LINC00601 promotes the progression of glioma via the p-STAT3 signaling pathway

LINC00601 promotes the progression of glioma via the p-STAT3 signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LINC00601 promotes the progression of glioma via the p-STAT3 signaling pathway Chao Ma, Linqi Wang, Renwu Zhang, Tong Li, Peng Li, Yuxiang Ding, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4952967/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Jun, 2025 Read the published version in Cancer Cell International → Version 1 posted 10 You are reading this latest preprint version Abstract Background Gliomas, the most common malignant tumors of the central nervous system, primarily originate from glial cells, which support nerve cells. Due to their high malignancy and aggressiveness, gliomas frequently result in poor prognoses. Increasing evidence suggests that long non-coding RNAs (lncRNAs) have diverse roles in cancer; however, their specific functions in gliomas remain poorly understood. This study elucidates the roles and potential mechanisms of the lncRNA LINC00601 in glioma. Methods Bioinformatics analysis was utilized to identify the expression of LINC00601 and to perform related survival analysis. Glioma cells were transfected with a control vector small interfering RNA (si-NC) or small interfering RNA LINC00601 (si-LINC00601). Cell proliferation was evaluated using the CCK-8 assay and plate colony formation assay. Cell migration and invasion were assessed using the Transwell assay. Protein expression was detected by Western blot analysis, and lncRNA levels were measured using quantitative real-time PCR (qRT-PCR). Results Bioinformatics analysis revealed that LINC00601 is associated with the pathological grade and prognosis of glioma, as evidenced by data from the TCGA and CGGA databases. In vivo experiments showed that LINC00601 knockdown inhibits the proliferation, migration, and invasion of U251 and U87 cells. Based on sequencing and Western blot results, this effect is thought to be linked to changes in Phosphorylated Signal Transducer and Activator of Transcription 3 (p-STAT3) expression. Additionally, in vitro knockdown of LINC00601 has been shown to inhibit glioma growth. Conclusions LINC00601, which facilitates glioma progression by modulating the p-STAT3 signaling pathway, could serve as a potential molecular target for glioma therapy. glioma lncRNA LINC00601 p-STAT3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Glioma is the most common intracranial malignancy, accounting for 80% of malignant brain tumors and 30% of brain tumors [1]. They are classified into several types: diffuse astrocytomas, oligodendrogliomas, other astrocytomas, ependymomas, mixed glial tumors, and other gliomas [2]. The annual incidence of glioma is approximately 6.04 cases per 100,000 people [3]. Although this rate is not high, the mortality rate is extremely high, warranting classification as "extremely dangerous." Owing to its invasive growth characteristics, the efficacy of surgical treatment for malignant glioma is severely limited; patients' postoperative survival time typically ranges from 12 to 15 months. Most patients die within two years, and the five-year survival rate is less than 5% [4]. Although new techniques and advances in research have significantly improved the clinical diagnosis, evaluation, treatment, and prognosis of glioma [5], most glioma patients exhibit resistance to radiotherapy and chemotherapy [6]. This resistance leads to treatments that can only partially delay the recurrence of glioma and prolong survival times; however, the therapeutic outcomes for some malignant glioma patients remain poor [7]. Therefore, the highly aggressive growth of gliomas has attracted increasing attention [8]. The search for effective molecular biological markers for glioma is currently one of the hotspots of glioma research and may facilitate early intervention and efficacy assessment in glioma treatment, thereby improving glioma prognosis [9]. Long noncoding RNAs (lncRNAs) are a class of noncoding RNA molecules located in the nucleus or cytoplasm. According to statistics, there are approximately 58,000 lncRNAs in the human genome [10]. LncRNAs are divided into five categories: sense lncRNAs, antisense lncRNAs, bidirectional lncRNAs, intragenic lncRNAs, and intergenic lncRNAs [11]. They are closely associated with nervous system tumors [12]. LncRNAs are expressed in mature tissues or cells of the nervous system, such as embryonic stem cells, brain tissue [13], retina [14], and neural cell subtypes [15], and their expression levels vary across different types of neural cells [16]. Increasing evidence suggests that lncRNAs can act through multiple pathways and play important roles in glioma development by regulating DNA methylation [17], histone modification [18], and chromatin remodeling [19]. For example, LINC02587 can regulate its promoter sequence through methylation and induce ferroptosis in gliomas via the CoQ-FSP1 pathway [20]. LSD1 binds to the 3' domain of the lncRNA HOTAIR to specifically remove monomethylation and demethylation marks from H3K4 [21]. The lncRNA birc3-ot can guide the RELA protein to the STC1 promoter, initiate STC1 transcription, and ultimately promote the progression of glioma [17]. The H19 gene was one of the first identified lncRNAs involved in the pathogenesis of multiple CNS tumors [22]. Zhang et al. reported that lncRNA HOTAIR expression is closely related to the pathological grade and prognosis of glioma. Targeted silencing of HOTAIR inhibited the formation of glioma cell clones and tumor growth and induced the G0/G1 phase arrest of glioma cells [23]. The above studies indicate that lncRNAs play crucial roles in glioma. Recent studies have reported that LINC00601 expression is increased in HCC, and mechanistic studies have revealed that LINC00601 promotes HCC cell growth through the MAPK signaling pathway [24]. However, the role of LINC00601 in gliomas remains unknown. The p-STAT3 signaling pathway plays an important role in gliomas. Elevated p-STAT3 activity is associated with increased proliferation, survival, and invasion of glioma cells, contributing to the aggressive nature [25]. Importantly, p-STAT3 has been identified as a promising therapeutic target. Inhibitors of this pathway have demonstrated potential in preclinical trials, showing reduced tumor growth and improved responses to conventional therapies [26]. These findings support the need for further exploration of p-STAT3 as both a prognostic marker and a therapeutic target in glioma treatment. However, the role of LINC00601 in gliomas has not been investigated, and its impact on the p-STAT3 signaling pathway also remains unclear. In this study, bioinformatics analysis revealed that LINC00601 is highly expressed in glioma tissues and that this high expression is correlated with a poor prognosis in glioma patients. Further experiments revealed that LINC00601 affects the proliferation, migration, and invasion abilities of glioma cells in vitro and promotes tumor formation in vivo. Moreover, our study revealed a mechanism by which LINC00601 regulates p-STAT3 expression to promote the invasive growth of glioma. These results indicate that LINC00601 acts as a tumor-promoting factor in glioma and may be a potential novel therapeutic target for glioma diagnosis, treatment, and prognosis evaluation. Materials and Methods Bioinformatics analysis Expression profiles and clinical sample data of glioma patients were downloaded from the China Glioma Genome Atlas (CGGA, www.CGGA.org ) and the Cancer Genome Atlas (TCGA) databases. Quantitative real-time PCR analysis Total RNA was extracted from cultured glioma cell lines using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from purified total RNA using the Thermoscript RT-PCR System (Takara) for first-strand cDNA synthesis. Briefly, each PCR reaction mixture, containing 10 ul of 2X SYBR-Green Master mix, 0.8 ul of sense and antisense primers (2.5 mM) and 5 ul of cDNA (10 ng), was run for 45 cycles with denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds and extension at 72°C for 30 seconds. For relative quantification, 2 −ΔΔCT method was adopted to calculate the relative expression levels of LINC00601 and GAPDH by subtracting the CT values of the control gene from the CT values of LINC00601 and GAPDH. GAPDH mRNA were used as an internal control. The primers used were showed as follows: The primers used were showed as follows: GAPDH: F: 5’-GGGAGCCAAAAGGGTCAT − 3’ and R: 5’-GTCCTTCCACGATACCAA-3’. LINC00601: F: 5’- TCAAATGACCAACGGTCTGA − 3’ and R: 5’- GAGGAAGCTGTCTGGGTGAG-3’. Cell culture procedures Glioma U251 and U87 cells, and normal human astrocytes (HEB) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 100 U/ml penicillin/streptomycin, at 37°C in a humidified atmosphere of 5% CO 2 . RNA interference (RNAi) analysis In vitro, LINC00601 expression was disrupted to observe its functional effect on glioma cells. Glioma cell lines were first seeded in 6-well plates with serum-free medium and incubated overnight, then ,5 µL of sh-control, sh-LINC00601 vectors were diluted into 250 µL Opti-MEM (Invitrogen). Additionally, 5 µL of Lipofectamine 2000 (Invitrogen) was diluted into 250 µL Opti-MEM. Both mixtures were incubated at room temperature for 5 min. The Lipofectamine 2000 mixture was then added to the vector mixture. After 6 hours of incubation, the transfection solution was replaced with 2 mL of medium containing 10% FBS. Finally, transfected cells receiving the designed treatment were collected for further studies. Cell proliferation Cell proliferation was tested using CCK-8. Cells were harvested 48 hours after transfection, adjusted to a concentration of 3×10^4 cells/mL, and placed into 96-well plates. Each well was seeded with 100 µL of cells, and 10 µL of CCK-8 solution was put at 0, 24, 48, and 72 hours after cell adherence. After adding the reagent, the cells were incubated at 37°C with 5% CO2 for 2 hours, and then the optical density (OD) was measured at 450 nm to assess cell proliferation. This procedure was performed three times. Cell migration assay and invasion assay The invasive ability of the cells was assessed by the Transwell assay, A 4–7% Matrigel solution was mixed with medium without FBS, added to the Transwell upper chamber, and placed in a 37℃ incubator for solidification. Then, 200 uL of the cell suspension and 500 µL of DMEM or MEM containing 20% FBS were added to the Transwell upper and lower chambers, respectively. After incubation at 37℃ and 5% CO2 for 48 hours, the medium was aspirated with a pipette, and the cells in the upper chamber were wiped then rinsed in PBS for 5 minutes three times, fixed with 4% paraformaldehyde for 15 minutes, and rinsed in PBS for three times. Finally, the cells were stained with 0. 1% crystal violet for 10 minutes. Cellular invasion into the lower chamber was observed under a microscope. The experiment was repeated three times. Tumor formation in nude mice Four-week-old male BALB/c-nu athymic nude mice were housed in the animal room of the Animal Experiment Center at Anhui Medical University. They were randomly divided into two groups: a negative control group and an experimental group. The body weight of each nude mouse was recorded. U87 cells from both experimental and control groups were washed twice with PBS, digested with trypsin, collected, and counted. After discarding the supernatant, the cells were resuspended in pre-cooled PBS to a final concentration of 5×10^7 cells/mL. The cells were then placed on ice in preparation for the following experiments. Select the left armpit of the nude mice, disinfect with an alcohol swab, and prepare a 1 mL syringe sterilized by ultraviolet irradiation. Inject 120 µL of cell suspension slowly into the left armpit of the nude mice. Ensure not to inject into the chest cavity, as this is critical for the experimental procedure. Keep the cells on ice during the operation. Subcutaneous tumor growth in nude mice was observed daily. Tumor size was measured every 7 days using vernier calipers to measure the tumor length (L) and width (W). Tumor volume (mm^3) was estimated using the formula V = 0.5LW^2. Data were recorded and processed to depict the tumor growth curve. After 28 days, the two groups of nude mice were euthanized by CO2 inhalation (excluding accidental deaths). Tumors were photographed, weighed, and measured for size. Tumor volume was estimated, and tumors were either stored at -80°C or fixed in 4% paraformaldehyde for further analysis. Statistical analysis Quantitative data were obtained from at least three independent experiments and are expressed as mean ± SD. Data were analyzed for multiple comparisons using Student tests or ANOVA. The relationship between LINC00601 and p-STAT3 expression in tissues was analyzed using Pearson correlation. Values of p < 0.05 were considered to indicate a statistically significant difference. (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001) Results Expression of LINC00601 in glioma tissues and its relationship with prognosis To explore whether the upregulation of LINC00601 is related to the pathological grade of glioma, we analyzed the TCGA and CGGA databases; we found that significant upregulation of LINC00601 expression was associated with increased malignancy in glioma (Fig. 1 A and 1 B). Furthermore, LINC00601 expression was significantly upregulated in recurrent glioma tissues compared with primary glioma tissues (Fig. 1 C and 1 D). Moreover, high expression of LINC00601 was associated with a poor prognosis in glioma patients (Fig. 1 E, 1 F, and 1 G). These results provide evidence that LINC00601 may be associated with glioma progression and prognosis. In vitro inhibition of glioma cell growth by LINC00601 knockdown To explore the functional roles of LINC00601, we transfected U251 and U87 human glioma cells with si-LINC00601 and verified the transfection efficiency via qRT‒PCR (Fig. 2 A). Next, we established a negative control group (si-NC) and an experimental group (si-LINC00601) and assessed differences in malignant biological characteristics such as the proliferation, migration, and invasion of glioma cells between these groups. The impact of LINC00601 knockdown on the viability of U251 and U87 cells was assessed via the CCK-8 assay. The results indicated that, compared with the shRNA control, LINC00601 knockdown significantly reduced cell viability (Fig. 2 B and 2 C). A colony formation assay demonstrated that LINC00601 knockdown significantly inhibited colony formation in glioma cells. Transwell experiments revealed a significant reduction in the number of migratory U251 and U87 glioma cells in the LINC00601 knockdown group compared with that in the shRNA control group (Fig. 2 D). Furthermore, LINC00601 knockdown significantly inhibited the invasion of U251 and U87 human glioma cells (Fig. 2 E). These findings suggest that LINC00601 knockdown suppresses the malignant phenotype of glioma cells. Bioinformatics analysis reveals an important relationship between LINC00601 and the p-STAT3 signaling pathway in gliomas For the U87 glioma cell lines we constructed, 10 samples from both the si-LINC00601 and si-NC groups were selected for transcriptome analysis. We observed differences in gene expression in the transcriptome data between U87 glioma cells transfected with si-LINC00601 and those transfected with si-NC (Fig. 3 A). These gene expression differences impact many biological processes, as demonstrated by GO enrichment analysis (Fig. 3 B). Additionally, KEGG pathway enrichment analysis indicated that, in glioma, LINC00601 predominantly interacts with the JAK/STAT, NOD-like receptor, and TNF signaling pathways (Fig. 3 C). We assessed the expression levels of STAT3 and p-STAT3 in both the control group and the si-LINC00601-treated U87 and U251 glioma cells via Western blot analysis (Fig. 3 D and 3 E) and confirmed that silencing LINC00601 significantly inhibited a key node of the JAK/STAT signaling pathway. Therefore, we hypothesized that LINC00601 influences glioma invasion by regulating the JAK/STAT signaling pathway. p-STAT3 mediates the tumor-suppressive effects of LINC00601 knockdown in glioma cells To investigate whether the tumor-promoting effects of LINC00601 are mediated by p-STAT3, U87 and U251 cells were transfected with Stattic (a potent STAT3 inhibitor that exerts its effects by inhibiting STAT3 phosphorylation at Y705 and S727), si-LINC00601, or si-LINC00601 + Stattic. Our results showed that Stattic can inhibit the proliferation of glioma cells and transfection with si-LINC00601 and combined with Stattic treatment enhances this inhibition. As shown here, Stattic increased the ability of si-LINC00601 to reduce the viability (Fig. 5 A and 5 B), proliferation (Fig. 5 C and 5 D), migration (Fig. 5 E and 5 F), and invasion (Fig. 5 G and 5 H) of U251 and U87 glioma cells. Therefore, these results suggest that LINC00601 may exert its oncogenic function in glioma cells through p-STAT3. LINC00601 gene knockdown inhibits tumor formation in nude mice in vivo U87 cells stably transfected with sh-NC or sh-LINC00601 were subcutaneously injected into the posterior flank of nude mice. The mice were euthanized and the tumor masses were removed 28 days after the injection. (B) Tumor volume was measured every 7 days via calipers. (A and C) The tumor tissues were excised and weighed. (D) The expression levels of LINC00601 in resected tumor tissues were determined via qRT‒PCR analysis. (E) H&E and Ki-67 staining of tumor tissues was performed. To investigate the effect of the LINC00601 gene in vivo, we used a lentiviral transduction method to establish stable control vector short hairpin RNA (sh-NC) and short hairpin RNA LINC00601 (sh-LINC00601) U87 cell lines in both groups. Two groups of cells suspended in matrix glue were injected subcutaneously into the underarms of two groups of nude mice to initiate tumor formation experiments. qRT‒PCR was used to verify the silencing efficiency of LINC00601 in the experimental group (Fig. 5 D). We evaluated tumor formation in nude mice. The results shown in the figure indicate that after LINC00601 expression was reduced, tumor size in nude mice was measured every 7 days. At 28 days, the tumor tissue was removed, and the results indicated that the tumors in the knockdown group were smaller than those in the experimental group (Fig. 5 A). LINC00601 knockdown significantly suppressed tumor growth, as evidenced by the reduced tumor volume (Fig. 5 B) and tumor weight (Fig. 5 C). H&E and Ki-67 staining were subsequently performed on the tumor tissue and revealed significantly lower levels of staining in the knockdown group than in the control group (Fig. 5 E). Thus, these results suggest that the inhibition of LINC00601 expression suppresses glioma cell growth in vivo. Discussion Glioma is a type of tumor derived from glial cells in the spine or brain and accounts for approximately 80% of malignant brain tumors [27]. At present, the treatment of glioma primarily relies on surgery supplemented by postoperative radiotherapy and chemotherapy. Owing to their invasive growth characteristics, gliomas cannot be completely removed by surgery [28]. Therefore, identifying effective biomarkers for the early diagnosis of glioma can improve patient treatment outcomes and prognosis. Through bioinformatics analysis and biological experiments, this study revealed that LINC00601 acts as a potential prognostic marker and oncogene in glioma. The LINC00601 gene, noted for its elevated expression in various cancers, is located on chromosome 10 at position 10q26.2. It spans 8,013 bases and is oriented on the minus strand. Y.-C. WANG et al. first demonstrated in vitro that LINC00601 promotes HCC cell proliferation, affects cell cycle distribution and inhibits apoptosis in the G1/G0 phase [24]. SHI X. et al. reported that LINC00601 expression may be associated with a poor prognosis in patients with esophageal squamous cell carcinoma [29]. In this study, we observed significant upregulation of LINC00601 in glioma, along with a strong correlation between its expression and histological grade. Elevated p-STAT3 activity has been associated with increased proliferation, survival, and invasion of glioma cells, contributing to the aggressive nature of these tumors [25]. Thus, LINC00601 may be related to the p-STAT3 signaling pathway, which needs to be confirmed by further study. Furthermore, our findings indicate that high LINC00601 expression is significantly associated with reduced overall survival and increased recurrence risk in glioma patients. Functionally, knockdown of LINC00601 significantly inhibited cell proliferation, colony formation, migration, and invasion in vitro and tumor growth in vivo. Overall, LINC00601 can be considered a potential prognostic marker and therapeutic target for gliomas. LncRNAs are RNA molecules that are more than 200 nucleotides in length and cannot be translated into proteins due to the lack of a promoter [30]. Although lncRNAs do not directly participate in protein coding, an increasing number of experimental findings have demonstrated that their abnormal expression leads to tumor cell development, which subsequently impacts prognosis and survival rates. For example, H19 lncRNA expression is significantly increased in many human malignant tumors, and elevated H19 expression is typically associated with a poor prognosis in cancer patients [31]. Ohgaki H et al. investigated autophagy-related lncRNAs in glioma patients and identified 10 such lncRNAs as independent prognostic factors [32]. Five of these lncRNAs (TP53TG1, ZNF674-AS1, COX10AS1, DDX11-AS1, and SBF2-AS1) were identified as adverse prognostic factors, whereas the other five (PCBP1)-AS1, DHRS4-AS1, GABPB1-AS1, MAPKAPK5-AS1, and MIR4453HG) were favorable prognostic factors [33]. In this study, using the TCGA and CGGA databases, we found that upregulation of LINC00601 expression is associated with increased malignancy and a poor prognosis in glioma patients. Additionally, LINC00601 expression was significantly higher in recurrent gliomas than in primary gliomas. These findings suggest that LINC00601 could serve as a potential prognostic marker and therapeutic target for glioma. LncRNAs play crucial roles in regulating cell proliferation, apoptosis, differentiation, and the response to hypoxia stress by actively participating in nuclear interference [34], transcriptional activation [35], and chromatin modification [28]. Consequently, they play key roles in the progression of glioma. Zhou, K et al. reported that the expression of the lncRNA NEAT1 is upregulated in glioma. It promotes glioma formation by inhibiting the expression of miR-132, thereby alleviating the negative regulatory effect of miR-132 on SOX2 [36]. In primary GBM tumors, SChLAP1 expressed at high levels interacts with heterogeneous nuclear ribonucleoprotein L (HNRNPL), leading to increased binding of HNRNPL to α-actinin-4 (ACTN4). This interaction inhibits the degradation of ACTN4, which in turn increases the activity of nuclear factor κB (NF-κB) signaling, a pathway associated with cancer progression [37]. Here, we observed that the knockdown of LINC00601 suppressed the proliferation, migration, and invasion of glioma cells. Furthermore, knockdown of LINC00601 significantly inhibited glioma tumor growth in vivo. These findings suggest that LINC00601 plays a cancer-promoting role both in vitro and in vivo. As previously discussed, the expression of lncRNAs in gliomas differs significantly from that in normal tissues. Research has confirmed that lncRNAs are involved in various signaling pathways, influencing the proliferation, migration, invasion, and other behaviors of glioma cells, as well as the regulation of the tumor microenvironment. Consequently, lncRNAs may serve as therapeutic targets by modulating these pathways. The expression of the lncRNA solute carrier family 8 member A1 antisense RNA 1 (SLC8A1-AS1) is highly upregulated in glioma tissues. This RNA promotes cell proliferation, colony formation, migration, and invasion by activating the Wnt/β-catenin signaling pathway [38]. LINC01410 activates the Notch signaling pathway and accelerates glioma progression by sponging miR-506-3p and upregulating the NOTCH2 receptor [39]. The roles of lncRNAs in glioma mechanisms vary, and their underlying mechanisms have not yet been fully elucidated, so further in-depth studies are needed. In our study, by analyzing transcriptome data for normal U87 cells and U87 cells with LINC00601 knockdown, we discovered that LINC00601 primarily influences the JAK/STAT, NOD-like receptor, and TNF signaling pathways, along with associated biological behaviors. Our Western blot analysis also revealed that LINC00601 knockdown significantly inhibited a key node of the JAK/STAT signaling pathway. Therefore, we hypothesized that LINC00601 modulates glioma biological behavior by regulating the p-STAT3 signaling pathway. We discovered that Stattic alone can suppress the proliferation of glioma cells and that the combined application of si-LINC00601 and Stattic enhances this inhibitory effect. These findings confirmed that LINC00601 promotes glioma cell proliferation and invasion via the p-STAT3 signaling pathway. In summary, our study revealed that LINC00601 is abnormally upregulated in gliomas and may serve as a valuable prognostic marker for glioma patients. LINC00601 plays a crucial role in glioma regulation by modulating the p-STAT3 pathway, thereby providing a new theoretical basis for glioma treatment. Abbreviations lncRNAs long non-coding RNAs siRNA small interfering RNA shRNA short hairpin RNA qRT-PCR quantitative real-time PCR si-NC control vector siRNA si-LINC00601 siRNA LINC00601 p-STAT3 Transducer and Activator of Transcription 3 Declarations Competing Interests The authors have no relevant financial or non-financial interests to disclose. Ethics approval All experiments were in agreement with the guidelines for the Care and Use of Laboratory Animals and were approved by the Ethics and Welfare Committee for Animal Research at the Second Affiliated Hospital of Anhui Medical University. Funding This work was supported by the Research Project Fund of Natural Science from Anhui Medical University, China (Grant No. KJ2021A0326). Author Contribution All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Chao Ma, Linqi WANG and Renwu Zhang . The first draft of the manuscript was written by Renwu Zhang and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data Availability The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. References de Robles P, Fiest KM, Frolkis AD, Pringsheim T, Atta C, St Germaine-Smith C, Day L, Lam D, Jette N: The worldwide incidence and prevalence of primary brain tumors: a systematic review and meta-analysis . Neuro Oncol 2015, 17 (6):776-783. Wesseling P, Capper D: WHO 2016 Classification of gliomas . Neuropathol Appl Neurobiol 2018, 44 (2):139-150. Ostrom QT, Price M, Neff C, Cioffi G, Waite KA, Kruchko C, Barnholtz-Sloan JS: CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2016-2020 . Neuro Oncol 2023, 25 (Supplement_4):iv1-iv99. Ostrom QT, Gittleman H, Liao P, Rouse C, Chen Y, Dowling J, Wolinsky Y, Kruchko C, Barnholtz-Sloan J: CBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in 2007-2011 . Neuro Oncol 2014, 16 Suppl 4 (Suppl 4):iv1-63. Kleber S, Sancho-Martinez I, Wiestler B, Beisel A, Gieffers C, Hill O, Thiemann M, Mueller W, Sykora J, Kuhn A et al : Yes and PI3K bind CD95 to signal invasion of glioblastoma . Cancer Cell 2008, 13 (3):235-248. Gillard AG, Shin DH, Hampton LA, Lopez-Rivas A, Parthasarathy A, Fueyo J, Gomez-Manzano C: Targeting Innate Immunity in Glioma Therapy . Int J Mol Sci 2024, 25 (2). Rezaee A, Tehrany PM, Tirabadi FJ, Sanadgol N, Karimi AS, Ajdari A, Eydivandi S, Etemad S, Rajabi R, Rahmanian P et al : Epigenetic regulation of temozolomide resistance in human cancers with an emphasis on brain tumors: Function of non-coding RNAs . Biomed Pharmacother 2023, 165 :115187. Yang W, Lin L, Lu T, Yu H, Zhang S: Identification of EMT-associated prognostic features among grade II/III gliomas . Sci Rep 2024, 14 (1):2822. Liang M, Gao C, Wang Y, Gong W, Fu S, Cui L, Zhou Z, Chu X, Zhang Y, Liu Q et al : Enhanced blood-brain barrier penetration and glioma therapy mediated by T7 peptide-modified low-density lipoprotein particles . Drug Deliv 2018, 25 (1):1652-1663. Iyer MK, Niknafs YS, Malik R, Singhal U, Sahu A, Hosono Y, Barrette TR, Prensner JR, Evans JR, Zhao S et al : The landscape of long noncoding RNAs in the human transcriptome . Nat Genet 2015, 47 (3):199-208. Mattick JS, Amaral PP, Carninci P, Carpenter S, Chang HY, Chen LL, Chen R, Dean C, Dinger ME, Fitzgerald KA et al : Long non-coding RNAs: definitions, functions, challenges and recommendations . Nat Rev Mol Cell Biol 2023, 24 (6):430-447. Li W, Wang YY, Xiao L, Ding J, Wang L, Wang F, Sun T: Mysterious long noncoding RNAs and their relationships to human disease . Front Mol Biosci 2022, 9 :950408. Ghosh A, Som A: Network analysis of transcriptomic data uncovers molecular signatures and the interplay of mRNAs, lncRNAs, and miRNAs in human embryonic stem cells . Differentiation 2023:100738. Perisset S, Potilinski MC, Gallo JE: Role of Lnc-RNAs in the Pathogenesis and Development of Diabetic Retinopathy . Int J Mol Sci 2023, 24 (18). Zhao J, Le M, Li J, Huang Q, Chen H, Zhang W, Mao H, Sun Q, Li A, Zhao Y et al : LINC00938 alleviates hypoxia ischemia encephalopathy induced neonatal brain injury by regulating oxidative stress and inhibiting JNK/p38 MAPK signaling pathway . Exp Neurol 2023, 367 :114449. Wei C, Xiao T, Zhang P, Wang Z, Chen X, Zhang L, Yao M, Chen R, Wang H: Deep profiling of the novel intermediate-size noncoding RNAs in intraerythrocytic Plasmodium falciparum . PLoS One 2014, 9 (4):e92946. Wang R, Li Q, Chu X, Li N, Liang H, He F: LncBIRC3-OT promotes the malignant progression of glioma by interacting with RELA to upregulate stanniocalcin-1 expression . Heliyon 2023, 9 (11):e21777. Yue B, Chen J, Bao T, Zhang Y, Yang L, Zhang Z, Wang Z, Zhu C: Chromosomal copy number amplification-driven Linc01711 contributes to gastric cancer progression through histone modification-mediated reprogramming of cholesterol metabolism . Gastric Cancer 2024. Tsuruta Y, Senmatsu S, Oe H, Hoffman CS, Hirota K: Metabolic stress-induced long ncRNA transcription governs the formation of meiotic DNA breaks in the fission yeast fbp1 gene . PLoS One 2024, 19 (1):e0294191. Wang Z, Cui Y, Wang F, Xu L, Yan Y, Tong X, Yan H: DNA methylation-regulated LINC02587 inhibits ferroptosis and promotes the progression of glioma cells through the CoQ-FSP1 pathway . BMC Cancer 2023, 23 (1):989. Zhao J, Jin W, Yi K, Wang Q, Zhou J, Tan Y, Xu C, Xiao M, Hong B, Xu F et al : Combination LSD1 and HOTAIR-EZH2 inhibition disrupts cell cycle processes and induces apoptosis in glioblastoma cells . Pharmacol Res 2021, 171 :105764. Nandhu MS, Behera P, Bhaskaran V, Longo SL, Barrera-Arenas LM, Sengupta S, Rodriguez-Gil DJ, Chiocca EA, Viapiano MS: Development of a Function-Blocking Antibody Against Fibulin-3 as a Targeted Reagent for Glioblastoma . Clin Cancer Res 2018, 24 (4):821-833. Li X, Ma C, Zhang L, Li N, Zhang X, He J, He R, Shao M, Wang J, Kang L et al : LncRNAAC132217.4, a KLF8-regulated long non-coding RNA, facilitates oral squamous cell carcinoma metastasis by upregulating IGF2 expression . Cancer letters 2017, 407 :45-56. Wang YC, Hu BH, Zhang WW, Li MM, Zhao X, Sui MH: Linc00601 upregulation promotes hepatocellular carcinoma development by activating MAPK signaling pathway . Eur Rev Med Pharmacol Sci 2020, 24 (11):6039-6045. Liu Z, Ren Z, Zhang C, Qian R, Wang H, Wang J, Zhang W, Liu B, Lian X, Wang Y et al : ELK3: A New Molecular Marker for the Diagnosis and Prognosis of Glioma . Front Oncol 2021, 11 :608748. Zhang CC, Wu T, Guan L, Wang YJ, Yao RQ, Gao DS, Li F: Effects of STAT3 Inhibitor BP-1-102 on The Proliferation, Invasiveness, Apoptosis and Neurosphere Formation of Glioma Cells in Vitro . Cell Biochem Biophys 2022, 80 (4):723-735. Montella L, Cuomo M, Del Gaudio N, Buonaiuto M, Costabile D, Visconti R, Di Risi T, Vinciguerra R, Trio F, Ferraro S et al : Epigenetic alterations in glioblastomas: Diagnostic, prognostic and therapeutic relevance . Int J Cancer 2023, 153 (3):476-488. Malta TM, Sabedot TS, Morosini NS, Datta I, Garofano L, Vallentgoed WR, Varn FS, Aldape K, D'Angelo F, Bakas S et al : The epigenetic evolution of glioma is determined by the IDH1 mutation status and treatment regimen . Cancer Res 2023. Shi X, Li Y, Sun Y, Zhao X, Sun X, Gong T, Liang Z, Ma Y, Zhang X: Genome-wide analysis of lncRNAs, miRNAs, and mRNAs forming a prognostic scoring system in esophageal squamous cell carcinoma . PeerJ 2020, 8 :e8368. Kopp F, Mendell JT: Functional Classification and Experimental Dissection of Long Noncoding RNAs . Cell 2018, 172 (3):393-407. Darmadi D, Chugaeva UY, Saleh RO, Hjazi A, Saleem HM, Ghildiyal P, Alwaily ER, Alawadi A, Alnajar MJ, Ihsan A: Critical roles of long noncoding RNA H19 in cancer . Cell Biochem Funct 2024, 42 (3):e4018. Ali MA, Shaker OG, Khalefa AA, Abdelwahed MY, Ali E, Ezzat EM, Elghobary HA, Awaji AA, Fouad NA, Ayoub SE: Serum long noncoding RNAs FAS-AS1 & PVT1 are novel biomarkers for systemic lupus erythematous . Br J Biomed Sci 2020, 77 (4):208-212. Ohgaki H, Dessen P, Jourde B, Horstmann S, Nishikawa T, Di Patre PL, Burkhard C, Schuler D, Probst-Hensch NM, Maiorka PC et al : Genetic pathways to glioblastoma: a population-based study . Cancer Res 2004, 64 (19):6892-6899. Lee B, Sahoo A, Marchica J, Holzhauser E, Chen X, Li JL, Seki T, Govindarajan SS, Markey FB, Batish M et al : The long noncoding RNA SPRIGHTLY acts as an intranuclear organizing hub for pre-mRNA molecules . Sci Adv 2017, 3 (5):e1602505. Yu Q, Cai B, Zhang Y, Xu J, Liu D, Zhang X, Han Z, Ma Y, Jiao L, Gong M et al : Long non-coding RNA LHX1-DT regulates cardiomyocyte differentiation through H2A.Z-mediated LHX1 transcriptional activation . iScience 2023, 26 (11):108051. Zhou K, Zhang C, Yao H, Zhang X, Zhou Y, Che Y, Huang Y: Knockdown of long non-coding RNA NEAT1 inhibits glioma cell migration and invasion via modulation of SOX2 targeted by miR-132 . Molecular cancer 2018, 17 (1):105. Ji J, Xu R, Ding K, Bao G, Zhang X, Huang B, Wang X, Martinez A, Wang X, Li G et al : Long Noncoding RNA SChLAP1 Forms a Growth-Promoting Complex with HNRNPL in Human Glioblastoma through Stabilization of ACTN4 and Activation of NF-kappaB Signaling . Clin Cancer Res 2019, 25 (22):6868-6881. He L, Yang H, Zhu XL, Zhang Y, Lv K: Knockdown of long non-coding RNA SLC8A1-AS1 attenuates cell invasion and migration in glioma via suppression of Wnt/beta-catenin signaling pathways . Brain Res Bull 2021, 176 :112-120. Zhao X, Shen F, Yang B: LncRNA LINC01410 Induced by MYC Accelerates Glioma Progression via Sponging miR-506-3p and Modulating NOTCH2 Expression to Motivate Notch Signaling Pathway . Cell Mol Neurobiol 2022, 42 (5):1513-1521. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 21 Jun, 2025 Read the published version in Cancer Cell International → Version 1 posted Editorial decision: Revision requested 11 Oct, 2024 Reviews received at journal 08 Oct, 2024 Reviewers agreed at journal 07 Oct, 2024 Reviews received at journal 30 Sep, 2024 Reviewers agreed at journal 22 Sep, 2024 Reviewers agreed at journal 20 Sep, 2024 Reviewers invited by journal 13 Sep, 2024 Editor assigned by journal 23 Aug, 2024 Submission checks completed at journal 23 Aug, 2024 First submitted to journal 21 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4952967","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":357461474,"identity":"682613c9-310d-487f-bae4-1d877628501d","order_by":0,"name":"Chao Ma","email":"","orcid":"","institution":"The Second Affiliated Hospital of Anhui Medical University, China","correspondingAuthor":false,"prefix":"","firstName":"Chao","middleName":"","lastName":"Ma","suffix":""},{"id":357461475,"identity":"a21527c3-3e13-44e8-bce1-32ee8559742b","order_by":1,"name":"Linqi Wang","email":"","orcid":"","institution":"The Second Affiliated Hospital of Anhui Medical University, China","correspondingAuthor":false,"prefix":"","firstName":"Linqi","middleName":"","lastName":"Wang","suffix":""},{"id":357461476,"identity":"e071d3e8-87aa-4fb2-b548-a59ba835b0db","order_by":2,"name":"Renwu Zhang","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Renwu","middleName":"","lastName":"Zhang","suffix":""},{"id":357461477,"identity":"6bd1480a-d391-4c60-be77-0a35ac313fc2","order_by":3,"name":"Tong Li","email":"","orcid":"","institution":"The Second Affiliated Hospital of Anhui Medical University, China","correspondingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Li","suffix":""},{"id":357461478,"identity":"b830f7e8-8b96-47a8-8075-961f484008eb","order_by":4,"name":"Peng Li","email":"","orcid":"","institution":"The Second Affiliated Hospital of Anhui Medical University, China","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Li","suffix":""},{"id":357461479,"identity":"4abbf21c-0d39-4812-b638-7402e3800232","order_by":5,"name":"Yuxiang Ding","email":"","orcid":"","institution":"The Second Affiliated Hospital of Anhui Medical University, China","correspondingAuthor":false,"prefix":"","firstName":"Yuxiang","middleName":"","lastName":"Ding","suffix":""},{"id":357461480,"identity":"1ac914ef-ca9b-4189-ad9b-657e48f2f05d","order_by":6,"name":"Dejun Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwklEQVRIiWNgGAWjYHACA4MPBjZ2/MzMhx8QrcVwRkVasmQ7W5oB0VqYec4cZtxwnkdBgjj1N5I3FPC2MTMbH+ZhMGCosYkmQktagYFkGxuf2WHeAw8YjqXlNhDSYnYjx8DAsI2H2ewwX4IBY8NhIrUktkkwbm7mMZAgXsuBMwaMG5iJ1WJ/5lmBYUNFQrLEYWAgJxDjF8n25G3Gfwz+2/H3Hz784EONDWEtQMCGiMEEIpSDAPMDIhWOglEwCkbBSAUASqk/FHuGzxcAAAAASUVORK5CYII=","orcid":"","institution":"The Second Affiliated Hospital of Anhui Medical University, China","correspondingAuthor":true,"prefix":"","firstName":"Dejun","middleName":"","lastName":"Wu","suffix":""},{"id":357461481,"identity":"12cd8f67-2a4f-45e4-a42a-13a6162ca547","order_by":7,"name":"Yinyan Wang","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yinyan","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-08-21 16:21:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4952967/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4952967/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12935-025-03735-9","type":"published","date":"2025-06-21T15:57:55+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65173731,"identity":"7c6cd619-e24e-4d26-9597-2030a89cf4a9","added_by":"auto","created_at":"2024-09-24 11:36:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":478935,"visible":true,"origin":"","legend":"\u003cp\u003eUpregulation of LINC00601 in glioma tissues and cell lines. (A) Differential expression of LINC00601 in glioma tissues stratified by clinical grade from the CGGA database (low grade: n = 523; high grade: n = 166). (B) Differential expression of LINC00601 in glioma tissues categorized by disease status from the CGGA database (primary: n = 662; recurrent: n = 27). (C) Relationship between LINC00601 expression and glioma clinical grade according to the TCGA database (low grade: n = 443; high grade: n = 249). (D) Differential expression of LINC00601 in glioma tissues grouped based on disease status from the TCGA database (primary: n = 422; recurrent: n = 271). (E, F, and G) Survival curves of glioma patients classified by LINC00601 expression level from the TCGA database (lowLINC00601: n = 310; highLINC00601: n = 310).\u003c/p\u003e","description":"","filename":"Figer1.png","url":"https://assets-eu.researchsquare.com/files/rs-4952967/v1/f0a079752f8c58ae5a0ce0f4.png"},{"id":65173535,"identity":"34036538-7e58-482b-bfbc-8c9306bc7c40","added_by":"auto","created_at":"2024-09-24 11:28:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5783064,"visible":true,"origin":"","legend":"\u003cp\u003eLINC00601 knockdown suppresses the proliferation, migration, and invasion of glioma cells. U87 and U251 cells were transfected with si-NC or si-LINC00601. (A) qRT‒PCR analysis was used to measure the expression level of LINC00601 in U87 and U251 cells. (B) The optical density (OD) at 450 nm was measured at 24, 48, and 72 hours after transfection of U87 and U251 cells. (D and G) Colony numbers in U87 and U251 cells were evaluated via a colony formation assay. (E, F, H, and I) The migration and invasion of U87 and U251 cells were assessed via Transwell migration and invasion assays.\u003c/p\u003e","description":"","filename":"Figer2.png","url":"https://assets-eu.researchsquare.com/files/rs-4952967/v1/ffc07b300aaccd5c2a3c9c1f.png"},{"id":65173537,"identity":"13ea7f0e-7caf-4143-b7d9-b20d766371ea","added_by":"auto","created_at":"2024-09-24 11:28:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1275981,"visible":true,"origin":"","legend":"\u003cp\u003eBioinformatics analysis of LINC00601 and its interaction with JAK/STAT signaling pathway components. (A) Volcano plot showing differentially expressed genes (DEGs) in LINC00601-knockdown glioma cells compared with normal glioma cells. (B) GO functional enrichment analysis of the DEGs. (C) KEGG functional enrichment analysis of the DEGs. (D and E) Western blot analysis of associated proteins (STAT3 and p-STAT3) in glioma cells transfected with si-LINC00601 or si-NC.\u003c/p\u003e","description":"","filename":"Figer3.png","url":"https://assets-eu.researchsquare.com/files/rs-4952967/v1/763d3525968fee286d1d6f01.png"},{"id":65173539,"identity":"a3c0e359-dcab-4ce5-8d8d-87045fcccdf4","added_by":"auto","created_at":"2024-09-24 11:28:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":11599189,"visible":true,"origin":"","legend":"\u003cp\u003eSTAT3 inhibition enhanced the effects of LINC00601 knockdown on the proliferation, migration and invasion of glioma cells. U87 and U251 cells were transfected with si-NC, si-LINC00601, Stattic, or si-LINC00601 + Stattic. (A and B) Cell viability was assessed by a CCK-8 assay. (C and D) Cell colony number determined by the colony formation assay. (E and F) Migration and (G and H) Transwell invasion assays.\u003c/p\u003e","description":"","filename":"Figer4.png","url":"https://assets-eu.researchsquare.com/files/rs-4952967/v1/2ff4dadebdc56103a9bc4631.png"},{"id":65173538,"identity":"9f74538c-cca5-43b3-ad69-63d0f6ed8ba4","added_by":"auto","created_at":"2024-09-24 11:28:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3577116,"visible":true,"origin":"","legend":"\u003cp\u003eLINC00601 knockdown suppressed tumor growth in glioma in vivo.\u003c/p\u003e","description":"","filename":"Figer5.png","url":"https://assets-eu.researchsquare.com/files/rs-4952967/v1/bf1c4aa81334c2e5d41b80b8.png"},{"id":85231506,"identity":"875c03be-75ed-4bff-840d-d74133476e4a","added_by":"auto","created_at":"2025-06-23 16:08:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":22674646,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4952967/v1/5373f169-c6f1-465c-875b-74eada6eaa68.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eLINC00601 promotes the progression of glioma via the p-STAT3 signaling pathway\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eGlioma is the most common intracranial malignancy, accounting for 80% of malignant brain tumors and 30% of brain tumors [1]. They are classified into several types: diffuse astrocytomas, oligodendrogliomas, other astrocytomas, ependymomas, mixed glial tumors, and other gliomas [2]. The annual incidence of glioma is approximately 6.04 cases per 100,000 people [3]. Although this rate is not high, the mortality rate is extremely high, warranting classification as \"extremely dangerous.\" Owing to its invasive growth characteristics, the efficacy of surgical treatment for malignant glioma is severely limited; patients' postoperative survival time typically ranges from 12 to 15 months. Most patients die within two years, and the five-year survival rate is less than 5% [4]. Although new techniques and advances in research have significantly improved the clinical diagnosis, evaluation, treatment, and prognosis of glioma [5], most glioma patients exhibit resistance to radiotherapy and chemotherapy [6]. This resistance leads to treatments that can only partially delay the recurrence of glioma and prolong survival times; however, the therapeutic outcomes for some malignant glioma patients remain poor [7]. Therefore, the highly aggressive growth of gliomas has attracted increasing attention [8]. The search for effective molecular biological markers for glioma is currently one of the hotspots of glioma research and may facilitate early intervention and efficacy assessment in glioma treatment, thereby improving glioma prognosis [9].\u003c/p\u003e \u003cp\u003eLong noncoding RNAs (lncRNAs) are a class of noncoding RNA molecules located in the nucleus or cytoplasm. According to statistics, there are approximately 58,000 lncRNAs in the human genome [10]. LncRNAs are divided into five categories: sense lncRNAs, antisense lncRNAs, bidirectional lncRNAs, intragenic lncRNAs, and intergenic lncRNAs [11]. They are closely associated with nervous system tumors [12]. LncRNAs are expressed in mature tissues or cells of the nervous system, such as embryonic stem cells, brain tissue [13], retina [14], and neural cell subtypes [15], and their expression levels vary across different types of neural cells [16]. Increasing evidence suggests that lncRNAs can act through multiple pathways and play important roles in glioma development by regulating DNA methylation [17], histone modification [18], and chromatin remodeling [19]. For example, LINC02587 can regulate its promoter sequence through methylation and induce ferroptosis in gliomas via the CoQ-FSP1 pathway [20]. LSD1 binds to the 3' domain of the lncRNA HOTAIR to specifically remove monomethylation and demethylation marks from H3K4 [21]. The lncRNA birc3-ot can guide the RELA protein to the STC1 promoter, initiate STC1 transcription, and ultimately promote the progression of glioma [17]. The H19 gene was one of the first identified lncRNAs involved in the pathogenesis of multiple CNS tumors [22]. Zhang et al. reported that lncRNA HOTAIR expression is closely related to the pathological grade and prognosis of glioma. Targeted silencing of HOTAIR inhibited the formation of glioma cell clones and tumor growth and induced the G0/G1 phase arrest of glioma cells [23]. The above studies indicate that lncRNAs play crucial roles in glioma. Recent studies have reported that LINC00601 expression is increased in HCC, and mechanistic studies have revealed that LINC00601 promotes HCC cell growth through the MAPK signaling pathway [24]. However, the role of LINC00601 in gliomas remains unknown.\u003c/p\u003e \u003cp\u003eThe p-STAT3 signaling pathway plays an important role in gliomas. Elevated p-STAT3 activity is associated with increased proliferation, survival, and invasion of glioma cells, contributing to the aggressive nature [25]. Importantly, p-STAT3 has been identified as a promising therapeutic target. Inhibitors of this pathway have demonstrated potential in preclinical trials, showing reduced tumor growth and improved responses to conventional therapies [26]. These findings support the need for further exploration of p-STAT3 as both a prognostic marker and a therapeutic target in glioma treatment. However, the role of LINC00601 in gliomas has not been investigated, and its impact on the p-STAT3 signaling pathway also remains unclear.\u003c/p\u003e \u003cp\u003eIn this study, bioinformatics analysis revealed that LINC00601 is highly expressed in glioma tissues and that this high expression is correlated with a poor prognosis in glioma patients. Further experiments revealed that LINC00601 affects the proliferation, migration, and invasion abilities of glioma cells in vitro and promotes tumor formation in vivo. Moreover, our study revealed a mechanism by which LINC00601 regulates p-STAT3 expression to promote the invasive growth of glioma. These results indicate that LINC00601 acts as a tumor-promoting factor in glioma and may be a potential novel therapeutic target for glioma diagnosis, treatment, and prognosis evaluation.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cp\u003eExpression profiles and clinical sample data of glioma patients were downloaded from the China Glioma Genome Atlas (CGGA, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.CGGA.org\" target=\"_blank\"\u003ewww.CGGA.org\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.CGGA.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the Cancer Genome Atlas (TCGA) databases.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cultured glioma cell lines using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from purified total RNA using the Thermoscript RT-PCR System (Takara) for first-strand cDNA synthesis. Briefly, each PCR reaction mixture, containing 10 ul of 2X SYBR-Green Master mix, 0.8 ul of sense and antisense primers (2.5 mM) and 5 ul of cDNA (10 ng), was run for 45 cycles with denaturation at 95\u0026deg;C for 15 seconds, annealing at 60\u0026deg;C for 30 seconds and extension at 72\u0026deg;C for 30 seconds. For relative quantification, 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method was adopted to calculate the relative expression levels of LINC00601 and GAPDH by subtracting the CT values of the control gene from the CT values of LINC00601 and GAPDH. GAPDH mRNA were used as an internal control. The primers used were showed as follows: The primers used were showed as follows: GAPDH: F: 5\u0026rsquo;-GGGAGCCAAAAGGGTCAT\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo; and R: 5\u0026rsquo;-GTCCTTCCACGATACCAA-3\u0026rsquo;. LINC00601: F: 5\u0026rsquo;- TCAAATGACCAACGGTCTGA\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo; and R: 5\u0026rsquo;- GAGGAAGCTGTCTGGGTGAG-3\u0026rsquo;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell culture procedures\u003c/h2\u003e \u003cp\u003eGlioma U251 and U87 cells, and normal human astrocytes (HEB) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were cultured in Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 100 U/ml penicillin/streptomycin, at 37\u0026deg;C in a humidified atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRNA interference (RNAi) analysis\u003c/h2\u003e \u003cp\u003eIn vitro, LINC00601 expression was disrupted to observe its functional effect on glioma cells. Glioma cell lines were first seeded in 6-well plates with serum-free medium and incubated overnight, then ,5 \u0026micro;L of sh-control, sh-LINC00601 vectors were diluted into 250 \u0026micro;L Opti-MEM (Invitrogen). Additionally, 5 \u0026micro;L of Lipofectamine 2000 (Invitrogen) was diluted into 250 \u0026micro;L Opti-MEM. Both mixtures were incubated at room temperature for 5 min. The Lipofectamine 2000 mixture was then added to the vector mixture. After 6 hours of incubation, the transfection solution was replaced with 2 mL of medium containing 10% FBS. Finally, transfected cells receiving the designed treatment were collected for further studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation\u003c/h2\u003e \u003cp\u003eCell proliferation was tested using CCK-8. Cells were harvested 48 hours after transfection, adjusted to a concentration of 3\u0026times;10^4 cells/mL, and placed into 96-well plates. Each well was seeded with 100 \u0026micro;L of cells, and 10 \u0026micro;L of CCK-8 solution was put at 0, 24, 48, and 72 hours after cell adherence. After adding the reagent, the cells were incubated at 37\u0026deg;C with 5% CO2 for 2 hours, and then the optical density (OD) was measured at 450 nm to assess cell proliferation. This procedure was performed three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell migration assay and invasion assay\u003c/h2\u003e \u003cp\u003eThe invasive ability of the cells was assessed by the Transwell assay, A 4\u0026ndash;7% Matrigel solution was mixed with medium without FBS, added to the Transwell upper chamber, and placed in a 37℃ incubator for solidification. Then, 200 uL of the cell suspension and 500 \u0026micro;L of DMEM or MEM containing 20% FBS were added to the Transwell upper and lower chambers, respectively. After incubation at 37℃ and 5% CO2 for 48 hours, the medium was aspirated with a pipette, and the cells in the upper chamber were wiped then rinsed in PBS for 5 minutes three times, fixed with 4% paraformaldehyde for 15 minutes, and rinsed in PBS for three times. Finally, the cells were stained with 0. 1% crystal violet for 10 minutes. Cellular invasion into the lower chamber was observed under a microscope. The experiment was repeated three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTumor formation in nude mice\u003c/h2\u003e \u003cp\u003eFour-week-old male BALB/c-nu athymic nude mice were housed in the animal room of the Animal Experiment Center at Anhui Medical University. They were randomly divided into two groups: a negative control group and an experimental group. The body weight of each nude mouse was recorded. U87 cells from both experimental and control groups were washed twice with PBS, digested with trypsin, collected, and counted. After discarding the supernatant, the cells were resuspended in pre-cooled PBS to a final concentration of 5\u0026times;10^7 cells/mL. The cells were then placed on ice in preparation for the following experiments. Select the left armpit of the nude mice, disinfect with an alcohol swab, and prepare a 1 mL syringe sterilized by ultraviolet irradiation. Inject 120 \u0026micro;L of cell suspension slowly into the left armpit of the nude mice. Ensure not to inject into the chest cavity, as this is critical for the experimental procedure. Keep the cells on ice during the operation. Subcutaneous tumor growth in nude mice was observed daily. Tumor size was measured every 7 days using vernier calipers to measure the tumor length (L) and width (W). Tumor volume (mm^3) was estimated using the formula V\u0026thinsp;=\u0026thinsp;0.5LW^2. Data were recorded and processed to depict the tumor growth curve. After 28 days, the two groups of nude mice were euthanized by CO2 inhalation (excluding accidental deaths). Tumors were photographed, weighed, and measured for size. Tumor volume was estimated, and tumors were either stored at -80\u0026deg;C or fixed in 4% paraformaldehyde for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eQuantitative data were obtained from at least three independent experiments and are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Data were analyzed for multiple comparisons using Student tests or ANOVA. The relationship between LINC00601 and p-STAT3 expression in tissues was analyzed using Pearson correlation. Values of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to indicate a statistically significant difference. (*\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ** \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; *** \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; **** \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001)\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eExpression of LINC00601 in glioma tissues and its relationship with prognosis\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo explore whether the upregulation of LINC00601 is related to the pathological grade of glioma, we analyzed the TCGA and CGGA databases; we found that significant upregulation of LINC00601 expression was associated with increased malignancy in glioma (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Furthermore, LINC00601 expression was significantly upregulated in recurrent glioma tissues compared with primary glioma tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Moreover, high expression of LINC00601 was associated with a poor prognosis in glioma patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). These results provide evidence that LINC00601 may be associated with glioma progression and prognosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro inhibition of glioma cell growth by LINC00601 knockdown\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo explore the functional roles of LINC00601, we transfected U251 and U87 human glioma cells with si-LINC00601 and verified the transfection efficiency via qRT‒PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Next, we established a negative control group (si-NC) and an experimental group (si-LINC00601) and assessed differences in malignant biological characteristics such as the proliferation, migration, and invasion of glioma cells between these groups. The impact of LINC00601 knockdown on the viability of U251 and U87 cells was assessed via the CCK-8 assay. The results indicated that, compared with the shRNA control, LINC00601 knockdown significantly reduced cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). A colony formation assay demonstrated that LINC00601 knockdown significantly inhibited colony formation in glioma cells. Transwell experiments revealed a significant reduction in the number of migratory U251 and U87 glioma cells in the LINC00601 knockdown group compared with that in the shRNA control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Furthermore, LINC00601 knockdown significantly inhibited the invasion of U251 and U87 human glioma cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). These findings suggest that LINC00601 knockdown suppresses the malignant phenotype of glioma cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis reveals an important relationship between LINC00601 and the p-STAT3 signaling pathway in gliomas\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor the U87 glioma cell lines we constructed, 10 samples from both the si-LINC00601 and si-NC groups were selected for transcriptome analysis. We observed differences in gene expression in the transcriptome data between U87 glioma cells transfected with si-LINC00601 and those transfected with si-NC (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). These gene expression differences impact many biological processes, as demonstrated by GO enrichment analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Additionally, KEGG pathway enrichment analysis indicated that, in glioma, LINC00601 predominantly interacts with the JAK/STAT, NOD-like receptor, and TNF signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). We assessed the expression levels of STAT3 and p-STAT3 in both the control group and the si-LINC00601-treated U87 and U251 glioma cells via Western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) and confirmed that silencing LINC00601 significantly inhibited a key node of the JAK/STAT signaling pathway. Therefore, we hypothesized that LINC00601 influences glioma invasion by regulating the JAK/STAT signaling pathway.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003ep-STAT3 mediates the tumor-suppressive effects of LINC00601 knockdown in glioma cells\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate whether the tumor-promoting effects of LINC00601 are mediated by p-STAT3, U87 and U251 cells were transfected with Stattic (a potent STAT3 inhibitor that exerts its effects by inhibiting STAT3 phosphorylation at Y705 and S727), si-LINC00601, or si-LINC00601\u0026thinsp;+\u0026thinsp;Stattic. Our results showed that Stattic can inhibit the proliferation of glioma cells and transfection with si-LINC00601 and combined with Stattic treatment enhances this inhibition. As shown here, Stattic increased the ability of si-LINC00601 to reduce the viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH) of U251 and U87 glioma cells. Therefore, these results suggest that LINC00601 may exert its oncogenic function in glioma cells through p-STAT3.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eLINC00601 gene knockdown inhibits tumor formation in nude mice in vivo\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eU87 cells stably transfected with sh-NC or sh-LINC00601 were subcutaneously injected into the posterior flank of nude mice. The mice were euthanized and the tumor masses were removed 28 days after the injection. (B) Tumor volume was measured every 7 days via calipers. (A and C) The tumor tissues were excised and weighed. (D) The expression levels of LINC00601 in resected tumor tissues were determined via qRT‒PCR analysis. (E) H\u0026amp;E and Ki-67 staining of tumor tissues was performed.\u003c/p\u003e \u003cp\u003eTo investigate the effect of the LINC00601 gene in vivo, we used a lentiviral transduction method to establish stable control vector short hairpin RNA (sh-NC) and short hairpin RNA LINC00601 (sh-LINC00601) U87 cell lines in both groups. Two groups of cells suspended in matrix glue were injected subcutaneously into the underarms of two groups of nude mice to initiate tumor formation experiments. qRT‒PCR was used to verify the silencing efficiency of LINC00601 in the experimental group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). We evaluated tumor formation in nude mice. The results shown in the figure indicate that after LINC00601 expression was reduced, tumor size in nude mice was measured every 7 days. At 28 days, the tumor tissue was removed, and the results indicated that the tumors in the knockdown group were smaller than those in the experimental group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). LINC00601 knockdown significantly suppressed tumor growth, as evidenced by the reduced tumor volume (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) and tumor weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). H\u0026amp;E and Ki-67 staining were subsequently performed on the tumor tissue and revealed significantly lower levels of staining in the knockdown group than in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Thus, these results suggest that the inhibition of LINC00601 expression suppresses glioma cell growth in vivo.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGlioma is a type of tumor derived from glial cells in the spine or brain and accounts for approximately 80% of malignant brain tumors [27]. At present, the treatment of glioma primarily relies on surgery supplemented by postoperative radiotherapy and chemotherapy. Owing to their invasive growth characteristics, gliomas cannot be completely removed by surgery [28]. Therefore, identifying effective biomarkers for the early diagnosis of glioma can improve patient treatment outcomes and prognosis. Through bioinformatics analysis and biological experiments, this study revealed that LINC00601 acts as a potential prognostic marker and oncogene in glioma.\u003c/p\u003e \u003cp\u003eThe LINC00601 gene, noted for its elevated expression in various cancers, is located on chromosome 10 at position 10q26.2. It spans 8,013 bases and is oriented on the minus strand. Y.-C. WANG et al. first demonstrated in vitro that LINC00601 promotes HCC cell proliferation, affects cell cycle distribution and inhibits apoptosis in the G1/G0 phase [24]. SHI X. et al. reported that LINC00601 expression may be associated with a poor prognosis in patients with esophageal squamous cell carcinoma [29]. In this study, we observed significant upregulation of LINC00601 in glioma, along with a strong correlation between its expression and histological grade. Elevated p-STAT3 activity has been associated with increased proliferation, survival, and invasion of glioma cells, contributing to the aggressive nature of these tumors [25]. Thus, LINC00601 may be related to the p-STAT3 signaling pathway, which needs to be confirmed by further study. Furthermore, our findings indicate that high LINC00601 expression is significantly associated with reduced overall survival and increased recurrence risk in glioma patients. Functionally, knockdown of LINC00601 significantly inhibited cell proliferation, colony formation, migration, and invasion in vitro and tumor growth in vivo. Overall, LINC00601 can be considered a potential prognostic marker and therapeutic target for gliomas.\u003c/p\u003e \u003cp\u003eLncRNAs are RNA molecules that are more than 200 nucleotides in length and cannot be translated into proteins due to the lack of a promoter [30]. Although lncRNAs do not directly participate in protein coding, an increasing number of experimental findings have demonstrated that their abnormal expression leads to tumor cell development, which subsequently impacts prognosis and survival rates. For example, H19 lncRNA expression is significantly increased in many human malignant tumors, and elevated H19 expression is typically associated with a poor prognosis in cancer patients [31]. Ohgaki H et al. investigated autophagy-related lncRNAs in glioma patients and identified 10 such lncRNAs as independent prognostic factors [32]. Five of these lncRNAs (TP53TG1, ZNF674-AS1, COX10AS1, DDX11-AS1, and SBF2-AS1) were identified as adverse prognostic factors, whereas the other five (PCBP1)-AS1, DHRS4-AS1, GABPB1-AS1, MAPKAPK5-AS1, and MIR4453HG) were favorable prognostic factors [33]. In this study, using the TCGA and CGGA databases, we found that upregulation of LINC00601 expression is associated with increased malignancy and a poor prognosis in glioma patients. Additionally, LINC00601 expression was significantly higher in recurrent gliomas than in primary gliomas. These findings suggest that LINC00601 could serve as a potential prognostic marker and therapeutic target for glioma.\u003c/p\u003e \u003cp\u003eLncRNAs play crucial roles in regulating cell proliferation, apoptosis, differentiation, and the response to hypoxia stress by actively participating in nuclear interference [34], transcriptional activation [35], and chromatin modification [28]. Consequently, they play key roles in the progression of glioma.\u003c/p\u003e \u003cp\u003eZhou, K et al. reported that the expression of the lncRNA NEAT1 is upregulated in glioma. It promotes glioma formation by inhibiting the expression of miR-132, thereby alleviating the negative regulatory effect of miR-132 on SOX2 [36]. In primary GBM tumors, SChLAP1 expressed at high levels interacts with heterogeneous nuclear ribonucleoprotein L (HNRNPL), leading to increased binding of HNRNPL to α-actinin-4 (ACTN4). This interaction inhibits the degradation of ACTN4, which in turn increases the activity of nuclear factor κB (NF-κB) signaling, a pathway associated with cancer progression [37]. Here, we observed that the knockdown of LINC00601 suppressed the proliferation, migration, and invasion of glioma cells. Furthermore, knockdown of LINC00601 significantly inhibited glioma tumor growth in vivo. These findings suggest that LINC00601 plays a cancer-promoting role both in vitro and in vivo.\u003c/p\u003e \u003cp\u003eAs previously discussed, the expression of lncRNAs in gliomas differs significantly from that in normal tissues. Research has confirmed that lncRNAs are involved in various signaling pathways, influencing the proliferation, migration, invasion, and other behaviors of glioma cells, as well as the regulation of the tumor microenvironment. Consequently, lncRNAs may serve as therapeutic targets by modulating these pathways. The expression of the lncRNA solute carrier family 8 member A1 antisense RNA 1 (SLC8A1-AS1) is highly upregulated in glioma tissues. This RNA promotes cell proliferation, colony formation, migration, and invasion by activating the Wnt/β-catenin signaling pathway [38]. LINC01410 activates the Notch signaling pathway and accelerates glioma progression by sponging miR-506-3p and upregulating the NOTCH2 receptor [39]. The roles of lncRNAs in glioma mechanisms vary, and their underlying mechanisms have not yet been fully elucidated, so further in-depth studies are needed. In our study, by analyzing transcriptome data for normal U87 cells and U87 cells with LINC00601 knockdown, we discovered that LINC00601 primarily influences the JAK/STAT, NOD-like receptor, and TNF signaling pathways, along with associated biological behaviors. Our Western blot analysis also revealed that LINC00601 knockdown significantly inhibited a key node of the JAK/STAT signaling pathway. Therefore, we hypothesized that LINC00601 modulates glioma biological behavior by regulating the p-STAT3 signaling pathway. We discovered that Stattic alone can suppress the proliferation of glioma cells and that the combined application of si-LINC00601 and Stattic enhances this inhibitory effect. These findings confirmed that LINC00601 promotes glioma cell proliferation and invasion via the p-STAT3 signaling pathway.\u003c/p\u003e \u003cp\u003eIn summary, our study revealed that LINC00601 is abnormally upregulated in gliomas and may serve as a valuable prognostic marker for glioma patients. LINC00601 plays a crucial role in glioma regulation by modulating the p-STAT3 pathway, thereby providing a new theoretical basis for glioma treatment.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.574074074074076%\" valign=\"top\"\u003e\n \u003cp\u003elncRNAs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"63.425925925925924%\" valign=\"top\"\u003e\n \u003cp\u003elong non-coding RNAs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.574074074074076%\" valign=\"top\"\u003e\n \u003cp\u003esiRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"63.425925925925924%\" valign=\"top\"\u003e\n \u003cp\u003esmall interfering RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.574074074074076%\" valign=\"top\"\u003e\n \u003cp\u003eshRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"63.425925925925924%\" valign=\"top\"\u003e\n \u003cp\u003eshort hairpin RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.574074074074076%\" valign=\"top\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"63.425925925925924%\" valign=\"top\"\u003e\n \u003cp\u003equantitative real-time PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.574074074074076%\" valign=\"top\"\u003e\n \u003cp\u003esi-NC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"63.425925925925924%\" valign=\"top\"\u003e\n \u003cp\u003econtrol vector siRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.574074074074076%\" valign=\"top\"\u003e\n \u003cp\u003esi-LINC00601\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"63.425925925925924%\" valign=\"top\"\u003e\n \u003cp\u003esiRNA LINC00601\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36.574074074074076%\" valign=\"top\"\u003e\n \u003cp\u003ep-STAT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"63.425925925925924%\" valign=\"top\"\u003e\n \u003cp\u003eTransducer and Activator of Transcription 3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthics approval\u003c/h2\u003e \u003cp\u003e All experiments were in agreement with the guidelines for the Care and Use of Laboratory Animals and were approved by the Ethics and Welfare Committee for Animal Research at the Second Affiliated Hospital of Anhui Medical University.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Research Project Fund of Natural Science from Anhui Medical University, China (Grant No. KJ2021A0326).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Chao Ma, Linqi WANG and Renwu Zhang . The first draft of the manuscript was written by Renwu Zhang and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e \u003cp\u003eThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ede Robles P, Fiest KM, Frolkis AD, Pringsheim T, Atta C, St Germaine-Smith C, Day L, Lam D, Jette N: \u003cstrong\u003eThe worldwide incidence and prevalence of primary brain tumors: a systematic review and meta-analysis\u003c/strong\u003e. \u003cem\u003eNeuro Oncol \u003c/em\u003e2015, \u003cstrong\u003e17\u003c/strong\u003e(6):776-783.\u003c/li\u003e\n\u003cli\u003eWesseling P, Capper D: \u003cstrong\u003eWHO 2016 Classification of gliomas\u003c/strong\u003e. \u003cem\u003eNeuropathol Appl Neurobiol \u003c/em\u003e2018, \u003cstrong\u003e44\u003c/strong\u003e(2):139-150.\u003c/li\u003e\n\u003cli\u003eOstrom QT, Price M, Neff C, Cioffi G, Waite KA, Kruchko C, Barnholtz-Sloan JS: \u003cstrong\u003eCBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2016-2020\u003c/strong\u003e. \u003cem\u003eNeuro Oncol \u003c/em\u003e2023, \u003cstrong\u003e25\u003c/strong\u003e(Supplement_4):iv1-iv99.\u003c/li\u003e\n\u003cli\u003eOstrom QT, Gittleman H, Liao P, Rouse C, Chen Y, Dowling J, Wolinsky Y, Kruchko C, Barnholtz-Sloan J: \u003cstrong\u003eCBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in 2007-2011\u003c/strong\u003e. \u003cem\u003eNeuro Oncol \u003c/em\u003e2014, \u003cstrong\u003e16 Suppl 4\u003c/strong\u003e(Suppl 4):iv1-63.\u003c/li\u003e\n\u003cli\u003eKleber S, Sancho-Martinez I, Wiestler B, Beisel A, Gieffers C, Hill O, Thiemann M, Mueller W, Sykora J, Kuhn A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eYes and PI3K bind CD95 to signal invasion of glioblastoma\u003c/strong\u003e. \u003cem\u003eCancer Cell \u003c/em\u003e2008, \u003cstrong\u003e13\u003c/strong\u003e(3):235-248.\u003c/li\u003e\n\u003cli\u003eGillard AG, Shin DH, Hampton LA, Lopez-Rivas A, Parthasarathy A, Fueyo J, Gomez-Manzano C: \u003cstrong\u003eTargeting Innate Immunity in Glioma Therapy\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2024, \u003cstrong\u003e25\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eRezaee A, Tehrany PM, Tirabadi FJ, Sanadgol N, Karimi AS, Ajdari A, Eydivandi S, Etemad S, Rajabi R, Rahmanian P\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eEpigenetic regulation of temozolomide resistance in human cancers with an emphasis on brain tumors: Function of non-coding RNAs\u003c/strong\u003e. \u003cem\u003eBiomed Pharmacother \u003c/em\u003e2023, \u003cstrong\u003e165\u003c/strong\u003e:115187.\u003c/li\u003e\n\u003cli\u003eYang W, Lin L, Lu T, Yu H, Zhang S: \u003cstrong\u003eIdentification of EMT-associated prognostic features among grade II/III gliomas\u003c/strong\u003e. \u003cem\u003eSci Rep \u003c/em\u003e2024, \u003cstrong\u003e14\u003c/strong\u003e(1):2822.\u003c/li\u003e\n\u003cli\u003eLiang M, Gao C, Wang Y, Gong W, Fu S, Cui L, Zhou Z, Chu X, Zhang Y, Liu Q\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eEnhanced blood-brain barrier penetration and glioma therapy mediated by T7 peptide-modified low-density lipoprotein particles\u003c/strong\u003e. \u003cem\u003eDrug Deliv \u003c/em\u003e2018, \u003cstrong\u003e25\u003c/strong\u003e(1):1652-1663.\u003c/li\u003e\n\u003cli\u003eIyer MK, Niknafs YS, Malik R, Singhal U, Sahu A, Hosono Y, Barrette TR, Prensner JR, Evans JR, Zhao S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe landscape of long noncoding RNAs in the human transcriptome\u003c/strong\u003e. \u003cem\u003eNat Genet \u003c/em\u003e2015, \u003cstrong\u003e47\u003c/strong\u003e(3):199-208.\u003c/li\u003e\n\u003cli\u003eMattick JS, Amaral PP, Carninci P, Carpenter S, Chang HY, Chen LL, Chen R, Dean C, Dinger ME, Fitzgerald KA\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLong non-coding RNAs: definitions, functions, challenges and recommendations\u003c/strong\u003e. \u003cem\u003eNat Rev Mol Cell Biol \u003c/em\u003e2023, \u003cstrong\u003e24\u003c/strong\u003e(6):430-447.\u003c/li\u003e\n\u003cli\u003eLi W, Wang YY, Xiao L, Ding J, Wang L, Wang F, Sun T: \u003cstrong\u003eMysterious long noncoding RNAs and their relationships to human disease\u003c/strong\u003e. \u003cem\u003eFront Mol Biosci \u003c/em\u003e2022, \u003cstrong\u003e9\u003c/strong\u003e:950408.\u003c/li\u003e\n\u003cli\u003eGhosh A, Som A: \u003cstrong\u003eNetwork analysis of transcriptomic data uncovers molecular signatures and the interplay of mRNAs, lncRNAs, and miRNAs in human embryonic stem cells\u003c/strong\u003e. \u003cem\u003eDifferentiation \u003c/em\u003e2023:100738.\u003c/li\u003e\n\u003cli\u003ePerisset S, Potilinski MC, Gallo JE: \u003cstrong\u003eRole of Lnc-RNAs in the Pathogenesis and Development of Diabetic Retinopathy\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2023, \u003cstrong\u003e24\u003c/strong\u003e(18).\u003c/li\u003e\n\u003cli\u003eZhao J, Le M, Li J, Huang Q, Chen H, Zhang W, Mao H, Sun Q, Li A, Zhao Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLINC00938 alleviates hypoxia ischemia encephalopathy induced neonatal brain injury by regulating oxidative stress and inhibiting JNK/p38 MAPK signaling pathway\u003c/strong\u003e. \u003cem\u003eExp Neurol \u003c/em\u003e2023, \u003cstrong\u003e367\u003c/strong\u003e:114449.\u003c/li\u003e\n\u003cli\u003eWei C, Xiao T, Zhang P, Wang Z, Chen X, Zhang L, Yao M, Chen R, Wang H: \u003cstrong\u003eDeep profiling of the novel intermediate-size noncoding RNAs in intraerythrocytic Plasmodium falciparum\u003c/strong\u003e. \u003cem\u003ePLoS One \u003c/em\u003e2014, \u003cstrong\u003e9\u003c/strong\u003e(4):e92946.\u003c/li\u003e\n\u003cli\u003eWang R, Li Q, Chu X, Li N, Liang H, He F: \u003cstrong\u003eLncBIRC3-OT promotes the malignant progression of glioma by interacting with RELA to upregulate stanniocalcin-1 expression\u003c/strong\u003e. \u003cem\u003eHeliyon \u003c/em\u003e2023, \u003cstrong\u003e9\u003c/strong\u003e(11):e21777.\u003c/li\u003e\n\u003cli\u003eYue B, Chen J, Bao T, Zhang Y, Yang L, Zhang Z, Wang Z, Zhu C: \u003cstrong\u003eChromosomal copy number amplification-driven Linc01711 contributes to gastric cancer progression through histone modification-mediated reprogramming of cholesterol metabolism\u003c/strong\u003e. \u003cem\u003eGastric Cancer \u003c/em\u003e2024.\u003c/li\u003e\n\u003cli\u003eTsuruta Y, Senmatsu S, Oe H, Hoffman CS, Hirota K: \u003cstrong\u003eMetabolic stress-induced long ncRNA transcription governs the formation of meiotic DNA breaks in the fission yeast fbp1 gene\u003c/strong\u003e. \u003cem\u003ePLoS One \u003c/em\u003e2024, \u003cstrong\u003e19\u003c/strong\u003e(1):e0294191.\u003c/li\u003e\n\u003cli\u003eWang Z, Cui Y, Wang F, Xu L, Yan Y, Tong X, Yan H: \u003cstrong\u003eDNA methylation-regulated LINC02587 inhibits ferroptosis and promotes the progression of glioma cells through the CoQ-FSP1 pathway\u003c/strong\u003e. \u003cem\u003eBMC Cancer \u003c/em\u003e2023, \u003cstrong\u003e23\u003c/strong\u003e(1):989.\u003c/li\u003e\n\u003cli\u003eZhao J, Jin W, Yi K, Wang Q, Zhou J, Tan Y, Xu C, Xiao M, Hong B, Xu F\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eCombination LSD1 and HOTAIR-EZH2 inhibition disrupts cell cycle processes and induces apoptosis in glioblastoma cells\u003c/strong\u003e. \u003cem\u003ePharmacol Res \u003c/em\u003e2021, \u003cstrong\u003e171\u003c/strong\u003e:105764.\u003c/li\u003e\n\u003cli\u003eNandhu MS, Behera P, Bhaskaran V, Longo SL, Barrera-Arenas LM, Sengupta S, Rodriguez-Gil DJ, Chiocca EA, Viapiano MS: \u003cstrong\u003eDevelopment of a Function-Blocking Antibody Against Fibulin-3 as a Targeted Reagent for Glioblastoma\u003c/strong\u003e. \u003cem\u003eClin Cancer Res \u003c/em\u003e2018, \u003cstrong\u003e24\u003c/strong\u003e(4):821-833.\u003c/li\u003e\n\u003cli\u003eLi X, Ma C, Zhang L, Li N, Zhang X, He J, He R, Shao M, Wang J, Kang L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLncRNAAC132217.4, a KLF8-regulated long non-coding RNA, facilitates oral squamous cell carcinoma metastasis by upregulating IGF2 expression\u003c/strong\u003e. \u003cem\u003eCancer letters \u003c/em\u003e2017, \u003cstrong\u003e407\u003c/strong\u003e:45-56.\u003c/li\u003e\n\u003cli\u003eWang YC, Hu BH, Zhang WW, Li MM, Zhao X, Sui MH: \u003cstrong\u003eLinc00601 upregulation promotes hepatocellular carcinoma development by activating MAPK signaling pathway\u003c/strong\u003e. \u003cem\u003eEur Rev Med Pharmacol Sci \u003c/em\u003e2020, \u003cstrong\u003e24\u003c/strong\u003e(11):6039-6045.\u003c/li\u003e\n\u003cli\u003eLiu Z, Ren Z, Zhang C, Qian R, Wang H, Wang J, Zhang W, Liu B, Lian X, Wang Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eELK3: A New Molecular Marker for the Diagnosis and Prognosis of Glioma\u003c/strong\u003e. \u003cem\u003eFront Oncol \u003c/em\u003e2021, \u003cstrong\u003e11\u003c/strong\u003e:608748.\u003c/li\u003e\n\u003cli\u003eZhang CC, Wu T, Guan L, Wang YJ, Yao RQ, Gao DS, Li F: \u003cstrong\u003eEffects of STAT3 Inhibitor BP-1-102 on The Proliferation, Invasiveness, Apoptosis and Neurosphere Formation of Glioma Cells in Vitro\u003c/strong\u003e. \u003cem\u003eCell Biochem Biophys \u003c/em\u003e2022, \u003cstrong\u003e80\u003c/strong\u003e(4):723-735.\u003c/li\u003e\n\u003cli\u003eMontella L, Cuomo M, Del Gaudio N, Buonaiuto M, Costabile D, Visconti R, Di Risi T, Vinciguerra R, Trio F, Ferraro S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eEpigenetic alterations in glioblastomas: Diagnostic, prognostic and therapeutic relevance\u003c/strong\u003e. \u003cem\u003eInt J Cancer \u003c/em\u003e2023, \u003cstrong\u003e153\u003c/strong\u003e(3):476-488.\u003c/li\u003e\n\u003cli\u003eMalta TM, Sabedot TS, Morosini NS, Datta I, Garofano L, Vallentgoed WR, Varn FS, Aldape K, D'Angelo F, Bakas S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe epigenetic evolution of glioma is determined by the IDH1 mutation status and treatment regimen\u003c/strong\u003e. \u003cem\u003eCancer Res \u003c/em\u003e2023.\u003c/li\u003e\n\u003cli\u003eShi X, Li Y, Sun Y, Zhao X, Sun X, Gong T, Liang Z, Ma Y, Zhang X: \u003cstrong\u003eGenome-wide analysis of lncRNAs, miRNAs, and mRNAs forming a prognostic scoring system in esophageal squamous cell carcinoma\u003c/strong\u003e. \u003cem\u003ePeerJ \u003c/em\u003e2020, \u003cstrong\u003e8\u003c/strong\u003e:e8368.\u003c/li\u003e\n\u003cli\u003eKopp F, Mendell JT: \u003cstrong\u003eFunctional Classification and Experimental Dissection of Long Noncoding RNAs\u003c/strong\u003e. \u003cem\u003eCell \u003c/em\u003e2018, \u003cstrong\u003e172\u003c/strong\u003e(3):393-407.\u003c/li\u003e\n\u003cli\u003eDarmadi D, Chugaeva UY, Saleh RO, Hjazi A, Saleem HM, Ghildiyal P, Alwaily ER, Alawadi A, Alnajar MJ, Ihsan A: \u003cstrong\u003eCritical roles of long noncoding RNA H19 in cancer\u003c/strong\u003e. \u003cem\u003eCell Biochem Funct \u003c/em\u003e2024, \u003cstrong\u003e42\u003c/strong\u003e(3):e4018.\u003c/li\u003e\n\u003cli\u003eAli MA, Shaker OG, Khalefa AA, Abdelwahed MY, Ali E, Ezzat EM, Elghobary HA, Awaji AA, Fouad NA, Ayoub SE: \u003cstrong\u003eSerum long noncoding RNAs FAS-AS1 \u0026amp; PVT1 are novel biomarkers for systemic lupus erythematous\u003c/strong\u003e. \u003cem\u003eBr J Biomed Sci \u003c/em\u003e2020, \u003cstrong\u003e77\u003c/strong\u003e(4):208-212.\u003c/li\u003e\n\u003cli\u003eOhgaki H, Dessen P, Jourde B, Horstmann S, Nishikawa T, Di Patre PL, Burkhard C, Schuler D, Probst-Hensch NM, Maiorka PC\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eGenetic pathways to glioblastoma: a population-based study\u003c/strong\u003e. \u003cem\u003eCancer Res \u003c/em\u003e2004, \u003cstrong\u003e64\u003c/strong\u003e(19):6892-6899.\u003c/li\u003e\n\u003cli\u003eLee B, Sahoo A, Marchica J, Holzhauser E, Chen X, Li JL, Seki T, Govindarajan SS, Markey FB, Batish M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe long noncoding RNA SPRIGHTLY acts as an intranuclear organizing hub for pre-mRNA molecules\u003c/strong\u003e. \u003cem\u003eSci Adv \u003c/em\u003e2017, \u003cstrong\u003e3\u003c/strong\u003e(5):e1602505.\u003c/li\u003e\n\u003cli\u003eYu Q, Cai B, Zhang Y, Xu J, Liu D, Zhang X, Han Z, Ma Y, Jiao L, Gong M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLong non-coding RNA LHX1-DT regulates cardiomyocyte differentiation through H2A.Z-mediated LHX1 transcriptional activation\u003c/strong\u003e. \u003cem\u003eiScience \u003c/em\u003e2023, \u003cstrong\u003e26\u003c/strong\u003e(11):108051.\u003c/li\u003e\n\u003cli\u003eZhou K, Zhang C, Yao H, Zhang X, Zhou Y, Che Y, Huang Y: \u003cstrong\u003eKnockdown of long non-coding RNA NEAT1 inhibits glioma cell migration and invasion via modulation of SOX2 targeted by miR-132\u003c/strong\u003e. \u003cem\u003eMolecular cancer \u003c/em\u003e2018, \u003cstrong\u003e17\u003c/strong\u003e(1):105.\u003c/li\u003e\n\u003cli\u003eJi J, Xu R, Ding K, Bao G, Zhang X, Huang B, Wang X, Martinez A, Wang X, Li G\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLong Noncoding RNA SChLAP1 Forms a Growth-Promoting Complex with HNRNPL in Human Glioblastoma through Stabilization of ACTN4 and Activation of NF-kappaB Signaling\u003c/strong\u003e. \u003cem\u003eClin Cancer Res \u003c/em\u003e2019, \u003cstrong\u003e25\u003c/strong\u003e(22):6868-6881.\u003c/li\u003e\n\u003cli\u003eHe L, Yang H, Zhu XL, Zhang Y, Lv K: \u003cstrong\u003eKnockdown of long non-coding RNA SLC8A1-AS1 attenuates cell invasion and migration in glioma via suppression of Wnt/beta-catenin signaling pathways\u003c/strong\u003e. \u003cem\u003eBrain Res Bull \u003c/em\u003e2021, \u003cstrong\u003e176\u003c/strong\u003e:112-120.\u003c/li\u003e\n\u003cli\u003eZhao X, Shen F, Yang B: \u003cstrong\u003eLncRNA LINC01410 Induced by MYC Accelerates Glioma Progression via Sponging miR-506-3p and Modulating NOTCH2 Expression to Motivate Notch Signaling Pathway\u003c/strong\u003e. \u003cem\u003eCell Mol Neurobiol \u003c/em\u003e2022, \u003cstrong\u003e42\u003c/strong\u003e(5):1513-1521.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cancer-cell-international","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccin","sideBox":"Learn more about [Cancer Cell International](http://cancerci.biomedcentral.com/)","snPcode":"12935","submissionUrl":"https://submission.nature.com/new-submission/12935/3","title":"Cancer Cell International","twitterHandle":"@OncoBioMed","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"glioma, lncRNA, LINC00601, p-STAT3","lastPublishedDoi":"10.21203/rs.3.rs-4952967/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4952967/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eGliomas, the most common malignant tumors of the central nervous system, primarily originate from glial cells, which support nerve cells. Due to their high malignancy and aggressiveness, gliomas frequently result in poor prognoses. Increasing evidence suggests that long non-coding RNAs (lncRNAs) have diverse roles in cancer; however, their specific functions in gliomas remain poorly understood. This study elucidates the roles and potential mechanisms of the lncRNA LINC00601 in glioma.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eBioinformatics analysis was utilized to identify the expression of LINC00601 and to perform related survival analysis. Glioma cells were transfected with a control vector small interfering RNA (si-NC) or small interfering RNA LINC00601 (si-LINC00601). Cell proliferation was evaluated using the CCK-8 assay and plate colony formation assay. Cell migration and invasion were assessed using the Transwell assay. Protein expression was detected by Western blot analysis, and lncRNA levels were measured using quantitative real-time PCR (qRT-PCR).\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eBioinformatics analysis revealed that LINC00601 is associated with the pathological grade and prognosis of glioma, as evidenced by data from the TCGA and CGGA databases. In vivo experiments showed that LINC00601 knockdown inhibits the proliferation, migration, and invasion of U251 and U87 cells. Based on sequencing and Western blot results, this effect is thought to be linked to changes in Phosphorylated Signal Transducer and Activator of Transcription 3 (p-STAT3) expression. Additionally, in vitro knockdown of LINC00601 has been shown to inhibit glioma growth.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eLINC00601, which facilitates glioma progression by modulating the p-STAT3 signaling pathway, could serve as a potential molecular target for glioma therapy.\u003c/p\u003e","manuscriptTitle":"LINC00601 promotes the progression of glioma via the p-STAT3 signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-24 11:27:56","doi":"10.21203/rs.3.rs-4952967/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-11T07:08:26+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-08T04:32:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"277879595664648911167621017787141267950","date":"2024-10-07T12:55:27+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-30T09:24:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"147398681163725507223670751976947285441","date":"2024-09-22T13:34:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"102115826552399071614345147710162179534","date":"2024-09-20T14:14:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-13T10:03:21+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-24T03:14:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-24T03:14:10+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cancer Cell International","date":"2024-08-21T16:18:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cancer-cell-international","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccin","sideBox":"Learn more about [Cancer Cell International](http://cancerci.biomedcentral.com/)","snPcode":"12935","submissionUrl":"https://submission.nature.com/new-submission/12935/3","title":"Cancer Cell International","twitterHandle":"@OncoBioMed","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"71c71d2a-812f-4532-864e-41ae8e2aa389","owner":[],"postedDate":"September 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-23T16:05:36+00:00","versionOfRecord":{"articleIdentity":"rs-4952967","link":"https://doi.org/10.1186/s12935-025-03735-9","journal":{"identity":"cancer-cell-international","isVorOnly":false,"title":"Cancer Cell International"},"publishedOn":"2025-06-21 15:57:55","publishedOnDateReadable":"June 21st, 2025"},"versionCreatedAt":"2024-09-24 11:27:56","video":"","vorDoi":"10.1186/s12935-025-03735-9","vorDoiUrl":"https://doi.org/10.1186/s12935-025-03735-9","workflowStages":[]},"version":"v1","identity":"rs-4952967","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4952967","identity":"rs-4952967","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}