Key Microbial Species Influencing the Priming Effects of Variously Degraded Alpine Meadow Soils Enriched with Animal Excrements

1. Tibetan sheep (Ovis aries) and plateau pika (Ochotona curzoniae) excrements are important organic materials that influence soil carbon cycling in the Qinghai-Tibetan Plateau. However, their exact priming effects (PE) on soil and mechanisms of influence in alpine meadows are subject to their health status. 2. To fill this knowledge gap, we carried out a 45-day incubation experiment using alpine meadow soils with differing degrees of degradation that had been enriched with these two types of excrement. Soil PE was assessed via the natural abundance method, while soil microbial communities and their compositions were examined through high-throughput sequencing. 3. The findings indicated that severely degraded soils are more susceptible to soil PEs than non-degraded soils (p < 0.05). Both types of excrement supplements modified the structure and composition of the soil microbial communities. Specifically, heavily degraded meadow soils displayed a significantly higher MBC:MBN ratio, reduced soil bacterial α-diversity, and notable shifts in the composition and β-diversity than the intact meadow soil. 4. Both excrement supplements demonstrated a direct negative correlation (r = -0.94) with key soil microbial taxa, namely Actinobacteriota (r = 0.21), Proteobacteria (r = 0.29) and Chloroflexi (r = 0.22), and showed direct positive correlations. The soil C:N ratio positively impacted Proteobacteria (r = 0.39), whereas the soil NO3–N:NH4+-N ratio negatively affected Actinobacteriota (r = -0.18), thereby influencing soil PE. Therefore, alpine meadow degradation indirectly modulated soil PE by altering key microbial taxa such as Actinobacteriota (r = 0.70), Proteobacteria (r = -0.52), and the soil C:N ratio (r = -0.26). Key Microbial Species Influencing the Priming Effects of Variously Degraded Alpine Meadow Soils Enriched with Animal Excrements Qinyao Li 1, Wenquan Yang 2, Jiancun Kou 1, Qian Liu 1, Yangcan Zhang 1, Weiliang Kou 1, Jiaqing Liu 1, Xilai Li 3, Jing Zhang 3 1 College of Grassland Agriculture, Northwest A&F University, Yangling, 712100, People’s Republic of China 2 College of Life Sciences, Northwest A&F University, Yangling, 712100, People’s Republic of China 3 College of Agriculture and Animal Husbandry, Qinghai University, Xining, 810000, People’s Republic of China *Corresponding author, Email: [email protected] Abstract： 1. Tibetan sheep ( Ovis aries ) and plateau pika ( Ochotona curzoniae ) excrements are important organic materials that influence soil carbon cycling in the Qinghai-Tibetan Plateau. However, their exact priming effects (PE) on soil and mechanisms of influence in alpine meadows are subject to their health status. 2. To fill this knowledge gap, we carried out a 45-day incubation experiment using alpine meadow soils with differing degrees of degradation that had been enriched with these two types of excrement. Soil PE was assessed via the natural abundance method, while soil microbial communities and their compositions were examined through high-throughput sequencing. 3. The findings indicated that severely degraded soils are more susceptible to soil PEs than non-degraded soils ( p < 0.05). Both types of excrement supplements modified the structure and composition of the soil microbial communities. Specifically, heavily degraded meadow soils displayed a significantly higher MBC:MBN ratio, reduced soil bacterial α-diversity, and notable shifts in the composition and β-diversity than the intact meadow soil. 4. Both excrement supplements demonstrated a direct negative correlation (r = -0.94) with key soil microbial taxa, namely Actinobacteriota (r = 0.21), Proteobacteria (r = 0.29) and Chloroflexi (r = 0.22), and showed direct positive correlations. The soil C:N ratio positively impacted Proteobacteria (r = 0.39), whereas the soil NO 3 - -N:NH 4 + -N ratio negatively affected Actinobacteriota (r = -0.18), thereby influencing soil PE. Therefore, alpine meadow degradation indirectly modulated soil PE by altering key microbial taxa such as Actinobacteriota (r = 0.70), Proteobacteria (r = -0.52), and the soil C:N ratio (r = -0.26).

Soil microbia taxa, degree of meadow degradation, soil priming effects, excrement supplements 1 | Introduction Renowned as the “Roof of the World” and the “Third Pole of the Earth”, the Tibetan Plateau, with an average elevation of 4,000 m above sea level, is the highest plateau in the world (Qiu 2008), where the land cover is dominated by alpine meadows. They offer a multitude of invaluable ecological services, including the preservation of biodiversity and water resources (Liu et al. 2018), the mitigation of greenhouse gas emissions, and the safeguarding of habitats for endangered species (Chen et al. 2018; Wang et al. 2020). However, about 80% of the alpine meadows have been degraded to varying degrees (Li et al. 2013; Zhu et al. 2022). Degraded alpine meadows exhibit a decreased plant cover and biodiversity (Yang et al. 2013; Urak et al. 2017), accompanied by a decline in soil nutrients and microbial biomass (Nunes et al. 2012; Korkanc & Korkanc 2016; Shang et al. 2016). These changes have subsequently altered soil microbial composition and structure (Li et al. 2021), ultimately affecting the capacity of the alpine meadows to sequester soil carbon (Wang et al. 2002; Kou et al. 2019). In an effort to restore the compromised meadow ecosystem functions, various measures have been attempted, such as supplementation of exogenous organic matter. After its application to the soil, it may promote or inhibit soil organic carbon mineralization temporally, a phenomenon termed the priming effect (PE) (Kuzyakov, Friedel & Stahr 2000; Fontaine, Mariotti & Abbadie 2003; Fontaine et al. 2004; Chen et al. 2014; Smith et al. 2014). Previous studies have indicated that the nature of exogenous organic matter, the existing soil nutrient status, and microbial composition are all factors influential to the magnitude and duration of PE (Blagodatskaya & Kuzyakov 2008). Moreover, alterations in soil microbial composition exert a significant impact on ecosystem carbon cycling (Chen et al. 2021). Researchers have discovered that specific microbial taxa, such as Proteobacteria and Acidobacteria, can facilitate the decomposition of soil organic matter (SOM) and may play a crucial role in modulating soil PE (Razanamalala et al. 2018; Tao et al. 2020). As a widespread and readily available soil amendment, animal excrement not only influences soil physicochemical properties and enzyme activities but also profoundly alters the composition of soil microbial communities (Ramirez, Craine & Fierer 2012; Wang et al. 2017; Ai et al. 2018) and dominant microbial communities in soil, and subsequently influences the efficiency of organic carbon cycling (Zhang et al. 2015). For instance, r-strategist microbes have a high demand for nitrogen and prefer easily accessible substrates, while oligotrophic K-strategist microbes favor recalcitrant carbon substrates, and have a lower nitrogen requirement (Fontaine, Mariotti & Abbadie 2003; Fierer, Bradford & Jackson 2007). They can thrive in soils of a high stoichiometric C:N ratio, and release extracellular enzymes to extract nitrogen from SOM (Zechmeister-Boltenstern et al. 2015; Heitkötter, Heinze & Marschner 2017; Hicks et al. 2019). Conversely, they tend to dominate substrates with a lower stoichiometric C:N ratio that match the growth rates and activity demands of fast-growing r-strategist microbes (Hessen et al. 2004; Chen et al. 2014; Fang et al. 2018), thereby altering SOM decomposition. So far, it has been confirmed that exogenous supplements with a low C:N ratio are more likely to influence soil microbial composition as they are mineralized more rapidly (Zimmermann et al. 2012; Xu et al. 2016), even though the rate and mechanisms of soil PE are also subject profoundly to the structure and composition of the microbial communities (Blagodatskaya & Kuzyakov 2008; Pascault et al. 2013). In recent decades, the alpine meadows in the Tibet Plateau have been degraded to various levels owing mostly to overgrazing and rodent outbreaks (Wei et al. 2023). Alpine meadows that have been degraded to varying degrees harbor different densities of livestock and plateau pikas ( Ochotona curzoniae ), naturally resulting in widely ranging quantities of excrement. It plays a distinct role in nutrient cycling (Wei et al. 2023). As one of the primary grazing livestock on the Qinghai-Tibet Plateau, Tibetan sheep ( Ovis aries ) and their excrement, if properly decomposed, are significant contributors to the nutrient cycling in the meadows (Liu et al. 2023). Additionally, the excrement is also a crucial source of organic fertilizer, often utilized for the restoration of degraded grasslands (Liu et al. 2023). The plateau pika is the most common small burrowing mammal in the alpine meadows of the Plateau (Thomson & Simpson 2007; Zhang et al. 2014; Qin, Chen & Yi 2015). Despite the wide distribution of pika excrement in some severely degraded alpine meadows, the reconstructed vegetation established via artificial seeding is still highly prone to degradation (Smith & Foggin 1999; Lai & Smith 2003; Davidson & Lightfoot 2008). This suggests that the difficulty in restoring degraded grasslands could not be attributed primarily to low soil fertility (Li et al. 2013; Liu et al. 2018). To some degree, the soil nutrients can be absorbed by plants only after they have been properly decomposed by the activities of microbes that are abundant in the soil. Nevertheless, their impact on soil carbon cycling and their intrinsic links with soil fungus communities in the alpine meadows with varying degrees of degradation remain unknown at present. On the other hand, such knowledge can provide theoretical insights into the mechanisms of soil PE induced by the excrements. The research in this area also can offer data support for the scientific utilization and management of these excrements in meadows degraded to different degrees. This study aims to explore the influence of these two types of excrement supplements on soil fungal communities in the alpine meadows with different degrees of degradation through high-throughput sequencing. The specific objectives are: (1) to explore how the level of soil degradation impacts the PE; (2) to identify major microbial species that are critical to enhancing soil PE; and (3) to develop a theory to explain how animal excrement supplements can be best used for the effective restoration of degraded meadows based on the relationship between microbial communities and soil PE. 2 | Materials and methods 2.1 | Collection of soil samples and excrements The research site is in Menyuan County, Qinghai Province (37°46′ N; 101°21′ E) whose altitude ranges approximately from 3200 to 3700 m a.m.s.l. Its typical plateau alpine climate enables alpine meadow to thrive year-round, especially in the warm season of June-September. Distributed in this meadow are such common plants as tarragon grasses ( Kobresia myosuroides ), tussock grasses ( Carex spp.), and lancewood ( Elymus dahuricus ). In July 2022, typical alpine meadows representive of non-degraded (N), and three degrees of degradation (L - lightly degraded, M - moderately degraded, and S - severely degraded) were selected. This classification was based primarily on plant coverage in accordance with the GB19377-2003 standards for grading natural grassland degradation (Su et al. 2003). The vegetation coverage exceeded 80% in non-degraded alpine meadows, ranged between 65% and 80% in lightly degraded areas, between 40% and 65% in moderately degraded areas, and dropped below 40% in severely degraded alpine meadows. For each level of degradation, three plots of 50 m × 50 m were chosen for analysis. Within each plot, ten 1 m × 1 m subplots spaced at > 1 m apart were randomly established. Five S-shaped cores of 0-20 cm soil samples were randomly collected using a soil auger with a diameter of 4.5 cm. The soil samples from a total of 150 cores in the three plots were thoroughly mixed. In the laboratory, the samples were cleaned by removing plant remnants, stones, and other impurities. Following air-drying, they were sieved through a 20-mesh sieve. The sieved soil was then utilized for assessing physicochemical properties and the PE (Table 1). Tibetan sheep excrement (T) and plateau pika excrement (P) were collected from the alpine meadows in the study area. After natural air-drying, the excrements were crushed and passed through a 20-mesh sieve for physicochemical property determination and soil PE analyses (Table 1). TABLE 1 Physicochemical properties of the collected excrements and soil samples. | SOC (g·kg -1 ) | TN (g·kg -1 ) | C:N ratio | NO 3 - -N (mg·kg -1 ) | NH 4 + -N (mg·kg -1 ) | NO 3 - -N: NH 4 + -N ratio | δ 13 C (%) | | | T | 336.42±2.54 | 13.03±0.21 | 25.81 ± 1.97 | 56.69±1.85 | 85.60±0.78 | 0.66±0.03 | -28.2±0.04 | | P | 186.61±1.34 | 7.10±0.12 | 26.56 ± 1.87 | 296.02±3.92 | 8.52±0.41 | 34.74±1.40 | -27.37±0.11 | | N | 84.98±1.00 | 5.13±0.05 | 16.56 ± 0.32 | 45.58±1.22 | 8.60±0.87 | 5.30±0.57 | -26.38±0.09 | | L | 67.95±2.52 | 4.21±0.05 | 16.14 ± 0.77 | 41.43±1.03 | 7.81±0.37 | 5.30±0.27 | -25.72±0.07 | | M | 70.54±1.54 | 4.58±0.07 | 15.38 ± 0.42 | 55.85±0.96 | 10.85±0.83 | 5.14±0.44 | -25.09±0.13 | | S | 78.44±1.92 | 4.98±0.04 | 15.75 ± 0.39 | 73.40±1.05 | 11.51±0.69 | 6.38±0.33 | -25.69±0.03 | Notes: Values are expressed as mean ± standard error (n = 3). T, Tibetan sheep excrements, P, plateau pika excrements, N, non-degraded, L, lightly degraded, M, moderately degraded, S, severely degraded, SOC, soil organic carbon, TN, total nitrogen, NO 3 - -N, nitrate nitrogen, NH 4 + -N, ammonium nitrogen, the same below. 2.2 | Pre-incubation experiments Since the maximum summer temperature in the alpine meadow area is around 20 °C, all incubation experiments in this study were conducted at this temperature. Initially, 120 grams (g) of soil samples were placed in 1-liter incubation bottles, adjusted to 50% of their water-holding capacity, and pre-incubated at 20 °C for seven days to stabilize soil microbial activities. Water was replenished using a gravimetric method during this period. Subsequently, a preliminary test was performed by adding 3 g, 9 g, and 15 g of Tibetan sheep excrement (T) and plateau pika excrement (P) to separate soil batches. The results of this test showed that the intensity of the PE reached its peak at a dosage of 9 g of Tibetan sheep excrement, while no clear correlation was observed with the dosage of plateau pika excrement. To ensure a consistent supplement dosage and based on the study by Gross and Glaser (2021), the final dosage for the main experiment was determined to be 9 g (Table S1). 2.3 | Experimental design The experimental treatments consisted of five soil types (quartz sand control vs. N vs. L vs. M vs. S) × 3 types of supplementations (control vs. plateau pika excrement vs. Tibetan sheep excrement) × 3 replicates or 45 samples. Thus, a total of 45 incubation bottles were set up, with a 50 mL vial suspended at the top of each, containing 20 mL of NaOH to absorb CO 2 released from the soil. The incubation bottles were then placed in a constant temperature incubator at 20°C for further incubation. On days 1, 3, 5, 7, 9, 11, 13, 17, 21, 25, 29, 37, and 45 of incubation, phenolphthalein was used as an indicator to precipitate carbonates with 20 mL of 1 M BaCl 2 . The NaOH solution was titrated using a standard 0.5 M hydrochloric acid solution. The precipitate was obtained by centrifugation at 1800 r·min -1 for 15 minutes, dried at 55°C, and analyzed for δ¹³C values using an isotope mass spectrometer (Qiao et al. 2014). Additionally, another set of soil samples was incubated under the same conditions and protocol. During the peak periods of CO 2 release from the excrements (days 9, 21, and 45), samples were collected to assess soil physicochemical properties, microbial composition, and diversity. | Soil | Soil type | 5 | | Soil | Excrement type | 3 | 2.4 | Measured indicators 2.4.1 | Soil priming effect The ratio of CO 2 -C (α) from soil respiration was calculated using the two-component mixing model (Pausch et al. 2013): α =( δ t - δ s )/( δ ck - δ s ) (1) In this context, δ t represents the δ¹³C value of the total CO 2 -C released from the soil after the addition of excrements. δ s represents the δ¹³C value of the excrement itself, while δ ck represents the δ¹³C value of the total CO 2 -C released from the control soil. The PE, which stands for the proportion of SOC respiration induced by the added excrements, was calculated using the following formula: PE= α ×R t -R ck (2) In this context, R t represents the total CO 2 -C released from respiration in the soil after the addition of excrements, while R ck represents the total CO 2 -C released from respiration in the control soil and excrement. Both R t and R ck are measured in milligrams of carbon (mg C). 2.4.2 | Determination of soil physicochemical properties Soil organic carbon (SOC) content was measured using the potassium dichromate-sulfuric acid oxidation method. Total nitrogen (TN) was measured through digestion with concentrated sulfuric acid followed by distillation. Total phosphorus (TP) was measured spectrophotometrically after digestion with HClO 4 -H 2 SO 4 . Total potassium (TK) was measured spectrophotometrically using the flame photometric method, following digestion with HF-HClO 4 . Concentrations of NH 4 + -N and NO 3 - -N were determined using a continuous flow injection analyzer after extraction with 1 mol·L -1 KCl. Available phosphorus (AP) was measured spectrophotometrically following extraction with NaHCO 3 . Available potassium was measured spectrophotometrically after extraction with NH 4 OAc (Sparks & Johnston 1996). Microbial biomass carbon (MBC) and microbial biomass nitrogen (MBN) were determined by chloroform fumigation at a 4:1 water-soil ratio, potassium sulphate leaching, and the TOC-L analyzer (Jenkinson & Powlson 1976). 2.4.3 | Soil microbial determination The diversity and composition of soil bacterial and fungal communities were ascertained with the help of Personalbio Inc. platform in Beijing (https://www.genescloud.cn/). The V3-V4 region of bacterial 16S rDNA and the ITSV1 of fungal ITS rDNA were amplified by specific primers for F: ACTCCTACGGGGAGGCAGCA R:GGACTACHVGGGTWTCTAAT and F:GGAAGTAAAAGTCGTAACAAGG R:GCTGCGTTCTTCATCGATGC region (Claesson et al. 2009). Microbiome biological information was analyzed using QIIME2 version 2019.4. Soil bacteria and fungi were analyzed through the Silva database (Release 132, http://www.arb-silva.de) and the UNITE database (Release 8.0, https://unite.ut.ee/), respectively, by comparing the ASV characteristic sequences to the reference sequences in the databases to obtain the corresponding taxonomic information corresponding to each ASV. 2.5 | Data analysis Analysis of variance (ANOVA) was utilized to detect significant differences between various treatments. IBM SPSS Statistics 26.0 (IBM SPSS Inc.) was employed for statistical analyses, with significance set at p < 0.05. Graphical representations were crafted using Graphpad Prism 7.0. Chao1 and Shannon indices were analyzed through ANOVA, whereas principal coordinates analysis (PCoA) was conducted using PERMANOVA. Soil microbial community composition at the amplicon sequence variant (ASV) level was explored through PCoA (employing Bray-Curtis distance) and PERMANOVA tests. Pearson correlation analysis was conducted to assess the relationships between soil physicochemical factors and the relative abundances of bacterial and fungal phyla. SPSS 26.0 was used for data analysis, and Origin 2019b, Graphpad Prism 7.0, and the Personalbio company’s cloud platform were utilized for graphical visualizations. Mean values were compared using the Tukey test ( p < 0.05). A correlation network was built using Spearman analysis and analyzed using Gephi. Significance P-values and correlation coefficients (R-values) were computed using the RMT package in R. Based on these coefficients and significance, a modular network and a ZiPi plot were developed. Structural equation modeling (SEM) was applied to identify the impacts among multiple variables. Prior to modeling, all parameters were logarithmically transformed to ensure normality and enhance linearity. Binary relationships between variables were evaluated to incorporate linear relationships into the model and avoid strong multicollinearity (r < 0.8). Gradually, insignificant pathways were eliminated, retaining only those that significantly contributed to the final model. Since some model input variables were not normally distributed, Bootstrap resampling was performed to determine the probability that a path coefficient differed from zero. Model fit was assessed using the comparative fit index (CFI), goodness of fit index (GFI), standardized fit index (NFI), and approximate root-mean-square error (RMSEA). The final model was deemed good based on the following criteria: (i) CFI between 0.97 and 1.00; (ii) GFI between 0.95 and 1.00; (iii) NFI between 0.95 and 1.00; (iv) CMIN/df between 1 and 3, with p -value between 0.05 and 1.00; (v) RMSEA ≤ 0.05, with p -value between 0.10 and 1.00. All SEM models were created using IBM SPSS Amos Version 24. 3 | Results 3.1 | Soil priming effects and physicochemical properties After introducing the two types of excrement, a generally positive PE was observed over the 45-day incubation period, with only occasional negative PE at specific times (Figure 1a). The addition of plateau pika excrement resulted in a significantly higher cumulative PE in soils at various levels of degradation than that Tibetan sheep excrement (Figure 1b). Initially, following the application of Tibetan sheep excrement, a negative PE was noted. Furthermore, non-degraded alpine meadow soil exhibited a significantly higher cumulative PE than severely degraded soil ( p < 0.05). Conversely, upon adding plateau pika excrement, a predominantly positive PE was observed throughout the incubation period. Notably, severely degraded alpine meadow soil showed a significantly higher cumulative PE than non-degraded soil ( p < 0.05). FIGURE 1 Cumulative priming effects of soils from degraded alpine meadows at four levels during a 45-day incubation after the addition of Tibetan sheep excrement (a) and plateau pika excrement (b). The standard errors of the means are shown (n = 3). N, non-degraded; L, lightly degraded; M, moderately degraded; S, severely degraded, the same below. During the early incubation period (9 d), there were significant differences in C:N ratio, MBC:MBN ratio, and NO 3 - -N:NH 4 + -N ratio between non-degraded and severely degraded soils (Figure 2a-c). As the incubation period lengthened, all these ratios significantly decreased. The addition of excrement significantly increased the soil C:N ratio, but significantly reduced the NO 3 - -N:NH 4 + -N ratio in both non-degraded and severely degraded soils on 9 d and 45 d ( p < 0.05). FIGURE 2 C:N ratio (a), NO 3 - -N:NH 4 + -N ratio (b), and MBC:MBN ratio (c) in soils from alpine meadows with varying degrees of degradation without addition (CK) and with the addition of two types of excrement. T, Tibetan sheep excrement; P, plateau pika excrement. Lowercase letters indicate significant differences between different excrements ( p < 0.05), while uppercase letters indicate significant differences between meadow soils with different degrees of degradation ( p < 0.05). The same below. 3.2 | Changes in microbial community composition On 9 d, 21 d, and 45 d of incubation, compared to the control soils, non-degraded, mildly degraded, and moderately degraded alpine meadow soils were not significantly impacted by the addition of the two types of excrement in their Chao1 and Shannon indiced (Figure 3a and 3b). In severely degraded alpine meadow soil, the addition of Tibetan sheep excrement significantly reduced the Chao1 and Shannon indices of bacteria ( p < 0.05). On the 9 d, 21 d, and 45 d of incubation, the added Tibetan sheep excrement significantly increased the Chao1 and Shannon indices of fungi in non-degraded, mildly degraded, and moderately degraded alpine meadow soils ( p < 0.05) in comparison with the control soil, but not the severely degraded alpine meadow soil (Figure 3c and 3d). FIGURE 3 Alpha diversity (including Chao1 index and Shannon index) of soil bacteria (a, b) and fungi (e, d) in different degradation degrees without addition (CK) and the addition of two types of excrement. After the addition of the two types of excrement, differences showed up in the composition of soil bacterial and fungal communities, with PCo1 and PCo2 explaining 28.4% and 36.0% of the total variance in bacterial and fungal communities, respectively (Figure 4a and 4b). PERMANOVA analysis revealed significant differences in bacterial communities between soils with and without the amendment of Tibetan sheep excrement in non-degraded meadow soil ( p < 0.05). Across all four types of alpine meadow soils, the β diversity of the fungal communities significantly differed between excrement-amended soils and unamended soils ( p < 0.05). FIGURE 4 β diversity of soil bacteria (a) and fungi (b) in alpine meadows with different degradation degrees without addition and the addition of two types of excrement. The addition of the two types of excrement increased the relative abundance of Proteobacteria and Actinobacteria, while decreasing the relative abundance of Acidobacteria and Gemmatimonadetes ( p < 0.05) (Figure 5a). Following the addition of excrement, the relative abundance of Ascomycota increased to over 90% to become the dominant fungal phylum in all treatments. The relative abundance of Mortierellomycota decreased to below 5%, but still remained as the second most abundant fungal phylum. The relative abundance of Basidiomycota dropped to below 2% to rank the third in terms of fungal phylum abundance in all treatments (Figure 5b). FIGURE 5 Taxonomic composition of soil bacteria (a) and fungi (b) in soils with different degradation degrees after the addition of two types of excrement. 3.3 | Soil microbial co-occurrence networks and key taxa Separate networks were constructed for soil bacteria and fungi, a control network without excrement (CK), a network with Tibetan sheep excrement (T), and a network with plateau pika excrement (P) (Figure 6). The addition of excrement increased total nodes, and the proportion of positive edges (Table 2). The ZiPi plot indicated that the key bacterial taxa without the excrement supplement and with the Tibetan sheep excrement supplement were Proteobacteria, Acidobacteriota, Actinobacteriota, Gemmatimonadota, and Chloroflexi. The key bacterial taxa with the addition of plateau pika excrement were Proteobacteria, Acidobacteriota, Actinobacteriota, Gemmatimonadota, and Bacteroidota. The key fungal taxa of all treatments (without excrement, with Tibetan sheep excrement, or plateau pika excrement) were identified as Ascomycota, Mortierellomycota, and Basidiomycota. FIGURE 6 Co-occurrence networks and ZiPi plots of soil bacterial (a-c, g-i) and fungal (d-f, j-l) communities without addition (CK) and with the addition of two types of excrement (CK, a, d, g, j; Tibetan sheep excrement, b, e, h, k; Plateau pika excrement, c, f, i, l). Different colors represent different modules (a-f), and different phyla (g-l). TABLE 2 Topological parameters of soil bacterial and fungal co-occurrence networks without addition (CK) and with the addition of two types of excrement. | CK | T | P | CK | T | P | | | Number of nodes | 91.00 | 92.00 | 98.00 | 64.00 | 77.00 | 75.00 | | Number of edges | 1024.00 | 697.00 | 946.00 | 169.00 | 248.00 | 394.00 | | Average degree | 22.51 | 15.15 | 19.11 | 5.28 | 6.44 | 10.51 | | Network diameter | 5.00 | 6.00 | 5.00 | 11.00 | 12.00 | 9.00 | | Graph density | 0.25 | 0.17 | 0.20 | 0.08 | 0.09 | 0.14 | | Modularity | 0.36 | 0.47 | 0.36 | 0.56 | 0.57 | 0.33 | | Average clustering coefficient | 0.65 | 0.64 | 0.66 | 0.56 | 0.63 | 0.67 | | Edges(+)/Total edges | 0.62 | 0.90 | 0.93 | 0.89 | 0.99 | 0.98 | We also constructed soil bacterial and fungal networks for alpine meadows in four states: non-degraded, lightly degraded, moderately degraded, and severely degraded (Figure 7), and analyzed these networks. Compared with severely degraded soil, non-degraded soil had an increased number of network edges and average degree (Table 3). The ZiPi plot revealed that the dominant bacterial phyla in non-degraded, lightly degraded, and moderately degraded soils were Proteobacteria, Acidobacteriota, Actinobacteriota, Gemmatimonadota, and Chloroflexi, respectively. In contrast, the dominant bacterial phyla in severely degraded soil were Actinobacteriota, Proteobacteria, Acidobacteriota, Gemmatimonadota, and Chloroflexi. The main fungal phyla in non-degraded, lightly degraded, and moderately degraded soils were Ascomycota, Basidiomycota, and Mortierellomycota. However, in severely degraded soil, the dominant fungal phyla were Ascomycota and Mortierellomycota. FIGURE 7 Co-occurrence networks and ZiPi plots of soil bacterial (a-d, i-l) and fungal (e-h, m-p) communities in non-degraded (a, e, i, m), lightly degraded (b, f, j, n), moderately degraded (c, g, k, o), and severely degraded alpine meadows (d, h, l, p). Different colors represent different phyla. TABLE 3 Topological parameters of symbiotic network of soil bacteria and fungi in alpine meadows degraded to different degrees. | N | L | M | S | N | L | M | S | | | Number of nodes | 97.00 | 91.00 | 96.00 | 97.00 | 14.00 | 15.00 | 17.00 | 17.00 | | Number of edges | 4108.00 | 4095.00 | 4281.00 | 3581.00 | 37.00 | 39.00 | 51.00 | 61.00 | | Average degree | 84.70 | 90.00 | 89.60 | 73.84 | 5.29 | 5.20 | 6.71 | 7.18 | | Network diameter | 2.00 | 1.00 | 1.00 | 2.00 | 3.00 | 3.00 | 3.00 | 3.00 | | Graph density | 0.82 | 1.00 | 0.94 | 0.77 | 0.41 | 0.37 | 0.42 | 0.45 | | Modularity | 0.01 | 0.02 | 0.00 | 0.01 | 0.12 | 0.13 | 0.19 | 0.15 | | Average clustering coefficient | 0.99 | 1.00 | 1.00 | 0.99 | 0.56 | 0.70 | 0.47 | 0.68 | | Edges(+)/Total edges | 0.96 | 0.74 | 1.00 | 0.93 | 0.59 | 0.69 | 0.53 | 0.49 | 3.4 | Effects of stoichiometric ratios and soil microbial composition The addition of the two types of excrement had a direct negative impact on PEs (r = -0.94). Key microbial communities in the soil, namely Actinobacteriota, Proteobacteria, and Chloroflexi, showed a direct positive influence on soil PEs (r = 0.21, r = 0.29, r = 0.22). The soil C:N ratio positively affected the key microbial community Proteobacteria (r = 0.39), thereby influencing PEs, while the soil NO 3 - -N:NH 4 + -N ratio negatively impacted the key microbial community Actinobacteriota (r = -0.18), subsequently affecting PEs. The degree of meadow degradation influenced the key microbial communities, Actinobacteriota and Proteobacteria, as well as the soil C:N ratio, indirectly affecting the soil PEs (r = 0.70, r = -0.52, r = -0.26) (Figure 8). FIGURE 8 Structural Equation Model (a) depicting the relationships among soil stoichiometric ratios, key microbial species, and soil organic carbon priming effects after the addition of two types of excrement (CMIN/df = 1.019 (P=0.422); RMSEA = 0.023; CFI = 0.999; GFI = 0.945; NFI = 0.975), along with the direct and indirect effects (b). In Fig. a, red indicates negative effects, blue indicates positive effects, * represents p < 0.05, ** represents p < 0.01, and *** represents p < 0.001. 4 | Discussion 4.1 | Impact of degradation degree In alpine meadow soils with varying degrees of degradation, severely degraded soils were more susceptible to soil PEs than non-degraded soils (Figure 1a and 1b). When the soil exhibited a positive PE, it was minimal in non-degraded soil and maximal in severely degraded soil. However, when the soil exhibited a negative PE, it was maximal in non-degraded soil and minimal in severely degraded soil, an outcome that was aligned with previous findings (Bernal et al. 2016; Zhang et al. 2017; Chen et al. 2019; Chen et al. 2022). That is, PE is related to plant coverage (degree of degradation), with PE in bare soil being typically stronger than that in vegetated soil. Additionally, it may also be associated with the NO 3 - -N:NH 4 + -N ratio. After the addition of excrement, compared to non-degraded soil, severely degraded soil had a higher NO 3 - -N:NH 4 + -N ratio. Previous studies have shown that soil C and N availability markedly influences soil microbial community composition and microbial functions related to soil C and N cycling (Koranda et al. 2011; Bowles et al. 2014; Zhou et al. 2017). Compared to non-degraded soil, severely degraded meadow soil had a higher MBC:MBN ratio (Figure 2), reduced soil α-diversity (Figure 3), no significant change in microbial community structure (Figure 3), but a significant change in soil bacterial community composition (Figure 4). This aligns with the findings of others in the literature (Sullivan & Hart 2013), and indicates that the addition of exogenous carbon alters the size and composition of microbial communities in different soils. After excrement supplementation, the relative abundance of Proteobacteria and Actinobacteria significantly increased. They are typically considered r-strategists (Fierer, Bradford & Jackson 2007; Peiffer et al. 2013). Compared to severely degraded soil, non-degraded soil had a higher relative abundance of Proteobacteria. As a key bacterial community in soil ecosystems, Proteobacteria promotes the dissolution of organophosphates and soil nitrogen fixation (Pascault et al. 2013). Both Proteobacteria and Actinobacteria prefer nutrients-rich environments and play crucial roles in cycling soil nutrients (Ren et al. 2018), particularly in decomposing excrements in which they are responsible for degrading organic matter (Pascault et al. 2013). The excrement supplements used in this study provided a rich nutrient source for Proteobacteria, potentially leading to an increase in its relative abundance. Actinobacteria have strong decomposition abilities for recalcitrant organic components in soil, such as chitin and cellulose, facilitating soil carbon cycling (Eilers et al. 2010). Additionally, their spore production endows them with robust metabolic capabilities in low-temperature environments (Yergeau et al. 2010), making Actinobacteria a dominant microbial community in the alpine meadow soil. After excrement supplementation, the relative abundance of K-strategists such as Acidobacteria and Gemmatimonadota decreased. Therefore, the increase in easily utilizable carbon sources led to an increase in r-strategist abundance and a decrease in K-strategist abundance. In degraded grasslands, however, nutrient depletion in plant roots reduced the availability of easily utilizable carbon sources, resulting in a decrease in r-strategist abundance and an increase in K-strategist abundance. In this study, after excrement supplementation, the relative abundance of Ascomycota increased, while the relative abundance of Basidiomycota decreased in the alpine meadow soil suffering varying degrees of degradation. As the degree of degradation intensified, the relative abundance of Ascomycota in the soil also increased, whereas the relative abundance of Basidiomycota decreased (Figure 4). In the literature (Kabuyah et al. 2012), both Ascomycota and Basidiomycota typically dominate soils rich in lignin and cellulose due to their effective decomposition of these recalcitrant components in vegetation residues. In particular, Ascomycota is able to grow in arid and nutrient-poor environments, and is often a key fungal decomposer in livestock excrement and agricultural waste compost (Yu et al. 2015; Chen et al. 2017; Duan et al. 2019), which may explain its increased abundance after excrement addition. Basidiomycota is considered a K-strategist (Yelle et al. 2008; Bastian et al. 2009), and often constitutes a major component of the fungal community in alpine meadow soil due to its high lignin content (van der Wal et al. 2006). Basidiomycota tends to dominate nutrient-rich ecosystems (Sterkenburg et al. 2015). Therefore, as the meadow degrades and soil and plant organic carbon dwindle, the abundance of Basidiomycota declines, in contrast to the more resilient Ascomycota that rises. 4.2 | Mechanisms of microbial communities influencing soil priming effects The excrement supplement increased the complexity and stability of the microbial symbiotic network in the degraded alpine meadow soil. Non-degraded alpine meadow soil exhibited a more complex and stable microbial symbiotic network than severely degraded alpine meadow soil (Figs. 5 and 6), characterized by an increase in the number of edges and average degree (Banerjee et al. 2019). They represent microbial interactions, which are crucial for the stability and resilience of microbial communities (Olesen et al. 2007; Shi et al. 2016). This may be attributed to the increased organic matter content in the soil following excrement addition, which promotes microbial metabolism (Hu et al. 2017). However, in severely degraded soil, the soil microbial symbiotic network was very simple, which may explain why vegetation restoration is difficult to suceed in severely degraded ”Black Soil Beach” despite the presence of large amounts of pika excrement. SEM revealed complex interactions among stoichiometric ratios, key microbial species, and SOC PEs (Figure 7). Previous studies have shown that the microbial mechanisms of PEs include ”cometabolism,” ”N-mining,” and ”stoichiometric decomposition” (Hessen et al. 2004; Craine, Morrow & Fierer 2007; Blagodatskaya & Kuzyakov 2008; Chen et al. 2014; Fang et al. 2018). In this study, the excrement supplements were the main influencer of soil PEs in the alpine meadows degraded to various degrees (r = -0.94) (Figure 7). The microbial community activities associated with different stoichiometries in the excrements were consistent across the alpine meadows regardless of their degree of degradation. The degree of degradation affected only key microbial species such as Actinobacteriota (r = 0.70), Proteobacteria (r = -0.52), and C:N ratio(r = -0.26), indirectly influencing PEs. Based on the analysis of soil symbiotic networks, the key species were identified at different phylum levels. These key microorganisms, including Actinobacteriota (r = 0.21), Proteobacteria (r = 0.29), and Chloroflexi (r = 0.22), directly and positively influenced PEs. Actinobacteria participate in nitrogen and organic matter decomposition and cycling processes (Sunagawa et al. 2015), which aligns with our findings. The soil NO 3 - -N:NH 4 + -N ratio negatively affected the key microbial species Actinobacteriota (r = -0.18), thereby influencing soil PE. Proteobacteria promote the dissolution of organophosphates and soil nitrogen fixation (Pascault et al. 2013), which is consistent with our results. Soil C:N ratio positively influenced the key microbial species Proteobacteria (r = 0.39), thereby affecting PEs. Chloroflexi can survive in extreme environments, performs anaerobic photosynthesis (Zeng et al. 2015; Zeng et al. 2021), possesses carbon fixation capabilities (Vavourakis et al. 2019; Zorz et al. 2019), and can reduce N 2 O in the nitrogen cycle (Park, Kim & Yoon 2017). Previously, this paper has demonstrated that the supplementation of both Tibetan sheep excrement and plateau pika excrement elevated the relative abundance of crucial soil microorganisms and bolstered microbial community stability. Consequently, the added excrements modulated PEs through alterations in the composition of key microbial communities. This research further reveals that, in contrast to plateau pika excrement, Tibetan sheep excrement boasted carbon stability more and a lower carbon-to-nitrogen ratio (C:N ratio). Based on the N mining hypothesis, the lower C:N ratio of Tibetan sheep excrement may induce a comparatively lower positive PE for soil organic carbon accumulation (Kuzyakov & Bol 2006; Jones et al. 2011). This attribute favors soil carbon sequestration, implying that Tibetan sheep excrement addition may offer superior benefits than plateau pika excrement in restoring degraded meadows in the context of soil remediation and enhancement. 5 | Conclusions Compared to non-degraded alpine meadow soils, the MBC:MBN ratio in severely degraded meadow soils exhibited a significant increase, accompanied by a notable decrease in bacterial α-diversity and pronounced changes in bacterial composition and β-diversity, the microbial symbiotic network in these degraded soils was simpler and less stable. Although the addition of excrements enhanced the soil organic carbon accumulation and improved the complexity and stability of the soil microbial symbiotic network, the microbial community in severely degraded soils remained unstable. Simultaneously, degradation of alpine meadows impacts key microbial species such as Actinobacteriota and Proteobacteria in the soil, which directly affects soil PEs. As a result, severely degraded soils were more susceptible to PEs than non-degraded soils. Of all the factors influencing soil PEs, key microbial species like Actinobacteriota, Proteobacteria, and Chloroflexi have a direct positive impact. Soil stoichiometric ratios (C:N ratio, NO 3 - -N:NH 4 + -N ratio) indirectly influence soil PEs by affecting these key microbial species. Therefore, in lightly and moderately degraded alpine meadow soils, the addition of both types of excrement is beneficial for soil restoration, with Tibetan sheep excrement showing superior effects to plateau pika excrement. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. CRediT authorship contribution statement Qinyao Li: Data curation, Investigation, Software, Writing—original draft; Wenquan Yang: Conceptualization, Supervision, Writing—review & editing; Jiancun Kou: Conceptualization, Project administration, Funding acquisition, Supervision, Writing—review & editing; Qian Liu: Investigation; Yangcan Zhang: Investigation; Weiliang Kou: Investigation; Jiaqing Liu: Investigation; Xilai Li: Conceptualization, Formal analysis, Methodology; Jing Zhang: Conceptualization, Formal analysis, Methodology. Acknowledgments This study was supported by the National Natural Science Foundation of China [grant numbers U23A20159, U21A20191], and the Special Project for Science and Technology Assistance to Qinghai Province’s Department of Science and Technology [grant number 2023-QY-210]. Data Availability statement The original data in this study is provided with the paper and will be published in the NCBI database.

Ai, C., Zhang, S., Zhang, X., Guo, D., Zhou, W. & Huang, S. (2018) Distinct responses of soil bacterial and fungal communities to changes in fertilization regime and crop rotation. Geoderma, 319, 156-166.Banerjee, S., Walder, F., Buchi, L., Meyer, M., Held, A.Y., Gattinger, A., Keller, T., Charles, R. & van der Heijden, M.G.A. (2019) Agricultural intensification reduces microbial network complexity and the abundance of keystone taxa in roots. Isme Journal, 13, 1722-1736.Bastian, F., Bouziri, L., Nicolardot, B. & Ranjard, L. (2009) Impact of wheat straw decomposition on successional patterns of soil microbial community structure. Soil Biology & Biochemistry, 41, 262-275.Bernal, B., McKinley, D.C., Hungate, B.A., White, P.M., Mozdzer, T.J. & Megonigal, J.P. (2016) Limits to soil carbon stability; Deep, ancient soil carbon decomposition stimulated by new labile organic inputs. Soil Biology & Biochemistry, 98, 85-94.Blagodatskaya, E. & Kuzyakov, Y. (2008) Mechanisms of real and apparent priming effects and their dependence on soil microbial biomass and community structure: critical review. Biology and Fertility of Soils, 45, 115-131.Bowles, T.M., Acosta-Martinez, V., Calderon, F. & Jackson, L.E. (2014) Soil enzyme activities, microbial communities, and carbon and nitrogen availability in organic agroecosystems across an intensively-managed agricultural landscape. Soil Biology & Biochemistry, 68, 252-262.Chen, B.B., Jiao, S., Luo, S.W., Ma, B.B., Qi, W., Cao, C.D., Zhao, Z.G., Du, G.Z. & Ma, X.J. (2021) High soil pH enhances the network interactions among bacterial and archaeal microbiota in alpine grasslands of the Tibetan Plateau. Environmental Microbiology, 23, 14.Chen, L., Liu, L., Qin, S., Yang, G., Fang, K., Zhu, B., Kuzyakov, Y., Chen, P., Xu, Y. & Yang, Y. (2019) Regulation of priming effect by soil organic matter stability over a broad geographic scale. Nature Communications, 10, 5112.Chen, L.Y., Liu, L., Mao, C., Qin, S.Q., Wang, J., Liu, F.T., Blagodatsky, S., Yang, G.B., Zhang, Q.W., Zhang, D.Y., Yu, J.C. & Yang, Y.H. (2018) Nitrogen availability regulates topsoil carbon dynamics after permafrost thaw by altering microbial metabolic efficiency. Nature Communications, 9, 3951.Chen, R., Senbayram, M., Blagodatsky, S., Myachina, O., Dittert, K., Lin, X., Blagodatskaya, E. & Kuzyakov, Y. (2014) Soil C and N availability determine the priming effect: microbial N mining and stoichiometric decomposition theories. Global Change Biology, 20, 2356-2367.Chen, X., Lin, J.J., Wang, P., Zhang, S., Liu, D. & Zhu, B. (2022) Resistant soil carbon is more vulnerable to priming effect than active soil carbon. Soil Biology & Biochemistry, 168, 108619.Chen, Y.L., Xu, T.L., Veresoglou, S.D., Hu, H.W., Hao, Z.P., Hu, Y.J., Liu, L., Deng, Y., Rillig, M.C. & Chen, B.D. (2017) Plant diversity represents the prevalent determinant of soil fungal community structure across temperate grasslands in northern China. Soil Biology & Biochemistry, 110, 12-21.Claesson, M.J., O’Sullivan, O., Wang, Q., Nikkilae, J., Marchesi, J.R., Smidt, H., de Vos, W.M., Ross, R.P. & O’Toole, P.W. (2009) Comparative analysis of pyrosequencing and a phylogenetic microarray for exploring microbial community structures in the human distal intestine. PLoS One, 4, e6669.Craine, J.M., Morrow, C. & Fierer, N. (2007) Microbial nitrogen limitation increases decomposition. Ecology, 88, 2105-2113.Davidson, A.D. & Lightfoot, D.C. (2008) Burrowing rodents increase landscape heterogeneity in a desert grassland. Journal of Arid Environments, 72, 1133-1145.Duan, Y.M., Awasthi, S.K., Liu, T., Chen, H.Y., Zhang, Z.Q., Wang, Q., Ren, X., Tu, Z., Awasthi, M.K. & Taherzadeh, M.J. (2019) Dynamics of fungal diversity and interactions with environmental elements in response to wheat straw biochar amended poultry manure composting. Bioresource Technology, 274, 410-417.Eilers, K.G., Lauber, C.L., Knight, R. & Fierer, N. (2010) Shifts in bacterial community structure associated with inputs of low molecular weight carbon compounds to soil. Soil Biology & Biochemistry, 42, 896-903.Fang, Y., Nazaries, L., Singh, B.K. & Singh, B.P. (2018) Microbial mechanisms of carbon priming effects revealed during the interaction of crop residue and nutrient inputs in contrasting soils. Global Change Biology, 24, 2775-2790.Fierer, N., Bradford, M.A. & Jackson, R.B. (2007) Toward an ecological classification of soil bacteria. Ecology, 88, 1354-1364.Fontaine, S., Bardoux, G., Abbadie, L. & Mariotti, A. (2004) Carbon input to soil may decrease soil carbon content. Ecology Letters, 7, 314-320.Fontaine, S., Mariotti, A. & Abbadie, L. (2003) The priming effect of organic matter: a question of microbial competition? Soil Biology & Biochemistry, 35, 837-843.Gross, A. & Glaser, B. (2021) Meta-analysis on how manure application changes soil organic carbon storage. Scientific Reports, 11 .Heitkötter, J., Heinze, S. & Marschner, B. (2017) Relevance of substrate quality and nutrients for microbial C-turnover in top-and subsoil of a Dystric Cambisol. Geoderma, 302, 89-99.Hessen, D.O., Agren, G.I., Anderson, T.R., Elser, J.J. & De Ruiter, P.C. (2004) Carbon, sequestration in ecosystems: The role of stoichiometry. Ecology, 85, 1179-1192.Hicks, L.C., Meir, P., Nottingham, A.T., Reay, D.S., Stott, A.W., Salinas, N. & Whitaker, J. (2019) Carbon and nitrogen inputs differentially affect priming of soil organic matter in tropical lowland and montane soils. Soil Biology & Biochemistry, 129, 212-222.Hu, X.J., Liu, J.J., Wei, D., Zhu, P., Cui, X., Zhou, B.K., Chen, X.L., Jin, J., Liu, X.B. & Wang, G.H. (2017) Effects of over 30-year of different fertilization regimes on fungal community compositions in the black soils of northeast China. Agriculture Ecosystems & Environment, 248, 113-122.Jenkinson, D.S. & Powlson, D.S. (1976) The effects of biocidal treatments on metabolism in soil—V: A method for measuring soil biomass,. Soil Biology and Biochemistry, 8, 209-213.Jones, D.L., Murphy, D.V., Khalid, M., Ahmad, W., Edwards-Jones, G. & DeLuca, T.H. (2011) Short-term biochar-induced increase in soil CO 2 release is both biotically and abiotically mediated. Soil Biology & Biochemistry, 43, 1723-1731.Kabuyah, R.N.T.M., van Dongen, B.E., Bewsher, A.D. & Robinson, C.H. (2012) Decomposition of lignin in wheat straw in a sand-dune grassland. Soil Biology & Biochemistry, 45, 128-131.Koranda, M., Schnecker, J., Kaiser, C., Fuchslueger, L., Kitzler, B., Stange, C.F., Sessitsch, A., Zechmeister-Boltenstern, S. & Richter, A. (2011) Microbial processes and community composition in the rhizosphere of European beech - The influence of plant C exudates. Soil Biology & Biochemistry, 43, 551-558.Korkanc, S.Y. & Korkanc, M. (2016) Physical and chemical degradation of grassland soils in semi-arid regions: A case from Central Anatolia, Turkey. Journal of African Earth Sciences, 124, 1-11.Kou, D., Ding, J.Z., Li, F., Wei, N., Fang, K., Yang, G.B., Zhang, B.B., Liu, L., Qin, S.Q., Chen, Y.L., Xia, J.Y. & Yang, Y.H. (2019) Spatially-explicit estimate of soil nitrogen stock and its implication for land model across Tibetan alpine permafrost region. Science of the Total Environment, 650, 1795-1804.Kuzyakov, Y. & Bol, R. (2006) Sources and mechanisms of priming effect induced in two grassland soils amended with slurry and sugar. Soil Biology & Biochemistry, 38, 747-758.Kuzyakov, Y., Friedel, J.K. & Stahr, K. (2000) Review of mechanisms and quantification of priming effects. Soil Biology & Biochemistry, 32, 1485-1498.Lai, C.H. & Smith, A.T. (2003) Keystone status of plateau pikas ( Ochotona curzoniae ): effect of control on biodiversity of native birds. Biodiversity and Conservation, 12, 1901-1912.Li, H.Y., Qiu, Y.Z., Yao, T., Han, D.R., Gao, Y.M., Zhang, J.G., Ma, Y.C., Zhang, H.R. & Yang, X.L. (2021) Nutrients available in the soil regulate the changes of soil microbial community alongside degradation of alpine meadows in the northeast of the Qinghai-Tibet Plateau. Science of the Total Environment, 792, 148363.Li, X.L., Gao, J., Brierley, G., Qiao, Y.M., Zhang, J. & Yang, Y.W. (2013) Rangeland degradation on the Qinghai-Tibet Plateau: implications for rehabilitation. Land Degradation & Development, 24, 72-80.Liu, J., Schneider, R.L., Morreale, S.J., Wang, H.M., Wang, R.X., Wang, F. & Li, Z.G. (2023) The roles for branch shelters and sheep manure to accelerate the restoration of degraded grasslands in northern China. Frontiers in Environmental Science, 10, 1089645.Liu, S.B., Zamanian, K., Schleuss, P.M., Zarebanadkouki, M. & Kuzyakov, Y. (2018) Degradation of Tibetan grasslands: Consequences for carbon and nutrient cycles. Agriculture Ecosystems & Environment, 252, 93-104.Nunes, J.S., Araujo, A.S.F., Nunes, L., Lima, L.M., Carneiro, R.F.V., Salviano, A.A.C. & Tsai, S.M. (2012) Impact of land degradation on soil microbial biomass and activity in northeast brazil. Pedosphere, 22, 88-95.Olesen, J.M., Bascompte, J., Dupont, Y.L. & Jordano, P. (2007) The modularity of pollination networks. Proceedings of the National Academy of Sciences of the United States of America, 104, 19891-19896.Park, D., Kim, H. & Yoon, S. (2017) Nitrous oxide reduction by an obligate aerobic bacterium, Gemmatimonas aurantiaca Strain T-27. Applied and Environmental Microbiology, 83, e00502-00517.Pascault, N., Ranjard, L., Kaisermann, A., Bachar, D., Christen, R., Terrat, S., Mathieu, O., Leveque, J., Mougel, C., Henault, C., Lemanceau, P., Pean, M., Boiry, S., Fontaine, S. & Maron, P.-A. (2013) Stimulation of different functional groups of bacteria by various plant residues as a driver of soil priming effect. Ecosystems, 16, 810-822.Pausch, J., Zhu, B., Kuzyakov, Y. & Cheng, W. (2013) Plant inter-species effects on rhizosphere priming of soil organic matter decomposition. Soil Biology & Biochemistry, 57, 91-99.Peiffer, J.A., Spor, A., Koren, O., Jin, Z., Tringe, S.G., Dangl, J.L., Buckler, E.S. & Ley, R.E. (2013) Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proceedings of the National Academy of Sciences of the United States of America, 110, 6548-6553.Qiao, N., Schaefer, D., Blagodatskaya, E., Zou, X.M., Xu, X.L. & Kuzyakov, Y. (2014) Labile carbon retention compensates for CO 2 released by priming in forest soils. Global Change Biology, 20, 1943-1954.Qin, Y., Chen, J.J. & Yi, S.H. (2015) Plateau pikas burrowing activity accelerates ecosystem carbon emission from alpine grassland on the Qinghai-Tibetan Plateau. Ecological Engineering, 84, 287-291.Qiu, J. (2008) The third pole. Nature, 454, 393-396.Ramirez, K.S., Craine, J.M. & Fierer, N. (2012) Consistent effects of nitrogen amendments on soil microbial communities and processes across biomes. Global Change Biology, 18, 1918-1927.Razanamalala, K., Razafimbelo, T., Maron, P.-A., Ranjard, L., Chemidlin, N., Lelievre, M., Dequiedt, S., Ramaroson, V.H., Marsden, C., Becquer, T., Trap, J., Blanchart, E. & Bernard, L. (2018) Soil microbial diversity drives the priming effect along climate gradients: a case study in Madagascar. ISME Journal, 12, 451-462.Ren, C.J., Wang, T., Xu, Y.D., Deng, J., Zhao, F.Z., Yang, G.H., Han, X.H., Feng, Y.Z. & Ren, G.X. (2018) Differential soil microbial community responses to the linkage of soil organic carbon fractions with respiration across land-use changes. Forest Ecology and Management, 409, 170-178.Shang, Z.H., Yang, S.H., Wang, Y.L., Shi, J.J., Ding, L.M. & Long, R.J. (2016) Soil seed bank and its relation with above-ground vegetation along the degraded gradients of alpine meadow. Ecological Engineering, 90, 268-277.Shi, S.J., Nuccio, E.E., Shi, Z.J., He, Z.L., Zhou, J.Z. & Firestone, M.K. (2016) The interconnected rhizosphere: High network complexity dominates rhizosphere assemblages. Ecology Letters, 19, 926-936.Smith, A.P., Marin-Spiotta, E., de Graaff, M.A. & Balser, T.C. (2014) Microbial community structure varies across soil organic matter aggregate pools during tropical land cover change. Soil Biology & Biochemistry, 77, 292-303.Smith, A.T. & Foggin, J.M. (1999) The plateau pika ( Ochotona curzoniae ) is a keystone species for biodiversity on the Tibetan plateau. Animal Conservation, 2, 235-240.Sparks, D.L., Page, A.L., Helmke, P.A., Loeppert, R.H., Soltanpour, P.N., Tabatabai, M.A., & Johnston, C.T., Sumner, M.E., (1996) Methods of Soil Analysis . Soil Science Society of America and Ameri-can Society of Agronomy, Madison.Sterkenburg, E., Bahr, A., Durling, M.B., Clemmensen, K.E. & Lindahl, B.D. (2015) Changes in fungal communities along a boreal forest soil fertility gradient. New Phytologist, 207, 1145-1158.Su, D.X., Zhang, Z.H., Chen, Z.Z. & Hu, X.Z. (2003) Parameters for degradation, sandification and salification of rangelands. The Ministry of Agriculture of the People’s Republic of China, GB 19377-2003, 12.Sullivan, B.W. & Hart, S.C. (2013) Evaluation of mechanisms controlling the priming of soil carbon along a substrate age gradient. Soil Biology & Biochemistry, 58, 293-301.Sunagawa, S., Coelho, L.P., Chaffron, S., Kultima, J.R., Labadie, K., Salazar, G., Djahanschiri, B., Zeller, G., Mende, D.R., Alberti, A., Cornejo-Castillo, F.M., Costea, P.I., Cruaud, C., d’Ovidio, F., Engelen, S., Ferrera, I., Gasol, J.M., Guidi, L., Hildebrand, F., Kokoszka, F., Lepoivre, C., Lima-Mendez, G., Poulain, J., Poulos, B.T., Royo-Llonch, M., Sarmento, H., Vieira-Silva, S., Dimier, C., Picheral, M., Searson, S., Kandels-Lewis, S., Bowler, C., de Vargas, C., Gorsky, G., Grimsley, N., Hingamp, P., Iudicone, D., Jaillon, O., Not, F., Ogata, H., Pesant, S., Speich, S., Stemmann, L., Sullivan, M.B., Weissenbach, J., Wincker, P., Karsenti, E., Raes, J., Acinas, S.G., Bork, P. & Tara Oceans, C. (2015) Structure and function of the global ocean microbiome. Science, 348, 1261359.Tao, X., Feng, J., Yang, Y., Wang, G., Tian, R., Fan, F., Ning, D., Bates, C.T., Hale, L., Yuan, M.M., Wu, L., Gao, Q., Lei, J., Schuur, E.A.G., Yu, J., Bracho, R., Luo, Y., Konstantinidis, K.T., Johnston, E.R., Cole, J.R., Penton, C.R., Tiedje, J.M. & Zhou, J. (2020) Winter warming in Alaska accelerates lignin decomposition contributed by Proteobacteria. Microbiome, 8, 84.Thomson, A.M. & Simpson, I.A. (2007) Modeling historic rangeland management and grazing pressures in landscapes of settlement. Human Ecology, 35, 151-168.Urak, I., Hartel, T., Galle, R. & Balog, A. (2017) Worldwide peatland degradations and the related carbon dioxide emissions: the importance of policy regulations. Environmental Science & Policy, 69, 57-64.van der Wal, A., van Veen, J.A., Smant, W., Boschker, H.T.S., Bloem, J., Kardol, P., van der Putten, W.H. & de Boer, W. (2006) Fungal biomass development in a chronosequence of land abandonment. Soil Biology & Biochemistry, 38, 51-60.Vavourakis, C.D., Mehrshad, M., Balkema, C., van Hall, R., Andrei, A.-S., Ghai, R., Sorokin, D.Y. & Muyzer, G. (2019) Metagenomes and metatranscriptomes shed new light on the microbial-mediated sulfur cycle in a Siberian soda lake. BMC Biology, 17, 69.Wang, G.X., Qian, J., Cheng, G.D. & Lai, Y.M. (2002) Soil organic carbon pool of grassland soils on the Qinghai-Tibetan Plateau and its global implication. Science of the Total Environment, 291, 207-217.Wang, J., Song, Y., Ma, T., Raza, W., Li, J., Howland, J.G., Huang, Q. & Shen, Q. (2017) Impacts of inorganic and organic fertilization treatments on bacterial and fungal communities in a paddy soil. Applied Soil Ecology, 112, 42-50.Wang, J., Wang, X., Liu, G., Wang, G., Wu, Y. & Zhang, C. (2020) Fencing as an effective approach for restoration of alpine meadows: Evidence from nutrient limitation of soil microbes. Geoderma, 363, 114148.Wei, W.R., Yao, X., Zhang, Y., Zhen, Q.Y., Qin, M.S., Tang, Z.M., Oosthuizen, M.K. & Zhang, W.G. (2023) Vegetation restoration measures: Increasing plant height suppresses population densities of plateau pikas. Land Degradation & Development, 34, 2201-2213.Xu, N., Tan, G.C., Wang, H.Y. & Gai, X.P. (2016) Effect of biochar additions to soil on nitrogen leaching, microbial biomass and bacterial community structure. European Journal of Soil Biology, 74, 1-8.Yang, Z.P., Gao, J.X., Zhao, L., Xu, X.L. & Ouyang, H. (2013) Linking thaw depth with soil moisture and plant community composition: effects of permafrost degradation on alpine ecosystems on the Qinghai-Tibet Plateau. Plant and Soil, 367, 687-700.Yelle, D.J., Ralph, J., Lu, F. & Hammel, K.E. (2008) Evidence for cleavage of lignin by a brown rot basidiomycete. Environmental Microbiology, 10, 1844-1849.Yergeau, E., Hogues, H., Whyte, L.G. & Greer, C.W. (2010) The functional potential of high Arctic permafrost revealed by metagenomic sequencing, qPCR and microarray analyses. ISME Journal, 4, 1206-1214.Yu, M., Zhang, J., Xu, Y., Xiao, H., An, W., Xi, H., Xue, Z., Huang, H., Chen, X. & Shen, A. (2015) Fungal community dynamics and driving factors during agricultural waste composting. Environmental Science and Pollution Research, 22, 19879-19886.Zechmeister-Boltenstern, S., Keiblinger, K.M., Mooshammer, M., Penuelas, J., Richter, A., Sardans, J. & Wanek, W. (2015) The application of ecological stoichiometry to plant-microbial-soil organic matter transformations. Ecological Monographs, 85, 133-155.Zeng, Y., Nupur, Wu, N., Madsen, A.M., Chen, X., Gardiner, A.T. & Koblizek, M. (2021) Gemmatimonas groenlandica sp. Nov. Is an aerobic anoxygenic phototroph in the phylum gemmatimonadetes. Frontiers in Microbiology, 11, 606612.Zeng, Y., Selyanin, V., Lukes, M., Dean, J., Kaftan, D., Feng, F. & Koblizek, M. (2015) Characterization of the microaerophilic, bacteriochlorophyll a -containing bacterium Gemmatimonas phototrophica sp nov., and emended descriptions of the genus Gemmatimonas and Gemmatimonas aurantiaca . International Journal of Systematic and Evolutionary Microbiology, 65, 2410-2419.Zhang, J.P., Zhang, L.B., Liu, W.L., Qi, Y. & Wo, X. (2014) Livestock-carrying capacity and overgrazing status of alpine grassland in the Three-River Headwaters region, China. Journal of Geographical Sciences, 24, 303-312.Zhang, Q., Zhou, W., Liang, G., Sun, J., Wang, X. & He, P. (2015) Distribution of soil nutrients, extracellular enzyme activities and microbial communities across particle-size fractions in a long-term fertilizer experiment. Applied Soil Ecology, 94, 59-71.Zhang, X., Han, X., Yu, W., Wang, P. & Cheng, W. (2017) Priming effects on labile and stable soil organic carbon decomposition: Pulse dynamics over two years. PLoS One, 12, e0184978.Zhou, Z., Wang, C., Zheng, M., Jiang, L. & Luo, Y. (2017) Patterns and mechanisms of responses by soil microbial communities to nitrogen addition. Soil Biology & Biochemistry, 115, 433-441.Zhu, B., Zhang, Z.X., Tian, J.X., Kong, R. & Chen, X. (2022) Increasing negative impacts of climatic change and anthropogenic activities on vegetation variation on the qinghai-tibet plateau during 1982-2019. Remote Sensing, 14, 4735.Zimmermann, M., Bird, M.I., Wurster, C., Saiz, G., Goodrick, I., Barta, J., Capek, P., Santruckova, H. & Smernik, R. (2012) Rapid degradation of pyrogenic carbon. Global Change Biology, 18, 3306-3316.Zorz, J.K., Sharp, C., Kleiner, M., Gordon, P.M.K., Pon, R.T., Dong, X. & Strous, M. (2019) A shared core microbiome in soda lakes separated by large distances. Nature Communications, 10, 4230. Information & Authors Information Version history Copyright This work is licensed under a Non Exclusive No Reuse License.

Authors Metrics & Citations Metrics Article Usage 242views 190downloads Citations Download citation Qinyao Li, Wenquan Yang, Jiancun Kou, et al. Key Microbial Species Influencing the Priming Effects of Variously Degraded Alpine Meadow Soils Enriched with Animal Excrements. Authorea. 09 January 2025. DOI: https://doi.org/10.22541/au.173640738.88937820/v1 DOI: https://doi.org/10.22541/au.173640738.88937820/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu.