Genetic transformation of rice overexpressing phosphoenolpyruvate carboxykinase to increase photosynthetic efficiency and confer tolerance to salt stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic transformation of rice overexpressing phosphoenolpyruvate carboxykinase to increase photosynthetic efficiency and confer tolerance to salt stress Suchismita Prusty, Swetaleena Mishra, Madhusmita Pradhan, Chinmaya Kumar Swain, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6598895/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Salinity stress is one of the major worldwide obstacle for the glycophytic crop production, including rice. This phenomenon alters the cellular metabolism and causes significant crop destruction resulting in substantial reductions in yield. Through genetic engineering, it is possible to decrease the oxidative stress and increase the photosynthetic capability by using C 3 transgenic plants that produce the C 4 enzymes like phosphoenolpyruvate carboxykinase ( PEPCK) at a high level. In this research, we evaluate the efficiency of transgenic rice plants ( Oryza sativa L. cv. IR64) over-expressing PEPCK genes to act against salinity stress as well as increasing its photosynthetic efficiency. Rice plants overexpressing PEPCK (T 1 generation) show tolerance to high salinity (200 mM NaCl) stress. The T 1 transgenics showed increased levels of several biochemical factors, including ascorbate peroxidase (APX), malondialdehyde (MDA), glutathione reductase (GR) and guaiacol peroxidase (GPX) activities suggesting the existence of an effective antioxidant defense mechanism that helps the plants to deal with oxidative damage driven by salt stress. The photosynthetic parameters like chlorophyll contents, net photosynthetic rate, intercellular CO 2 content and stomatal conductance were all considerably elevated in transgenic plants when compared with the control plants (null seggregant). It also exhibited higher agronomic characteristics than the control plant. Our findings add a preliminary conclusive evidence of PEPCK gene's potential role in regulating salt stress response and tolerance of rice plants. PEPCK Salinity stress Antioxidant enzymes Oryza sativa Reactive oxygen species (ROS) Photosynthesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The worldwide population expansion has led to extended demand for food production by people, despite an estimated decline in total fertile land. Given the situation, 70% more of the present production levels would be needed by 2050 to meet the guesstimated population of 9.7 Billion and the expanding market, especially for staple foods like rice, wheat, soy, and maize [ 1 ]. Moreover, the natural catastrophe makes it more difficult to increase crop yield. Enhancing the capableness of plants to thrive when subjected to challenging environments is vital to fulfilling the expanding economic needs. One of the primary constraints on crop productivity in the agriculture industry is soil salinity. Excessive amounts of salt in soils inhibit the growth of glycophytic plants (100–200 mM NaCl). Salinity causes the concerning depletion of 2000 hectares of agricultural land every day universally [ 2 ]. This causes crop yields to drop by a significant 10–25%, and in extreme instances, it causes desertification [ 3 ]. Saline soil makes up 25% of arable land worldwide. In 60% of the stress-affected land of Central Asia, 60–65% of the terra firma is afflicted by salinity stress [ 4 ]. One of the most salt-sensitive cereals, rice ( Oryza sativa L.), is the mainstay food for over half of the global population. For instance, soil salinity causes deficits in rice output by as much as 45% and 36–69%, respectively, in the Indo-Gangetic Basin of India and the Indus Basin of Pakistan. Thus, taking immediate action to lessen the effects of salt is essential to maintaining cropland and boosting agricultural productivity in an economically sustainable manner, with the goal of establishing food security. Scientists and researchers are concerned about this and are motivated to create new transgenic varieties in order to address the challenge at hand. The introduction of genetically engineered crops with increased salt tolerance has drawn a lot of interest as a practical solution to this problem. One possible attempt has been taken that requires the integration of the single-cell C 4 -like mechanism into the C 3 plants' mesophyll cells [ 5 ]. The transformation from C 3 to C 4 plants requires gradual modifications in their metabolic pathways that might lead to the development of resultant species with evolutionary advantages. Even so, more has to be understood about the overall system that manages C 4 photosynthesis [ 6 ]. Although the engineering of high-level and cell-specific gene expression poses obstacles for the insertion of C 4 biochemistry in rice, genes encoding the majority of metabolite transporters and the enzymes of the C 4 pathway have recently been discovered [ 7 ]. PEPCK functions as a prime decarboxylase cytosolic enzyme present in C 4 plants and has been observed to positively respond to halophytic stress in some plant species [ 8 , 9 ]. It contributes to the maintenance of the pH and is engaged in several metabolic activities, including the metabolism of amino acids, nitrogen sugar, organic acids, and malate [ 10 ]. Through genetic engineering, transgenic crops expressing high levels of the C 4 enzymes PEPC or PEPCK have demonstrated improved crop photosynthetic capability [ 10 ]. In the present research, we overexpressed the PEPCK gene to generate transgenic rice plants ( Oryza sativa L., cv. IR64), which have enhanced the plants' resilience to salt stress through involvement with processes associated with repairing oxidative damage caused by stress. The resultant transgenic rice plant indicated enhanced photosynthesis, antioxidant capacity and development in addition to resistance to salt stress. We have successfully developed a transgenic plant overexpressing a C 4 PEPCK gene thereby taking a progressive step towards bridging a gap in the C 4 rice project. Our research indicates that even though a better C 4 biochemistry and higher vein density will eventually be required for highly effective C 4 rice, adding a bit of C 4 photosynthesis to preexisting veins may currently offer the advantages of greater photosynthesis while progressing toward C 4 rice. Materials and Method PEPCK Gene Cloning and Agrobacterium -mediated IR64 Rice Transformation Applying the forward primers 5' ATGGAGTTGGTTCAGAATAAAA 3' and reverse primer 5' GGTGTGGAGTTCTCTTA 3', the coding region of the PEPCK gene was amplified by PCR from the complementary DNA (cDNA) of rice ( O. sativa L. cv. IR64 ). The 35S promoter: PEPCK :poly A signal cassette was then obtained by cloning the amplified product into pRT-100 at the NcoI site. The PEPCK gene cassette (GenBank accession number: AF136163.1) was fully cloned into the PstI site of the plant transformation vector pCAMBIA1301. The Agrobacterium tumefaciens (strain LBA4404) was used to introduce the plasmid into the embryogenic calli from mature rice seeds ( O. sativa L. cv. IR64) for the plant transformation technique as outlined by [ 11 ]. The transgenic rice lines were contrasted with the control plants (null-segregant plants that share similar genetic attributes with the transgenic plants but lack any incorporated genetic materials) derived from the tissue culture method. For each transgenic line, ten plants were selected (thirty plants in total) for a biological repetition in the subsequent trials. Analysis was done on the sample numbers of T 1 seedlings that came from the stress testing. PCR, Southern Blot Assay and Tolerance Index Assessment of T 1 Plants PCR was used to validate the integration of the PEPCK gene in transgenic IR64 rice plants. Genomic DNA (0.15–0.20 µg) was derived from 0.5g of fresh and healthy leaves, and amplification was performed with gene-specific forward and reverse primers, together with promoter-specific forward and gene-specific reverse primers. XbaI was used to digest the DNA (20 µg), and the obtained specimens were then settled on 0.8% agarose gels for Southern blotting evaluation. The transferring of DNA to a negatively charged nylon membrane (Hybond-N+, Amersham, Inc).was done as per the procedure outlined by Sambrook et al. 1989 [ 12 ]. Using α-[32P] dCTP and promoter-specific (CaMV35S) primers for both directions (forward and reverse), a radioactive probe was created. The protocol outlined by Sambrook et al. was followed for hybridization, which involved heating the probe to 53°C and rinsing it at 65°C [ 12 ]. The tolerance index was computed using the subsequent formula for PEPCK T 1 transgenic lines (L2, L7 and L12) and control plants in 200 mM NaCl. T 1 (%) = [(plant dry weight with 200 mM NaCl) / (plant dry weight with water)] ×100 RNA Isolation and qRT-PCR TRIzol reagent (Invitrogen Life Technologies, USA) was utilized to disunite total RNA collected from three-weeks-young IR 64 T 1 PEPCK transgenic and control rice seedlings maintained in a hydroponic environment after they were treated with 200 mM NaCl for 24 hours. The acquired total RNA served as the model for the generation of cDNA. 5 mg of total RNA was used to create the first-strand cDNA using Superscript II Reverse Transcriptase (Invitrogen Life Technologies USA) and an oligo(dT)18 primer, by following the instructions given by the manufacturer. With gene-specific primers (Forward: 5'-GGAAATCCTCGACCCCATCA-3' and Reverse: 5'-CGATCTTGTAGCTGGCGAAC-3') the quantitative real-time PCR (qRT-PCR) was conducted. The cycle was performed at the following temperatures: 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, as per the instructions given by the manufacturer (Step One Real-Time PCR system Applied Biosystems). Using the ΔΔCT technique, the quantitative variance amidst several samples was assessed. The qRT-PCR results were validated by repeating the procedures three times and the expression level mean values were calculated individually. The expression level of the relative gene was determined using the formula 2 −ΔΔCT , as described by [ 13 ]. Measurement of Salinity Tolerance by Leaf Disc Senescence Assay Little squares of thriving and fully broad rice leaves measuring 1 cm × 1 cm were extracted from control plants and transgenic lines of the same age (L2, L7, and L12) of the T 1 generations. For 72 hours, the discs drifted in NaCl solutions containing 100 and 200 mM. As mentioned earlier, the research study was conducted using three biological duplicates at room temperature as depicted by [ 14 ]. Assessments of Antioxidants in PEPCK Transgenic Lines 21-day-old control plant and PEPCK transgenic plant seedlings were cultivated in 200 mM NaCl for 24 hours in this experiment before being utilized for biochemical studies. According to Garg et al. (2012) the enzyme activity of the ascorbate peroxidase (APX), catalase (CAT), guaiacol peroxidase (GPX), and glutathione reductase (GR) were evaluated. Amounts of proline as well as hydrogen peroxide (H 2 O 2 ) were analyzed as they play significant functions in stressful situations [ 15 ]. Proline estimation Adopting the Bates et al. technique, 500 mg of fresh root tissues were standardized in 10 ml of 3% sulphosalicylic acid in an ice-cold solution to determine the amounts of proline [ 16 ]. After centrifuging the resulting mixture at 10,000 g for 15 minutes, 2 ml of the solution was combined with 2 ml of acid ninhydrin and glacial acetic acid. The mix was cooled in ice to stop the chemical reaction after being incubated at 100°C for one hour, during which time a colorful complex was produced in the water bath. The colored complex was vortexed for 15–20 seconds after adding 4 milliliters of toluene. Afterward, at 520 nm, the optical density of the layer comprising the chromophore was evaluated to determine the proline content by utilizing an L-Proline standard curve. Determination of HO Content The H 2 O 2 level was determined using an updated version of Jana and Choudhuri approach [ 17 ]. After standardizing 100 mg of leaf tissue using liquid nitrogen and crushing it in 3 cm 3 of 50 mM phosphate buffer (pH 7), H 2 O 2 was isolated. After filtering and centrifuging the homogenated solution for 6,000 g at 4°C for 25 minutes, 0.9 cm 3 of the supernatant was combined with 0.3 cm 3 of 1% (v/v) TiCl 4 in concentrated HCl, and the mixture was centrifuged again for 6,000 g at 4°C for 15 minutes. At 410 nm, the yellow supernatant's absorbancy was determined. The standard curve was then created based on various reported H 2 O 2 concentrations to determine the H 2 O 2 level. The estimation of the levels of electrolytic leakage, lipid peroxidation, and relative water content (RWC), were determined by using the procedure outlined by Tuteja et al. (2013) [ 14 ]. Lipid peroxidation measurement (MDA content) Malondialdehyde (MDA), a breakdown product of lipid peroxidation, was measured to quantify lipid peroxidation [ 18 ]. Using a mixer mill (MM400, Retsch, Germany) with two cycles of 35 Hz per minute, leaves (0.1 g) were crushed into a fine powders. Following the addition of 1 cm 3 of 0.1% trichloroacetic acid (TCA), the resulting solution went through a centrifuge for 15 minutes at 5,000 g and 25°C. Following centrifugation, 0.75 cm 3 of 0.25% 2-thiobarbituric acid in 10% TCA was mixed with 0.3 cm 3 of the supernatant, and the absorbance was measured at 532 nm and 600 nm. Implementing an absorption coefficient of 155 mM − 1 cm − 1 , the MDA concentration was evaluated by deducting the absorbance of the supernatant at 600 nm from that of 532 nm. Electrolytic leakage (Membrane permeability) Three days post salt stress, leaves were cut into 1 cm square pieces, placed in a test tube, and were rinsed with 5 cm 3 of deionized water to remove surface contaminants. Electrical conductivity (EC) was subsequently evaluated both prior to and after autoclaving at 121°C for 20 minutes, while the material was immersed in 5 cm 3 of deionized water in a test tube for two hours. The formula for calculating the cell membrane stability [%] was 100 - [(EC1/EC2) × 100], where EC1 represents the electric conductivity following a two-hour dip in deionized water and EC2 represents electrical conductivity following a 20-minute autoclave [ 19 ]. Relative water content Barrs and Whetherley approach was implemented, and plants from all treatments were chosen at random [ 20 ]. To calculate initial mass (Mi), a leaf specimen weighing about 0.1 g was divided into smaller fragments and analyzed. To calculate the completely water-saturated mass (Mf), the leaf specimens were submerged in recently de-ionized water for 12 hours. After a three-day oven drying at 60°C, the specimen's dry mass (Md) was measured. We then calculated the RWC [%] using the formula [(Mi - Md)/(Mf - Md)] * 100. Quantification of Photosynthetic Parameters Over the course of 30 days, mature IR64 rice control plants and PEPCK transgenic rice plants were subjected to 200 mM and 0 mM NaCl, respectively. On a sunny weather between 10:00 AM and 12:00 PM, the fourth and fifth fully extended leaves of transgenic lines (L2, L7, and L12) as well as control plants were measured for stomatal conductance (gs) intercellular CO 2 concentration (Ci), net photosynthetic rate (Pn), and transpiration rate using an infrared gas analyzer (IRGA from LiCor, located in Lincoln, Nebraska, USA). The examination was conducted in the following atmospheric factors: atmospheric temperature of 30 ± 2°C, relative humidity of 68.2 ± 6%, atmospheric CO 2 of 404 µmol mol − 1 , photosynthetically active radiation (PAR) of 1,900 ± 6 µmol m − 2 s − 1 . The Agronomic Attributes of T 1 Transgenic Plant The matured control plant lines as well as PEPCK transgenic plant lines' agronomic attributes were assessed following a 30-day treatment with 200 and 0 mM NaCl and their development and yield efficiency were evaluated post-salt stress. A variety of agronomic parameters were also measured, including plant height, number of tillers/plant, number of panicles/plant, number of chaffy grains/panicle, number of filled grain/panicle, leaf area, 100-grain weight, root dry weight, straw dry weight, root length, and plant dry weight pre and post salt stress in both control and PEPCK transgenic rice lines. On a metre scale, the length of the shoot and roots were determined. Plant samples were desiccated in a hot-air oven (Memmert, Model 500, Germany) at 80°C for four days until a uniform weight was achieved. Dry weight was established by incubating the specimens in a desiccator. The leaf area was determined using a leaf area meter (manufactured by Systronics in Hyderabad, India). Determining the endogenous ion content and soluble sugar and hormones To estimate endogenous ions (potassium, nitrogen, sodium, and phosphorus concentration), leaves from T 1 transgenic lines and control lines cultivated for 56 days on 200 mM NaCl and 0 mM NaCl, respectively, were used. Jackson's method was utilized to calculate the total nitrogen concentration [ 21 ]. A spectrophotometer was utilized to determine the phosphorus concentration in accordance with Gupta's instructions [ 22 ]. Using a flame ionization photometer and regular procedure, the potassium content was determined [ 23 ]. The Munns et al. technique was used to test the sodium content [ 24 ]. After subjecting both transgenic and control plants to a 24-hour salt treatment, the amounts of fructose and glucose in both, the roots and shoots were determined [ 25 ]. As previously stated by Chen et al. estimates of the endogenous plant hormones (GA, zeatin, and IAA) have been determined [ 26 ]. Statistical analysis Data from three studies and mean values and standard errors were gathered. Applying SPSS (12.0 Inc., USA), the ANOVA test was run on the collected data to find the least significant difference (LSD) for the statistically substantial data, which allowed for the identification of treatment-wise changes in the mean. Duncan's multiple-range analyses (DMRT) were utilized to determine the means. Results Molecular assessment of the transgenic PEPCK plants Transgenic IR64 rice plants were created using the pCAMBIA1301- PEPCK T-DNA construct [ Fig. 1 (a)] . Comparing the transgenic lines (L2, L7, and L12) and control plants lines, there were no discernible phenotypic changes [ Fig. 1 (b)] . The transgene ( PEPCK ) presence was confirmed using PCR with specific primers (forward and reverse) and an expected 1.4 kb fragment was magnified [ Fig. 1 (c)] . The count of incorporated transgene copies in T 1 transgenic lines was determined using the Southern blot hybridization technique. All three lines (L2, L7, and L12) showed single-copy insertion [ Fig. 1 (d)] . The transgenic lines (L2, L7, and L12) exhibited a roughly 10-fold increase in transcript levels in comparison to control plants cultivated in normal conditions, according to quantitative real-time PCR (qRT-PCR) findings [ Fig. 2 (a)] . All of the transgenic lines tissues from leaves (L2, L7, and L12) exhibited GUS activity, however the control plants lacked any blue color [ Fig. 2 (b)] . Transgenic T 1 Plants Display Salinity Tolerance T 1 transgenic lines (L2, L7, and L12) and control lines’ leaf chunks (about 1 cm × 1 cm) were suspended individually on 100 and 200 mM NaCl for 72 hours in order to evaluate the plants' salinity tolerance. The leaf tissue showed discoloration after 72 hours, indicating harm from salt stress. In comparison to control plants, all transgenic lines showed dropped chlorophyll loss, indicating a higher tolerance to saline stress. [ Fig. 2 (c)] . The increased levels of chlorophyll in the leaf discs senescence assay of the transgenic plants mentioned above show that the T 1 transgenic lines are resistant to salt stress at both mild (100 mM) and severe (200 mM) intensities of NaCl [ Fig. 2 (d)] . Ion Leakage, MDA and H 2 O 2 accumulation in Transgenic Plants Under Salt Stress When T 1 transgenic lines (L2, L7, and L12) were subjected to severe salt stress (200 mM NaCl), the results of the assessment for antioxidant activity showed that the proportion of malondialdehyde (MDA) was approximately two times lower than control, the H 2 O 2 content was approximately 2.5 times lower, and the ion leakage was approximately 1.5 times lower [ Fig. 3 (a–c)] . This suggests that in the transgenic rice plants, overexpression of PEPCK may reduce the build-up of H 2 O 2 , MDA, and ion leakage. ROS Activity in Transgenic Lines The antioxidant enzyme activities, proline amounts, and relative water content (RWC) were assessed in transgenic lines and control plants. In transgenic rice lines, the level of proline has increased (by about 1.5 times) under 200 mM NaCl stress compared to control [ Fig. 3 (d)] . In addition, under the stress (200 mM NaCl), transgenic rice lines revealed a substantial rise in the activity of antioxidant enzymes like CAT (∼1.5-fold), APX (∼2.4-fold), GPX (∼3.2-fold), and GR (∼2.4-fold) along with RWC (∼2.7-fold) when compared to the control rice lines. The agronomic traits and photosynthetic productivity of T 1 transgenic rice plants A segregating ratio of 3:1 was observed in the T 1 transgenic rice seeds ( Table 1 ) . While comparing the developmental rate of T 1 transgenics rice seedlings under NaCl stress to that of control plants, no discernible variation was seen. Table 1 Comparison of segregation ratio (Hygr:Hygs) and plant seedlings survival (%) of the null-segregant (control) and T 1 generation of PEPCK overexpressing transgenic plants (line 2, line 7 and line 12) ( Oryza sativa L. cv. IR64) grown in the presence of 0 and 200Mm NaCl, respectively Attributes Water-grown control plants 200 mM NaCl-grown PEPCK transgenic plants Control Line 2 Line 7 Line 12 Segregation ratio (Hygr:Hygs [n]a 0 2.62:1[178] 2.72:1 [156] 3.1:1[184] Plant seedlings survival (%) 95 ± 3.6 a 92 ± 2.6 a 96 ± 2.6 a 91 ± 3.6 a Each value represents mean of three replicates ± SE. The letters “a” indicate significant differences at P > 0.05 level as determined by DMRT a Recording made from seeds When exposed to 200 mM salinity stress, the transgenic rice lines that overexpressed PEPCK performed better than the control plants in terms of growth variables such as plant’s height, tiller/plant count, panicle/plant count, filled grain/panicle count, chaffy grain/panicle count, straw dry weight, 100-grain weight, root length, root dry weight, leaf area, and root and shoot lengths ( Table 2 ) . Under salt stress (200mM NaCl), T 1 transgenics exhibited elevated levels of all the photosynthetic parameters such as stomatal conductance (gs), net photosynthetic rate (Pn), intercellular CO 2 concentration (Ci) and transpiration rate in comparison to the control plants [ Fig. 4 (a-d)] . In general, salt stress affects the photosynthesis system of both transgenic and control plants; however, control plants exhibited greater damage than T 1 transgenic plants [ Fig. 4 (a-d)] . Table 2 Agronomical parameters of rice ( Oryza sativa L. cv. IR64) null-segregant and T 1 generation of PEPCK overexpressing transgenic lines (line 2, line 7 and line 12) under 0 and 200 mM NaCl Attributes Control plants NaCl (mM)-grown T 1 PEPCK transgenic plants L2 L7 L12 0 200 0 200 0 200 0 200 Plant height (cm) 72 ± 3.0 31 ± 2.0 76 ± 2.6 68 ± 2.6 71 ± 3.0 66 ± 3.6 78 ± 2.0 71 ± 3.0 Root length (cm) 26 ± 1.0 12.3 ± 1.1 28.3 ± 0.5 23.1 ± 0.7 23.8 ± 0.7 23 ± 0.5 29.6 ± 0.7 25.1 ± 1.0 Root dry weight (g) 2.5 ± 0.4 1.3 ± 0.2 2.8 ± 0.1 1.9 ± 0.2 3.1 ± 0.3 2.5 ± 0.4 2.6 ± 0.3 2.3 ± 0.1 Leaf area (cm 2 /plant) 93 ± 3.6 39 ± 3.0 93.3 ± 2.5 84 ± 3.0 97 ± 2.0 92.3 ± 2.5 100 ± 2.6 87 ± 2.0 Total protein(mg g − 1 fw) 1.95 ± 0.04 0.67 ± 0.11 1.98 ± 0.10 1.51 ± 0.22 1.99 ± 0.09 1.88 ± 0.10 1.93 ± 0.05 1.58 ± 0.26 Nitrogen (%) 0.276 ± 0.006 0.107 ± 0.004 0.314 ± 0.012 0.289 ± 0.014 0.320 ± 0.015 0.298 ± 0.009 0.312 ± 0.010 0.272 ± 0.011 Phosphorus (%) 0.268 ± 0.008 0.126 ± 0.008 0.258 ± 0.009 0.227 ± 0.009 0.276 ± 0.009 0.232 ± 0.008 0.256 ± 0.006 0.214 ± 0.007 Potassium (%) 0.168 ± 0.001 0.085 ± 0.007 0.175 ± 0.008 0.135 ± 0.006 0.178 ± 0.004 0.153 ± 0.002 0.154 ± 0.003 0.147 ± 0.004 Sodium (%) 0.044 ± 0.003 0.074 ± 0.002 0.037 ± 0.004 0.051 ± 0.005 0.035 ± 0.004 0.045 ± 0.003 0.038 ± 0.04 0.067 ± 0.003 Each value represents mean of three replicates ± SE.Means were compared using ANOVA. Phenotypic traits, chlorophyll, endogenous ion content, soluble sugars, and hormones of T 1 transgenic plants The PEPCK T 1 transgenic lines showed reduced sodium concentrations in contrast to the control plants when endogenous ion content was measured under the 200 mM salt stress, yet greater amounts of potassium, phosphorus, and nitrogen ions became apparent ( Table 2 ) . Transgenic rice lines under salt stress also showed greater concentrations of chlorophyll than control plants ( Table 2 ) . Transgenic rice lines showed similar yield variables to control rice plants in water (0 mM NaCl), including tillers/plant, filled grain/panicle, panicles/plant, chaffy grain/panicle, and days to achieve flowers ( Table 3 ) . But under 200 mM NaCl stress, the control rice plants failed to make it to the blooming phase ( Table 3 ) . Table 3 Comparison of various yield parameters in rice ( Oryza sativa L . cv. IR64) null-segregant (control) and T 1 generation of PEPCK overexpressing transgenic lines (line 2, line 7 and line 12) under 0 and 200 mM NaCl Parameters Control plants NaCl (mM)-grown T 1 PEPCK transgenic plants L2 L7 L12 0 200 0 200 0 200 0 200 Time required for flowering (days) 86 ± 3.6 ND 95 ± 3.6 69.6 ± 5.9 97 ± 3.0 77 ± 3.6 92 ± 3.6 65.6 ± 4.521 No. of tillers/plant 21.3 ± 1.52 ND 24 ± 0.17 16.6 ± 0.57 26.6 ± 0.57 20 ± 0.17 22.6 ± 1.15 14.3 ± 0.57 No. of panicle/plant 25 ± 1 ND 22.6 ± 0.57 14 ± 0.5 25.6 ± 0.57 17 ± 1.0 20 ± 0.5 11.3 ± 0.57 No. of filled grain/panicle 86 ± 3.4 ND 89 ± 3.0 80 ± 3.0 94 ± 3.0 83 ± 3.0 84 ± 3.6 72 ± 3.6 No. of chaffy grains/panicle 10.3 ± 0.57 ND 5.3 ± 0.57 10.6 ± 0.57 7.6 ± 0.57 8.6 ± 0.57 4.6 ± 0.57 11 ± 1.0 Straw dry weight (g) 55 ± 3.0 ND 59 ± 2.6 49 ± 2.6 63 ± 3.0 53.6 ± 2.51 59.3 ± 2.5 48.3 ± 1.15 100 grain weight 2.88 ± 0.18 ND 2.96 ± 0.30 2.27 ± 0.13 3.24 ± 0.15 2.63 ± 0.06 2.52 ± 0.13 2.25 ± 0.06 Control plants did not survive until harvesting under 200 mM NaCl. Each value represents mean of three replicates ± SE. Means were compared using ANOVA. ND no data During salt stress, the PEPCK overexpressing T 1 plants collected more fructose (∼-2.5 times) and glucose (∼2- times) in their shoots and roots [ Figs. 5 (a, b)] than the control rice lines. In addition, the roots and shoots of the PEPCK transgenics had a higher concentration of hormones (including GA, zeatin, and IAA) than the control plant [ Fig. 5 (c- e)] . Discussion Rice production is negatively impacted by salinity levels, a multigenic characteristic that regulates every aspect of the plant's functioning. Previous research has reported on the novel involvement of PEPCK in plant lines' resistance to abiotic stressors, including salt and drought, in various plants like Arabidopsis thaliana and Sorghum bicolor [ 27 , 28 ]. Resilience against salt stress requires knowledge of processes like homeostasis of ions and ROS elimination [ 29 ]. The objective of the current experimentation is to determine more about the mechanism and possible function of PEPCK gene in providing rice ( Oryza sativa L. cv. IR64) with salt stress resistance. While compared to other abiotic stressors, it has been observed that the PEPCK gene is expressed three times more when exposed to NaCl. Prior research has also shown that the expression of othere genes including OsHKT1, PDH45, OsBAT1 and OsSUV3 , being stimulated by salt [ 30 , 31 ]. Transgenic lines overexpressing PEPCK were cultivated, and three transgenic lines (L2, L7, and L12) were maintained for functional validation in stress conditions generated by salt. Transgenic screening and GUS activities inspection verified that PEPCK induced by the 35SCaMV promoter was present in transgenic strains. The decline in the amount of chlorophyll in leaves with response to abiotic stress is usually linked to the degradation of chlorophyll pigments seen in a variety of crops including rice[ 32 ]. By using the salt endurance index and the leaf disc senescence tests, significant resistance to salt stress in transgenic rice lines was found. The damage caused by salt stress (100 and 200 mM NaCl) to the leaves of some transgenic line as well as control plants was reflected in the degree of bleaching observed in the leaf tissues. The loss of chlorophyll was higher in 200 mM NaCl in comparision to 100 mM NaCl stress. But the degree of bleaching was highest in the leaves of control plants. It is evident that the transgenic lines showing tolerance to salinity stress in boath mild (100 mM) and severe (200 mM) NaCl concentrations. The transgenic lines showed regular development under standard factors, much like control plants, and significantly better development than the control variety under salt stress conditions, demonstrating the transgene's beneficial effects on the plant. Additionally, they exhibited a greater endogenous nutrient content, demonstrating the transgenic lines' capacity to cope with salt stress. Prior research on several plants like rice types revealed similar results [ 30 , 14 ]. Under salt stress, the leaves of PEPCK overexpressing transgenic lines had increased potassium and decreased sodium concentrations than the leaves of control rice plants. The results suggest that transgenic overexpression of PEPCK may limit sodium ion accumulation in the leaves, protecting the photosynthesis system from salt stress. In accordance with prior research, the PEPCK overexpressing transgenic lines also maintained better chlorophyll than the control under salt stress [ 33 , 34 , 35 ]. Stress from salinity reduced photosynthetic functions such as intercellular CO 2 concentration (Ci), net photosynthesis rate (Pn), and stomatal conductance (gs); however, in PEPCK transgenic lines, this decline was less noticeable than in control plants. Our research also resonates with the recent findings [ 32 , 36 ]. The transgenic plants' ability to retain the level of chlorophyll may be responsible for their enhanced ability to regulate the photosynthetic system under salt stress. The plants that are affected by salt generate higher levels of reactive oxygen species (ROS), which may seriously harm proteins and nucleic acids as well as the mitochondria, chloroplasts, and plasma membrane by peroxidizing and de-esterifying lipids in the membrane [ 37 ]. Under salt stress, the current study's findings indicate a considerable reduction in lipid peroxidation, ion leakage, and H 2 O 2 generation when collated with control plants. Our findings resonated with the finds from various previous studies [ 38 , 39 ]. Salinity-induced degradation of membrane integrity results from the production of H 2 O 2 , a significant reactive oxygen species (ROS) that may oxidatively degrade biomolecules such as proteins, lipids, and nucleic acids [ 40 , 31 ]. Through the AsA–GSH process, which employs ascorbate as a hydrogen contributor, plants create larger amounts of APX to shield them from the detrimental impacts of H 2 O 2 . The NADPH-dependent breakdown of GSSG (oxidized form) to GSH (reduced form) is catalyzed by various antioxidant enzymes, such as GR, which also sustain an elevated proportion of GSH/GSSG. The outcomes of our study imply that the T 1 transgenic lines exhibit much greater mechanism of antioxidant enzymes comprising APX, GPX, and GR during salt stress than the control plant lines. This recommends that the plants are more capable of scavenging ROS over stress conditions. Through their interactions with phospholipid head groups and ROS elimination, sugars may be important components of salt defense systems [ 41 ]. We found that transgenic lines overexpressing PEPCK had greater levels of fructose and glucose compared to the control plants. In several plants, such as Dendrobium officinale , Medicago sativa L, Zea mays , and Solanum lycopersicum , the buildup of sugars as a consequence of salt stress has previously shown similar results [ 42 , 43 , 44 , 45 ]. The transgenic rice plants also demonstrated a notably elevated endogenous plant hormone content in their shoot and root, which also might have contributed to directing the molecular and biochemical processes that conferred enhanced stress tolerance. Our study correlated with the findings of Anjum et al. and Sahoo et al. [ 46 , 32 ]. In conclusion, the current work shows that PEPCK over-expressing transgenic rice has a distinct role in enabling transgenic rice to withstand salt stress while maintaining yield. It additionally serves as an excellent instance of how elements from nucleic acid metabolic pathways, such as splicing factors, may be used to improve agricultural productivity, which can survive harsh weather while ensuring food security. Declarations Acknowledgments All authors would like to express their gratitude to the Centurion University of Technology and Management, located in Bhubaneswar, India, for providing the financial support necessary for the fulfillment of this manuscript. Author contributions RKS planned the experiment. SP executed the experiment and authored the manuscript. MP provided valuable inputs during the experiment. SM provided the necessary inputs for writing the manuscript. CKS provided valuable inputs for finalising the data. The paper has been reviewed and approved by all mentioned authors. Funding: There was no funding raised to perform the research Data availability statement The findings of this study are available from the corresponding author. Consent for publication: The manuscript does not include individual person’s data, and consent for publication is not required. This statement affirms that the manuscript does not infringe on the privacy or rights of any individuals Conflict of interest The authors declare that they do not have any conflicts of interest. Clinical Trial Number: Not applicable Ethics declaration Ethics declaration: Not applicable Consent to Participate declaration: Not applicable References Li Y, Zhong H, Shan Y, Hang Y, Wang D, Zhou Y, Hubacek K (2023) Changes in global food consumption increase GHG emissions despite efficiency gains along global supply chains. Nature Food. https://doi.org/10.1038/s43016-023-00768-z Huang S, Huang P, Hareem M, Tahzeeb-ul-Hassan M, Younis U, Dawar K, Fahad S, Salmen SH, Ansari MJ, Danish S (2024) Evaluating the hidden potential of deashed biochar in mitigating salinity stress for cultivation of fenugreek, Scientific Reports. 14(1):141. Shahid SA, Zaman M, Heng L (2018) Soil Salinity: Historical Perspectives and a World Overview of the Problem. in Guideline for Salinity Assessment, Mitigation and Adaptation Using Nuclear and Related Techniques, Springer International Publishing. 43–53 https://doi.org/10.1007/978-3-319-96190-3_2 . Mamasolieva MA, L A G, Hudoynazarov IA (2023) Study the effect of a Biosolvent preparation on the amount of salts in saline soils and antioxidant enzymes of cotton. JSSWQ. 15(2):242–51. Jobe TO, Zenzen I, Rahimzadeh Karvansara P, Kopriva S (2019) Integration of sulfate assimilation with carbon and nitrogen metabolism in transition from C3 to C4 photosynthesis. J. Exp. Bot. 15;70(16):4211–21. https://doi.org/10.1093/jxb/erz250 . Ermakova M, Arrivault S, Giuliani R, Danila F, Alonso-Cantabrana H, Vlad D, Ishihara H., Feil R, Guenther M, Borghi GL, Covshoff S, Ludwig M, Cousins AB, Langdale JA, Kelly S, Lunn JE, Stitt M, von Caemmerer S, Furbank RT (2021) Installation of C4 photosynthetic pathway enzymes in rice using a single construct. Plant Biotechnol J. 19:575–588. Ermakova M, Danila FR, Furbank RT, von Caemmerer S (2020) On the road to C4 rice: advances and perspectives. T P J. 101(4):940–50. https://doi.org/10.1111/tpj.14562 Shen Z, Dong XM, Gao ZF, Chao Q, Wang BC (2017) Phylogenic and phosphorylation regulation difference of phosphoenolpyruvate carboxykinase of C3 and C4 plants. J plant physiol. 213:16–22. https://doi.org/10.1016/j.jplph.2017.02.008 Saito T, Matsukura C, Ban Y, Shoji K, Sugiyama M, Fukuda N, Nishimura S (2008) Salinity stress affects assimilate metabolism at the gene-expression level during fruit development and improves fruit quality in tomato (Solanum lycopersicum L.). JJSHS. 77(1):61–8. https://doi.org/10.2503/jjshs1.77.61 . Prusty S, Sahoo RK (2022) PEPCK Gene for Enhanced Photosynthesis and Salinity Stress Tolerance in Rice: A Review, Agricultural Reviews. DOI: 10.18805/ag.R-2494 . Sahoo RK, Tuteja N (2012) Development of Agrobacterium-mediated transformation technology for mature seed-derived callus tissues of indica rice cultivar IR64, GM Crops Food. 3:123–128. https://doi.org/10.4161/gmcr.20032 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual,; 2d ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Jayaraman A, Puranik S, Rai NK, Vidapu S, Sahu PP, Lata C, Prasad M (2008) cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.), Mol Biotechnol. 40:241–251 Tuteja N, Sahoo RK, Garg B, Tuteja R (2013) OsSUV3 dual helicase functions in salinity stress tolerance by maintaining photosynthesis and antioxidant machinery in rice (Oryza sativa L. cv. IR64), Plant J. 76:115–127. doi: 10.1111/tpj.12277 Garg B, Jaiswal JP, Misra S, Tripathi BN M.A. Prasad (2012) A comprehensive study on dehydration-induced antioxidative responses during germination of Indian bread wheat (Triticum aestivum L. em Thell) cultivars collected from different agroclimatic zones, Physiol Mol Biol Plants. 18:217–228. https://doi.org/10.1007/s12298-012-0117-7 Bates LS, Waldren RP, Teare ID (1973) Rapid determination of proline in water stress studies. Plant Soil. 39:205–207. doi: 10.1007/BF00018060 . Jana S, Choudhuri MA (1981) Glycolate metabolism of three submerged aquatic angiosperms during aging, Aquat. Bot. 12: 345–354. De Vos CHR, Schat H, Vooijs R, Ernst (1989) WHO Copper-induced damage to the permeability barrier in roots of Silene cucubalus, J. Plant Physiol. 135: 164–179. Blum A, Ebercon A (1981) Cell membrane stability as a measure of drought and heat tolerance in wheat 1. Crop Science. 21(1):43–7. Barrs HD, Weatherley PE (1962) A re-examination of the relative turgidity technique for estimating water deficit in leaves, Aust J Biol Sci. 15:413–428. Jackson TL (1973) Soil chemical analysis. Prentice-Hall of India Private Limited, New Delhi Gupta PK (2004) Methods in environmental analysis water, soil and air. Agrobios, India pp 242–245. Chapman HD, Pratt PF (1982) Method and of analysis of soil, plant and water, 2nd edn. California University Agricultural Division, California, 170. Munns R, Wallace PA, Teakle NL, Colmer TD (2010) Measuring soluble ion concentrations (Na+, K+, Cl–) in salt-treated plants. In: Sunkar R (ed) Methods in molecular biology, vol 639, Plant stress tolerance:methods and protocols. Humana Press. Springer, New York, 371–382. https://doi.org/10.1007/978-1-60761-702-0_23 Karkacier M, Erbas M, Uslu MK, Aksu M (2003) Comparison of different extraction and detectionmethods for sugars using amino-bonded phase HPLC, J Chromatogr Sci. 41:331–333 Chen JG, Du XM, Zhao HY, Zhou X (1996) Fluctuation in levels of endogenous plant hormones in ovules of normal and mutant cotton during flowering and their relation to fiber development. J. Plant Growth Regul. 15, 173–177. https://doi.org/10.1007/BF00190581 Feria AB, Bosch N, Sánchez A, Nieto-Ingelmo AI, Osa C, Echevarría C, Mauriño SG, Monreal JA (2016) Phosphoenolpyruvate carboxylase (PEPC) and PEPC-kinase (PEPC-k) isoenzymes in Arabidopsis thaliana: role in control and abiotic stress conditions. Planta 244, 901–913. https://doi.org/10.1007/s00425-016-2556-9 Monreal JA, Arias-Baldrich C, Tossi V, Feria AB, Rubio-Casal A, García-Mata C, Lamattina L, García-Mauriño S (2013) Nitric oxide regulation of leaf phosphoenolpyruvate carboxylase-kinase activity: implication in sorghum responses to salinity. Planta. 238:859–69. https://doi.org/10.1007/s00425-013-1933-x Hao S, Wang Y, Yan Y, Liu Y, Wang J, Chen S (2021) A review on plant responses to salt stress and their mechanisms of salt resistance, Horticulturae. 7(6):132. https://doi.org/10.3390/horticulturae7060132 Wang J, Nan N, Li N, Liu Y, Wang TJ, Hwang I, Liu B, Xu ZY (2020) A DNA methylation reader–chaperone regulator–transcription factor complex activates OsHKT1; 5 expression during salinity stress. Plant Cell. 1;32(11):3535-58. https://doi.org/10.1105/tpc.20.00301 Tuteja N, Sahoo RK, Huda KM, Tula S, Tuteja R (2015) OsBAT1 augments salinity stress tolerance by enhancing detoxification of ROS and expression of stress-responsive genes in transgenic rice. Plant molecular biology reporter. 33:1192–209. https://doi.org/10.1007/s11105-014-0827-9 . Sahoo RK, Tuteja R, Gill R, Jiménez Bremont JF, Gill SS, Tuteja N (2022) Marker-free rice (Oryza sativa L. cv. IR 64) overexpressing PDH45 gene confers salinity tolerance by maintaining photosynthesis and antioxidant machinery. Antioxidants. 11(4):770. https://doi.org/10.3390/antiox11040770 Cao W, Zhang H, Zhou Y, Zhao J, Lu S, Wang X, Chen X, Yuan L, Guan H, Wang G, Shen W (2022) Suppressing chlorophyll degradation by silencing OsNYC3 improves rice resistance to Rhizoctonia solani, the causal agent of sheath blight. Plant Biotechnol J. 20(2):335–49. https://doi.org/10.1111/pbi.13715 . Mukherjee S, Mukherjee A, Das P, Bandyopadhyay S, Chattopadhyay D, Chatterjee J, Majumder AL (2021) A salt-tolerant chloroplastic FBPase from Oryza coarctata confers improved photosynthesis with higher yield and multi‐stress tolerance to indica rice. Plant Cell, Tissue and Organ Culture (PCTOC) 145:561–78. https://doi.org/10.1007/s11240-021-02026-1 Nounjan N, Mahakham W, Siangliw JL, Toojinda T, Theerakulpisut P (2020) Chlorophyll retention and high photosynthetic performance contribute to salinity tolerance in rice carrying drought tolerance quantitative trait loci (QTLs). Agriculture. 10(12):620. https://doi.org/10.3390/agriculture10120620 Liu C, Hu ZH, Yu LF, Chen ST, Liu (2020) XM Responses of photosynthetic characteristics and growth in rice and winter wheat to different elevated CO2 concentrations. Photosynthetica. 58(5). DOI: 10.32615/ps.2020.066 Yildiz M, Poyraz İ, Çavdar A, Özgen Y, Beyaz R (2020) Plant responses to salt stress. IntechOpen. DOI: 10.5772/intechopen.93920 . Basu S, Kumari S, Kumar P, Kumar G, Rajwanshi R (2021) Redox imbalance impedes photosynthetic activity in rice by disrupting cellular membrane integrity and induces programmed cell death under submergence, Physiologia Plantarum. 172(3):1764–78. Kaewneramit T, Buaboocha T, Sangchai P, Wutipraditkul N (2019) OsCaM1-1 overexpression in the transgenic rice mitigated salt-induced oxidative damage, Biol Plant. 63:335. http://dx.doi.org/10.32615/bp.2019.039 Ali M, Kamran M, Abbasi GH, Saleem MH, Ahmad S, Parveen A, Malik Z, Afzal S, Ahmar S, Dawar KM, Ali S (2021) Melatonin-induced salinity tolerance by ameliorating osmotic and oxidative stress in the seedlings of two tomato (Solanum lycopersicum L.) cultivars. Journal of Plant Growth Regulation. 40:2236–48. https://doi.org/10.1007/s00344-020-10273-3 Ejaz S, Fahad S, Anjum MA, Nawaz A, Naz S, Hussain S, Ahmad S (2020) Role of osmolytes in the mechanisms of antioxidant defense of plants, Sustainable Agriculture Reviews 39. 95–117. https://doi.org/10.1007/978-3-030-38881-2_4 He C, Yu Z, Teixeira da Silva JA, Zhang J, Liu X, Wang X, Zhang X, Zeng S, Wu K, Tan J, Ma G, Luo J, Duan J (2017) DoGMP1 from Dendrobium officinale contributes to mannose content of water-soluble polysaccharides and plays a role in salt stress response, Sci Rep. 7:41010. Gao Y, Long R, Kang J, Wang Z, Zhang T, Sun H, Li X, Yang Q (2018) Comparative proteomic analysis reveals that antioxidant system and soluble sugar metabolism contribute to salt tolerance in alfalfa (Medicago sativa L.) leaves, Journal of proteome research. 18(1):191–203. https://doi.org/10.1021/acs.jproteome.8b00521 Bai X, Zeng X, Huang S, Liang J, Dong L, Wei Y, Li Y, Qu J, Wang Z (2019) Marginal impact of cropping BADH transgenic maize BZ-136 on chemical property, enzyme activity, and bacterial community diversity of rhizosphere soil, Plant Soil. 436:527–541. https://doi.org/10.1007/s11104 019-03941-1 Mohamed AN, Ismail MR (2011) Changes in organic and inorganic solutes of in vitro tomato cultivars under NaCl stress. Aust J Crop Sci. 5:939–944 Anjum N, Maiti MK (2024) OsNAC121 regulates root development, tillering, panicle morphology, and grain filling in rice plant. Plant Molecular Biology. 114(4):1–20. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6598895","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":464751735,"identity":"6d640355-a3fa-4528-9d7f-f59514bba1f8","order_by":0,"name":"Suchismita Prusty","email":"","orcid":"","institution":"Centurion University of Technology and Management","correspondingAuthor":false,"prefix":"","firstName":"Suchismita","middleName":"","lastName":"Prusty","suffix":""},{"id":464751736,"identity":"42e6263b-b4d3-4395-ba64-1a4e6cc7eb84","order_by":1,"name":"Swetaleena Mishra","email":"","orcid":"","institution":"Centurion University of Technology and Management","correspondingAuthor":false,"prefix":"","firstName":"Swetaleena","middleName":"","lastName":"Mishra","suffix":""},{"id":464751737,"identity":"06841376-5ab1-4269-b71e-7041ea82f275","order_by":2,"name":"Madhusmita Pradhan","email":"","orcid":"","institution":"Centurion University of Technology and Management","correspondingAuthor":false,"prefix":"","firstName":"Madhusmita","middleName":"","lastName":"Pradhan","suffix":""},{"id":464751738,"identity":"c16fceb7-dbbb-4ed0-9e61-e94938ba6d45","order_by":3,"name":"Chinmaya Kumar Swain","email":"","orcid":"","institution":"MITS Institute of Professional Studies","correspondingAuthor":false,"prefix":"","firstName":"Chinmaya","middleName":"Kumar","lastName":"Swain","suffix":""},{"id":464751739,"identity":"d4fad48d-47fd-4ffb-8c88-47448c883d3d","order_by":4,"name":"Ranjan Kumar Sahoo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYJACAzApAcQf0MQIa2GcAdFJWAsDTAszD1wLHmDefvZAwc8dDPb8s5sPPrapOVyn28D88ANDwR2cWmTO5CUY9p5hSJxx51iycc6xwxJmB9iMJRgMnuFxTo6BAW8bQwLDjRwz6dwGkBYGM6BfDuPWwv/GwPBvG4O9PEiLJVgL+zf8WiRyDIyBtjBuAGlhBGvhIWCLxBsDY9k2icSNN9KSDXuOpUtuO8xTLJGA12E5ZoZv22zs5W4kH3zwo8aa3+x4+8YPH/7g1gIEbAaoscEMxAn4NACVPMAvPwpGwSgYBSMeAAD3uExfALv/+wAAAABJRU5ErkJggg==","orcid":"","institution":"Centurion University of Technology and Management","correspondingAuthor":true,"prefix":"","firstName":"Ranjan","middleName":"Kumar","lastName":"Sahoo","suffix":""}],"badges":[],"createdAt":"2025-05-06 04:38:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6598895/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6598895/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83790798,"identity":"c105d1bf-f003-42d9-b8fc-1c64e62b202b","added_by":"auto","created_at":"2025-06-02 19:16:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":41583,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis and expression of \u0026nbsp;T\u003csub\u003e1\u003c/sub\u003e Transgenic lines ( \u003cem\u003ePEPCK\u003c/em\u003e). (a) Structure of T-DNA region of pCAMBIA1301 containing the \u003cem\u003ePEPCK\u003c/em\u003e gene (1.4 kb) inserted in \u003cem\u003eHindIII\u003c/em\u003e restriction enzyme site of the Multiple Cloning Site (MCS) with the promoter (CaMV35S) and terminator (poly A). (b) The \u003cem\u003ePEPCK\u003c/em\u003e overexpressing T\u003csub\u003e1\u003c/sub\u003e transgenic lines (L2, L7, and L12) and control plant (wild type) were used for further analysis. (c) Polymerase chain reaction (PCR) analysis of \u003cem\u003ePEPCK \u003c/em\u003eoverexpressing transgenic (T\u003csub\u003e1\u003c/sub\u003e) lines by using CaMV35S promoter-specific forward and gene reverse primers showing the expected amplification of a 1.4-kb fragment in three independent transgenic lines (L2, L7, and L12). Here M represents the marker and L2, L7 and L12 are independent transgenic lines (d) Southern blot analysis showing the integration and copy number of the \u003cem\u003ePEPCK\u003c/em\u003e gene in all three transgenic lines. Each value represents the mean of three replicates ±SE. Different letters on the top of bars indicate significant differences at p ≤ 0.05 level as determined by Duncan’s multiple range test (DMRT).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6598895/v1/2f202b794dab1a45de16ab15.jpg"},{"id":83790799,"identity":"46d77309-c687-468f-929c-6481ff4d8cd7","added_by":"auto","created_at":"2025-06-02 19:16:30","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":44223,"visible":true,"origin":"","legend":"\u003cp\u003e(a) Relative gene expression analysis of the T\u003csub\u003e1\u003c/sub\u003e \u003cem\u003ePEPCK\u003c/em\u003e transgenic lines to observe the RNA expression (fold change) in control and transgenic lines. (b) Visualization of GUS activity in leaf tissues of transgenic lines with control plants. (c) Leaf disc senescence assay for salt tolerance in T\u003csub\u003e1\u003c/sub\u003e \u003cem\u003ePEPCK\u003c/em\u003e transgenic rice lines with control plants. (d) Chlorophyll content (mg g\u003csup\u003e−1\u003c/sup\u003e fw) in T\u003csub\u003e1\u003c/sub\u003e \u003cem\u003ePEPCK\u003c/em\u003e transgenic lines under 100 and 200mM NaCl after 72 hours. Each value represents the mean of three replicates ±SE. Different letters on the top of bars indicate significant differences at p ≤ 0.05 level as determined by Duncan’s multiple range test (DMRT).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6598895/v1/d42343b6b9969efc2d511fde.jpg"},{"id":83791096,"identity":"e06fb292-e238-46e9-9922-72f31cd247ce","added_by":"auto","created_at":"2025-06-02 19:24:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":56959,"visible":true,"origin":"","legend":"\u003cp\u003eBiochemical analysis and the response of the antioxidant machinery in \u003cem\u003ePEPCK\u003c/em\u003e overexpressing T\u003csub\u003e1\u003c/sub\u003e transgenic lines (L2, L7, and L12) and control rice plants exposed to 24 h salt stress (200 mM NaCl). (a) Determination of lipid peroxidation expressed in terms of MDA content. (b) Changes in the level of hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) content. (c) Measurement of electrolytic leakage. (d) Changes in the level of proline accumulation. (e) Catalase (CAT) activity in transgenic lines after salt stress where one unit of enzyme activity defined as 1 μmol H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e oxidized min\u003csup\u003e−1\u003c/sup\u003e. (f) Changes in ascorbate peroxidase (APX) enzyme activity in transgenic lines after salt stress where one unit of enzyme activity defined as 1 μmol of ascorbate oxidized min\u003csup\u003e−1\u003c/sup\u003e. (g) Changes in guaiacol peroxidase (GPX) activity in transgenic lines after salt stress. (h) Changes in glutathione reductase (GR) activity in transgenic lines after salt stress where one unit of enzyme activity defined as 1 μmol of GS-TNB formed min\u003csup\u003e−1\u003c/sup\u003e due to reduction of DTNB. (i) Estimation of relative water content (RWC%) in leaf discs of transgenic and control rice. Each value represents the mean of three replicates ±SE. Different letters on the top of bars indicate significant differences at p ≤ 0.05 level as determined by Duncan’s multiple range test (DMRT).\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6598895/v1/94f603b51432a0edfa5220fd.jpg"},{"id":83790801,"identity":"d1bc055c-ce9f-4676-a5db-2ebd665a5fb4","added_by":"auto","created_at":"2025-06-02 19:16:30","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":50641,"visible":true,"origin":"","legend":"\u003cp\u003eMeasurement of photosynthetic characteristics of control and \u003cem\u003ePEPCK\u003c/em\u003e \u0026nbsp;T\u003csub\u003e1\u003c/sub\u003e transgenic lines (L2, L7, and L12) under 0mM NaCl and 200 mM NaCl treatment.\u003c/p\u003e\n\u003cp\u003e(a) Total Chlorophyll. (b) Net Photosynthetic rate. (c) Stomatal conductance.. (d) Intracellular CO\u003csub\u003e2\u003c/sub\u003e. (e) Transpiration rate. (f). Values are mean of three replicates ± SE (n = 3). Different letters on the top of bars indicate significant differences at p ≤ 0.05 level as determined by Duncan’s multiple range test (DMRT).\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6598895/v1/295b5f593a5bd3fb102ca0c7.jpg"},{"id":83791095,"identity":"f696dac6-3dd8-4d66-aa14-2414a2c9c4d5","added_by":"auto","created_at":"2025-06-02 19:24:30","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":52843,"visible":true,"origin":"","legend":"\u003cp\u003eSoluble sugar content in roots and shoots of \u003cem\u003ePEPCK\u003c/em\u003e overexpressing T\u003csub\u003e1\u003c/sub\u003e transgenic lines (L2, L7, and L12) compared to control rice plants exposed to 24 h salinity stress (200 mM NaCl). (a) Glucose content in shoots and roots in transgenic lines and control line after salt stress. (b) Fructose content in shoots and roots in transgenic lines and control line after salt stress. (c) Endogenous GA content in transgenic lines and control line after salt stress. (d) Endogenous Zeatin content in transgenic lines and control line after salt stress. (e) Endogenous IAA content in transgenic lines and control line after salt stress. Each value represents the mean of three replicates ±SE. Different letters on the top of bars indicate significant differences at p ≤ 0.05 level as determined by Duncan’s multiple range test (DMRT).\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6598895/v1/e3135db4d44cb0f12657a28d.jpg"},{"id":88624768,"identity":"c0b4bc01-0362-4e81-be4f-21a86a2b89b2","added_by":"auto","created_at":"2025-08-08 12:39:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1607065,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6598895/v1/f1d20229-c9f6-4165-aead-daeb4b667e1f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genetic transformation of rice overexpressing phosphoenolpyruvate carboxykinase to increase photosynthetic efficiency and confer tolerance to salt stress","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe worldwide population expansion has led to extended demand for food production by people, despite an estimated decline in total fertile land. Given the situation, 70% more of the present production levels would be needed by 2050 to meet the guesstimated population of 9.7\u0026nbsp;Billion and the expanding market, especially for staple foods like rice, wheat, soy, and maize [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Moreover, the natural catastrophe makes it more difficult to increase crop yield. Enhancing the capableness of plants to thrive when subjected to challenging environments is vital to fulfilling the expanding economic needs. One of the primary constraints on crop productivity in the agriculture industry is soil salinity. Excessive amounts of salt in soils inhibit the growth of glycophytic plants (100\u0026ndash;200 mM NaCl). Salinity causes the concerning depletion of 2000 hectares of agricultural land every day universally [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This causes crop yields to drop by a significant 10\u0026ndash;25%, and in extreme instances, it causes desertification [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Saline soil makes up 25% of arable land worldwide. In 60% of the stress-affected land of Central Asia, 60\u0026ndash;65% of the terra firma is afflicted by salinity stress [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. One of the most salt-sensitive cereals, rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.), is the mainstay food for over half of the global population. For instance, soil salinity causes deficits in rice output by as much as 45% and 36\u0026ndash;69%, respectively, in the Indo-Gangetic Basin of India and the Indus Basin of Pakistan. Thus, taking immediate action to lessen the effects of salt is essential to maintaining cropland and boosting agricultural productivity in an economically sustainable manner, with the goal of establishing food security. Scientists and researchers are concerned about this and are motivated to create new transgenic varieties in order to address the challenge at hand. The introduction of genetically engineered crops with increased salt tolerance has drawn a lot of interest as a practical solution to this problem. One possible attempt has been taken that requires the integration of the single-cell C\u003csub\u003e4\u003c/sub\u003e-like mechanism into the C\u003csub\u003e3\u003c/sub\u003e plants' mesophyll cells [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The transformation from C\u003csub\u003e3\u003c/sub\u003e to C\u003csub\u003e4\u003c/sub\u003e plants requires gradual modifications in their metabolic pathways that might lead to the development of resultant species with evolutionary advantages. Even so, more has to be understood about the overall system that manages C\u003csub\u003e4\u003c/sub\u003e photosynthesis [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Although the engineering of high-level and cell-specific gene expression poses obstacles for the insertion of C\u003csub\u003e4\u003c/sub\u003e biochemistry in rice, genes encoding the majority of metabolite transporters and the enzymes of the C\u003csub\u003e4\u003c/sub\u003e pathway have recently been discovered [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003ePEPCK\u003c/em\u003e functions as a prime decarboxylase cytosolic enzyme present in C\u003csub\u003e4\u003c/sub\u003e plants and has been observed to positively respond to halophytic stress in some plant species [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. It contributes to the maintenance of the pH and is engaged in several metabolic activities, including the metabolism of amino acids, nitrogen sugar, organic acids, and malate [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Through genetic engineering, transgenic crops expressing high levels of the C\u003csub\u003e4\u003c/sub\u003e enzymes \u003cem\u003ePEPC\u003c/em\u003e or \u003cem\u003ePEPCK\u003c/em\u003e have demonstrated improved crop photosynthetic capability [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In the present research, we overexpressed the \u003cem\u003ePEPCK\u003c/em\u003e gene to generate transgenic rice plants (\u003cem\u003eOryza sativa\u003c/em\u003e L., cv. IR64), which have enhanced the plants' resilience to salt stress through involvement with processes associated with repairing oxidative damage caused by stress. The resultant transgenic rice plant indicated enhanced photosynthesis, antioxidant capacity and development in addition to resistance to salt stress. We have successfully developed a transgenic plant overexpressing a C\u003csub\u003e4\u003c/sub\u003e \u003cem\u003ePEPCK\u003c/em\u003e gene thereby taking a progressive step towards bridging a gap in the C\u003csub\u003e4\u003c/sub\u003e rice project. Our research indicates that even though a better C\u003csub\u003e4\u003c/sub\u003e biochemistry and higher vein density will eventually be required for highly effective C\u003csub\u003e4\u003c/sub\u003e rice, adding a bit of C\u003csub\u003e4\u003c/sub\u003e photosynthesis to preexisting veins may currently offer the advantages of greater photosynthesis while progressing toward C\u003csub\u003e4\u003c/sub\u003e rice.\u003c/p\u003e"},{"header":"Materials and Method","content":"\u003cp\u003e \u003cb\u003ePEPCK\u003c/b\u003e \u003cb\u003eGene Cloning and\u003c/b\u003e \u003cb\u003eAgrobacterium\u003c/b\u003e\u003cb\u003e-mediated IR64 Rice Transformation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eApplying the forward primers 5' ATGGAGTTGGTTCAGAATAAAA 3' and reverse primer 5' GGTGTGGAGTTCTCTTA 3', the coding region of the \u003cem\u003ePEPCK\u003c/em\u003e gene was amplified by PCR from the complementary DNA (cDNA) of rice (\u003cem\u003eO. sativa\u003c/em\u003e L. cv. IR64 ). The 35S promoter:\u003cem\u003ePEPCK\u003c/em\u003e:poly A signal cassette was then obtained by cloning the amplified product into pRT-100 at the NcoI site. The \u003cem\u003ePEPCK\u003c/em\u003e gene cassette (GenBank accession number: AF136163.1) was fully cloned into the PstI site of the plant transformation vector pCAMBIA1301. The \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e (strain LBA4404) was used to introduce the plasmid into the embryogenic calli from mature rice seeds (\u003cem\u003eO. sativa\u003c/em\u003e L. cv. IR64) for the plant transformation technique as outlined by [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The transgenic rice lines were contrasted with the control plants (null-segregant plants that share similar genetic attributes with the transgenic plants but lack any incorporated genetic materials) derived from the tissue culture method. For each transgenic line, ten plants were selected (thirty plants in total) for a biological repetition in the subsequent trials. Analysis was done on the sample numbers of T\u003csub\u003e1\u003c/sub\u003e seedlings that came from the stress testing.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePCR, Southern Blot Assay and Tolerance Index Assessment of T\u003csub\u003e1\u003c/sub\u003e Plants\u003c/h2\u003e \u003cp\u003ePCR was used to validate the integration of the \u003cem\u003ePEPCK\u003c/em\u003e gene in transgenic IR64 rice plants. Genomic DNA (0.15\u0026ndash;0.20 \u0026micro;g) was derived from 0.5g of fresh and healthy leaves, and amplification was performed with gene-specific forward and reverse primers, together with promoter-specific forward and gene-specific reverse primers. XbaI was used to digest the DNA (20 \u0026micro;g), and the obtained specimens were then settled on 0.8% agarose gels for Southern blotting evaluation. The transferring of DNA to a negatively charged nylon membrane (Hybond-N+, Amersham, Inc).was done as per the procedure outlined by Sambrook et al. 1989 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Using α-[32P] dCTP and promoter-specific (CaMV35S) primers for both directions (forward and reverse), a radioactive probe was created. The protocol outlined by Sambrook et al. was followed for hybridization, which involved heating the probe to 53\u0026deg;C and rinsing it at 65\u0026deg;C [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe tolerance index was computed using the subsequent formula for \u003cem\u003ePEPCK\u003c/em\u003e T\u003csub\u003e1\u003c/sub\u003e transgenic lines (L2, L7 and L12) and control plants in 200 mM NaCl.\u003c/p\u003e \u003cp\u003eT\u003csub\u003e1\u003c/sub\u003e(%) = [(plant dry weight with 200 mM NaCl) / (plant dry weight with water)] \u0026times;100\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRNA Isolation and qRT-PCR\u003c/h3\u003e\n\u003cp\u003eTRIzol reagent (Invitrogen Life Technologies, USA) was utilized to disunite total RNA collected from three-weeks-young IR 64 T\u003csub\u003e1\u003c/sub\u003e \u003cem\u003ePEPCK\u003c/em\u003e transgenic and control rice seedlings maintained in a hydroponic environment after they were treated with 200 mM NaCl for 24 hours. The acquired total RNA served as the model for the generation of cDNA. 5 mg of total RNA was used to create the first-strand cDNA using Superscript II Reverse Transcriptase (Invitrogen Life Technologies USA) and an oligo(dT)18 primer, by following the instructions given by the manufacturer. With gene-specific primers (Forward: 5'-GGAAATCCTCGACCCCATCA-3' and Reverse: 5'-CGATCTTGTAGCTGGCGAAC-3') the quantitative real-time PCR (qRT-PCR) was conducted. The cycle was performed at the following temperatures: 95\u0026deg;C for 30 s, 60\u0026deg;C for 30 s, and 72\u0026deg;C for 30 s, as per the instructions given by the manufacturer (Step One Real-Time PCR system Applied Biosystems). Using the ΔΔCT technique, the quantitative variance amidst several samples was assessed. The qRT-PCR results were validated by repeating the procedures three times and the expression level mean values were calculated individually. The expression level of the relative gene was determined using the formula 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e, as described by [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eMeasurement of Salinity Tolerance by Leaf Disc Senescence Assay\u003c/h3\u003e\n\u003cp\u003eLittle squares of thriving and fully broad rice leaves measuring 1 cm \u0026times; 1 cm were extracted from control plants and transgenic lines of the same age (L2, L7, and L12) of the T\u003csub\u003e1\u003c/sub\u003e generations. For 72 hours, the discs drifted in NaCl solutions containing 100 and 200 mM. As mentioned earlier, the research study was conducted using three biological duplicates at room temperature as depicted by [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eAssessments of Antioxidants in\u003c/b\u003e \u003cb\u003ePEPCK\u003c/b\u003e \u003cb\u003eTransgenic Lines\u003c/b\u003e\u003c/p\u003e \u003cp\u003e21-day-old control plant and \u003cem\u003ePEPCK\u003c/em\u003e transgenic plant seedlings were cultivated in 200 mM NaCl for 24 hours in this experiment before being utilized for biochemical studies. According to Garg et al. (2012) the enzyme activity of the ascorbate peroxidase (APX), catalase (CAT), guaiacol peroxidase (GPX), and glutathione reductase (GR) were evaluated. Amounts of proline as well as hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) were analyzed as they play significant functions in stressful situations [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eProline estimation\u003c/h3\u003e\n\u003cp\u003eAdopting the Bates et al. technique, 500 mg of fresh root tissues were standardized in 10 ml of 3% sulphosalicylic acid in an ice-cold solution to determine the amounts of proline [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. After centrifuging the resulting mixture at 10,000 g for 15 minutes, 2 ml of the solution was combined with 2 ml of acid ninhydrin and glacial acetic acid. The mix was cooled in ice to stop the chemical reaction after being incubated at 100\u0026deg;C for one hour, during which time a colorful complex was produced in the water bath. The colored complex was vortexed for 15\u0026ndash;20 seconds after adding 4 milliliters of toluene. Afterward, at 520 nm, the optical density of the layer comprising the chromophore was evaluated to determine the proline content by utilizing an L-Proline standard curve.\u003c/p\u003e\n\u003ch3\u003eDetermination of HO Content\u003c/h3\u003e\n\u003cp\u003eThe H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e level was determined using an updated version of Jana and Choudhuri approach [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. After standardizing 100 mg of leaf tissue using liquid nitrogen and crushing it in 3 cm\u003csup\u003e3\u003c/sup\u003e of 50 mM phosphate buffer (pH 7), H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was isolated. After filtering and centrifuging the homogenated solution for 6,000 g at 4\u0026deg;C for 25 minutes, 0.9 cm\u003csup\u003e3\u003c/sup\u003e of the supernatant was combined with 0.3 cm\u003csup\u003e3\u003c/sup\u003e of 1% (v/v) TiCl\u003csub\u003e4\u003c/sub\u003e in concentrated HCl, and the mixture was centrifuged again for 6,000 g at 4\u0026deg;C for 15 minutes. At 410 nm, the yellow supernatant's absorbancy was determined. The standard curve was then created based on various reported H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e concentrations to determine the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e level.\u003c/p\u003e \u003cp\u003eThe estimation of the levels of electrolytic leakage, lipid peroxidation, and relative water content (RWC), were determined by using the procedure outlined by Tuteja et al. (2013) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eLipid peroxidation measurement (MDA content)\u003c/h2\u003e \u003cp\u003eMalondialdehyde (MDA), a breakdown product of lipid peroxidation, was measured to quantify lipid peroxidation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Using a mixer mill (MM400, Retsch, Germany) with two cycles of 35 Hz per minute, leaves (0.1 g) were crushed into a fine powders. Following the addition of 1 cm\u003csup\u003e3\u003c/sup\u003e of 0.1% trichloroacetic acid (TCA), the resulting solution went through a centrifuge for 15 minutes at 5,000 g and 25\u0026deg;C. Following centrifugation, 0.75 cm\u003csup\u003e3\u003c/sup\u003e of 0.25% 2-thiobarbituric acid in 10% TCA was mixed with 0.3 cm\u003csup\u003e3\u003c/sup\u003e of the supernatant, and the absorbance was measured at 532 nm and 600 nm. Implementing an absorption coefficient of 155 mM\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, the MDA concentration was evaluated by deducting the absorbance of the supernatant at 600 nm from that of 532 nm.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eElectrolytic leakage (Membrane permeability)\u003c/h3\u003e\n\u003cp\u003eThree days post salt stress, leaves were cut into 1 cm square pieces, placed in a test tube, and were rinsed with 5 cm\u003csup\u003e3\u003c/sup\u003e of deionized water to remove surface contaminants. Electrical conductivity (EC) was subsequently evaluated both prior to and after autoclaving at 121\u0026deg;C for 20 minutes, while the material was immersed in 5 cm\u003csup\u003e3\u003c/sup\u003e of deionized water in a test tube for two hours.\u003c/p\u003e \u003cp\u003eThe formula for calculating the cell membrane stability [%] was 100 - [(EC1/EC2) \u0026times; 100], where EC1 represents the electric conductivity following a two-hour dip in deionized water and EC2 represents electrical conductivity following a 20-minute autoclave [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eRelative water content\u003c/h3\u003e\n\u003cp\u003eBarrs and Whetherley approach was implemented, and plants from all treatments were chosen at random [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. To calculate initial mass (Mi), a leaf specimen weighing about 0.1 g was divided into smaller fragments and analyzed. To calculate the completely water-saturated mass (Mf), the leaf specimens were submerged in recently de-ionized water for 12 hours. After a three-day oven drying at 60\u0026deg;C, the specimen's dry mass (Md) was measured. We then calculated the RWC [%] using the formula [(Mi - Md)/(Mf - Md)] * 100.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eQuantification of Photosynthetic Parameters\u003c/h2\u003e \u003cp\u003eOver the course of 30 days, mature IR64 rice control plants and \u003cem\u003ePEPCK\u003c/em\u003e transgenic rice plants were subjected to 200 mM and 0 mM NaCl, respectively. On a sunny weather between 10:00 AM and 12:00 PM, the fourth and fifth fully extended leaves of transgenic lines (L2, L7, and\u003c/p\u003e \u003cp\u003eL12) as well as control plants were measured for stomatal conductance (gs) intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration (Ci), net photosynthetic rate (Pn), and transpiration rate using an infrared gas analyzer (IRGA from LiCor, located in Lincoln, Nebraska, USA). The examination was conducted in the following atmospheric factors: atmospheric temperature of 30\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, relative humidity of 68.2\u0026thinsp;\u0026plusmn;\u0026thinsp;6%, atmospheric CO\u003csub\u003e2\u003c/sub\u003e of 404 \u0026micro;mol mol\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, photosynthetically active radiation (PAR) of 1,900\u0026thinsp;\u0026plusmn;\u0026thinsp;6 \u0026micro;mol m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eThe Agronomic Attributes of T\u003csub\u003e1\u003c/sub\u003e Transgenic Plant\u003c/h2\u003e \u003cp\u003eThe matured control plant lines as well as \u003cem\u003ePEPCK\u003c/em\u003e transgenic plant lines' agronomic attributes were assessed following a 30-day treatment with 200 and 0 mM NaCl and their development and yield efficiency were evaluated post-salt stress. A variety of agronomic parameters were also measured, including plant height, number of tillers/plant, number of panicles/plant, number of chaffy grains/panicle, number of filled grain/panicle, leaf area, 100-grain weight, root dry weight, straw dry weight, root length, and plant dry weight pre and post salt stress in both control and \u003cem\u003ePEPCK\u003c/em\u003e transgenic rice lines. On a metre scale, the length of the shoot and roots were determined. Plant samples were desiccated in a hot-air oven (Memmert, Model 500, Germany) at 80\u0026deg;C for four days until a uniform weight was achieved. Dry weight was established by incubating the specimens in a desiccator. The leaf area was determined using a leaf area meter (manufactured by Systronics in Hyderabad, India).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDetermining the endogenous ion content and soluble sugar and hormones\u003c/h2\u003e \u003cp\u003eTo estimate endogenous ions (potassium, nitrogen, sodium, and phosphorus concentration), leaves from T\u003csub\u003e1\u003c/sub\u003e transgenic lines and control lines cultivated for 56 days on 200 mM NaCl and 0 mM NaCl, respectively, were used. Jackson's method was utilized to calculate the total nitrogen concentration [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. A spectrophotometer was utilized to determine the phosphorus concentration in accordance with Gupta's instructions [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Using a flame ionization photometer and regular procedure, the potassium content was determined [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The Munns et al. technique was used to test the sodium content [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. After subjecting both transgenic and control plants to a 24-hour salt treatment, the amounts of fructose and glucose in both, the roots and shoots were determined [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. As previously stated by Chen et al. estimates of the endogenous plant hormones (GA, zeatin, and IAA) have been determined [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData from three studies and mean values and standard errors were gathered. Applying SPSS (12.0 Inc., USA), the ANOVA test was run on the collected data to find the least significant difference (LSD) for the statistically substantial data, which allowed for the identification of treatment-wise changes in the mean. Duncan's multiple-range analyses (DMRT) were utilized to determine the means.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eMolecular assessment of the transgenic\u003c/b\u003e \u003cb\u003ePEPCK\u003c/b\u003e \u003cb\u003eplants\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTransgenic IR64 rice plants were created using the pCAMBIA1301-\u003cem\u003ePEPCK\u003c/em\u003e T-DNA construct \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u003cb\u003e(a)]\u003c/b\u003e. Comparing the transgenic lines (L2, L7, and L12) and control plants lines, there were no discernible phenotypic changes \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u003cb\u003e(b)]\u003c/b\u003e. The transgene (\u003cem\u003ePEPCK\u003c/em\u003e) presence was confirmed using PCR with specific primers (forward and reverse) and an expected 1.4 kb fragment was magnified \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u003cb\u003e(c)]\u003c/b\u003e. The count of incorporated transgene copies in T\u003csub\u003e1\u003c/sub\u003e transgenic lines was determined using the Southern blot hybridization technique. All three lines (L2, L7, and L12) showed single-copy insertion \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u003cb\u003e(d)]\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe transgenic lines (L2, L7, and L12) exhibited a roughly 10-fold increase in transcript levels in comparison to control plants cultivated in normal conditions, according to quantitative real-time PCR (qRT-PCR) findings \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e(a)]\u003c/b\u003e. All of the transgenic lines tissues from leaves (L2, L7, and L12) exhibited GUS activity, however the control plants lacked any blue color \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e(b)]\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eTransgenic T\u003csub\u003e1\u003c/sub\u003e Plants Display Salinity Tolerance\u003c/h2\u003e \u003cp\u003eT\u003csub\u003e1\u003c/sub\u003e transgenic lines (L2, L7, and L12) and control lines\u0026rsquo; leaf chunks (about 1 cm \u0026times; 1 cm) were suspended individually on 100 and 200 mM NaCl for 72 hours in order to evaluate the plants' salinity tolerance. The leaf tissue showed discoloration after 72 hours, indicating harm from salt stress. In comparison to control plants, all transgenic lines showed dropped chlorophyll loss, indicating a higher tolerance to saline stress. \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(c)]\u003c/b\u003e. The increased levels of chlorophyll in the leaf discs senescence assay of the transgenic plants mentioned above show that the T\u003csub\u003e1\u003c/sub\u003e transgenic lines are resistant to salt stress at both mild (100 mM) and severe (200 mM) intensities of NaCl \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(d)]\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eIon Leakage, MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e accumulation in Transgenic Plants Under Salt Stress\u003c/h2\u003e \u003cp\u003eWhen T\u003csub\u003e1\u003c/sub\u003e transgenic lines (L2, L7, and L12) were subjected to severe salt stress (200 mM NaCl), the results of the assessment for antioxidant activity showed that the proportion of malondialdehyde (MDA) was approximately two times lower than control, the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content was approximately 2.5 times lower, and the ion leakage was approximately 1.5 times \u003cb\u003elower [\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e \u003cb\u003e(a\u0026ndash;c)]\u003c/b\u003e. This suggests that in the transgenic rice plants, overexpression of \u003cem\u003ePEPCK\u003c/em\u003e may reduce the build-up of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, MDA, and ion leakage.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eROS Activity in Transgenic Lines\u003c/h2\u003e \u003cp\u003eThe antioxidant enzyme activities, proline amounts, and relative water content (RWC) were assessed in transgenic lines and control plants. In transgenic rice lines, the level of proline has increased (by about 1.5 times) under 200 mM NaCl stress compared to control \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e \u003cb\u003e(d)]\u003c/b\u003e. In addition, under the stress (200 mM NaCl), transgenic rice lines revealed a substantial rise in the activity of antioxidant enzymes like CAT (\u0026sim;1.5-fold), APX (\u0026sim;2.4-fold), GPX (\u0026sim;3.2-fold), and GR (\u0026sim;2.4-fold) along with RWC (\u0026sim;2.7-fold) when compared to the control rice lines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eThe agronomic traits and photosynthetic productivity of T\u003csub\u003e1\u003c/sub\u003e transgenic rice plants\u003c/h2\u003e \u003cp\u003eA segregating ratio of 3:1 was observed in the T\u003csub\u003e1\u003c/sub\u003e transgenic rice seeds \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. While comparing the developmental rate of T\u003csub\u003e1\u003c/sub\u003e transgenics rice seedlings under NaCl stress to that of control plants, no discernible variation was seen.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of segregation ratio (Hygr:Hygs) and plant seedlings survival (%) of the null-segregant (control) and T\u003csub\u003e1\u003c/sub\u003e generation of \u003cem\u003ePEPCK\u003c/em\u003e overexpressing transgenic plants (line 2, line 7 and line 12) (\u003cem\u003eOryza sativa\u003c/em\u003e L. cv. IR64) grown in the presence of 0 and 200Mm NaCl, respectively\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAttributes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWater-grown control plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003e200 mM NaCl-grown PEPCK transgenic plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLine 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLine 7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eLine 12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSegregation ratio (Hygr:Hygs [n]a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.62:1[178]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.72:1 [156]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.1:1[184]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant seedlings survival (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e95\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e92\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e96\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e91\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eEach value represents mean of three replicates\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. The letters \u0026ldquo;a\u0026rdquo; indicate significant differences at P\u0026thinsp;\u0026gt;\u0026thinsp;0.05 level as determined by DMRT\u003c/p\u003e \u003cp\u003e \u003csup\u003ea\u003c/sup\u003e Recording made from seeds\u003c/p\u003e \u003cp\u003eWhen exposed to 200 mM salinity stress, the transgenic rice lines that overexpressed \u003cem\u003ePEPCK\u003c/em\u003e performed better than the control plants in terms of growth variables such as plant\u0026rsquo;s height, tiller/plant count, panicle/plant count, filled grain/panicle count, chaffy grain/panicle count, straw dry weight, 100-grain weight, root length, root dry weight, leaf area, and root and shoot lengths \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Under salt stress (200mM NaCl), T\u003csub\u003e1\u003c/sub\u003e transgenics exhibited elevated levels of all the photosynthetic parameters such as stomatal conductance (gs), net photosynthetic rate (Pn), intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration (Ci) and transpiration rate in comparison to the control plants \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e \u003cb\u003e(a-d)]\u003c/b\u003e. In general, salt stress affects the photosynthesis system of both transgenic and control plants; however, control plants exhibited greater damage than T\u003csub\u003e1\u003c/sub\u003e transgenic plants \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e \u003cb\u003e(a-d)]\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAgronomical parameters of rice (\u003cem\u003eOryza sativa\u003c/em\u003e L. cv. IR64) null-segregant and T\u003csub\u003e1\u003c/sub\u003e generation of \u003cem\u003ePEPCK\u003c/em\u003e overexpressing transgenic lines (line 2, line 7 and line 12) under 0 and 200 mM NaCl\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eAttributes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c3\" namest=\"c2\" rowspan=\"2\"\u003e \u003cp\u003eControl plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c9\" namest=\"c4\"\u003e \u003cp\u003eNaCl (mM)-grown T\u003csub\u003e1\u003c/sub\u003e PEPCK transgenic plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eL2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eL7\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eL12\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant height (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e72\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e31\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e76\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e68\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e71\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e66\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e78\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e71\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRoot length (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e26\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e12.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e28.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e23.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e23.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e29.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e25.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRoot dry weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e3.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e2.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e2.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeaf area (cm\u003csup\u003e2\u003c/sup\u003e/plant)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e93\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e39\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e93.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e84\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e97\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e92.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e100\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e87\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal protein(mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e fw)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e1.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e1.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e1.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e1.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNitrogen (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.276\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.107\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.314\u0026thinsp;\u0026plusmn;\u0026thinsp;0.012\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.289\u0026thinsp;\u0026plusmn;\u0026thinsp;0.014\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e0.320\u0026thinsp;\u0026plusmn;\u0026thinsp;0.015\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e0.298\u0026thinsp;\u0026plusmn;\u0026thinsp;0.009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e0.312\u0026thinsp;\u0026plusmn;\u0026thinsp;0.010\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e0.272\u0026thinsp;\u0026plusmn;\u0026thinsp;0.011\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhosphorus (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.268\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.126\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.258\u0026thinsp;\u0026plusmn;\u0026thinsp;0.009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.227\u0026thinsp;\u0026plusmn;\u0026thinsp;0.009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e0.276\u0026thinsp;\u0026plusmn;\u0026thinsp;0.009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e0.232\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e0.256\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e0.214\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePotassium (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.168\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.085\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.175\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.135\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e0.178\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e0.153\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e0.154\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e0.147\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSodium (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.044\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.074\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.037\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.051\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e0.035\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e0.045\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e0.038\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e0.067\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eEach value represents mean of three replicates\u0026thinsp;\u0026plusmn;\u0026thinsp;SE.Means were compared using ANOVA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003ePhenotypic traits, chlorophyll, endogenous ion content, soluble sugars, and hormones of T\u003csub\u003e1\u003c/sub\u003e transgenic plants\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003ePEPCK\u003c/em\u003e T\u003csub\u003e1\u003c/sub\u003e transgenic lines showed reduced sodium concentrations in contrast to the control plants when endogenous ion content was measured under the 200 mM salt stress, yet greater amounts of potassium, phosphorus, and nitrogen ions became apparent \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Transgenic rice lines under salt stress also showed greater concentrations of chlorophyll than control plants \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Transgenic rice lines showed similar yield variables to control rice plants in water (0 mM NaCl), including tillers/plant, filled grain/panicle, panicles/plant, chaffy grain/panicle, and days to achieve flowers \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. But under 200 mM NaCl stress, the control rice plants failed to make it to the blooming phase \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of various yield parameters in rice (\u003cem\u003eOryza sativa L\u003c/em\u003e. cv. IR64) null-segregant (control) and T\u003csub\u003e1\u003c/sub\u003e generation of \u003cem\u003ePEPCK\u003c/em\u003e overexpressing transgenic lines (line 2, line 7 and line 12) under 0 and 200 mM NaCl\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c3\" namest=\"c2\" rowspan=\"2\"\u003e \u003cp\u003eControl plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c9\" namest=\"c4\"\u003e \u003cp\u003eNaCl (mM)-grown T\u003csub\u003e1\u003c/sub\u003e PEPCK transgenic plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eL2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eL7\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eL12\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTime required for flowering (days)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e86\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e95\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e69.6\u0026thinsp;\u0026plusmn;\u0026thinsp;5.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e97\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e77\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e92\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e65.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4.521\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo. of tillers/plant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e21.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e16.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e26.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e22.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e14.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo. of panicle/plant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e22.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e25.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e17\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e11.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo. of filled grain/panicle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e86\u0026thinsp;\u0026plusmn;\u0026thinsp;3.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e89\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e80\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e94\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e83\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e84\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e72\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo. of chaffy grains/panicle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e10.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e5.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e10.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e7.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e8.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e4.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e11\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStraw dry weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e55\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e59\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e49\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e63\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e53.6\u0026thinsp;\u0026plusmn;\u0026thinsp;2.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e59.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e48.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e100 grain weight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e2.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e3.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e2.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e2.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eControl plants did not survive until harvesting under 200 mM NaCl. Each value represents mean of three replicates\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. Means were compared using ANOVA. ND no data\u003c/p\u003e \u003cp\u003eDuring salt stress, the \u003cem\u003ePEPCK\u003c/em\u003e overexpressing T\u003csub\u003e1\u003c/sub\u003e plants collected more fructose (\u0026sim;-2.5 times) and glucose (\u0026sim;2- times) in their shoots and roots \u003cb\u003e[\u003c/b\u003eFigs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e \u003cb\u003e(a, b)]\u003c/b\u003e than the control rice lines. In addition, the roots and shoots of the \u003cem\u003ePEPCK\u003c/em\u003e transgenics had a higher concentration of hormones (including GA, zeatin, and IAA) than the control plant \u003cb\u003e[\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e \u003cb\u003e(c- e)]\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eRice production is negatively impacted by salinity levels, a multigenic characteristic that regulates every aspect of the plant's functioning. Previous research has reported on the novel involvement of \u003cem\u003ePEPCK\u003c/em\u003e in plant lines' resistance to abiotic stressors, including salt and drought, in various plants like Arabidopsis thaliana and Sorghum bicolor [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Resilience against salt stress requires knowledge of processes like homeostasis of ions and ROS elimination [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The objective of the current experimentation is to determine more about the mechanism and possible function of \u003cem\u003ePEPCK\u003c/em\u003e gene in providing rice (\u003cem\u003eOryza sativa\u003c/em\u003e L. cv. IR64) with salt stress resistance.\u003c/p\u003e \u003cp\u003eWhile compared to other abiotic stressors, it has been observed that the \u003cem\u003ePEPCK\u003c/em\u003e gene is expressed three times more when exposed to NaCl. Prior research has also shown that the expression of othere genes including \u003cem\u003eOsHKT1, PDH45, OsBAT1\u003c/em\u003e and \u003cem\u003eOsSUV3\u003c/em\u003e, being stimulated by salt [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTransgenic lines overexpressing \u003cem\u003ePEPCK\u003c/em\u003e were cultivated, and three transgenic lines (L2, L7, and L12) were maintained for functional validation in stress conditions generated by salt. Transgenic screening and GUS activities inspection verified that \u003cem\u003ePEPCK\u003c/em\u003e induced by the 35SCaMV promoter was present in transgenic strains. The decline in the amount of chlorophyll in leaves with response to abiotic stress is usually linked to the degradation of chlorophyll pigments seen in a variety of crops including rice[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. By using the salt endurance index and the leaf disc senescence tests, significant resistance to salt stress in transgenic rice lines was found. The damage caused by salt stress (100 and 200 mM NaCl) to the leaves of some transgenic line as well as control plants was reflected in the degree of bleaching observed in the leaf tissues. The loss of chlorophyll was higher in 200 mM NaCl in comparision to 100 mM NaCl stress. But the degree of bleaching was highest in the leaves of control plants. It is evident that the transgenic lines showing tolerance to salinity stress in boath mild (100 mM) and severe (200 mM) NaCl concentrations. The transgenic lines showed regular development under standard factors, much like control plants, and significantly better development than the control variety under salt stress conditions, demonstrating the transgene's beneficial effects on the plant. Additionally, they exhibited a greater endogenous nutrient content, demonstrating the transgenic lines' capacity to cope with salt stress. Prior research on several plants like rice types revealed similar results [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Under salt stress, the leaves of \u003cem\u003ePEPCK\u003c/em\u003e overexpressing transgenic lines had increased potassium and decreased sodium concentrations than the leaves of control rice plants. The results suggest that transgenic overexpression of \u003cem\u003ePEPCK\u003c/em\u003e may limit sodium ion accumulation in the leaves, protecting the photosynthesis system from salt stress. In accordance with prior research, the \u003cem\u003ePEPCK\u003c/em\u003e overexpressing transgenic lines also maintained better chlorophyll than the control under salt stress [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Stress from salinity reduced photosynthetic functions such as intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration (Ci), net photosynthesis rate (Pn), and stomatal conductance (gs); however, in \u003cem\u003ePEPCK\u003c/em\u003e transgenic lines, this decline was less noticeable than in control plants. Our research also resonates with the recent findings [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The transgenic plants' ability to retain the level of chlorophyll may be responsible for their enhanced ability to regulate the photosynthetic system under salt stress.\u003c/p\u003e \u003cp\u003eThe plants that are affected by salt generate higher levels of reactive oxygen species (ROS), which may seriously harm proteins and nucleic acids as well as the mitochondria, chloroplasts, and plasma membrane by peroxidizing and de-esterifying lipids in the membrane [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Under salt stress, the current study's findings indicate a considerable reduction in lipid peroxidation, ion leakage, and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e generation when collated with control plants. Our findings resonated with the finds from various previous studies [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Salinity-induced degradation of membrane integrity results from the production of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, a significant reactive oxygen species (ROS) that may oxidatively degrade biomolecules such as proteins, lipids, and nucleic acids [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Through the AsA\u0026ndash;GSH process, which employs ascorbate as a hydrogen contributor, plants create larger amounts of APX to shield them from the detrimental impacts of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. The NADPH-dependent breakdown of GSSG (oxidized form) to GSH (reduced form) is catalyzed by various antioxidant enzymes, such as GR, which also sustain an elevated proportion of GSH/GSSG. The outcomes of our study imply that the T\u003csub\u003e1\u003c/sub\u003e transgenic lines exhibit much greater mechanism of antioxidant enzymes comprising APX, GPX, and GR during salt stress than the control plant lines. This recommends that the plants are more capable of scavenging ROS over stress conditions. Through their interactions with phospholipid head groups and ROS elimination, sugars may be important components of salt defense systems [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. We found that transgenic lines overexpressing \u003cem\u003ePEPCK\u003c/em\u003e had greater levels of fructose and glucose compared to the control plants. In several plants, such as \u003cem\u003eDendrobium officinale\u003c/em\u003e, \u003cem\u003eMedicago sativa\u003c/em\u003e L, \u003cem\u003eZea mays\u003c/em\u003e, and \u003cem\u003eSolanum lycopersicum\u003c/em\u003e, the buildup of sugars as a consequence of salt stress has previously shown similar results [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The transgenic rice plants also demonstrated a notably elevated endogenous plant hormone content in their shoot and root, which also might have contributed to directing the molecular and biochemical processes that conferred enhanced stress tolerance. Our study correlated with the findings of Anjum et al. and Sahoo et al. [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn conclusion, the current work shows that \u003cem\u003ePEPCK\u003c/em\u003e over-expressing transgenic rice has a distinct role in enabling transgenic rice to withstand salt stress while maintaining yield. It additionally serves as an excellent instance of how elements from nucleic acid metabolic pathways, such as splicing factors, may be used to improve agricultural productivity, which can survive harsh weather while ensuring food security.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors would like to express their gratitude to the Centurion University of Technology and Management, located in Bhubaneswar, India, for providing the financial support necessary for the fulfillment of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRKS planned the experiment. SP executed the experiment and authored the manuscript. MP provided valuable inputs during the experiment. SM provided the necessary inputs for writing the manuscript. CKS provided valuable inputs for finalising the data. The paper has been reviewed and approved by all mentioned authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e There was no funding raised to perform the research\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe findings of this study are available from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eThe manuscript does not include individual person’s data, and consent for publication is not required. This statement affirms that the manuscript does not infringe on the privacy or rights of any individuals\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they do not have any conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical Trial Number:\u0026nbsp;\u003c/strong\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration Ethics declaration:\u0026nbsp;\u003c/strong\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate declaration:\u0026nbsp;\u003c/strong\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLi Y, Zhong H, Shan Y, Hang Y, Wang D, Zhou Y, Hubacek K (2023) Changes in global food consumption increase GHG emissions despite efficiency gains along global supply chains. Nature Food. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s43016-023-00768-z\u003c/span\u003e\u003cspan address=\"10.1038/s43016-023-00768-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang S, Huang P, Hareem M, Tahzeeb-ul-Hassan M, Younis U, Dawar K, Fahad S, Salmen SH, Ansari MJ, Danish S (2024) Evaluating the hidden potential of deashed biochar in mitigating salinity stress for cultivation of fenugreek, Scientific Reports. 14(1):141.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahid SA, Zaman M, Heng L (2018) Soil Salinity: Historical Perspectives and a World Overview of the Problem. in Guideline for Salinity Assessment, Mitigation and Adaptation Using Nuclear and Related Techniques, Springer International Publishing. 43\u0026ndash;53 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-319-96190-3_2\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-96190-3_2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMamasolieva MA, L A G, Hudoynazarov IA (2023) Study the effect of a Biosolvent preparation on the amount of salts in saline soils and antioxidant enzymes of cotton. JSSWQ. 15(2):242\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJobe TO, Zenzen I, Rahimzadeh Karvansara P, Kopriva S (2019) Integration of sulfate assimilation with carbon and nitrogen metabolism in transition from C3 to C4 photosynthesis. J. Exp. Bot. 15;70(16):4211\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erz250\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erz250\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErmakova M, Arrivault S, Giuliani R, Danila F, Alonso-Cantabrana H, Vlad D, Ishihara H., Feil R, Guenther M, Borghi GL, Covshoff S, Ludwig M, Cousins AB, Langdale JA, Kelly S, Lunn JE, Stitt M, von Caemmerer S, Furbank RT (2021) Installation of C4 photosynthetic pathway enzymes in rice using a single construct. Plant Biotechnol J. 19:575\u0026ndash;588.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErmakova M, Danila FR, Furbank RT, von Caemmerer S (2020) On the road to C4 rice: advances and perspectives. T P J. 101(4):940\u0026ndash;50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/tpj.14562\u003c/span\u003e\u003cspan address=\"10.1111/tpj.14562\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen Z, Dong XM, Gao ZF, Chao Q, Wang BC (2017) Phylogenic and phosphorylation regulation difference of phosphoenolpyruvate carboxykinase of C3 and C4 plants. J plant physiol. 213:16\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jplph.2017.02.008\u003c/span\u003e\u003cspan address=\"10.1016/j.jplph.2017.02.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaito T, Matsukura C, Ban Y, Shoji K, Sugiyama M, Fukuda N, Nishimura S (2008) Salinity stress affects assimilate metabolism at the gene-expression level during fruit development and improves fruit quality in tomato (Solanum lycopersicum L.). JJSHS. 77(1):61\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2503/jjshs1.77.61\u003c/span\u003e\u003cspan address=\"10.2503/jjshs1.77.61\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrusty S, Sahoo RK (2022) PEPCK Gene for Enhanced Photosynthesis and Salinity Stress Tolerance in Rice: A Review, Agricultural Reviews. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18805/ag.R-2494\u003c/span\u003e\u003cspan address=\"10.18805/ag.R-2494\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahoo RK, Tuteja N (2012) Development of Agrobacterium-mediated transformation technology for mature seed-derived callus tissues of indica rice cultivar IR64, GM Crops Food. 3:123\u0026ndash;128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/gmcr.20032\u003c/span\u003e\u003cspan address=\"10.4161/gmcr.20032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual,; 2d ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJayaraman A, Puranik S, Rai NK, Vidapu S, Sahu PP, Lata C, Prasad M (2008) cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.), Mol Biotechnol. 40:241\u0026ndash;251\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuteja N, Sahoo RK, Garg B, Tuteja R (2013) OsSUV3 dual helicase functions in salinity stress tolerance by maintaining photosynthesis and antioxidant machinery in rice (Oryza sativa L. cv. IR64), Plant J. 76:115\u0026ndash;127. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tpj.12277\u003c/span\u003e\u003cspan address=\"10.1111/tpj.12277\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarg B, Jaiswal JP, Misra S, Tripathi BN M.A. Prasad (2012) A comprehensive study on dehydration-induced antioxidative responses during germination of Indian bread wheat (Triticum aestivum L. em Thell) cultivars collected from different agroclimatic zones, Physiol Mol Biol Plants. 18:217\u0026ndash;228. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12298-012-0117-7\u003c/span\u003e\u003cspan address=\"10.1007/s12298-012-0117-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBates LS, Waldren RP, Teare ID (1973) Rapid determination of proline in water stress studies. Plant Soil. 39:205\u0026ndash;207. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/BF00018060\u003c/span\u003e\u003cspan address=\"10.1007/BF00018060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJana S, Choudhuri MA (1981) Glycolate metabolism of three submerged aquatic angiosperms during aging, Aquat. Bot. 12: 345\u0026ndash;354.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Vos CHR, Schat H, Vooijs R, Ernst (1989) WHO Copper-induced damage to the permeability barrier in roots of Silene cucubalus, J. Plant Physiol. 135: 164\u0026ndash;179.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlum A, Ebercon A (1981) Cell membrane stability as a measure of drought and heat tolerance in wheat 1. Crop Science. 21(1):43\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarrs HD, Weatherley PE (1962) A re-examination of the relative turgidity technique for estimating water deficit in leaves, Aust J Biol Sci. 15:413\u0026ndash;428.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJackson TL (1973) Soil chemical analysis. Prentice-Hall of India Private Limited, New Delhi\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta PK (2004) Methods in environmental analysis water, soil and air. Agrobios, India pp 242\u0026ndash;245.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChapman HD, Pratt PF (1982) Method and of analysis of soil, plant and water, 2nd edn. California University Agricultural Division, California, 170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunns R, Wallace PA, Teakle NL, Colmer TD (2010) Measuring soluble ion concentrations (Na+, K+, Cl\u0026ndash;) in salt-treated plants. In: Sunkar R (ed) Methods in molecular biology, vol 639, Plant stress tolerance:methods and protocols. Humana Press. Springer, New York, 371\u0026ndash;382. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-1-60761-702-0_23\u003c/span\u003e\u003cspan address=\"10.1007/978-1-60761-702-0_23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarkacier M, Erbas M, Uslu MK, Aksu M (2003) Comparison of different extraction and detectionmethods for sugars using amino-bonded phase HPLC, J Chromatogr Sci. 41:331\u0026ndash;333\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen JG, Du XM, Zhao HY, Zhou X (1996) Fluctuation in levels of endogenous plant hormones in ovules of normal and mutant cotton during flowering and their relation to fiber development. J. Plant Growth Regul. 15, 173\u0026ndash;177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF00190581\u003c/span\u003e\u003cspan address=\"10.1007/BF00190581\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeria AB, Bosch N, S\u0026aacute;nchez A, Nieto-Ingelmo AI, Osa C, Echevarr\u0026iacute;a C, Mauri\u0026ntilde;o SG, Monreal JA (2016) Phosphoenolpyruvate carboxylase (PEPC) and PEPC-kinase (PEPC-k) isoenzymes in Arabidopsis thaliana: role in control and abiotic stress conditions. Planta 244, 901\u0026ndash;913. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00425-016-2556-9\u003c/span\u003e\u003cspan address=\"10.1007/s00425-016-2556-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonreal JA, Arias-Baldrich C, Tossi V, Feria AB, Rubio-Casal A, Garc\u0026iacute;a-Mata C, Lamattina L, Garc\u0026iacute;a-Mauri\u0026ntilde;o S (2013) Nitric oxide regulation of leaf phosphoenolpyruvate carboxylase-kinase activity: implication in sorghum responses to salinity. Planta. 238:859\u0026ndash;69. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00425-013-1933-x\u003c/span\u003e\u003cspan address=\"10.1007/s00425-013-1933-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHao S, Wang Y, Yan Y, Liu Y, Wang J, Chen S (2021) A review on plant responses to salt stress and their mechanisms of salt resistance, Horticulturae. 7(6):132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/horticulturae7060132\u003c/span\u003e\u003cspan address=\"10.3390/horticulturae7060132\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Nan N, Li N, Liu Y, Wang TJ, Hwang I, Liu B, Xu ZY (2020) A DNA methylation reader\u0026ndash;chaperone regulator\u0026ndash;transcription factor complex activates OsHKT1; 5 expression during salinity stress. Plant Cell. 1;32(11):3535-58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.20.00301\u003c/span\u003e\u003cspan address=\"10.1105/tpc.20.00301\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuteja N, Sahoo RK, Huda KM, Tula S, Tuteja R (2015) OsBAT1 augments salinity stress tolerance by enhancing detoxification of ROS and expression of stress-responsive genes in transgenic rice. Plant molecular biology reporter. 33:1192\u0026ndash;209. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11105-014-0827-9\u003c/span\u003e\u003cspan address=\"10.1007/s11105-014-0827-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahoo RK, Tuteja R, Gill R, Jim\u0026eacute;nez Bremont JF, Gill SS, Tuteja N (2022) Marker-free rice (Oryza sativa L. cv. IR 64) overexpressing PDH45 gene confers salinity tolerance by maintaining photosynthesis and antioxidant machinery. Antioxidants. 11(4):770. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox11040770\u003c/span\u003e\u003cspan address=\"10.3390/antiox11040770\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao W, Zhang H, Zhou Y, Zhao J, Lu S, Wang X, Chen X, Yuan L, Guan H, Wang G, Shen W (2022) Suppressing chlorophyll degradation by silencing OsNYC3 improves rice resistance to Rhizoctonia solani, the causal agent of sheath blight. Plant Biotechnol J. 20(2):335\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/pbi.13715\u003c/span\u003e\u003cspan address=\"10.1111/pbi.13715\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMukherjee S, Mukherjee A, Das P, Bandyopadhyay S, Chattopadhyay D, Chatterjee J, Majumder AL (2021) A salt-tolerant chloroplastic FBPase from Oryza coarctata confers improved photosynthesis with higher yield and multi‐stress tolerance to indica rice. Plant Cell, Tissue and Organ Culture (PCTOC) 145:561\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11240-021-02026-1\u003c/span\u003e\u003cspan address=\"10.1007/s11240-021-02026-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNounjan N, Mahakham W, Siangliw JL, Toojinda T, Theerakulpisut P (2020) Chlorophyll retention and high photosynthetic performance contribute to salinity tolerance in rice carrying drought tolerance quantitative trait loci (QTLs). Agriculture. 10(12):620. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agriculture10120620\u003c/span\u003e\u003cspan address=\"10.3390/agriculture10120620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Hu ZH, Yu LF, Chen ST, Liu (2020) XM Responses of photosynthetic characteristics and growth in rice and winter wheat to different elevated CO2 concentrations. Photosynthetica. 58(5). DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.32615/ps.2020.066\u003c/span\u003e\u003cspan address=\"10.32615/ps.2020.066\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYildiz M, Poyraz İ, \u0026Ccedil;avdar A, \u0026Ouml;zgen Y, Beyaz R (2020) Plant responses to salt stress. IntechOpen. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5772/intechopen.93920\u003c/span\u003e\u003cspan address=\"10.5772/intechopen.93920\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasu S, Kumari S, Kumar P, Kumar G, Rajwanshi R (2021) Redox imbalance impedes photosynthetic activity in rice by disrupting cellular membrane integrity and induces programmed cell death under submergence, Physiologia Plantarum. 172(3):1764\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaewneramit T, Buaboocha T, Sangchai P, Wutipraditkul N (2019) OsCaM1-1 overexpression in the transgenic rice mitigated salt-induced oxidative damage, Biol Plant. 63:335. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.32615/bp.2019.039\u003c/span\u003e\u003cspan address=\"10.32615/bp.2019.039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAli M, Kamran M, Abbasi GH, Saleem MH, Ahmad S, Parveen A, Malik Z, Afzal S, Ahmar S, Dawar KM, Ali S (2021) Melatonin-induced salinity tolerance by ameliorating osmotic and oxidative stress in the seedlings of two tomato (Solanum lycopersicum L.) cultivars. Journal of Plant Growth Regulation. 40:2236\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00344-020-10273-3\u003c/span\u003e\u003cspan address=\"10.1007/s00344-020-10273-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEjaz S, Fahad S, Anjum MA, Nawaz A, Naz S, Hussain S, Ahmad S (2020) Role of osmolytes in the mechanisms of antioxidant defense of plants, Sustainable Agriculture Reviews 39. 95\u0026ndash;117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-38881-2_4\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-38881-2_4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe C, Yu Z, Teixeira da Silva JA, Zhang J, Liu X, Wang X, Zhang X, Zeng S, Wu K, Tan J, Ma G, Luo J, Duan J (2017) DoGMP1 from Dendrobium officinale contributes to mannose content of water-soluble polysaccharides and plays a role in salt stress response, Sci Rep. 7:41010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Y, Long R, Kang J, Wang Z, Zhang T, Sun H, Li X, Yang Q (2018) Comparative proteomic analysis reveals that antioxidant system and soluble sugar metabolism contribute to salt tolerance in alfalfa (Medicago sativa L.) leaves, Journal of proteome research. 18(1):191\u0026ndash;203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.jproteome.8b00521\u003c/span\u003e\u003cspan address=\"10.1021/acs.jproteome.8b00521\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai X, Zeng X, Huang S, Liang J, Dong L, Wei Y, Li Y, Qu J, Wang Z (2019) Marginal impact of cropping BADH transgenic maize BZ-136 on chemical property, enzyme activity, and bacterial community diversity of rhizosphere soil, Plant Soil. 436:527\u0026ndash;541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11104 019-03941-1\u003c/span\u003e\u003cspan address=\"10.1007/s11104 019-03941-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohamed AN, Ismail MR (2011) Changes in organic and inorganic solutes of in vitro tomato cultivars under NaCl stress. Aust J Crop Sci. 5:939\u0026ndash;944\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnjum N, Maiti MK (2024) OsNAC121 regulates root development, tillering, panicle morphology, and grain filling in rice plant. Plant Molecular Biology. 114(4):1\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"PEPCK, Salinity stress, Antioxidant enzymes, Oryza sativa, Reactive oxygen species (ROS), Photosynthesis","lastPublishedDoi":"10.21203/rs.3.rs-6598895/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6598895/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSalinity stress is one of the major worldwide obstacle for the glycophytic crop production, including rice. This phenomenon alters the cellular metabolism and causes significant crop destruction resulting in substantial reductions in yield. Through genetic engineering, it is possible to decrease the oxidative stress and increase the photosynthetic capability by using C\u003csub\u003e3\u003c/sub\u003e transgenic plants that produce the C\u003csub\u003e4\u003c/sub\u003e enzymes like phosphoenolpyruvate carboxykinase (\u003cem\u003ePEPCK)\u003c/em\u003e at a high level. In this research, we evaluate the efficiency of transgenic rice plants (\u003cem\u003eOryza sativa\u003c/em\u003e L. cv. IR64) over-expressing \u003cem\u003ePEPCK\u003c/em\u003e genes to act against salinity stress as well as increasing its photosynthetic efficiency. Rice plants overexpressing \u003cem\u003ePEPCK\u003c/em\u003e (T\u003csub\u003e1\u003c/sub\u003e generation) show tolerance to high salinity (200 mM NaCl) stress. The T\u003csub\u003e1\u003c/sub\u003e transgenics showed increased levels of several biochemical factors, including ascorbate peroxidase (APX), malondialdehyde (MDA), glutathione reductase (GR) and guaiacol peroxidase (GPX) activities suggesting the existence of an effective antioxidant defense mechanism that helps the plants to deal with oxidative damage driven by salt stress. The photosynthetic parameters like chlorophyll contents, net photosynthetic rate, intercellular CO\u003csub\u003e2\u003c/sub\u003e content and stomatal conductance were all considerably elevated in transgenic plants when compared with the control plants (null seggregant). It also exhibited higher agronomic characteristics than the control plant. Our findings add a preliminary conclusive evidence of \u003cem\u003ePEPCK\u003c/em\u003e gene's potential role in regulating salt stress response and tolerance of rice plants.\u003c/p\u003e","manuscriptTitle":"Genetic transformation of rice overexpressing phosphoenolpyruvate carboxykinase to increase photosynthetic efficiency and confer tolerance to salt stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-02 19:16:25","doi":"10.21203/rs.3.rs-6598895/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c8d99a28-451e-40b8-9f0b-5de3b7f55cdd","owner":[],"postedDate":"June 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-08T12:39:21+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-02 19:16:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6598895","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6598895","identity":"rs-6598895","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.