition . Genetics 174 : 639 – 49 OpenUrl Abstract / FREE Full Text ↵ Wang GT , Pan HY , Lang WH , Yu YD , Hsieh CH , Kuan YS ( 2021 ) Three-dimensional multi-gene expression maps reveal cell fate changes associated with laterality reversal of zebrafish habenula . J Neurosci Res 99 : 1632 – 1645 OpenUrl CrossRef PubMed ↵ Wolf L , Boutros M ( 2023 ) The role of Evi/Wntless in exporting Wnt proteins . Development 150 ↵ Wu BT , Wen SH , Hwang SP , Huang CJ , Kuan YS ( 2015 ) Control of Wnt5b secretion by Wntless modulates chondrogenic cell proliferation through fine-tuning fgf3 expression . J Cell Sci 128 : 2328 – 39 OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted August 06, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Wntless interacts with Notch signaling to balance the generation of neurons and gliocytes in vertebrate dorsal diencephalon Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Wntless interacts with Notch signaling to balance the generation of neurons and gliocytes in vertebrate dorsal diencephalon Shu-Heng Lin , He-Yen Pan , Bo-Tsung Wu , Joe Sakamoto , Chun-Hsiu Wu , Atsuko Shimada , Yasuhiro Kamei , Hiroyuki Takeda , Yung-Shu Kuan bioRxiv 2025.08.06.668881; doi: https://doi.org/10.1101/2025.08.06.668881 Share This Article: Copy Citation Tools Wntless interacts with Notch signaling to balance the generation of neurons and gliocytes in vertebrate dorsal diencephalon Shu-Heng Lin , He-Yen Pan , Bo-Tsung Wu , Joe Sakamoto , Chun-Hsiu Wu , Atsuko Shimada , Yasuhiro Kamei , Hiroyuki Takeda , Yung-Shu Kuan bioRxiv 2025.08.06.668881; doi: https://doi.org/10.1101/2025.08.06.668881 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41937) Biophysics (21452) Cancer Biology (18588) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15156) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)