Comprehensive analysis of the cardiac whole-transcriptome expression profiling involved in rehabilitation exercise improving myocardial remodeling after acute myocardial infarction | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Comprehensive analysis of the cardiac whole-transcriptome expression profiling involved in rehabilitation exercise improving myocardial remodeling after acute myocardial infarction Xueying Chen, Mingrui Chen, Zhongxin Li, Yugang Yan, Nan Lin, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4865745/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Rehabilitation exercise (RE) has been shown to mitigate cardiac remodeling and enhance cardiac function in patients with acute myocardial infarction (AMI). However, the precise molecular mechanisms underlying these effects remain incompletely elucidated. In this study, we established a mice model of acute myocardial infarction (AMI) and implemented an 8-week rehabilitation exercise intervention. Whole-transcription sequencing was conducted to examine the expression patterns of mRNA and non-coding RNAs (ncRNAs) in the myocardium of mice with AMI, with and without rehabilitation exercise (RE). GO, KEGG pathway enrichment and protein-protein interaction (PPI) network analyses were performed. And the mRANs within the ceRNA network were validated by RT-PCR. Our findings demonstrate that RE effectively enhances cardiac function, attenuates fibrosis and promotes angiogenesis in the myocardial tissue following MI. Furthermore, bio informatics tools and databases were utilized to investigate potential functions and associations of non-coding RNAs. Our data revealed that: a total of 100 long ncRNAs (lncRNAs), 14 microRNAs (miRNAs), 131 circular RNAs (circRNAs), and 1028 messenger RNAs (mRNAs) were significant. The most prominent pathways involved in RE-mediated improvement of cardiac remodeling after AMI are the PI3K-Akt signaling pathway, cytokine − cytokine receptor interaction, chemokine signaling pathway and MAPK signaling pathway. In addition, lncRNA‒miRNA-mRNA and circRNA-miRNA‒mRNA networks of RE-mediated improvement of cardiac remodeling after AMI were constructed. The present study elucidates the physiological roles of mRNA and ncRNAs in facilitating cardiac remodeling post-AMI. Our findings establish a theoretical framework for investigating the mechanisms underlying cardiac remodeling after AMI, while also providing valuable insights for exploring potential therapeutic interventions for AMI. Health sciences/Cardiology Health sciences/Medical research Biological sciences/Molecular biology/Non coding rnas Rehabilitation exercise Acute myocardial infarction Noncoding RNAs (ncRNAs) Whole-transcriptome sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Acute myocardial infarction (AMI) is a prevalent clinical emergency, with its worldwide incidence rapidly increasing and affecting younger populations 1 . Despite significant advancements in medical, interventional, and surgical treatments for cardiovascular diseases (CVD) in recent years, there remains a substantial number of patients who experience heart failure following acute myocardial infarction (AMI), imposing a considerable burden on both families and society. Rehabilitation exercise (RE) has emerged as a promising strategy for mitigating the development and progression of CVD, while concurrently enhancing cardiac function among heart failure patients 2 . Previous studies have demonstrated that the pathophysiological basis underlying the beneficial effects of RE on cardiac remodeling after AMI involves the activation of signaling pathways, modulation of cardiac cellular metabolism, and mitochondrial adaptation 3 , 4 . However, the precise mechanisms responsible for RE-mediated improvement in cardiac remodeling following AMI remain to be fully elucidated. Given that most patients with post-AMI heart failure experience limited mobility, there is an urgent need for studies focused on identifying novel therapeutic targets for exercise-induced cardioprotection and evaluating the efficacy of resistance exercise. In recent decades, there has been rapid advancement in high-quality deep RNA sequencing technology, enabling the acquisition of extensive biological and medical information within a short time frame 5 . A growing number of noncoding RNAs (ncRNAs), which constitute the majority of the transcriptome, have been discovered. Based on their size, ncRNAs can be categorized into microRNAs (miRNAs), long noncoding RNAs (lncRNAs), and circular RNAs (circRNAs). An increasing body of evidence suggests that these noncoding transcripts exert significant regulatory effects through epigenetic, posttranscriptional, and translational mechanisms, thereby exerting substantial influence on key biological processes such as inflammation, cell proliferation, and dysregulation of the extracellular matrix 6 . Consequently, ncRNAs have emerged as promising diagnostic candidates and potential therapeutic targets for a wide range of diseases including cardiovascular disorders. In addition, ncRNAs play important roles in RE regulation of cardiac remodeling after AMI. Studies have identified lncRNAs that contribute to the modulation of exercise-induced cardiac growth, termed cardiac physiological hypertrophy-associated regulators, providing new insights into the regulation of this cardiac growth process. However, the regulatory functions of ncRNAs in RE-mediated regulation of cardiac remodeling after AMI and their underlying mechanisms have not been systematically described. Thus, comprehensive forecasting and analysis of the ncRNAs underlying RE-mediated regulation of cardiac remodeling after AMI are essential to generate targets for evaluating the effectiveness of RE and achieving exercise-induced cardioprotective effects. As the changes in ncRNA expression and the potential lncRNA–circRNA–miRNA‒mRNA network remain unclear in RE regulating cardiac remodeling after AMI, the present study analyzed ncRNA expression in AMI mice with or without RE by whole-transcriptome sequencing. Furthermore, we employed bioinformatics analysis methods to screen and analyze the differential expression profiles of ncRNAs, subsequently constructing a regulatory network of ncRNAs and mRNAs based on the competing endogenous RNA (ceRNA) theory. The primary aim of this study was to augment the theoretical foundation for elucidating the roles of ncRNAs in RE-mediated regulation of cardiac remodeling following AMI. Results The flow chart of the study This study utilizes mice to create a myocardial infarction model. Following successful construction, the RE is administered. Subsequent to the completion of RE, myocardial tissue samples are collected for high-throughput sequencing of the entire transcription. Figure 1 illustrates the flow chart of the molecular experiment and the approach to biological information analysis employed in this study. Construction of a model for acute myocardial infarction The MI model was established by ligating the mice's LAD. Following LAD ligation, Electrocardiogram results indicated elevated and distorted QRS complexes, along with ST-segment depression (Fig. 2 A). The mouse hearts were promptly acquired after ligation. The ischemic myocardium at the apex displays a pallid hue (Fig. 2 B). Echocardiography was used to assess the cardiac function of mice one month after myocardial infarction. The echocardiographic measurements of mouse hearts include representative B-mode, M-mode, and pulsed-wave Doppler (PW-mode) echocardiograms See the Fig. 2 D; Quantitative analysis showed that: in comparison to the control group, LVPWd and LVEF decreased, LVIDd increased in the AMI group (Fig. 2 E-G). Additionally, the ratio of heart weight (HW) to body weight (BW) decreased in the AMI group (Fig. 2 C). RE improves cardiac structure and function after MI Rehabilitation exercise was initiated 1 month post-myocardial infarction, followed by an 8-week period of RE. A high-resolution ultrasonic imaging system was utilized to measure LVIDd, LVPWd, and LVEF, with typical images presented in Fig. 3 A. Compared to the AMI + NC group, LVPWd showed no statistically significant differences (Fig. 3 B), while LVIDd decreased (Fig. 3 C), LVEF increased (Fig. 3 D) in the AM I + RE group. And the ratio of HW to BW decreased in the AMI + RE group, but did not reach statistical significance (Fig. 3 E). RE improves myocardial remodeling after MI To investigate the impact of exercise on myocardial remodeling in mice following AMI, we observed the effect of RE on myocardial fibrosis and angiogenesis after myocardial infarction. HE staining demonstrated a significant reduction in enlarged cardiac chambers with exercise intervention (Fig. 4 A). Masson staining illustrated that exercise intervention attenuated AMI-induced fibrosis, as depicted in Fig. 4 B-C. To investigate the impact of RE on myocardial angiogenesis, we employed CD34 immunofluorescence to assess neovascularization levels 7 . CD34 is specifically expressed in neovascular endothelial cells and serves as a marker for neovascularization. In comparison to the control group, the AMI + RE group exhibited a significant increase in CD34-positive staining (p < 0.01), as depicted in Fig. 4 D-E. Differential expression (DE) analysis of mRNAs, lncRNAs, miRNAs, circRNAs We analysis the differential expression of mRNAs, lncRNAs, miRNAs, circRNAs in the myocardial tissue samples of AMI + RE group compared to AMI + NC group. Heatmaps with | log2FC | > 1 (p 2 (p < 0.01) were generated to visualize the overall distribution of DEmRNAs, DElncRNAs, DEmiRNAs, and DEcircRNAs (Fig. 5 ). According to the screening criteria, a total of 1028 DE mRNAs were obtained, among which 696 were upregulated and 332 were downregulated(Fig. 5 A, 5 E and Supplementary Table 1). One hundred DE lncRNAs were identified, 59 of which were upregulated and 41 of which were downregulated(Fig. 5 B, 5 F and Supplementary Table 2). A total of 14 DE miRNAs were obtained, among which 10 were upregulated and 4 were downregulated(Fig. 5 C, 5 G and Supplementary Table 3. A total of 131 DE circRNAs were found, of which 116 were upregulated and 15 were downregulated(Fig. 5 D, 5 H and Supplementary Table 4). Functional enrichment analysis of DE mRNA To further investigate the biological functions of the differentially expressed mRNAs, we performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. The top 20 terms with the smallest p-values in the GO analysis, which includes classifications for biological process, cellular component, and molecular function, as well as the KEGG enrichment analysis, were visualized using a bubble plot (as shown in Fig. 6 A-C and supplyment table 5). Specifically, terms such as negative regulation of immune system process and leukocyte migration were identified in the biological process category (Fig. 6 A), while apical part of cell and membrane raft were highlighted in the cellular component category (Fig. 6 B). Additionally, receptor ligand activity and metal ion transmembrane transporter activity were observed in the molecular function category (Fig. 6 C). KEGG pathway analysis revealed associations of the differentially expressed mRNAs with pathways such as cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, and MAPK signaling pathway (Fig. 6 D and supplyment table 6 ). PPI and significant cluster module analysis of DE mRNAs The PPI network of DE mRNAs consists of 891 nodes and 5184 edges. According to the criteria of scoring more than 10, three subnetworks were selected using MCODE of Cytoscape (Fig. 7 A and supplement table 7). The genes in these three subnetworks were all upregulated. MCODE1 (score 23.5) had 29 nodes and 329 interacting pairs, MCODE2 (score 14.057) had 36 nodes and 246 interacting pairs (Fig. 7 B and supplement table 8), and MCODE3 (score 10.828) had 30 nodes and 157 interacting pairs (Fig. 7 C and supplement table 9). In the GO-BP enrichment analysis of the genes in the module, the first 10 terms were selected for display according to significance (Fig. 7 D and supplement table10). Interestingly, both MCODE1 and MCODE2 encompassed identical biological process terms, including cell chemotaxis, myeloid leukocyte chemotaxis, myeloid leukocyte migration, and leukocyte migration. Notably, the genes within MCODE3 exhibit significant involvement in the regulation of immune response through cell surface receptor signaling pathway and activation of immune response via signal transduction. lncRNA-, miRNA- and circRNA-related target gene enrichment analysis KEGG enrichment analysis was conducted based on the mRNAs involved in the differential expression miRNA–mRNA target relationships, as well as the coexpression relationships between differentially expressed lncRNAs and mRNAs, and between differentially expressed circRNAs and mRNAs. The results of this analysis are presented in a bubble map (Fig. 8 ). The results showed that LncRNAs were mainly enriched in the cytokine − cytokine receptor interaction, PI3K − Akt signaling pathway and Chemokine signaling pathway (Fig. 8 A and supplement table11). MiRNAs were significantly enriched in the MAPK signaling pathway, mTOR signaling pathway and cellular senescence (Fig. 8 B and supplement table 12). CircRNAs were mainly enriched in Th1 and Th2 cell differentiation, the C − type lectin receptor signaling pathway and the cAMP signaling pathway (Fig. 8 C and supplement table13). Construction of regulatory networks for ncRNAs According to the predicted regulatory relationships between targeted lncRNA-miRNA, circRNA-miRNA, and miRNA-mRNA interactions, we identified lncRNAs, circRNAs, and mRNAs that exhibited significant differential expression and regulation by the same miRNA. Subsequently, we obtained 10 regulatory networks involving lncRNA-miRNA-mRNA interactions. Among them, 3 lncRNAs were downregulated, 5 miRNAs were upregulated, and 45 mRNAs were downregulated to obtain 5 circRNA-miRNA‒mRNA regulatory networks, among which 4 circRNAs were upregulated and 1 circRNA was downregulated. Furthermore, one miRNA displayed downregulation along with ten upregulated mRNAs. The ncRNA regulatory network is shown in Fig. 9 and supplementary Table 14. Validation of RNA expression in the ceRNA network To validate the accuracy of the detection results, we conducted RT-PCR verification on the RNA of the LncRNA‒miRNA-mRNA ceRAN Network. The LncRNA-miRNA-mRNA Network selected for analysis is visualized using a Sankey diagram in Fig. 10 A(supplementary Table 14). Figure 10 B shows the RT-PCR detection results for LncRNA (Gm4544, Gm26794) RNA expression in the myocardial tissue of AMI-NC and AMI-RE mice. The expression of miRNA RNA is illustrated in Fig. 10 C, while the mRNA expression is depicted in Fig. 10 D. By comparing the RT-PCR results with the sequencing data, we observed a high degree of consistency in the gene expression patterns, thus confirming the reliability of our data. Discussion Numerous previous studies have demonstrated that exercise after acute myocardial infarction (AMI) can effectively ameliorate cardiac fibrosis, reduce myocardial cell apoptosis, delay ventricular remodeling, and improve cardiac function 8 , 9 . However, the specific molecular mechanism underlying the beneficial effects of exercise on cardiac remodeling and function post-AMI remains unclear. To gain a better understanding of this mechanism, we performed whole-transcriptome sequencing analysis on heart samples from the AMI + NC and AMI + RE groups and found 1028 DE mRNAs, 100 DE lncRNAs, 14 DE miRNAs and 131 DE circRNAs. GO analysis of the differentially expressed mRNAs showed significant enrichment in negative regulation of the immune system while KEGG pathway analysis indicated significant enrichment in cytokine-cytokine receptor interaction. PPI network analysis highlighted an important role for chemokine family genes among the differentially expressed mRNAs. Based on the ceRNA theory, a ceRNA interaction network was constructed to analyze the regulatory roles of DE lncRNAs and circRNAs in cardiac repair after AMI. We selected several DE mRNAs, lncRNAs, and miRNAs for RT-qPCR validation which yielded consistent results with our sequencing data. The successful construction of mouse AMI was experimentally confirmed. Following myocardial infarction, mice exhibited ventricular wall thinning, enlarged heart chambers, and decreased ejection fraction, consistent with previous research findings 10 , 11 . In this study, we conducted HE and Masson staining, revealing a significantly lower area of myocardial fibrosis in the AMI + RE group compared to the AMI + NC group. Additionally, ventricular expansion was reduced. Cardiac color Doppler ultrasound revealed that the LVEF of the mice in the AMI + RE group was increased, which suggested that RE after AMI is beneficial to improve cardiac function and reduce adverse cardiac remodeling. Numerous clinical studies have reported that individualized REs for AMI patients can improve cardiac ejection fraction, enhance quality of life, alleviate anxiety and depression symptoms, as well as reduce rates of sudden cardiac death and readmission 12 – 14 . These results are consistent with this study. We conducted an enrichment analysis of differentially expressed mRNAs (DE mRNAs). Interestingly, our findings revealed a significant enrichment of biological functions associated with the negative regulation of immune processes, including inflammatory cell activation, adhesion, and migration. These results suggest that RE plays a role in cardiac repair after AMI by negatively regulating molecular functions related to immune processes. There are previous studies that support our experimental data 15 – 17 . Necrotic myocardial tissue triggers an immune cascade that leads to a widespread inflammatory response. Prolonged inflammation infiltrates into the noninfarcted area, resulting in increased fibrosis and impaired ventricular diastolic function 18 , 19 . Therefore, timely inhibition of the immune response and chemotactic migration of inflammatory cells are crucial for promoting MI repair. In the PPI analysis of mRNA, chemokine family genes constituted the major component in the three MCODEs, with CCL2 and CCR5 exhibiting higher degrees of freedom compared to other proteins. Extensive clinical studies and experiments have provided support for the crucial roles played by inflammatory cytokines and chemokines in cardiac dysfunction and adverse cardiac remodeling 20 – 23 . However, this evidence is often misinterpreted to suggest that inflammatory cytokines and chemokines have only deleterious effects. In fact, inflammatory cytokines have multiple effects and versatility. In the process of myocardial injury, multiple members of the cytokine and chemokine family can be upregulated to regulate the quantitative mobilization of immune cell subsets in the area of MI, activate the cardiomyocyte repair program and play a beneficial role 24 – 26 . CCL2 can be rapidly upregulated in infarcted myocardium 27 – 29 . Cardiac overexpression of CCL2 has been observed to reduce infarct size, scar formation, while promoting neovascularization in the border area following myocardial infarction using a mouse model 29 . Our sequencing results showed that the expression of CCL2 increased after exercise, which played a favorable role, which was consistent with the above results. Studies have shown that CCR5 can inhibit inflammation and reduce poor remodeling after MI by regulating T cells (Tregs) 30 – 33 . In our study, sequencing revealed that RE increased expression of CCR5 in myocardial tissue after MI which contributed towards improving cardiac structure and function aligning with previous research perspectives. During KEGG analysis of DE genes, we observed significant enrichment of both DE mRNAs and DE lncRNAs in the cytokine-cytokine receptor interaction, chemokine signaling pathway, PI3K-Akt signaling pathway, and MAPK signaling pathway. Studies have shown that the interaction between chemokines and chemokine receptors guides cell migration to the site of injury by activating the PI3K pathway 34 , 35 . Among them, the PI3K-Akt signaling pathway plays an important role in the occurrence, development and treatment of MI 36 . Exercise induces multiorgan responses and activates diverse signaling pathways within the body including the PI3K-Akt signaling pathway 37 . Activation of this particular pathway has been shown to alleviate myocardial cell apoptosis, myocardial fibrosis, and mitochondrial dysfunction induced by myocardial ischemia-reperfusion 38 , 39 . Additionally, it has been found that activating the PI3K-Akt signaling pathway promotes angiogenesis in the infarct area using a mouse model of MI 40 , 41 . In the ceRNA regulatory network, upregulated miR21, upregulated miR34 and downregulated let-7c occupy an important position. In a pig model of MI, YanLi et al 42 used nanocarriers to deliver miR-21 to the infarction site and found that it could inhibit the transformation of myocardial macrophages to type M1 and effectively alleviate the inflammatory response. When delivered to endothelial cells, it could promote local angiogenesis and effectively reduce infarct size. Studies have shown 43 that high expression of miR-34 in autologous bone marrow mesenchymal stem cells can promote angiogenesis by targeting stem cell factor (SCF) in heart repair therapy. Downregulation of Let-7c improved cardiac function and reduced myocardial apoptosis and fibrosis, while c-kit + cardiac stem cells and Ki-67 + proliferating cells were not affected. These results are consistent with the results of our analysis 44 . We also used RT‒PCR to verify the expression changes of the components of the four groups of ceRNAs, showing that the Gm26794-miR21a-Plxnb3/Slc16a8, Gm26794-miR34b-Olfr1393/Slc16a8, Gm4544-miR21a-Plxnb3/Slc16a8 and Gm4544-miR34b-Olfr1393/Slc16a8 ceRNA networks are consistent with the analysis of the sequencing results. At present, there is no relevant literatuire report on this ceRNA network. This network will be an important part of our future experimental verification. Limitations of the study Because human cardiac tissue is difficult to obtain, we used myocardial tissue from mice to perform the above interventions and sequencing. However, due to the differences in species attributes, the adaptability in human tissues needs further experimental verification. Conclusion In conclusion, this study explored the molecular mechanism by which RE improves myocardial remodeling after AMI via whole-transcriptome sequencing and RT‒PCR. The results revealed that a large number of ncRNAs are involved in RE-mediated regulation of cardiac remodeling after AMI. Chemokine family genes play an important role in RE to improve cardiac remodeling, and miR21, miR34 and let-7c may play an important role in RE-mediated treatment of MI. The Gm26794-miR21a-Plxnb3/Slc16a8,Gm26794-miR34b-Olfr1393/Slc16a8,Gm4544-miR21a-Plxnb3/Slc16a8 and Gm4544-miR34b-Olfr1393/Slc16a8 ceRNA interaction networks may be involved in important mechanisms by which RE improves cardiac remodeling after AMI. These findings reveal the genomic complexity of post-MI RE effects and suggest potential new targets for their characterization. Materials and methods Establishment of an AMI mouse model Male C57BL/6 mice (8 weeks old, weighing 21-25g) were obtained from Wei Tong Li De Biotechnology Co. Ltd., and housed in cages under a controlled temperature of 25°C with a 12-hour light/dark cycle. They had ad libitum access to food and water. All animal experiments were conducted in accordance with the guidelines approved by the Ethics Committee of the Affiliated Hospital of Jining Medical University (2018B002). All animal care and experimental procedures were performed under the supervision of this committee. In addition, the experiments complied with the revised ARRIVE guidelines 2.0. The mice were anesthetized using continuous inhalation of 2% isoflurane, and myocardial infarction was induced as previously described [10]. Briefly, left thoracotomy was performed between the third and fourth intercostal spaces to expose the heart accurately. Subsequently, the heart was exteriorized, and in the AMI group, ligation of the left anterior descending artery (LAD)was achieved using a sterile 5/0 suture. After ligation, the mouse heart was repositioned within the chest cavity followed by immediate closure using 3 − 0 nylon sutures. The sham group only had thoracotomy without LAD ligation. Rehabilitation exercise (RE)intervention The MI model was successfully established in 24 mice. The AMI mice were randomly divided into two groups: the AMI + negative control (NC) group and the AMI + RE group. 30 days after modeling, RE intervention was administered to the mice. The AMI + NC group moved freely in the cage. The exercise intensity of the AMI + RE group was based on the Bedford training model standard [23] . The AMI + RE group underwent aerobic exercise treadmill adaptation training for 1 week: on the first two days, the treadmill slope was zero, the speed was 6 m/min, and the duration was 20 min/d. On the third and fourth days, the platform slope was 5 ཡ , the speed was 8 m/min, and the duration was 40 min/d. On the fifth and sixth days, the slope was 8 ཡ , the speed was 10 m/min, and the duration was 60 min/d. After adaptive training, exercise intensity at a slope 8 ཡ and a speed of 10 m/min was maintained for 60 min/d 6 days/week until sampling after anesthesia at the eighth week. Cardiac function measurement After the rehabilitation exercise of the two groups of mice, the cardiac diameter and function were measured using a high-resolution ultrasonic imaging system (Mindray M9Vet) before sampling. All mice were anesthetized with 2% isoflurane and fixed on a heating pad in a supine position. 2D echocardiography, M-mode echocardiography, and pulsed-wave Doppler echocardiography were used to measure the left ventricular internal dimension at end-diastolic (LVIDd) and LV internal diameter at end-systole (LVIDs). The LV thickness of the posterior wall at end-diastolic (LVPWd) was determined from the long-axis view at the level of the chordae tendineae. The percentage LV ejection fraction (LVEF) was calculated as 100 × [(LVIDd -LVIDs) /LVIDd]. The peak velocity of early (E) and late (A) ventricular filling velocity was obtained by the apical four-chamber view at the level of mitral valve flow. Hematoxylin and eosin (HE) staining and Masson staining Mice were euthanized by intraperitoneal injection of sodium pentobarbital (150mg/kg). After measuring the weight of the mice, the skin was cut near the sternum of the mice to separate the tissue and remove the heart, and its weight was measured. Mouse hearts were dissected and immediately fixed in 4% formalin. Tissue was paraffin embedded and sectioned (5 µm) for staining with HE. To examine the level of cardiac fibrosis, cardiac sections were stained using Masson's trichrome (Solarbio, G1340) in accordance with the instructions. The level of fibrosis was quantified by using Image J software. CD34 immunofluorescence staining The heart tissue slides were fixed with 4% formaldehyde, permeabilized using 0.3% Triton X-100, and blocked with 5% BSA. Following overnight incubation at 4°C with the indicated CD34 antibodies (diluted to 1:100), the slides were further incubated for 1 hour at room temperature with Alexa Fluor 594-conjugated secondary antibodies (diluted to 1:200). Subsequently, DAPI was employed for nuclear staining at room temperature for a duration of 10 minutes. The cells were visualized and captured utilizing the fluorescent confocal, and the obtained results were analyzed using Image J software. Whole-transcriptome sequencing Apical myocardial tissue was collected from mice subjected to exercise and those without exercise following myocardial infarction. Total RNA extraction from cardiac tissues was performed using TRIzol, ensuring high-quality total RNA from each sample for the construction of libraries intended for RNA-seq and small RNA sequencing. Paired-end sequencing on an Illumina Novaseq™ 6000 (LC Bio, China) was conducted according to the manufacturer's instructions. Library construction and sequencing were carried out at Jiespiral (Shanghai) Medical Technology Co., Ltd. Bioinformatics analysis The first step involves performing data quality control and preprocessing to obtain clean data for subsequent analysis. Subsequently, the RNA sequencing data is aligned to a reference sequence using HISAT2 software, followed by transcript assembly using StringTie software. After that, further analyses, such as differential expression screening, were carried out. Differentially expressed (DE) ncRNAs and mRNAs are shown in a cluster heatmap 1.0-fold or greater and an adjusted p value < 0.05 were selected as thresholds. Prediction of DE ncRNA target genes ENCORI ( https://starbase.sysu.edu.cn/ ) and DIANA-LncBase v3 ( https://diana.e-ce.uth.gr/lncbasev3/home ) were used to predict lncRNAs, circRNAs and mRNAs targeted by DE miRNAs, and the regulatory relationships of miRNA‒lncRNA, miRNA-circRNA and miRNA‒mRNA were obtained. The miRNA‒lncRNA, miRNA-circRNA and miRNA‒mRNA regulatory relationships for DE genes were obtained by integration with DE lncRNAs, DE circRNAs and DE mRNAs. Then, based on the coexpression analysis method of expression correlation, the Pearson correlation coefficient was used to predict the mRNAs that DE lncRNAs acted on, and the threshold was set to | r | > 0.9, p < 0.05. Finally, based on the locus relationship, the mRNAs that the DE circRNAs acted on were obtained. By integrating the above results, the DE lncRNA–DE mRNA and DE circRNA–DE mRNA relationship pairs were obtained. Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis GO and KEGG pathway analyses were applied to investigate the roles of all DE ncRNAs. GO analysis included terms in the biological process, molecular function and cellular component categories. The enriched GO terms and KEGG pathways for the DE ncRNAs between the two groups are presented ( http://www.geneontology.org ). KEGG pathway analysis was performed to explore the significant pathways of the DE genes ( https://www.genome.jp/kegg/ ). Protein–protein interaction (PPI) network and module analysis of DE mRNAs To further understand the interaction between the DE mRNA encoded proteins, the DE mRNAs were imported into String ( https://cn.string-db.org/ ), the species was set as Mus musculus, and the rest of the parameters were set as the default values. The results were imported into Cytoscape 3.9.1, and the significantly polymerized modules were screened by the plug-in MCODE, with a score > 10 as the screening threshold. For the GO-BP enrichment analysis module, p < 0.05 was the threshold value. Analysis of the ncRNA regulatory network To reveal the roles and interactions among ncRNAs and mRNAs in the pathophysiological process of RE ameliorating cardiac remodeling after MI, we constructed a ncRNA regulatory network. According to the obtained regulatory relationships of DE lncRNAs‒miRNAs, circRNAs-miRNAs and miRNAs‒mRNAs, the ncRNA regulatory network was constructed based on the ceRNA principle, and Cytoscape software was used for visualization. Quantitative real-time polymerase chain reaction (RT‒PCR) Total RNA was extracted from the heart tissues using TRIzol Reagent (Invitrogen). Isolated RNA was reverse-transcribed using a Script cDNA Synthesis Kit (Takara BIO, Otsu, Japan) according to the manufacturer’s instructions. The expression levels of lncRNAs and mRNAs were normalized to that of the reference gene β-actin, and those of miRNAs were normalized to that of U6. RT‒PCR was performed in a Bio-Rad CFX-96 System (Bio-Rad, Foster City, CA, USA) using Ultra SYBR Mixture. The relative expression levels of genes were calculated using the 2 ΔΔCT method. The primers are listed in Table 1. Statistical analysis The data are presented as the means ± SDs, and statistical analysis was performed using Fisher’s exact t test. P < 0.05 was considered to indicate statistical significance. Statistical analysis was performed using GraphPad Prism 9.0.0. (GraphPad Software, Inc, USA). Declarations Conflicts of interest The authors declare that they do not have any competing interests. Funding statement This work was supported by China Postdoctoral Science Foundation (71th Batch-2022M711321), National Natural Science Foundation Youth Fund (81700230), Shandong Province Key Project of TCM science and technology (Z-2022081), Key research and development plan in Jining City (2022YXNS003,2022YXNS071), Jining Medical University Research Fund for Academician Lin He New Medicine (JYHL2022FZD03). Author Contribution Lijun Gan and Xueying Chen designed the experimental plan. Mingrui Chen and Yugang Yan conducted biological analysis, Zhong xin Li, Nan Lin, Liangchun Ni , Yang Zhang, Haizhu Gao, Cuimei Guo, Xinxin Bian did the animal experiment and collected data. Nan Kan, Shaohui Zhang, Qingyun Zhang supervised data collection and provided intellectual expertise. Chen Xueying and Chen Mingrui prepared the manucript; All authors reviewed and edited the manuscript. Acknowledgement We would like to express our gratitude to Chuanpeng Zhang, a bioinformation engineer from the Medical Research Center at the Affiliated Hospital of Jining Medical valuable assistance in data analysis and visualization. Data Availability The whole-transcriptome High-throughput sequencing from the myocardial tissue of acute myocardial infarction and acute myocardial infarction+rehabilitation exercise mice have been deposited at Gene Expression Omnibus (GEO) with Super Series reference number GSE241919. Ethics statement This study was conducted under the guidelines of the Declaration of Helsinki. The study was approved by the ethics committee of Affiliated Hospital of Jining Medical University.(2018B002)The experiments complied with the revised ARRIVE guidelines 2.0. References Gulati, R. et al. Acute Myocardial Infarction in Young Individuals. Mayo Clin. Proc. 95 , 136–156. https://doi.org/10.1016/j.mayocp.2019.05.001 (2020). Schüttler, D., Clauss, S., Weckbach, L. T. & Brunner, S. Molecular Mechanisms of Cardiac Remodeling and Regeneration in Physical Exercise. Cells . 8 https://doi.org/10.3390/cells8101128 (2019). Bo, B. et al. The Molecular Mechanisms Associated with Aerobic Exercise-Induced Cardiac Regeneration. Biomolecules 11 (2020). https://doi.org/10.3390/biom11010019 Wang, H. et al. Exercise Prevents Cardiac Injury and Improves Mitochondrial Biogenesis in Advanced Diabetic Cardiomyopathy with PGC-1α and Akt Activation. Cell. Physiol. Biochem. 35 , 2159–2168. https://doi.org/10.1159/000374021 (2015). Lo Giudice, C., Pesole, G. & Picardi, E. High-Throughput Sequencing to Detect DNA-RNA Changes. Methods Mol. Biol. 2181 , 193–212. https://doi.org/10.1007/978-1-0716-0787-9_12 (2021). Ali, S. A., Peffers, M. J., Ormseth, M. J., Jurisica, I. & Kapoor, M. The non-coding RNA interactome in joint health and disease. Nat. Rev. Rheumatol. 17 , 692–705. https://doi.org/10.1038/s41584-021-00687-y (2021). Skóra, J. P. et al. Local intramuscular administration of ANG1 and VEGF genes using plasmid vectors mobilizes CD34 + cells to peripheral tissues and promotes angiogenesis in an animal model. Biomed. Pharmacother . 143 , 112186. https://doi.org/10.1016/j.biopha.2021.112186 (2021). Corrà, U. et al. Secondary prevention through cardiac rehabilitation: physical activity counselling and exercise training: key components of the position paper from the Cardiac Rehabilitation Section of the European Association of Cardiovascular Prevention and Rehabilitation. Eur. Heart J. 31 , 1967–1974. https://doi.org/10.1093/eurheartj/ehq236 (2010). Kitzman, D. W. et al. Physical Rehabilitation for Older Patients Hospitalized for Heart Failure. N Engl. J. Med. 385 , 203–216. https://doi.org/10.1056/NEJMoa2026141 (2021). Aliaga, J. et al. Preservation of Contractile Reserve and Diastolic Function by Inhibiting the NLRP3 Inflammasome with OLT1177(®) (Dapansutrile) in a Mouse Model of Severe Ischemic Cardiomyopathy Due to Non-Reperfused Anterior Wall Myocardial Infarction. Molecules . 26 https://doi.org/10.3390/molecules26123534 (2021). Lang, C. I. et al. [(68)Ga]-NODAGA-RGD Positron Emission Tomography (PET) for Assessment of Post Myocardial Infarction Angiogenesis as a Predictor for Left Ventricular Remodeling in Mice after Cardiac Stem Cell Therapy. Cells . 9 https://doi.org/10.3390/cells9061358 (2020). Dibben, G. O. et al. Exercise-based cardiac rehabilitation for coronary heart disease: a meta-analysis. Eur. Heart J. 44 , 452–469. https://doi.org/10.1093/eurheartj/ehac747 (2023). Mueller, S. et al. Effect of High-Intensity Interval Training, Moderate Continuous Training, or Guideline-Based Physical Activity Advice on Peak Oxygen Consumption in Patients With Heart Failure With Preserved Ejection Fraction: A Randomized Clinical Trial. Jama . 325 , 542–551. https://doi.org/10.1001/jama.2020.26812 (2021). Tucker, W. J. et al. Exercise for Primary and Secondary Prevention of Cardiovascular Disease: JACC Focus Seminar 1/4. J. Am. Coll. Cardiol. 80 , 1091–1106. https://doi.org/10.1016/j.jacc.2022.07.004 (2022). Frangogiannis, N. G. Regulation of the inflammatory response in cardiac repair. Circ. Res. 110 , 159–173. https://doi.org/10.1161/circresaha.111.243162 (2012). Prabhu, S. D. & Frangogiannis, N. G. The Biological Basis for Cardiac Repair After Myocardial Infarction: From Inflammation to Fibrosis. Circ. Res. 119 , 91–112. https://doi.org/10.1161/circresaha.116.303577 (2016). Sun, K., Li, Y. Y. & Jin, J. A double-edged sword of immuno-microenvironment in cardiac homeostasis and injury repair. Signal. Transduct. Target. Ther. 6 , 79. https://doi.org/10.1038/s41392-020-00455-6 (2021). Frangogiannis, N. G., Smith, C. W. & Entman, M. L. The inflammatory response in myocardial infarction. Cardiovasc. Res. 53 , 31–47. https://doi.org/10.1016/s0008-6363(01)00434-5 (2002). Nian, M., Lee, P., Khaper, N. & Liu, P. Inflammatory cytokines and postmyocardial infarction remodeling. Circ. Res. 94 , 1543–1553. https://doi.org/10.1161/01.RES.0000130526.20854.fa (2004). Agarwal, U. et al. Role of cardiac myocyte CXCR4 expression in development and left ventricular remodeling after acute myocardial infarction. Circ. Res. 107 , 667–676. https://doi.org/10.1161/circresaha.110.223289 (2010). Dong, F. et al. Myocardial CXCR4 expression is required for mesenchymal stem cell mediated repair following acute myocardial infarction. Circulation . 126 , 314–324. https://doi.org/10.1161/circulationaha.111.082453 (2012). Heinrichs, M. et al. The healing myocardium mobilizes a distinct B-cell subset through a CXCL13-CXCR5-dependent mechanism. Cardiovasc. Res. 117 , 2664–2676. https://doi.org/10.1093/cvr/cvab181 (2021). Liehn, E. A., Postea, O., Curaj, A. & Marx, N. Repair after myocardial infarction, between fantasy and reality: the role of chemokines. J. Am. Coll. Cardiol. 58 , 2357–2362. https://doi.org/10.1016/j.jacc.2011.08.034 (2011). Golpanian, S., Wolf, A., Hatzistergos, K. E. & Hare, J. M. Rebuilding the Damaged Heart: Mesenchymal Stem Cells, Cell-Based Therapy, and Engineered Heart Tissue. Physiol. Rev. 96 , 1127–1168. https://doi.org/10.1152/physrev.00019.2015 (2016). Penn, M. S., Pastore, J., Miller, T. & Aras, R. SDF-1 in myocardial repair. Gene Ther. 19 , 583–587. https://doi.org/10.1038/gt.2012.32 (2012). Xiang, F. L., Lu, X., Liu, Y. & Feng, Q. Cardiomyocyte-specific overexpression of human stem cell factor protects against myocardial ischemia and reperfusion injury. Int. J. Cardiol. 168 , 3486–3494. https://doi.org/10.1016/j.ijcard.2013.04.165 (2013). Hedayati-Moghadam, M. et al. The Role of Chemokines in Cardiovascular Diseases and the Therapeutic Effect of Curcumin on CXCL8 and CCL2 as Pathological Chemokines in Atherosclerosis. Adv. Exp. Med. Biol. 1328 , 155–170. https://doi.org/10.1007/978-3-030-73234-9_11 (2021). Shen, S. C. et al. Macrophages promote the transition from myocardial ischemia reperfusion injury to cardiac fibrosis in mice through GMCSF/CCL2/CCR2 and phenotype switching. Acta Pharmacol. Sin . 45 , 959–974. https://doi.org/10.1038/s41401-023-01222-3 (2024). Wang, W. et al. Chemokine CCL2 promotes cardiac regeneration and repair in myocardial infarction mice via activation of the JNK/STAT3 axis. Acta Pharmacol. Sin . 45 , 728–737. https://doi.org/10.1038/s41401-023-01198-0 (2024). Dobaczewski, M., Xia, Y., Bujak, M., Gonzalez-Quesada, C. & Frangogiannis, N. G. CCR5 signaling suppresses inflammation and reduces adverse remodeling of the infarcted heart, mediating recruitment of regulatory T cells. Am. J. Pathol. 176 , 2177–2187. https://doi.org/10.2353/ajpath.2010.090759 (2010). Liu, J. et al. Intramyocardial injected human umbilical cord-derived mesenchymal stem cells (HucMSCs) contribute to the recovery of cardiac function and the migration of CD4(+) T cells into the infarcted heart via CCL5/CCR5 signaling. Stem Cell. Res. Ther. 13 , 247. https://doi.org/10.1186/s13287-022-02914-z (2022). Sakaguchi, S., Yamaguchi, T., Nomura, T. & Ono, M. Regulatory T cells and immune tolerance. Cell . 133 , 775–787. https://doi.org/10.1016/j.cell.2008.05.009 (2008). Zamilpa, R. et al. CC chemokine receptor 5 deletion impairs macrophage activation and induces adverse remodeling following myocardial infarction. Am. J. Physiol. Heart Circ. Physiol. 300 , H1418–1426. https://doi.org/10.1152/ajpheart.01002.2010 (2011). Legler, D. F. & Thelen, M. New insights in chemokine signaling. F1000Res . 7 , 95. https://doi.org/10.12688/f1000research.13130.1 (2018). Sotsios, Y. & Ward, S. G. Phosphoinositide 3-kinase: a key biochemical signal for cell migration in response to chemokines. Immunol. Rev. 177 , 217–235. https://doi.org/10.1034/j.1600-065x.2000.17712.x (2000). Ghigo, A., Laffargue, M., Li, M. & Hirsch, E. PI3K and Calcium Signaling in Cardiovascular Disease. Circ. Res. 121 , 282–292. https://doi.org/10.1161/circresaha.117.310183 (2017). Vega, R. B., Konhilas, J. P., Kelly, D. P. & Leinwand, L. A. Molecular Mechanisms Underlying Cardiac Adaptation to Exercise. Cell. Metab. 25 , 1012–1026. https://doi.org/10.1016/j.cmet.2017.04.025 (2017). Qin, G. W., Lu, P., Peng, L. & Jiang, W. Ginsenoside Rb1 Inhibits Cardiomyocyte Autophagy via PI3K/Akt/mTOR Signaling Pathway and Reduces Myocardial Ischemia/Reperfusion Injury. Am. J. Chin. Med. 49 , 1913–1927. https://doi.org/10.1142/s0192415x21500907 (2021). Yu, P., Ma, S., Dai, X. & Cao, F. Elabela alleviates myocardial ischemia reperfusion-induced apoptosis, fibrosis and mitochondrial dysfunction through PI3K/AKT signaling. Am. J. Transl Res. 12 , 4467–4477 (2020). Cheng, S. et al. Astragaloside IV exerts angiogenesis and cardioprotection after myocardial infarction via regulating PTEN/PI3K/Akt signaling pathway. Life Sci. 227 , 82–93. https://doi.org/10.1016/j.lfs.2019.04.040 (2019). Han, X. et al. Buyang Huanwu Decoction promotes angiogenesis in myocardial infarction through suppression of PTEN and activation of the PI3K/Akt signalling pathway. J. Ethnopharmacol. 287 , 114929. https://doi.org/10.1016/j.jep.2021.114929 (2022). Li, Y. et al. Injectable hydrogel with MSNs/microRNA-21-5p delivery enables both immunomodification and enhanced angiogenesis for myocardial infarction therapy in pigs. Sci. Adv. 7 https://doi.org/10.1126/sciadv.abd6740 (2021). Kang, H. J. et al. Involvement of miR-34c in high glucose-insulted mesenchymal stem cells leads to inefficient therapeutic effect on myocardial infarction. Cell. Signal. 27 , 2241–2251. https://doi.org/10.1016/j.cellsig.2015.07.024 (2015). Tolonen, A. M. et al. Inhibition of Let-7 microRNA attenuates myocardial remodeling and improves cardiac function postinfarction in mice. Pharmacol. Res. Perspect. 2 , e00056. https://doi.org/10.1002/prp2.56 (2014). Table 1 Table 1: The primer squence of RT-PCR. Primer Species Sequence(5'→3') Tm(℃) Ppp1r1b mouse F:GATTCAGTTCTCTGTGCCCGC 60.0 R:TTGGGTCTCTTCGACTTTGGG Olfr1393 mouse F:TTGGCTATTGCTTCCTGGGTA 60.0 R:CACTGCAACAATCACCACTC Plxnb3 mouse F:AGCCTACTTCTGCGATTCTGG 60.0 R:AATCCCGGCCCACTTTATGC Slc16a8 mouse F:GCTCTCAACTTCCAGCCGTC 60.0 R:ACAGCATGGACAGAAACACG Gm26794 mouse F:GCTGATCCCTGGTCTTGTCCTTC 60.0 R:AGCCTGTTTTATCAGATTGCCAAC Gm4544 mouse F:CACAAAGCTCGAACCCATGTAA 60.0 R:GGGAGGTGTAGACCGTAGCA miR-34b mouse F:ACACGCAGGCAGTGTAATTAGCT 60.0 R:TATGCTTGTTCTCGTCTCTGTGTC miR-21a mouse F:ACGTTGTGTAGCTTATCAGACTG 60.0 R:AATGGTTGTTCTCCACACTCTC miR-U6 mouse F:CAGCACATATACTAAAATTGGAACG 60.0 R:ACGAATTTGCGTGTCATCC Actin mouse F:GGCTGTATTCCCCTCCATCG 60.0 R:CCAGTTGGTAACAATGCCATGT Additional Declarations No competing interests reported. Supplementary Files 1SupplymentTable1DifferentialexpressionmRNAFig5AE.xlsx 2SupplymentTable2DifferentialexpressionlncRNAFig5BF.xlsx 3SupplymentTable3DifferentialexpressionmiRNAFig5CG.xlsx 4SupplymentTable4DifferentialexpressioncircRNAFig5DH.xlsx 5SupplymentTable5DifferentiallyexpressedmRNAGOanalysisFig6ABC.xlsx 6SupplymentTable6KEGGanalysisofdifferentiallyexpressedmRNAFig6D.xlsx 7SupplymentTable7mRNAPPIanalysismcode1Fig7A.xlsx 8SupplymentTable8mRNAPPIanalysismcode2Fig7B.xlsx 9SupplymentTable9mRNAPPIanalysismcode3Fig7C.xlsx 10SupplymentTable10Mcode123GOAnalysisFig7D.xlsx 11SupplymentTable11lncRNAKEGGanalysisFig8A.xlsx 12SupplymentTable12miRNAKEGGanalysisFig8B.xlsx 13SupplymentTable13circRNAKEGGanalysisFig8C.xlsx 14SupplymentTable14NoncodingRNAmRNAnetworkFig9Fig10A.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4865745","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":359689928,"identity":"56c9814f-e86d-4969-af0a-0175f1d2de9b","order_by":0,"name":"Xueying Chen","email":"","orcid":"","institution":"Shandong Provincial Key Medical and Health Discipline of Cardiology ( Affiliated Hospital of Jining Medical University)","correspondingAuthor":false,"prefix":"","firstName":"Xueying","middleName":"","lastName":"Chen","suffix":""},{"id":359689929,"identity":"bde4b1c3-3a67-4b1d-8d27-2d3cbf61c187","order_by":1,"name":"Mingrui Chen","email":"","orcid":"","institution":"Affiliated Hospital of Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mingrui","middleName":"","lastName":"Chen","suffix":""},{"id":359689931,"identity":"d4bde656-a1bf-4ee6-a0e6-dfdbd6bc3990","order_by":2,"name":"Zhongxin Li","email":"","orcid":"","institution":"Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhongxin","middleName":"","lastName":"Li","suffix":""},{"id":359689933,"identity":"abb8527c-fb99-49df-a478-1ed600d9b181","order_by":3,"name":"Yugang Yan","email":"","orcid":"","institution":"Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yugang","middleName":"","lastName":"Yan","suffix":""},{"id":359689934,"identity":"90dd89ac-5325-43c2-9e7c-4c188ca1f830","order_by":4,"name":"Nan Lin","email":"","orcid":"","institution":"Affiliated Hospital of Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Nan","middleName":"","lastName":"Lin","suffix":""},{"id":359689935,"identity":"28df23d5-9a04-42c6-abb0-8e3f5782f977","order_by":5,"name":"Liangchun Ni","email":"","orcid":"","institution":"Affiliated Hospital of Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Liangchun","middleName":"","lastName":"Ni","suffix":""},{"id":359689936,"identity":"2c9dfb49-049c-494c-90fa-0bc2b5dacd75","order_by":6,"name":"Yang Zhang","email":"","orcid":"","institution":"Affiliated Hospital of Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Zhang","suffix":""},{"id":359689937,"identity":"7290c065-f281-4f8c-9d4c-8ac7d88d320a","order_by":7,"name":"Nan Kang","email":"","orcid":"","institution":"Postdoctoral Mobile Station of Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Nan","middleName":"","lastName":"Kang","suffix":""},{"id":359689938,"identity":"e5b8eaf2-49c6-4b2a-871b-cbc923e4d9de","order_by":8,"name":"Haizhu Gao","email":"","orcid":"","institution":"Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Haizhu","middleName":"","lastName":"Gao","suffix":""},{"id":359689941,"identity":"90177df2-bc60-48cd-9bfc-793b4a75436d","order_by":9,"name":"Cuimei Guo","email":"","orcid":"","institution":"Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Cuimei","middleName":"","lastName":"Guo","suffix":""},{"id":359689942,"identity":"b50a7cd0-2b2a-45ca-a2b5-0c56f55aec22","order_by":10,"name":"Xinxin Bian","email":"","orcid":"","institution":"Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xinxin","middleName":"","lastName":"Bian","suffix":""},{"id":359689943,"identity":"5bf73d11-13b5-40e8-ad3a-3a6caf4d9323","order_by":11,"name":"Shaohui Zhang","email":"","orcid":"","institution":"Affiliated Hospital of Jining Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shaohui","middleName":"","lastName":"Zhang","suffix":""},{"id":359689946,"identity":"20eff389-8c2d-44ea-afb0-42f04b4f256f","order_by":12,"name":"Qingyun Zhang","email":"","orcid":"","institution":"Shandong Provincial Key Medical and Health Discipline of Cardiology ( Affiliated Hospital of Jining Medical University)","correspondingAuthor":false,"prefix":"","firstName":"Qingyun","middleName":"","lastName":"Zhang","suffix":""},{"id":359689948,"identity":"e04fe0db-c7ee-4eac-81ac-79e625612e7e","order_by":13,"name":"Lijun Gan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYBACxgbGBww8YCbzASAhIUOEFmYDkBYJBga2BJAWHiLsgWvhMQBxCWthnpHMJvGmwq6OX/rMx0c3aix4GNjPHsDvMKAWyTlnkiUk+3I3G+ccAzqMJy+BgJb8Y9K8bQckDM7wbpPOYQNqkYC4EK8tUC08z3/n/CNRCxtzbhsxWnoeM1sC/SI5s4fNWDq3T4KHjScHvxbD9mTGG8AQ4+fnYX74OedbnRw/+xkCWiYksEigiLDhVQ8E8vwHmD8QUjQKRsEoGAUjHAAAJvI50fJuUGQAAAAASUVORK5CYII=","orcid":"","institution":"Shandong Provincial Key Medical and Health Discipline of Cardiology ( Affiliated Hospital of Jining Medical University)","correspondingAuthor":true,"prefix":"","firstName":"Lijun","middleName":"","lastName":"Gan","suffix":""}],"badges":[],"createdAt":"2024-08-06 05:40:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4865745/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4865745/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":66949357,"identity":"8c44e4fb-d6eb-4b6c-af72-33e148d1efde","added_by":"auto","created_at":"2024-10-18 10:04:35","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1312116,"visible":true,"origin":"","legend":"\u003cp\u003eThe flow chart of the molecular experiment and the approach to biological information analysis employed in this study.\u003c/p\u003e\n\u003cp\u003eLVIDd: left ventricular internal dimension at end-diastolic, LVIDs:left ventricular internal dimension at end-systole; LVEF:left ventricular ejection fraction, DE: differentially expressed, GO: Gene Ontology, KEGG: Kyoto Encyclopedia of Genes and Genomes, PPI: Protein-Protein Interaction, HE: Hematoxylin-Eosin staining.\u003c/p\u003e","description":"","filename":"Figure1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/0e025aa015c3651ae38e027f.jpg"},{"id":66950854,"identity":"faca64df-d783-46ef-8412-ecf5d9cda232","added_by":"auto","created_at":"2024-10-18 10:20:35","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":532124,"visible":true,"origin":"","legend":"\u003cp\u003eEvidence supporting the construction of a model for acute myocardial infarction\u003c/p\u003e\n\u003cp\u003eA. Electrocardiogram changes pre- and post-ligation of the left anterior descending artery (LAD). Pre-LAD ligation:Normal electrocardiogram; Post-LAD ligation:Electrocardiogram post-ligation of LAD; B. The morphological changes of the heart following myocardial infarction; C. The ratio of heart weight (HW, mg ) to body weight (BW, g ) decreased in the AMI group; D. The echocardiographic measurements of mouse hearts include representative B-mode, M-mode, and pulsed-wave Doppler (PW-mode) echocardiograms one month post-myocardial infarction; E-G. Quantitative analysis of left ventricular posterior wall thickness (LVPWd), left ventricular internal dimension in diastole (LVIDd) and the left ventricular ejection fraction (LVEF) . Control: control group mice, AMI: acute myocardial infarction group mice. BW:body weight, HW:heart weight. The data are the mean±SD. **p \u0026lt;0.01 compared with Control. ***p \u0026lt;0.001 compared with Control.\u003c/p\u003e","description":"","filename":"Figure2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/3828c0c5a6d70835ae3d1721.jpg"},{"id":66949410,"identity":"7a9c0e23-92fc-4364-a32e-a0b64caab980","added_by":"auto","created_at":"2024-10-18 10:04:41","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":474835,"visible":true,"origin":"","legend":"\u003cp\u003eRE improves cardiac structure and function after MI\u003c/p\u003e\n\u003cp\u003eA.Echocardiographic measurements of mouse hearts: representative B-mode, M-mode and pulsed-wave Doppler (PW-mode) echocardiograms; B. Quantitative analysis of LVPWd; C. Quantitative analysis of LVIDd; D. Quantitative analysis of LVEF. E. The ratio of heart weight (HW) to body weight (BW) in the AMI+NC and AMI+RE group. The data are the mean±SD.\u003c/p\u003e\n\u003cp\u003e*p \u0026lt;0.05 compared with AMI + NC, **p \u0026lt;0.01 compared with AMI + NC.\u003c/p\u003e","description":"","filename":"Figure3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/4f89e183873f7f957ec7b819.jpg"},{"id":66950420,"identity":"6f2734d3-7fc9-42c9-af52-baba98121cbd","added_by":"auto","created_at":"2024-10-18 10:12:35","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1451845,"visible":true,"origin":"","legend":"\u003cp\u003eRE improves myocardial remodeling after myocardial infarction (MI)\u003c/p\u003e\n\u003cp\u003eA.AMI+NC and AMI+RE mouse heart HE staining; B. AMI+NC and AMI+RE mouse heart Masson staining; C. Quantification of Masson staining area in mouse heart. D. Immunofluorescence of CD34 in the myocardium of the mouse; blue is the nucleus stained with DAPI, and red is CD34. E. Quantitative analysis the percentage of CD34+ area . The data are the mean±SD. **p \u0026lt;0.01 compared with AMI + NC.\u003c/p\u003e","description":"","filename":"Figure4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/1185b3fc1c00075d87d2f2a2.jpg"},{"id":66948618,"identity":"b6b9975b-1f20-42a6-8e04-83c72f4705d5","added_by":"auto","created_at":"2024-10-18 09:56:36","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1011869,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential expression (DE) analysis of mRNAs, lncRNAs, miRNAs, circRNA\u003c/p\u003e\n\u003cp\u003eThe DE mRNAs heatmap (A) and volcano plot (E) comparisons between the AMI+NC and AMI+RE groups. The DE lncRNAs heatmap (B)and volcano plot (F) comparisons between the AMI+NC and AMI+RE groups. The DE siRNAs heatmap (C) and volcano plot (G) comparisons between the AMI+NC and AMI+RE groups. The DE circRNAs heatmap (D) and volcano plot (H) comparisons between the AMI+NC and AMI+RE groups.\u003c/p\u003e","description":"","filename":"Figure5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/924327978b7069e678e695b4.jpg"},{"id":66948616,"identity":"1d8c7eb9-2afd-4162-8e82-77989d77a23b","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":884189,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of GO and KEGG pathways of the DE mRNAs\u003c/p\u003e\n\u003cp\u003eA.Top 20 GO biological process terms enriched for DE mRNAs; B. Top 20 GO cellular component terms enriched for DE mRNAs; C. Top 20 GO molecular function terms enriched for DE mRNAs; D.Top 20 KEGG pathways enriched for DE mRNAs. GO: Gene Ontology, BP: Biological Process, CC: Cellular Component, MF: molecular function, and KEGG: Kyoto Encyclopedia of Genes and Genomes.\u003c/p\u003e","description":"","filename":"Figure6.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/b08530b9c0060b4623cdd120.jpg"},{"id":66948611,"identity":"69ba0100-71e8-457d-81e6-36a2b7beb83e","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":722296,"visible":true,"origin":"","legend":"\u003cp\u003eThree modules extracted from the PPI network and GO biological process enrichment analysis\u003c/p\u003e\n\u003cp\u003eA-C. Significant clustered modules from the PPI network. Yellow prisms indicate upregulated genes. and the larger the node, the higher the degree; D. Top 10 GO biological process terms enriched for genes in those three modules.\u003c/p\u003e","description":"","filename":"Figure7.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/3b9eac88511a8f88c683cafc.jpg"},{"id":66950857,"identity":"de3c0cb7-f81d-4f65-bc22-ad2521a70c49","added_by":"auto","created_at":"2024-10-18 10:20:35","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":676040,"visible":true,"origin":"","legend":"\u003cp\u003eBubble diagram of KEGG enrichment analysis of DE ncRNAs\u003c/p\u003e\n\u003cp\u003eA. DE lncRNA enrichment signaling pathway; B. DE miRNA enrichment signaling pathway; C. DE circRNA enrichment signaling pathway.\u003c/p\u003e","description":"","filename":"Figure8.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/0ed550c102865acd5a930c0c.jpg"},{"id":66949362,"identity":"fc98b74d-becc-4ea1-8d25-8a8dfde894df","added_by":"auto","created_at":"2024-10-18 10:04:35","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":624833,"visible":true,"origin":"","legend":"\u003cp\u003eLncRNA‒miRNA-mRNA and circRNA-miRNA‒mRNA networks\u003c/p\u003e\n\u003cp\u003eThe blue V represents a downregulated lncRNA, the purple triangle signifies an upregulated circRNA, the gray blue indicates a downregulated circRNA, the red diamond denotes an upregulated miRNA, the green diamond represents a downregulated miRNA, the yellow circle symbolizes an upregulated mRNA, and the green circle signifies an mRNA.\u003c/p\u003e","description":"","filename":"Figure9.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/7181703513229b5d77602640.jpg"},{"id":66950855,"identity":"e5303baf-1edf-4dbd-97e2-36d86f04a97f","added_by":"auto","created_at":"2024-10-18 10:20:35","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":474634,"visible":true,"origin":"","legend":"\u003cp\u003eValidation of RNA expression in the ceRNA network\u003c/p\u003e\n\u003cp\u003eA.The Sankey diagram of lncRNA-miRNA-mRNA Network verified by RT-PCR. B. DE lncRNA expression relative to β-actin. C. DE miRNA expression relative to U6; D. DE mRNA expression relative to β-actin; The data are the mean±SD. *P\u0026lt;0.05. P values were calculated by using Fisher’s exact t test.\u003c/p\u003e","description":"","filename":"Figure10.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/52e1fe807b1c0931d7be65de.jpg"},{"id":78329763,"identity":"2b6317a1-a3e0-4b6b-b518-567dbb8c93f0","added_by":"auto","created_at":"2025-03-12 07:02:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9387709,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/c9b4ebd6-8384-45ab-983a-2e2e3e031d03.pdf"},{"id":66948592,"identity":"c81f5d70-83a5-40ec-a441-9cfc7cc293bd","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":145088,"visible":true,"origin":"","legend":"","description":"","filename":"1SupplymentTable1DifferentialexpressionmRNAFig5AE.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/8aae3cae3f24d91091950d27.xlsx"},{"id":66950416,"identity":"bcfa4202-7931-4a10-8b85-f58535f60dfb","added_by":"auto","created_at":"2024-10-18 10:12:35","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":21465,"visible":true,"origin":"","legend":"","description":"","filename":"2SupplymentTable2DifferentialexpressionlncRNAFig5BF.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/dbee4c812f556b4e772e11cd.xlsx"},{"id":66948599,"identity":"7016a485-fa28-42e8-aac7-f1357f643673","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":12465,"visible":true,"origin":"","legend":"","description":"","filename":"3SupplymentTable3DifferentialexpressionmiRNAFig5CG.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/2a96a351a0220622d5a6e3fd.xlsx"},{"id":66950417,"identity":"f1189311-5612-4d07-b162-47a372a5d842","added_by":"auto","created_at":"2024-10-18 10:12:35","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":28498,"visible":true,"origin":"","legend":"","description":"","filename":"4SupplymentTable4DifferentialexpressioncircRNAFig5DH.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/0b0b1e9fd3855232e97e3064.xlsx"},{"id":66948615,"identity":"d728b2d3-e8bc-43a1-858d-49dade6ebe00","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":193769,"visible":true,"origin":"","legend":"","description":"","filename":"5SupplymentTable5DifferentiallyexpressedmRNAGOanalysisFig6ABC.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/a574716b0f966a1cf142f433.xlsx"},{"id":66948617,"identity":"1605342c-aa11-4e19-97be-104ff4efaf72","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":12582,"visible":true,"origin":"","legend":"","description":"","filename":"6SupplymentTable6KEGGanalysisofdifferentiallyexpressedmRNAFig6D.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/033daabd422f3180be4027ab.xlsx"},{"id":66949359,"identity":"b4be84b1-c3df-4c53-a5a5-21da00457024","added_by":"auto","created_at":"2024-10-18 10:04:35","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":15203,"visible":true,"origin":"","legend":"","description":"","filename":"7SupplymentTable7mRNAPPIanalysismcode1Fig7A.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/d2c3bf05c416fce932a350df.xlsx"},{"id":66951932,"identity":"2d33a6e1-c2ca-4d43-94c8-e8d34ae10044","added_by":"auto","created_at":"2024-10-18 10:28:35","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":16298,"visible":true,"origin":"","legend":"","description":"","filename":"8SupplymentTable8mRNAPPIanalysismcode2Fig7B.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/1c5edbc57bc4b64b4214dc2f.xlsx"},{"id":66950419,"identity":"9c657ee1-e22c-4b74-ba01-11e17d2eae68","added_by":"auto","created_at":"2024-10-18 10:12:35","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":15566,"visible":true,"origin":"","legend":"","description":"","filename":"9SupplymentTable9mRNAPPIanalysismcode3Fig7C.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/075b5c2bd77a262881c6cd6b.xlsx"},{"id":66950421,"identity":"7eecae7c-e2b0-4c8d-b60b-2f69f5a76019","added_by":"auto","created_at":"2024-10-18 10:12:35","extension":"xlsx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":175019,"visible":true,"origin":"","legend":"","description":"","filename":"10SupplymentTable10Mcode123GOAnalysisFig7D.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/ead7f95b35760ee97af9b4c6.xlsx"},{"id":66949367,"identity":"096d0fec-e42f-4c94-967e-fbfebc72f089","added_by":"auto","created_at":"2024-10-18 10:04:35","extension":"xlsx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":13161,"visible":true,"origin":"","legend":"","description":"","filename":"11SupplymentTable11lncRNAKEGGanalysisFig8A.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/4e9ec98dca6dcb66077b99b9.xlsx"},{"id":66948604,"identity":"6cf977d5-e0e9-4421-9b89-21bfe83dc346","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"xlsx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":13060,"visible":true,"origin":"","legend":"","description":"","filename":"12SupplymentTable12miRNAKEGGanalysisFig8B.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/d3434bfa05c53c3f296b3492.xlsx"},{"id":66948614,"identity":"68e046c5-dbb1-4214-a1b8-477db0191b2f","added_by":"auto","created_at":"2024-10-18 09:56:35","extension":"xlsx","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":11375,"visible":true,"origin":"","legend":"","description":"","filename":"13SupplymentTable13circRNAKEGGanalysisFig8C.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/a713d06825dfef074b8196be.xlsx"},{"id":66950424,"identity":"41a4f83e-4841-4759-b384-8fd0dc8366ba","added_by":"auto","created_at":"2024-10-18 10:12:35","extension":"xlsx","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":11691,"visible":true,"origin":"","legend":"","description":"","filename":"14SupplymentTable14NoncodingRNAmRNAnetworkFig9Fig10A.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4865745/v1/8c5fc955c5cbff04c9b4ec80.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Comprehensive analysis of the cardiac whole-transcriptome expression profiling involved in rehabilitation exercise improving myocardial remodeling after acute myocardial infarction","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAcute myocardial infarction (AMI) is a prevalent clinical emergency, with its worldwide incidence rapidly increasing and affecting younger populations\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Despite significant advancements in medical, interventional, and surgical treatments for cardiovascular diseases (CVD) in recent years, there remains a substantial number of patients who experience heart failure following acute myocardial infarction (AMI), imposing a considerable burden on both families and society. Rehabilitation exercise (RE) has emerged as a promising strategy for mitigating the development and progression of CVD, while concurrently enhancing cardiac function among heart failure patients\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Previous studies have demonstrated that the pathophysiological basis underlying the beneficial effects of RE on cardiac remodeling after AMI involves the activation of signaling pathways, modulation of cardiac cellular metabolism, and mitochondrial adaptation\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. However, the precise mechanisms responsible for RE-mediated improvement in cardiac remodeling following AMI remain to be fully elucidated. Given that most patients with post-AMI heart failure experience limited mobility, there is an urgent need for studies focused on identifying novel therapeutic targets for exercise-induced cardioprotection and evaluating the efficacy of resistance exercise.\u003c/p\u003e \u003cp\u003eIn recent decades, there has been rapid advancement in high-quality deep RNA sequencing technology, enabling the acquisition of extensive biological and medical information within a short time frame\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. A growing number of noncoding RNAs (ncRNAs), which constitute the majority of the transcriptome, have been discovered. Based on their size, ncRNAs can be categorized into microRNAs (miRNAs), long noncoding RNAs (lncRNAs), and circular RNAs (circRNAs). An increasing body of evidence suggests that these noncoding transcripts exert significant regulatory effects through epigenetic, posttranscriptional, and translational mechanisms, thereby exerting substantial influence on key biological processes such as inflammation, cell proliferation, and dysregulation of the extracellular matrix\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Consequently, ncRNAs have emerged as promising diagnostic candidates and potential therapeutic targets for a wide range of diseases including cardiovascular disorders. In addition, ncRNAs play important roles in RE regulation of cardiac remodeling after AMI. Studies have identified lncRNAs that contribute to the modulation of exercise-induced cardiac growth, termed cardiac physiological hypertrophy-associated regulators, providing new insights into the regulation of this cardiac growth process. However, the regulatory functions of ncRNAs in RE-mediated regulation of cardiac remodeling after AMI and their underlying mechanisms have not been systematically described. Thus, comprehensive forecasting and analysis of the ncRNAs underlying RE-mediated regulation of cardiac remodeling after AMI are essential to generate targets for evaluating the effectiveness of RE and achieving exercise-induced cardioprotective effects.\u003c/p\u003e \u003cp\u003eAs the changes in ncRNA expression and the potential lncRNA\u0026ndash;circRNA\u0026ndash;miRNA‒mRNA network remain unclear in RE regulating cardiac remodeling after AMI, the present study analyzed ncRNA expression in AMI mice with or without RE by whole-transcriptome sequencing. Furthermore, we employed bioinformatics analysis methods to screen and analyze the differential expression profiles of ncRNAs, subsequently constructing a regulatory network of ncRNAs and mRNAs based on the competing endogenous RNA (ceRNA) theory. The primary aim of this study was to augment the theoretical foundation for elucidating the roles of ncRNAs in RE-mediated regulation of cardiac remodeling following AMI.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eThe flow chart of the study\u003c/h2\u003e\n \u003cp\u003eThis study utilizes mice to create a myocardial infarction model. Following successful construction, the RE is administered. Subsequent to the completion of RE, myocardial tissue samples are collected for high-throughput sequencing of the entire transcription. Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e illustrates the flow chart of the molecular experiment and the approach to biological information analysis employed in this study.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eConstruction of a model for acute myocardial infarction\u003c/h2\u003e\n \u003cp\u003eThe MI model was established by ligating the mice\u0026apos;s LAD. Following LAD ligation, Electrocardiogram results indicated elevated and distorted QRS complexes, along with ST-segment depression (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). The mouse hearts were promptly acquired after ligation. The ischemic myocardium at the apex displays a pallid hue (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). Echocardiography was used to assess the cardiac function of mice one month after myocardial infarction. The echocardiographic measurements of mouse hearts include representative B-mode, M-mode, and pulsed-wave Doppler (PW-mode) echocardiograms See the Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD; Quantitative analysis showed that: in comparison to the control group, LVPWd and LVEF decreased, LVIDd increased in the AMI group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE-G). Additionally, the ratio of heart weight (HW) to body weight (BW) decreased in the AMI group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eRE improves cardiac structure and function after MI\u003c/h2\u003e\n \u003cp\u003eRehabilitation exercise was initiated 1 month post-myocardial infarction, followed by an 8-week period of RE. A high-resolution ultrasonic imaging system was utilized to measure LVIDd, LVPWd, and LVEF, with typical images presented in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA. Compared to the AMI\u0026thinsp;+\u0026thinsp;NC group, LVPWd showed no statistically significant differences (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB), while LVIDd decreased (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC), LVEF increased (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD) in the AM I\u0026thinsp;+\u0026thinsp;RE group. And the ratio of HW to BW decreased in the AMI\u0026thinsp;+\u0026thinsp;RE group, but did not reach statistical significance (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eRE improves myocardial remodeling after MI\u003c/h2\u003e\n \u003cp\u003eTo investigate the impact of exercise on myocardial remodeling in mice following AMI, we observed the effect of RE on myocardial fibrosis and angiogenesis after myocardial infarction. HE staining demonstrated a significant reduction in enlarged cardiac chambers with exercise intervention (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). Masson staining illustrated that exercise intervention attenuated AMI-induced fibrosis, as depicted in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB-C. To investigate the impact of RE on myocardial angiogenesis, we employed CD34 immunofluorescence to assess neovascularization levels\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. CD34 is specifically expressed in neovascular endothelial cells and serves as a marker for neovascularization. In comparison to the control group, the AMI\u0026thinsp;+\u0026thinsp;RE group exhibited a significant increase in CD34-positive staining (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), as depicted in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD-E.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eDifferential expression (DE) analysis of mRNAs, lncRNAs, miRNAs, circRNAs\u003c/h2\u003e\n \u003cp\u003eWe analysis the differential expression of mRNAs, lncRNAs, miRNAs, circRNAs in the myocardial tissue samples of AMI\u0026thinsp;+\u0026thinsp;RE group compared to AMI\u0026thinsp;+\u0026thinsp;NC group. Heatmaps with | log2FC | \u0026gt; 1 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and volcano maps with | log2FC | \u0026gt; 2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) were generated to visualize the overall distribution of DEmRNAs, DElncRNAs, DEmiRNAs, and DEcircRNAs (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). According to the screening criteria, a total of 1028 DE mRNAs were obtained, among which 696 were upregulated and 332 were downregulated(Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE and Supplementary Table 1). One hundred DE lncRNAs were identified, 59 of which were upregulated and 41 of which were downregulated(Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eF and Supplementary Table 2). A total of 14 DE miRNAs were obtained, among which 10 were upregulated and 4 were downregulated(Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eG and Supplementary Table 3. A total of 131 DE circRNAs were found, of which 116 were upregulated and 15 were downregulated(Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eH and Supplementary Table 4).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eFunctional enrichment analysis of DE mRNA\u003c/h2\u003e\n \u003cp\u003eTo further investigate the biological functions of the differentially expressed mRNAs, we performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. The top 20 terms with the smallest p-values in the GO analysis, which includes classifications for biological process, cellular component, and molecular function, as well as the KEGG enrichment analysis, were visualized using a bubble plot (as shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA-C and supplyment table 5). Specifically, terms such as negative regulation of immune system process and leukocyte migration were identified in the biological process category (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA), while apical part of cell and membrane raft were highlighted in the cellular component category (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB). Additionally, receptor ligand activity and metal ion transmembrane transporter activity were observed in the molecular function category (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC). KEGG pathway analysis revealed associations of the differentially expressed mRNAs with pathways such as cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, and MAPK signaling pathway (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD and supplyment table 6 ).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003ePPI and significant cluster module analysis of DE mRNAs\u003c/h2\u003e\n \u003cp\u003eThe PPI network of DE mRNAs consists of 891 nodes and 5184 edges. According to the criteria of scoring more than 10, three subnetworks were selected using MCODE of Cytoscape (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA and supplement table 7). The genes in these three subnetworks were all upregulated. MCODE1 (score 23.5) had 29 nodes and 329 interacting pairs, MCODE2 (score 14.057) had 36 nodes and 246 interacting pairs (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB and supplement table 8), and MCODE3 (score 10.828) had 30 nodes and 157 interacting pairs (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC and supplement table 9). In the GO-BP enrichment analysis of the genes in the module, the first 10 terms were selected for display according to significance (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eD and supplement table10). Interestingly, both MCODE1 and MCODE2 encompassed identical biological process terms, including cell chemotaxis, myeloid leukocyte chemotaxis, myeloid leukocyte migration, and leukocyte migration. Notably, the genes within MCODE3 exhibit significant involvement in the regulation of immune response through cell surface receptor signaling pathway and activation of immune response via signal transduction.\u003c/p\u003e\n \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e\n \u003ch2\u003elncRNA-, miRNA- and circRNA-related target gene enrichment analysis\u003c/h2\u003e\n \u003cp\u003eKEGG enrichment analysis was conducted based on the mRNAs involved in the differential expression miRNA\u0026ndash;mRNA target relationships, as well as the coexpression relationships between differentially expressed lncRNAs and mRNAs, and between differentially expressed circRNAs and mRNAs. The results of this analysis are presented in a bubble map (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). The results showed that LncRNAs were mainly enriched in the cytokine\u0026thinsp;\u0026minus;\u0026thinsp;cytokine receptor interaction, PI3K\u0026thinsp;\u0026minus;\u0026thinsp;Akt signaling pathway and Chemokine signaling pathway (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eA and supplement table11). MiRNAs were significantly enriched in the MAPK signaling pathway, mTOR signaling pathway and cellular senescence (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eB and supplement table 12). CircRNAs were mainly enriched in Th1 and Th2 cell differentiation, the C\u0026thinsp;\u0026minus;\u0026thinsp;type lectin receptor signaling pathway and the cAMP signaling pathway (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eC and supplement table13).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eConstruction of regulatory networks for ncRNAs\u003c/h2\u003e\n \u003cp\u003eAccording to the predicted regulatory relationships between targeted lncRNA-miRNA, circRNA-miRNA, and miRNA-mRNA interactions, we identified lncRNAs, circRNAs, and mRNAs that exhibited significant differential expression and regulation by the same miRNA. Subsequently, we obtained 10 regulatory networks involving lncRNA-miRNA-mRNA interactions. Among them, 3 lncRNAs were downregulated, 5 miRNAs were upregulated, and 45 mRNAs were downregulated to obtain 5 circRNA-miRNA‒mRNA regulatory networks, among which 4 circRNAs were upregulated and 1 circRNA was downregulated. Furthermore, one miRNA displayed downregulation along with ten upregulated mRNAs. The ncRNA regulatory network is shown in Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e and supplementary Table 14.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eValidation of RNA expression in the ceRNA network\u003c/h2\u003e\n \u003cp\u003eTo validate the accuracy of the detection results, we conducted RT-PCR verification on the RNA of the LncRNA‒miRNA-mRNA ceRAN Network. The LncRNA-miRNA-mRNA Network selected for analysis is visualized using a Sankey diagram in Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eA(supplementary Table 14). Figure \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eB shows the RT-PCR detection results for LncRNA (Gm4544, Gm26794) RNA expression in the myocardial tissue of AMI-NC and AMI-RE mice. The expression of miRNA RNA is illustrated in Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eC, while the mRNA expression is depicted in Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eD. By comparing the RT-PCR results with the sequencing data, we observed a high degree of consistency in the gene expression patterns, thus confirming the reliability of our data.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNumerous previous studies have demonstrated that exercise after acute myocardial infarction (AMI) can effectively ameliorate cardiac fibrosis, reduce myocardial cell apoptosis, delay ventricular remodeling, and improve cardiac function\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. However, the specific molecular mechanism underlying the beneficial effects of exercise on cardiac remodeling and function post-AMI remains unclear. To gain a better understanding of this mechanism, we performed whole-transcriptome sequencing analysis on heart samples from the AMI\u0026thinsp;+\u0026thinsp;NC and AMI\u0026thinsp;+\u0026thinsp;RE groups and found 1028 DE mRNAs, 100 DE lncRNAs, 14 DE miRNAs and 131 DE circRNAs. GO analysis of the differentially expressed mRNAs showed significant enrichment in negative regulation of the immune system while KEGG pathway analysis indicated significant enrichment in cytokine-cytokine receptor interaction. PPI network analysis highlighted an important role for chemokine family genes among the differentially expressed mRNAs. Based on the ceRNA theory, a ceRNA interaction network was constructed to analyze the regulatory roles of DE lncRNAs and circRNAs in cardiac repair after AMI. We selected several DE mRNAs, lncRNAs, and miRNAs for RT-qPCR validation which yielded consistent results with our sequencing data.\u003c/p\u003e \u003cp\u003eThe successful construction of mouse AMI was experimentally confirmed. Following myocardial infarction, mice exhibited ventricular wall thinning, enlarged heart chambers, and decreased ejection fraction, consistent with previous research findings\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. In this study, we conducted HE and Masson staining, revealing a significantly lower area of myocardial fibrosis in the AMI\u0026thinsp;+\u0026thinsp;RE group compared to the AMI\u0026thinsp;+\u0026thinsp;NC group. Additionally, ventricular expansion was reduced. Cardiac color Doppler ultrasound revealed that the LVEF of the mice in the AMI\u0026thinsp;+\u0026thinsp;RE group was increased, which suggested that RE after AMI is beneficial to improve cardiac function and reduce adverse cardiac remodeling. Numerous clinical studies have reported that individualized REs for AMI patients can improve cardiac ejection fraction, enhance quality of life, alleviate anxiety and depression symptoms, as well as reduce rates of sudden cardiac death and readmission\u003csup\u003e\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. These results are consistent with this study.\u003c/p\u003e \u003cp\u003eWe conducted an enrichment analysis of differentially expressed mRNAs (DE mRNAs). Interestingly, our findings revealed a significant enrichment of biological functions associated with the negative regulation of immune processes, including inflammatory cell activation, adhesion, and migration. These results suggest that RE plays a role in cardiac repair after AMI by negatively regulating molecular functions related to immune processes. There are previous studies that support our experimental data\u003csup\u003e\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Necrotic myocardial tissue triggers an immune cascade that leads to a widespread inflammatory response. Prolonged inflammation infiltrates into the noninfarcted area, resulting in increased fibrosis and impaired ventricular diastolic function\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Therefore, timely inhibition of the immune response and chemotactic migration of inflammatory cells are crucial for promoting MI repair.\u003c/p\u003e \u003cp\u003eIn the PPI analysis of mRNA, chemokine family genes constituted the major component in the three MCODEs, with CCL2 and CCR5 exhibiting higher degrees of freedom compared to other proteins. Extensive clinical studies and experiments have provided support for the crucial roles played by inflammatory cytokines and chemokines in cardiac dysfunction and adverse cardiac remodeling\u003csup\u003e\u003cspan additionalcitationids=\"CR21 CR22\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. However, this evidence is often misinterpreted to suggest that inflammatory cytokines and chemokines have only deleterious effects. In fact, inflammatory cytokines have multiple effects and versatility. In the process of myocardial injury, multiple members of the cytokine and chemokine family can be upregulated to regulate the quantitative mobilization of immune cell subsets in the area of MI, activate the cardiomyocyte repair program and play a beneficial role\u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. CCL2 can be rapidly upregulated in infarcted myocardium\u003csup\u003e\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Cardiac overexpression of CCL2 has been observed to reduce infarct size, scar formation, while promoting neovascularization in the border area following myocardial infarction using a mouse model\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Our sequencing results showed that the expression of CCL2 increased after exercise, which played a favorable role, which was consistent with the above results. Studies have shown that CCR5 can inhibit inflammation and reduce poor remodeling after MI by regulating T cells (Tregs) \u003csup\u003e\u003cspan additionalcitationids=\"CR31 CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. In our study, sequencing revealed that RE increased expression of CCR5 in myocardial tissue after MI which contributed towards improving cardiac structure and function aligning with previous research perspectives.\u003c/p\u003e \u003cp\u003eDuring KEGG analysis of DE genes, we observed significant enrichment of both DE mRNAs and DE lncRNAs in the cytokine-cytokine receptor interaction, chemokine signaling pathway, PI3K-Akt signaling pathway, and MAPK signaling pathway. Studies have shown that the interaction between chemokines and chemokine receptors guides cell migration to the site of injury by activating the PI3K pathway\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Among them, the PI3K-Akt signaling pathway plays an important role in the occurrence, development and treatment of MI\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Exercise induces multiorgan responses and activates diverse signaling pathways within the body including the PI3K-Akt signaling pathway\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Activation of this particular pathway has been shown to alleviate myocardial cell apoptosis, myocardial fibrosis, and mitochondrial dysfunction induced by myocardial ischemia-reperfusion\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Additionally, it has been found that activating the PI3K-Akt signaling pathway promotes angiogenesis in the infarct area using a mouse model of MI\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn the ceRNA regulatory network, upregulated miR21, upregulated miR34 and downregulated let-7c occupy an important position. In a pig model of MI, YanLi et al \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003eused nanocarriers to deliver miR-21 to the infarction site and found that it could inhibit the transformation of myocardial macrophages to type M1 and effectively alleviate the inflammatory response. When delivered to endothelial cells, it could promote local angiogenesis and effectively reduce infarct size. Studies have shown \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003ethat high expression of miR-34 in autologous bone marrow mesenchymal stem cells can promote angiogenesis by targeting stem cell factor (SCF) in heart repair therapy. Downregulation of Let-7c improved cardiac function and reduced myocardial apoptosis and fibrosis, while c-kit\u0026thinsp;+\u0026thinsp;cardiac stem cells and Ki-67\u0026thinsp;+\u0026thinsp;proliferating cells were not affected. These results are consistent with the results of our analysis\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. We also used RT‒PCR to verify the expression changes of the components of the four groups of ceRNAs, showing that the Gm26794-miR21a-Plxnb3/Slc16a8, Gm26794-miR34b-Olfr1393/Slc16a8, Gm4544-miR21a-Plxnb3/Slc16a8 and Gm4544-miR34b-Olfr1393/Slc16a8 ceRNA networks are consistent with the analysis of the sequencing results. At present, there is no relevant literatuire report on this ceRNA network. This network will be an important part of our future experimental verification.\u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eLimitations of the study\u003c/h2\u003e \u003cp\u003eBecause human cardiac tissue is difficult to obtain, we used myocardial tissue from mice to perform the above interventions and sequencing. However, due to the differences in species attributes, the adaptability in human tissues needs further experimental verification.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, this study explored the molecular mechanism by which RE improves myocardial remodeling after AMI via whole-transcriptome sequencing and RT‒PCR. The results revealed that a large number of ncRNAs are involved in RE-mediated regulation of cardiac remodeling after AMI. Chemokine family genes play an important role in RE to improve cardiac remodeling, and miR21, miR34 and let-7c may play an important role in RE-mediated treatment of MI. The Gm26794-miR21a-Plxnb3/Slc16a8,Gm26794-miR34b-Olfr1393/Slc16a8,Gm4544-miR21a-Plxnb3/Slc16a8 and Gm4544-miR34b-Olfr1393/Slc16a8 ceRNA interaction networks may be involved in important mechanisms by which RE improves cardiac remodeling after AMI. These findings reveal the genomic complexity of post-MI RE effects and suggest potential new targets for their characterization.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of an AMI mouse model\u003c/h2\u003e \u003cp\u003eMale C57BL/6 mice (8 weeks old, weighing 21-25g) were obtained from Wei Tong Li De Biotechnology Co. Ltd., and housed in cages under a controlled temperature of 25\u0026deg;C with a 12-hour light/dark cycle. They had ad libitum access to food and water. All animal experiments were conducted in accordance with the guidelines approved by the Ethics Committee of the Affiliated Hospital of Jining Medical University (2018B002). All animal care and experimental procedures were performed under the supervision of this committee. In addition, the experiments complied with the revised ARRIVE guidelines 2.0. The mice were anesthetized using continuous inhalation of 2% isoflurane, and myocardial infarction was induced as previously described [10]. Briefly, left thoracotomy was performed between the third and fourth intercostal spaces to expose the heart accurately. Subsequently, the heart was exteriorized, and in the AMI group, ligation of the left anterior descending artery (LAD)was achieved using a sterile 5/0 suture. After ligation, the mouse heart was repositioned within the chest cavity followed by immediate closure using 3\u0026thinsp;\u0026minus;\u0026thinsp;0 nylon sutures. The sham group only had thoracotomy without LAD ligation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eRehabilitation exercise (RE)intervention\u003c/h2\u003e \u003cp\u003eThe MI model was successfully established in 24 mice. The AMI mice were randomly divided into two groups: the AMI\u0026thinsp;+\u0026thinsp;negative control (NC) group and the AMI\u0026thinsp;+\u0026thinsp;RE group. 30 days after modeling, RE intervention was administered to the mice. The AMI\u0026thinsp;+\u0026thinsp;NC group moved freely in the cage. The exercise intensity of the AMI\u0026thinsp;+\u0026thinsp;RE group was based on the Bedford training model standard \u003csup\u003e[23]\u003c/sup\u003e. The AMI\u0026thinsp;+\u0026thinsp;RE group underwent aerobic exercise treadmill adaptation training for 1 week: on the first two days, the treadmill slope was zero, the speed was 6 m/min, and the duration was 20 min/d. On the third and fourth days, the platform slope was 5\u003csup\u003eཡ\u003c/sup\u003e, the speed was 8 m/min, and the duration was 40 min/d. On the fifth and sixth days, the slope was 8\u003csup\u003eཡ\u003c/sup\u003e, the speed was 10 m/min, and the duration was 60 min/d. After adaptive training, exercise intensity at a slope 8\u003csup\u003eཡ\u003c/sup\u003e and a speed of 10 m/min was maintained for 60 min/d 6 days/week until sampling after anesthesia at the eighth week.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eCardiac function measurement\u003c/h2\u003e \u003cp\u003eAfter the rehabilitation exercise of the two groups of mice, the cardiac diameter and function were measured using a high-resolution ultrasonic imaging system (Mindray M9Vet) before sampling. All mice were anesthetized with 2% isoflurane and fixed on a heating pad in a supine position. 2D echocardiography, M-mode echocardiography, and pulsed-wave Doppler echocardiography were used to measure the left ventricular internal dimension at end-diastolic (LVIDd) and LV internal diameter at end-systole (LVIDs). The LV thickness of the posterior wall at end-diastolic (LVPWd) was determined from the long-axis view at the level of the chordae tendineae. The percentage LV ejection fraction (LVEF) was calculated as 100 \u0026times; [(LVIDd -LVIDs) /LVIDd]. The peak velocity of early (E) and late (A) ventricular filling velocity was obtained by the apical four-chamber view at the level of mitral valve flow.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin and eosin (HE) staining and Masson staining\u003c/h2\u003e \u003cp\u003eMice were euthanized by intraperitoneal injection of sodium pentobarbital (150mg/kg). After measuring the weight of the mice, the skin was cut near the sternum of the mice to separate the tissue and remove the heart, and its weight was measured. Mouse hearts were dissected and immediately fixed in 4% formalin. Tissue was paraffin embedded and sectioned (5 \u0026micro;m) for staining with HE. To examine the level of cardiac fibrosis, cardiac sections were stained using Masson's trichrome (Solarbio, G1340) in accordance with the instructions. The level of fibrosis was quantified by using Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eCD34 immunofluorescence staining\u003c/h2\u003e \u003cp\u003eThe heart tissue slides were fixed with 4% formaldehyde, permeabilized using 0.3% Triton X-100, and blocked with 5% BSA. Following overnight incubation at 4\u0026deg;C with the indicated CD34 antibodies (diluted to 1:100), the slides were further incubated for 1 hour at room temperature with Alexa Fluor 594-conjugated secondary antibodies (diluted to 1:200). Subsequently, DAPI was employed for nuclear staining at room temperature for a duration of 10 minutes. The cells were visualized and captured utilizing the fluorescent confocal, and the obtained results were analyzed using Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eWhole-transcriptome sequencing\u003c/h2\u003e \u003cp\u003eApical myocardial tissue was collected from mice subjected to exercise and those without exercise following myocardial infarction. Total RNA extraction from cardiac tissues was performed using TRIzol, ensuring high-quality total RNA from each sample for the construction of libraries intended for RNA-seq and small RNA sequencing. Paired-end sequencing on an Illumina Novaseq\u0026trade; 6000 (LC Bio, China) was conducted according to the manufacturer's instructions. Library construction and sequencing were carried out at Jiespiral (Shanghai) Medical Technology Co., Ltd.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cp\u003eThe first step involves performing data quality control and preprocessing to obtain clean data for subsequent analysis. Subsequently, the RNA sequencing data is aligned to a reference sequence using HISAT2 software, followed by transcript assembly using StringTie software. After that, further analyses, such as differential expression screening, were carried out. Differentially expressed (DE) ncRNAs and mRNAs are shown in a cluster heatmap 1.0-fold or greater and an adjusted p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were selected as thresholds.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003ePrediction of DE ncRNA target genes\u003c/h2\u003e \u003cp\u003eENCORI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://starbase.sysu.edu.cn/\u003c/span\u003e\u003cspan address=\"https://starbase.sysu.edu.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and DIANA-LncBase v3 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://diana.e-ce.uth.gr/lncbasev3/home\u003c/span\u003e\u003cspan address=\"https://diana.e-ce.uth.gr/lncbasev3/home\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) were used to predict lncRNAs, circRNAs and mRNAs targeted by DE miRNAs, and the regulatory relationships of miRNA‒lncRNA, miRNA-circRNA and miRNA‒mRNA were obtained. The miRNA‒lncRNA, miRNA-circRNA and miRNA‒mRNA regulatory relationships for DE genes were obtained by integration with DE lncRNAs, DE circRNAs and DE mRNAs. Then, based on the coexpression analysis method of expression correlation, the Pearson correlation coefficient was used to predict the mRNAs that DE lncRNAs acted on, and the threshold was set to | r | \u0026gt; 0.9, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Finally, based on the locus relationship, the mRNAs that the DE circRNAs acted on were obtained. By integrating the above results, the DE lncRNA\u0026ndash;DE mRNA and DE circRNA\u0026ndash;DE mRNA relationship pairs were obtained.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eGene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis\u003c/h2\u003e \u003cp\u003eGO and KEGG pathway analyses were applied to investigate the roles of all DE ncRNAs. GO analysis included terms in the biological process, molecular function and cellular component categories. The enriched GO terms and KEGG pathways for the DE ncRNAs between the two groups are presented (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.geneontology.org\u003c/span\u003e\u003cspan address=\"http://www.geneontology.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). KEGG pathway analysis was performed to explore the significant pathways of the DE genes (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genome.jp/kegg/\u003c/span\u003e\u003cspan address=\"https://www.genome.jp/kegg/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eProtein\u0026ndash;protein interaction (PPI) network and module analysis of DE mRNAs\u003c/h2\u003e \u003cp\u003eTo further understand the interaction between the DE mRNA encoded proteins, the DE mRNAs were imported into String (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cn.string-db.org/\u003c/span\u003e\u003cspan address=\"https://cn.string-db.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), the species was set as Mus musculus, and the rest of the parameters were set as the default values. The results were imported into Cytoscape 3.9.1, and the significantly polymerized modules were screened by the plug-in MCODE, with a score\u0026thinsp;\u0026gt;\u0026thinsp;10 as the screening threshold. For the GO-BP enrichment analysis module, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was the threshold value.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eAnalysis of the ncRNA regulatory network\u003c/h2\u003e \u003cp\u003eTo reveal the roles and interactions among ncRNAs and mRNAs in the pathophysiological process of RE ameliorating cardiac remodeling after MI, we constructed a ncRNA regulatory network. According to the obtained regulatory relationships of DE lncRNAs‒miRNAs, circRNAs-miRNAs and miRNAs‒mRNAs, the ncRNA regulatory network was constructed based on the ceRNA principle, and Cytoscape software was used for visualization.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time polymerase chain reaction (RT‒PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from the heart tissues using TRIzol Reagent (Invitrogen). Isolated RNA was reverse-transcribed using a Script cDNA Synthesis Kit (Takara BIO, Otsu, Japan) according to the manufacturer\u0026rsquo;s instructions. The expression levels of lncRNAs and mRNAs were normalized to that of the reference gene β-actin, and those of miRNAs were normalized to that of U6. RT‒PCR was performed in a Bio-Rad CFX-96 System (Bio-Rad, Foster City, CA, USA) using Ultra SYBR Mixture. The relative expression levels of genes were calculated using the 2\u003csup\u003eΔΔCT\u003c/sup\u003e method. The primers are listed in Table\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SDs, and statistical analysis was performed using Fisher\u0026rsquo;s exact t test. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate statistical significance. Statistical analysis was performed using GraphPad Prism 9.0.0. (GraphPad Software, Inc, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflicts of interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they do not have any competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding statement\u003c/h2\u003e \u003cp\u003eThis work was supported by China Postdoctoral Science Foundation (71th Batch-2022M711321), National Natural Science Foundation Youth Fund (81700230), Shandong Province Key Project of TCM science and technology (Z-2022081), Key research and development plan in Jining City (2022YXNS003,2022YXNS071), Jining Medical University Research Fund for Academician Lin He New Medicine (JYHL2022FZD03).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eLijun Gan and Xueying Chen designed the experimental plan. Mingrui Chen and Yugang Yan conducted biological analysis, Zhong xin Li, Nan Lin, Liangchun Ni , Yang Zhang, Haizhu Gao, Cuimei Guo, Xinxin Bian did the animal experiment and collected data. Nan Kan, Shaohui Zhang, Qingyun Zhang supervised data collection and provided intellectual expertise. Chen Xueying and Chen Mingrui prepared the manucript; All authors reviewed and edited the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe would like to express our gratitude to Chuanpeng Zhang, a bioinformation engineer from the Medical Research Center at the Affiliated Hospital of Jining Medical valuable assistance in data analysis and visualization.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe whole-transcriptome High-throughput sequencing from the myocardial tissue of acute myocardial infarction and acute myocardial infarction+rehabilitation exercise mice have been deposited at Gene Expression Omnibus (GEO) with Super Series reference number GSE241919.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted under the guidelines of the Declaration of Helsinki. The study was approved by the ethics committee of Affiliated Hospital of Jining Medical University.(2018B002)The experiments complied with the revised ARRIVE guidelines 2.0.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGulati, R. et al. Acute Myocardial Infarction in Young Individuals. \u003cem\u003eMayo Clin. Proc.\u003c/em\u003e \u003cb\u003e95\u003c/b\u003e, 136\u0026ndash;156. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mayocp.2019.05.001\u003c/span\u003e\u003cspan address=\"10.1016/j.mayocp.2019.05.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSch\u0026uuml;ttler, D., Clauss, S., Weckbach, L. T. \u0026amp; Brunner, S. Molecular Mechanisms of Cardiac Remodeling and Regeneration in Physical Exercise. \u003cem\u003eCells\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells8101128\u003c/span\u003e\u003cspan address=\"10.3390/cells8101128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBo, B. et al. The Molecular Mechanisms Associated with Aerobic Exercise-Induced Cardiac Regeneration. \u003cem\u003eBiomolecules\u003c/em\u003e 11 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biom11010019\u003c/span\u003e\u003cspan address=\"10.3390/biom11010019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, H. et al. Exercise Prevents Cardiac Injury and Improves Mitochondrial Biogenesis in Advanced Diabetic Cardiomyopathy with PGC-1α and Akt Activation. \u003cem\u003eCell. Physiol. Biochem.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 2159\u0026ndash;2168. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000374021\u003c/span\u003e\u003cspan address=\"10.1159/000374021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo Giudice, C., Pesole, G. \u0026amp; Picardi, E. High-Throughput Sequencing to Detect DNA-RNA Changes. \u003cem\u003eMethods Mol. Biol.\u003c/em\u003e \u003cb\u003e2181\u003c/b\u003e, 193\u0026ndash;212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-1-0716-0787-9_12\u003c/span\u003e\u003cspan address=\"10.1007/978-1-0716-0787-9_12\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAli, S. A., Peffers, M. J., Ormseth, M. J., Jurisica, I. \u0026amp; Kapoor, M. The non-coding RNA interactome in joint health and disease. \u003cem\u003eNat. Rev. Rheumatol.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 692\u0026ndash;705. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41584-021-00687-y\u003c/span\u003e\u003cspan address=\"10.1038/s41584-021-00687-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSk\u0026oacute;ra, J. P. et al. Local intramuscular administration of ANG1 and VEGF genes using plasmid vectors mobilizes CD34\u0026thinsp;+\u0026thinsp;cells to peripheral tissues and promotes angiogenesis in an animal model. \u003cem\u003eBiomed. Pharmacother\u003c/em\u003e. \u003cb\u003e143\u003c/b\u003e, 112186. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2021.112186\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2021.112186\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorr\u0026agrave;, U. et al. Secondary prevention through cardiac rehabilitation: physical activity counselling and exercise training: key components of the position paper from the Cardiac Rehabilitation Section of the European Association of Cardiovascular Prevention and Rehabilitation. \u003cem\u003eEur. Heart J.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 1967\u0026ndash;1974. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/eurheartj/ehq236\u003c/span\u003e\u003cspan address=\"10.1093/eurheartj/ehq236\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKitzman, D. W. et al. Physical Rehabilitation for Older Patients Hospitalized for Heart Failure. \u003cem\u003eN Engl. J. Med.\u003c/em\u003e \u003cb\u003e385\u003c/b\u003e, 203\u0026ndash;216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJMoa2026141\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa2026141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAliaga, J. et al. Preservation of Contractile Reserve and Diastolic Function by Inhibiting the NLRP3 Inflammasome with OLT1177(\u0026reg;) (Dapansutrile) in a Mouse Model of Severe Ischemic Cardiomyopathy Due to Non-Reperfused Anterior Wall Myocardial Infarction. \u003cem\u003eMolecules\u003c/em\u003e. \u003cb\u003e26\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules26123534\u003c/span\u003e\u003cspan address=\"10.3390/molecules26123534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLang, C. I. et al. [(68)Ga]-NODAGA-RGD Positron Emission Tomography (PET) for Assessment of Post Myocardial Infarction Angiogenesis as a Predictor for Left Ventricular Remodeling in Mice after Cardiac Stem Cell Therapy. \u003cem\u003eCells\u003c/em\u003e. \u003cb\u003e9\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells9061358\u003c/span\u003e\u003cspan address=\"10.3390/cells9061358\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDibben, G. O. et al. Exercise-based cardiac rehabilitation for coronary heart disease: a meta-analysis. \u003cem\u003eEur. Heart J.\u003c/em\u003e \u003cb\u003e44\u003c/b\u003e, 452\u0026ndash;469. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/eurheartj/ehac747\u003c/span\u003e\u003cspan address=\"10.1093/eurheartj/ehac747\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMueller, S. et al. Effect of High-Intensity Interval Training, Moderate Continuous Training, or Guideline-Based Physical Activity Advice on Peak Oxygen Consumption in Patients With Heart Failure With Preserved Ejection Fraction: A Randomized Clinical Trial. \u003cem\u003eJama\u003c/em\u003e. \u003cb\u003e325\u003c/b\u003e, 542\u0026ndash;551. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1001/jama.2020.26812\u003c/span\u003e\u003cspan address=\"10.1001/jama.2020.26812\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTucker, W. J. et al. Exercise for Primary and Secondary Prevention of Cardiovascular Disease: JACC Focus Seminar 1/4. \u003cem\u003eJ. Am. Coll. Cardiol.\u003c/em\u003e \u003cb\u003e80\u003c/b\u003e, 1091\u0026ndash;1106. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jacc.2022.07.004\u003c/span\u003e\u003cspan address=\"10.1016/j.jacc.2022.07.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrangogiannis, N. G. Regulation of the inflammatory response in cardiac repair. \u003cem\u003eCirc. Res.\u003c/em\u003e \u003cb\u003e110\u003c/b\u003e, 159\u0026ndash;173. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/circresaha.111.243162\u003c/span\u003e\u003cspan address=\"10.1161/circresaha.111.243162\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrabhu, S. D. \u0026amp; Frangogiannis, N. G. The Biological Basis for Cardiac Repair After Myocardial Infarction: From Inflammation to Fibrosis. \u003cem\u003eCirc. Res.\u003c/em\u003e \u003cb\u003e119\u003c/b\u003e, 91\u0026ndash;112. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/circresaha.116.303577\u003c/span\u003e\u003cspan address=\"10.1161/circresaha.116.303577\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, K., Li, Y. Y. \u0026amp; Jin, J. A double-edged sword of immuno-microenvironment in cardiac homeostasis and injury repair. \u003cem\u003eSignal. Transduct. Target. Ther.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41392-020-00455-6\u003c/span\u003e\u003cspan address=\"10.1038/s41392-020-00455-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrangogiannis, N. G., Smith, C. W. \u0026amp; Entman, M. L. The inflammatory response in myocardial infarction. \u003cem\u003eCardiovasc. Res.\u003c/em\u003e \u003cb\u003e53\u003c/b\u003e, 31\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0008-6363(01)00434-5\u003c/span\u003e\u003cspan address=\"10.1016/s0008-6363(01)00434-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNian, M., Lee, P., Khaper, N. \u0026amp; Liu, P. Inflammatory cytokines and postmyocardial infarction remodeling. \u003cem\u003eCirc. Res.\u003c/em\u003e \u003cb\u003e94\u003c/b\u003e, 1543\u0026ndash;1553. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.RES.0000130526.20854.fa\u003c/span\u003e\u003cspan address=\"10.1161/01.RES.0000130526.20854.fa\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgarwal, U. et al. Role of cardiac myocyte CXCR4 expression in development and left ventricular remodeling after acute myocardial infarction. \u003cem\u003eCirc. Res.\u003c/em\u003e \u003cb\u003e107\u003c/b\u003e, 667\u0026ndash;676. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/circresaha.110.223289\u003c/span\u003e\u003cspan address=\"10.1161/circresaha.110.223289\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong, F. et al. Myocardial CXCR4 expression is required for mesenchymal stem cell mediated repair following acute myocardial infarction. \u003cem\u003eCirculation\u003c/em\u003e. \u003cb\u003e126\u003c/b\u003e, 314\u0026ndash;324. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/circulationaha.111.082453\u003c/span\u003e\u003cspan address=\"10.1161/circulationaha.111.082453\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeinrichs, M. et al. The healing myocardium mobilizes a distinct B-cell subset through a CXCL13-CXCR5-dependent mechanism. \u003cem\u003eCardiovasc. Res.\u003c/em\u003e \u003cb\u003e117\u003c/b\u003e, 2664\u0026ndash;2676. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/cvr/cvab181\u003c/span\u003e\u003cspan address=\"10.1093/cvr/cvab181\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiehn, E. A., Postea, O., Curaj, A. \u0026amp; Marx, N. Repair after myocardial infarction, between fantasy and reality: the role of chemokines. \u003cem\u003eJ. Am. Coll. Cardiol.\u003c/em\u003e \u003cb\u003e58\u003c/b\u003e, 2357\u0026ndash;2362. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jacc.2011.08.034\u003c/span\u003e\u003cspan address=\"10.1016/j.jacc.2011.08.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGolpanian, S., Wolf, A., Hatzistergos, K. E. \u0026amp; Hare, J. M. Rebuilding the Damaged Heart: Mesenchymal Stem Cells, Cell-Based Therapy, and Engineered Heart Tissue. \u003cem\u003ePhysiol. Rev.\u003c/em\u003e \u003cb\u003e96\u003c/b\u003e, 1127\u0026ndash;1168. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/physrev.00019.2015\u003c/span\u003e\u003cspan address=\"10.1152/physrev.00019.2015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePenn, M. S., Pastore, J., Miller, T. \u0026amp; Aras, R. SDF-1 in myocardial repair. \u003cem\u003eGene Ther.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 583\u0026ndash;587. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/gt.2012.32\u003c/span\u003e\u003cspan address=\"10.1038/gt.2012.32\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang, F. L., Lu, X., Liu, Y. \u0026amp; Feng, Q. Cardiomyocyte-specific overexpression of human stem cell factor protects against myocardial ischemia and reperfusion injury. \u003cem\u003eInt. J. Cardiol.\u003c/em\u003e \u003cb\u003e168\u003c/b\u003e, 3486\u0026ndash;3494. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijcard.2013.04.165\u003c/span\u003e\u003cspan address=\"10.1016/j.ijcard.2013.04.165\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHedayati-Moghadam, M. et al. The Role of Chemokines in Cardiovascular Diseases and the Therapeutic Effect of Curcumin on CXCL8 and CCL2 as Pathological Chemokines in Atherosclerosis. \u003cem\u003eAdv. Exp. Med. Biol.\u003c/em\u003e \u003cb\u003e1328\u003c/b\u003e, 155\u0026ndash;170. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-73234-9_11\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-73234-9_11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen, S. C. et al. Macrophages promote the transition from myocardial ischemia reperfusion injury to cardiac fibrosis in mice through GMCSF/CCL2/CCR2 and phenotype switching. \u003cem\u003eActa Pharmacol. Sin\u003c/em\u003e. \u003cb\u003e45\u003c/b\u003e, 959\u0026ndash;974. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41401-023-01222-3\u003c/span\u003e\u003cspan address=\"10.1038/s41401-023-01222-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, W. et al. Chemokine CCL2 promotes cardiac regeneration and repair in myocardial infarction mice via activation of the JNK/STAT3 axis. \u003cem\u003eActa Pharmacol. Sin\u003c/em\u003e. \u003cb\u003e45\u003c/b\u003e, 728\u0026ndash;737. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41401-023-01198-0\u003c/span\u003e\u003cspan address=\"10.1038/s41401-023-01198-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDobaczewski, M., Xia, Y., Bujak, M., Gonzalez-Quesada, C. \u0026amp; Frangogiannis, N. G. CCR5 signaling suppresses inflammation and reduces adverse remodeling of the infarcted heart, mediating recruitment of regulatory T cells. \u003cem\u003eAm. J. Pathol.\u003c/em\u003e \u003cb\u003e176\u003c/b\u003e, 2177\u0026ndash;2187. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2353/ajpath.2010.090759\u003c/span\u003e\u003cspan address=\"10.2353/ajpath.2010.090759\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, J. et al. Intramyocardial injected human umbilical cord-derived mesenchymal stem cells (HucMSCs) contribute to the recovery of cardiac function and the migration of CD4(+) T cells into the infarcted heart via CCL5/CCR5 signaling. \u003cem\u003eStem Cell. Res. Ther.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 247. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-022-02914-z\u003c/span\u003e\u003cspan address=\"10.1186/s13287-022-02914-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakaguchi, S., Yamaguchi, T., Nomura, T. \u0026amp; Ono, M. Regulatory T cells and immune tolerance. \u003cem\u003eCell\u003c/em\u003e. \u003cb\u003e133\u003c/b\u003e, 775\u0026ndash;787. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2008.05.009\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2008.05.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZamilpa, R. et al. CC chemokine receptor 5 deletion impairs macrophage activation and induces adverse remodeling following myocardial infarction. \u003cem\u003eAm. J. Physiol. Heart Circ. Physiol.\u003c/em\u003e \u003cb\u003e300\u003c/b\u003e, H1418\u0026ndash;1426. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpheart.01002.2010\u003c/span\u003e\u003cspan address=\"10.1152/ajpheart.01002.2010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegler, D. F. \u0026amp; Thelen, M. New insights in chemokine signaling. \u003cem\u003eF1000Res\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e, 95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12688/f1000research.13130.1\u003c/span\u003e\u003cspan address=\"10.12688/f1000research.13130.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSotsios, Y. \u0026amp; Ward, S. G. Phosphoinositide 3-kinase: a key biochemical signal for cell migration in response to chemokines. \u003cem\u003eImmunol. Rev.\u003c/em\u003e \u003cb\u003e177\u003c/b\u003e, 217\u0026ndash;235. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1034/j.1600-065x.2000.17712.x\u003c/span\u003e\u003cspan address=\"10.1034/j.1600-065x.2000.17712.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhigo, A., Laffargue, M., Li, M. \u0026amp; Hirsch, E. PI3K and Calcium Signaling in Cardiovascular Disease. \u003cem\u003eCirc. Res.\u003c/em\u003e \u003cb\u003e121\u003c/b\u003e, 282\u0026ndash;292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/circresaha.117.310183\u003c/span\u003e\u003cspan address=\"10.1161/circresaha.117.310183\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVega, R. B., Konhilas, J. P., Kelly, D. P. \u0026amp; Leinwand, L. A. Molecular Mechanisms Underlying Cardiac Adaptation to Exercise. \u003cem\u003eCell. Metab.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 1012\u0026ndash;1026. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2017.04.025\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2017.04.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin, G. W., Lu, P., Peng, L. \u0026amp; Jiang, W. Ginsenoside Rb1 Inhibits Cardiomyocyte Autophagy via PI3K/Akt/mTOR Signaling Pathway and Reduces Myocardial Ischemia/Reperfusion Injury. \u003cem\u003eAm. J. Chin. Med.\u003c/em\u003e \u003cb\u003e49\u003c/b\u003e, 1913\u0026ndash;1927. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1142/s0192415x21500907\u003c/span\u003e\u003cspan address=\"10.1142/s0192415x21500907\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu, P., Ma, S., Dai, X. \u0026amp; Cao, F. Elabela alleviates myocardial ischemia reperfusion-induced apoptosis, fibrosis and mitochondrial dysfunction through PI3K/AKT signaling. \u003cem\u003eAm. J. Transl Res.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 4467\u0026ndash;4477 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng, S. et al. Astragaloside IV exerts angiogenesis and cardioprotection after myocardial infarction via regulating PTEN/PI3K/Akt signaling pathway. \u003cem\u003eLife Sci.\u003c/em\u003e \u003cb\u003e227\u003c/b\u003e, 82\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lfs.2019.04.040\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2019.04.040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan, X. et al. Buyang Huanwu Decoction promotes angiogenesis in myocardial infarction through suppression of PTEN and activation of the PI3K/Akt signalling pathway. \u003cem\u003eJ. Ethnopharmacol.\u003c/em\u003e \u003cb\u003e287\u003c/b\u003e, 114929. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jep.2021.114929\u003c/span\u003e\u003cspan address=\"10.1016/j.jep.2021.114929\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y. et al. Injectable hydrogel with MSNs/microRNA-21-5p delivery enables both immunomodification and enhanced angiogenesis for myocardial infarction therapy in pigs. \u003cem\u003eSci. Adv.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciadv.abd6740\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.abd6740\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, H. J. et al. Involvement of miR-34c in high glucose-insulted mesenchymal stem cells leads to inefficient therapeutic effect on myocardial infarction. \u003cem\u003eCell. Signal.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 2241\u0026ndash;2251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cellsig.2015.07.024\u003c/span\u003e\u003cspan address=\"10.1016/j.cellsig.2015.07.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTolonen, A. M. et al. Inhibition of Let-7 microRNA attenuates myocardial remodeling and improves cardiac function postinfarction in mice. \u003cem\u003ePharmacol. Res. Perspect.\u003c/em\u003e \u003cb\u003e2\u003c/b\u003e, e00056. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/prp2.56\u003c/span\u003e\u003cspan address=\"10.1002/prp2.56\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Table 1","content":"\u003cp\u003eTable 1: The primer squence of RT-PCR.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 278px;\"\u003e\n \u003cp\u003eSequence(5\u0026apos;\u0026rarr;3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003eTm(℃)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 137px;\"\u003e\n \u003cp\u003ePpp1r1b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003eF:GATTCAGTTCTCTGTGCCCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003eR:TTGGGTCTCTTCGACTTTGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 137px;\"\u003e\n \u003cp\u003eOlfr1393\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eF:TTGGCTATTGCTTCCTGGGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eR:CACTGCAACAATCACCACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 137px;\"\u003e\n \u003cp\u003ePlxnb3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eF:AGCCTACTTCTGCGATTCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eR:AATCCCGGCCCACTTTATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 137px;\"\u003e\n \u003cp\u003eSlc16a8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eF:GCTCTCAACTTCCAGCCGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eR:ACAGCATGGACAGAAACACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 137px;\"\u003e\n \u003cp\u003eGm26794\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003eF:GCTGATCCCTGGTCTTGTCCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003eR:AGCCTGTTTTATCAGATTGCCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 137px;\"\u003e\n \u003cp\u003eGm4544\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eF:CACAAAGCTCGAACCCATGTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eR:GGGAGGTGTAGACCGTAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 137px;\"\u003e\n \u003cp\u003emiR-34b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eF:ACACGCAGGCAGTGTAATTAGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eR:TATGCTTGTTCTCGTCTCTGTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 137px;\"\u003e\n \u003cp\u003emiR-21a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eF:ACGTTGTGTAGCTTATCAGACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eR:AATGGTTGTTCTCCACACTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 137px;\"\u003e\n \u003cp\u003emiR-U6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eF:CAGCACATATACTAAAATTGGAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 278px;\"\u003e\n \u003cp\u003eR:ACGAATTTGCGTGTCATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 137px;\"\u003e\n \u003cp\u003eActin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003eF:GGCTGTATTCCCCTCCATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 278px;\"\u003e\n \u003cp\u003eR:CCAGTTGGTAACAATGCCATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Rehabilitation exercise, Acute myocardial infarction, Noncoding RNAs (ncRNAs), Whole-transcriptome sequencing","lastPublishedDoi":"10.21203/rs.3.rs-4865745/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4865745/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRehabilitation exercise (RE) has been shown to mitigate cardiac remodeling and enhance cardiac function in patients with acute myocardial infarction (AMI). However, the precise molecular mechanisms underlying these effects remain incompletely elucidated. In this study, we established a mice model of acute myocardial infarction (AMI) and implemented an 8-week rehabilitation exercise intervention. Whole-transcription sequencing was conducted to examine the expression patterns of mRNA and non-coding RNAs (ncRNAs) in the myocardium of mice with AMI, with and without rehabilitation exercise (RE). GO, KEGG pathway enrichment and protein-protein interaction (PPI) network analyses were performed. And the mRANs within the ceRNA network were validated by RT-PCR. Our findings demonstrate that RE effectively enhances cardiac function, attenuates fibrosis and promotes angiogenesis in the myocardial tissue following MI. Furthermore, bio informatics tools and databases were utilized to investigate potential functions and associations of non-coding RNAs. Our data revealed that: a total of 100 long ncRNAs (lncRNAs), 14 microRNAs (miRNAs), 131 circular RNAs (circRNAs), and 1028 messenger RNAs (mRNAs) were significant. The most prominent pathways involved in RE-mediated improvement of cardiac remodeling after AMI are the PI3K-Akt signaling pathway, cytokine\u0026thinsp;\u0026minus;\u0026thinsp;cytokine receptor interaction, chemokine signaling pathway and MAPK signaling pathway. In addition, lncRNA‒miRNA-mRNA and circRNA-miRNA‒mRNA networks of RE-mediated improvement of cardiac remodeling after AMI were constructed. The present study elucidates the physiological roles of mRNA and ncRNAs in facilitating cardiac remodeling post-AMI. Our findings establish a theoretical framework for investigating the mechanisms underlying cardiac remodeling after AMI, while also providing valuable insights for exploring potential therapeutic interventions for AMI.\u003c/p\u003e","manuscriptTitle":"Comprehensive analysis of the cardiac whole-transcriptome expression profiling involved in rehabilitation exercise improving myocardial remodeling after acute myocardial infarction","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-18 09:56:29","doi":"10.21203/rs.3.rs-4865745/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a1ca74d3-829d-4cac-9f39-8b19120287c0","owner":[],"postedDate":"October 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":38275330,"name":"Health sciences/Cardiology"},{"id":38275331,"name":"Health sciences/Medical research"},{"id":38275332,"name":"Biological sciences/Molecular biology/Non coding rnas"}],"tags":[],"updatedAt":"2025-03-12T06:53:48+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-18 09:56:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4865745","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4865745","identity":"rs-4865745","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.