Incidence, antimicrobial resistance and distribution of class 1 and class 2 integron gene cassette arrays in bacteria isolated from ornamental fishes cultured in three districts of Tamil Nadu

Incidence, antimicrobial resistance and distribution of class 1 and class 2 integron gene cassette arrays in bacteria isolated from ornamental fishes cultured in three districts of Tamil Nadu | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Incidence, antimicrobial resistance and distribution of class 1 and class 2 integron gene cassette arrays in bacteria isolated from ornamental fishes cultured in three districts of Tamil Nadu Nallaiah Hemamalini, Seerappalli Aran Shanmugam, Ayyathurai Kathirvelpandian, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4434353/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Antimicrobial resistance (AMR) is an emerging problem in the aquaculture sector. Further, it connects livestock and human health through possible horizontal gene transfer. In the present study, 258 bacterial isolates were recovered from ornamental fish samples collected from fish farms in Chennai, Madurai and Tiruvarur districts of Tamil Nadu. 16S rRNA sequencing of the isolates revealed the presence of 86 different bacterial strains in the infected fish samples. The highest diversity index was observed in the Goldfish sample (1.99) collected from Tiruvarur, followed by Flower horn (1.98) sample from Chennai. All the bacterial isolates were susceptible to ciprofloxacin and sulphafurazole. The highest resistance was recorded against oxytetracycline, followed by bacitracin, tetracycline and ampicillin. Some of the bacterial isolates exhibited resistance against the new-generation antibiotic, cefepime. Resistance to new generation antibiotics indicates the need for surveillance and monitoring programs to control the indiscriminate use of antibiotics in aquaculture and develop new generation antibiotics. The highest MAR index was recorded in P. vulgaris (0.79) from Guppy (Tiruvarur). MAR index values, ≥ 0.20 exhibited by the bacterial strains isolated from different locations in Tamil Nadu indicate the abusive use of the antimicrobials. Class 1 and Class 2 integrons were detected in the genomic and plasmid DNA of 71 and 3 isolates, respectively. The findings of the present study indicate that ornamental fish may act as the reservoir of MAR bacteria and threaten the human and animal health through dissemination ARGs via horizontal gene transfer. Antimicrobial resistance gene Antimicrobial resistance Bacterial diversity Multiple antimicrobial resistance Ornamental fishes Figures Figure 1 Figure 2 Figure 3 Introduction Ornamental fish production has a significant role in the economy of the country. Over 4,500 fish species are involved in the global ornamental fish industry, of which 60% are of freshwater origin. In India, freshwater ornamental fishes contribute about 80% to the ornamental fish trade. The ornamental fish exports from India showed an increasing trend and exponential growth over the years. One of the major constraints in the aquaculture sector is disease occurrence (Hemamalini et al. 2021 ). Most of the diseases in the aquaculture sector are caused by bacteria (Hemamalini et al. 2022a ). Bacterial disease outbreak causes less profitability in the aquaculture facility. Hence, the farmers are compelled to use antibiotics in the aquaculture system. Antibiotics have been widely used in aquaculture to treat various bacterial diseases in cultured fish globally (Hemamalini et al. 2022b ). The drugs used to control bacterial infections in fish farms are usually the same as those used in human and animal husbandry. Prolonged usage of antibiotics in aquaculture leads to the emergence of antimicrobial resistance (AMR) in the bacteria associated with the system. Resistance from the animal can be transmitted to human commensal and pathogenic bacteria via horizontal gene transfer (HGT). This indicates the possibility of spreading AMR from aquatic to non-aquatic environments, which could seriously impact global health concerns. The development and spread of AMR are widely documented in human, veterinary, and fish pathogens due to its exposure to antimicrobials. AMR has been recognized as a worldwide risk to human health since the resistance can spread from animals to humans via the food chain, handling and environment. Fish handlers are often infected by zoonotic bacteria such as Mycobacterium sp., A. hydrophilia , Streptococcus iniae , Vibrio vulnificus , and Photobacterium damselae present in the aquaculture system (Haenen et al. 2013 ). The occurrence of AMR in these bacteria are quite common, which in the case of causing the disease in humans, cannot be treated anymore. Human contact with resistant bacteria in ornamental fish has severe consequences for humans and the environment. As a consequence of the One Health Approach, AMR monitoring should limit not only food fishes but also ornamental fishes. Antimicrobial resistance gene dissemination in bacterial pathogens is mainly mediated by integron. It is also believed that integron plays a significant role in the rapid dissemination of MAR among bacteria. The presence of class 1 and class 2 integrons were reported in aquaculture systems (Soufi et al. 2011 ). Of which class 1 integron was the most predominant gene cassette in aquaculture systems. Ornamental fish culture sectors are now widely accepted as one of the major contributors to the rise in AMR and its resistance determinants in microorganisms (Preena et al. 2020b ; Hemamalini et al. 2021 ). Hence, the antimicrobial resistance magnitude in ornamental fishes should be studied thoroughly to formulate the necessary measures to solve the crisis. The present study focused on bacterial diversity determination, antibiogram profile and resistance gene cassette detection from infected ornamental fish samples collected from different fish farms of Tamil Nadu for successful treatment of bacterial infection. Materials and methods Ethical Approval Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, has approved the procedures and methodologies followed in the present study. Sample collection Based on the freshwater ornamental fish production in Tamil Nadu, major ornamental fish producing districts such as Chennai, Madurai and Tiruvarur were selected for this study. Two ornamental fish farms were selected from each district, and freshly dead and moribund were collected. Commercially important ornamental fishes such as Flower horn and Kadango (Cichlid) from Chennai; Sailfin molly, Swordtail, Koi carp, Angelfish, Tiger barb and Longfin tetra from Madurai; Goldfish, Koi carp, Guppy, Cichlid and Platy from Tiruvarur were collected. Thirty infected moribund fish specimens from each species were collected and transported to the laboratory in aerated plastic bags containing pond water and euthanized immediately using 0.3 mg/ml of tricaine methane sulfonate (MS-222, Sigma Aldrich, USA). Bacterial isolation and phenotypic characterization The infected tissue samples were dissected aseptically and pooled for bacterial isolation, according to the species and sampling location. The excised tissues were homogenized with sterile physiological saline and inoculated into the sterile nutrient agar plates in triplicate (Himedia, India), and incubated overnight at 37°C. The isolated distinctive colonies were selected and sub cultured on nutrient agar slants and further undergone various biochemical tests (gram staining, motility, catalase, oxidase, sugar fermentation (glucose and mannitol), indole, Voges-Proskauer and citrate utilization) for presumptive identification (Cowan and Steel 1965). Dendrogram construction and diversity analysis The result of the biochemical tests was recorded as numerical values in an excel spreadsheet. Positive results were recorded as “1” and negative as “0”. For dendrogram construction, the biochemical test results were analysed in NTedit, version 1.2 and NTSYSpc, version 2.10e (Exeter Software, Setauket, NY, USA) (Rohlf 1998). Thus, clusters were generated based on the similarities, and the representative isolates from each cluster were taken for molecular characterization. The Shannon- wiener diversity index was calculated using Primer E software. Species richness, evenness and dominance are the three important factors which influence the diversity index of the microbial community and which were also determined (Clarke and Gorley 2015). Molecular identification and Phylogenetic analysis The genomic DNA of bacterial isolates from infected fish samples was extracted following the salting-out method (Miller et al. 1988). The quality and quantity of the DNA were checked using nanodrop spectrophotometer (Thermo Scientific, Waltham, USA) at 260 and 280 nm. The Polymerase chain reaction (PCR) was performed in a thermal cycler (Eppendorf, Germany) using PCR master mix (Ampliqon, Denmark). For molecular 16S rRNA gene amplification was performed by using universal primers fD1 (5’ CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG 3′) and rD1 (5’ CCCGGGATCCAAGCTTAAGGAGGTGATCCAGCC 3′) (Weisburg et al. 1991). Phylogenetic trees were constructed using UPGMA statistical method with Kimura 2- parameter substitution model with 1000 bootstrap replications in MEGA 7.0 software (Kumar et al. 2016). Antimicrobial resistance profiling and determination of multiple antibiotic resistance (MAR) index Antimicrobial resistance patterns of all the bacterial isolates were carried out using thirty eight antibiotics (Himedia, India) belonging to 16 classes. The list of antibiotics used in the study are provided in Table 1. Antimicrobial susceptibility test (AST) was performed following the Kirby-Bauer disc diffusion method on Muller Hinton agar (MHA) plates(Bauer 1966). 0.5 McFarland standards were prepared for all the isolates and inoculated into MHA agar plates. CLSI reference strain, Escherichia coli ATCC 25922, was used as a control. The zone of inhibition (mm) was measured and interpreted by CLSI (2018), EUCAST (2021) and manufacturer guidelines. The multiple antibiotic resistance (MAR) index was determined by following the procedure described by Krumperman (1983). Detection of AMR gene cassettes Plasmids from the resistant isolates were extracted using the HiPurA plasmid DNA miniprep purification kit (Himedia, India) as per the manufacturer’s protocol. The presence of class 1 and class 2 integron gene cassettes in both genomic and plasmid DNA of all the isolates were detected using class 1 integron primers 5’CSF (5’GGCATCCAAGCAGCAAG3’) and 3’CSR (5’AAGCAGACTTGACCTGA3’) (Lévesque et al. 1995) and class 2 integron primers Hep74F (5’CGGGATCCCCGGCATGCACGATTTGTA3’) and Hep51R (5′GATGCCATCGCAAGTACGAG3′) (White et al. 2001). The amplified PCR products were checked on 1% agarose gel stained with ethidium bromide. Results Isolation and identification of bacterial isolates from ornamental fishes The tissue samples from 13 ornamental fish species provided more than 200 bacterial colonies. The isolated distinctive colonies were selected, sub-cultured, and further identified by various biochemical tests. Biochemical test results of the recovered isolates revealed that most of the bacterial strains isolated from infected ornamental fish samples were gram-negative. The bacterial diversity was higher in the Goldfish sample (1.99) collected from Tiruvarur, followed by Flower horn (1.98) from Chennai and Cichlid (1.97) from Tiruvarur (Table 2). Whereas the lowest bacterial diversity (1.50) was observed in Angelfish samples collected from Madurai. Unique biochemical characteristics aided to differentiate the isolates and identified the representatives through dendrogram construction. Among the 258 isolates selected for the phenotypic study, only 86 types were identified on the basis of dendrogram. Thus, a total of 86 representative isolates were subjected to molecular identification. The 16S rRNA genes were identified and submitted to the GenBank database. The list of bacterial isolates recovered from infected fish samples and their accession numbers are provided in Table 3. The phylogenetic tree was constructed using MEGA 7.0 software. The bacterial isolates belonging to the same genera are represented in sister clades, and the species belonging to the different genera are in a separate clade (Fig.S1 to Fig.S3). Antibiogram profile Chennai Antimicrobial susceptibility test results revealed that bacterial isolates of Flower horn were resistant to minimum of 5 and maximum of 18 antibiotics tested. Bacterial isolates from Kadango showed resistance to at least 5 and up to 20 antibiotics used in this study. The most dominant group, A. hydrophila from Flower horn and Kadango, showed resistance to more than 11 antibiotics with the MAR index of 0.29. In Kadango, the highest MAR index was recorded in B. cereus (0.5) and the lowest in C. freundii (0.14). In Flower horn, P. entomophila showed the highest MAR index (0.48) and the lowest was recorded in K. gibsonii (0.14). The MAR index of various bacterial strains isolated from infected ornamental fish samples are shown in Table 3. All the bacterial isolates from Flower horn and Kadango exhibited resistance toward tetracycline and oxytetracycline. 75% of isolates from Flower horn and 84% from Kadango exhibited resistance against bacitracin. Besides that, amoxicillin, ampicillin, cefalexin, cefixime/clavulanic acid, trimethoprim, sulphadiazine and furazolidone were also ineffective for >50% of the bacterial isolates from Flower horn. In the case of Kadango, >50% of isolates were resistant towards amoxicillin, ampicillin, cefazolin, cephalothin, cefalexin, cefoxitin, trimethoprim, sulphadiazine, nitrofurantoin, furazolidone and rifampicin. Most of the isolates from Flower horn exhibited resistance against at least one of the cephalosporin antibiotics. It was observed that B. cereus from Kadango exhibited resistance against 4 th generation cephalosporin antibiotic, cefepime. The percentage of resistant strains isolated from infected ornamental fishes at Chennai fish farms are depicted in Table 1. The graph depicting the percentage of antimicrobial resistance towards different classes of antibiotics is shown in Fig.1. Madurai The fish samples such as Sailfin molly, Swordtail, Koi carp, Angelfish, Tiger barb and Longfin tetra were collected from ornamental fish farms of Madurai. The results revealed that the bacterial isolates of Sailfin molly were resistant to minimum of 4 and maximum of 22 antibiotics tested. Bacterial isolates from Swordtail exhibited resistance to minimum of 0 and maximum of 16 antibiotics used in this study. The bacterial isolates from Koi carp exhibited resistance against minimum of 3 and maximum of 27 antibiotics tested. Minimum of 9 and maximum of 19 antibiotics were ineffective for the bacterial isolates recovered from Angelfish. Bacterial isolates from Tiger barb were resistant to at least 9 and up to 30 antibiotics; isolates from Longfin tetra were resistant to minimum of 7 and maximum of 15 antibiotics tested. The highest MAR index was exhibited by C. cronae (0.56) from Sailfin molly, B. subtilis (0.43) from Swordtail, E. alcedinis (0.69) from Koi carp, P. entomophila (0.48) from Angelfish, P. penneri (0.77) from Tiger barb and A. caviae (0.37) from Longfin tetra. In this study, 86% of the isolates recovered from infected ornamental fish samples collected from fish farms in Madurai possessed a MAR index of ≥0.2. In contrast, B. drentensis from Swordtail exhibited susceptibility to all the antibiotics tested. The MAR index of bacterial isolates recovered from ornamental fish samples collected at Madurai is shown in Table 3. It was observed that more than 50% of bacterial isolates from Sailfin molly were resistant to amoxicillin, ampicillin, cefixime/clavulanic acid, ceftazidime, cefoperazone, cefepime, aztreonam, bacitracin, tetracycline and oxytetracycline. Similarly, antibiotics such as cephalothin, rifampicin, tetracycline and oxytetracycline were ineffective against more than 50% of isolates derived from Koi carp. All the bacterial strains from Koi carp were resistant to bacitracin and more than 50% of bacterial isolates from Koi carp exhibited resistance against amoxicillin, ampicillin, amoxiclav, cephalothin, cefixime/clavulanic acid, aztreonam, kanamycin, nitrofurantoin, rifampicin and oxytetracycline. Similarly, all the bacterial strains isolated from Angelfish exhibited resistance to amoxicillin, and bacitracin. 50% of the isolates were resistant to ampicillin, cefotaxime, streptomycin, furazolidone, rifampicin, tetracycline and oxytetracycline. All the bacterial strains from Tiger barb were resistant to aztreonam and only 50% of the isolates were resistant to ampicillin, cefazolin, cefixime/clavulanic acid, ceftazidime, cefotaxime, nalidixic acid, nitrofurantoin, bacitracin, rifampicin and oxytetracycline. Ampicillin was resistant to all the bacterial isolates derived from Longfin tetra. Over 50% of bacterial isolates recovered from Longfin tetra were resistant to furazolidone, bacitracin, rifampicin, tetracycline and oxytetracycline. It was found that more than 50% of bacterial isolates from all the fish samples collected from Madurai were resistant to oxytetracycline. It was also found that some bacterial isolates from ornamental fish samples, except the isolates from Longfin tetra collected from Madurai, exhibited resistance towards 4 th generation cephalosporin antibiotic cefepime. The percentage of antibiotic resistance bacterial isolates against 38 antibiotics tested are given in Table 1. The graph depicting the percentage of AMR towards different classes of antibiotics is shown in Fig. 2a& Fig. 2b. Tiruvarur The ornamental fish samples such as Goldfish, Koi carp, Guppy, Cichlids and Platy were collected from ornamental fish farms of Tiruvarur. Antimicrobial susceptibility test results revealed that 8 representative isolates of Goldfish were resistant to at least 6 and up to 27 antibiotics tested. Six representative isolates from Koi carp showed resistance to at least 9 and up to 18 antibiotics used in this study. Representative Guppy isolates showed resistance to at least 13 and up to 31 of the tested antibiotics. Bacterial isolates from Cichlids were resistant to at least 11 and up to 19 antibiotics, and isolates from Platy were resistant to minimum of 0 and maximum of 19 antibiotics tested. The MAR index of most bacterial strains isolated from the ornamental fish samples at Tiruvarur fish farms was reported as >0.25. In contrast, B. drentensis from Platy exhibited susceptibility to all the antibiotics tested. E. alcedinis from Goldfish possessed a higher MAR index (0.69); The highest MAR index was exhibited by C . cronae (0.45) from Koi carp, P. vulgaris (0.79) from Guppy, K. aerogenes (0.48) from Cichlid and Platy. The MAR index of bacterial isolates from ornamental fish samples collected at Tiruvarur is shown in Table 3. The graph depicting the percentage of AMR towards different classes of antibiotics is shown in Fig. 3a & Fig. 3b. More than 50% of the isolates from infected Goldfish were resistant to amoxicillin, ampicillin, piperacillin, amoxiclav, cefalexin, trimethoprim, sulphadiazine, furazolidone, bacitracin, tetracycline and oxytetracycline. More than 50% of the bacterial isolates from Koi carp were resistant to amoxicillin, ampicillin, cefalexin, cefixime/clavulanic acid, ceftazidime, polymyxin-B, bacitracin and rifampicin. All the isolates from Guppy exhibited susceptibility to bacitracin, and more than 50% of the isolates exhibited resistance to amoxicillin, ampicillin, cefazolin, cephalothin, cefalexin, cefoperazone, aztreonam, trimethoprim, sulphadiazine, rifampicin, tetracycline and oxytetracycline. Antibiotics such as ampicillin, cefazolin, cephalothin, cefalexin, cefoperazone, cefpodoxime, trimethoprim, sulphadiazine, nalidixic acid, furazolidone, nitrofurantoin, bacitracin, rifampicin, tetracycline and oxytetracycline were ineffective against 50% bacterial isolates from Cichlid. More than 50% of the bacterial isolates from Platy exhibited resistance against ampicillin, cefalexin, trimethoprim, nalidixic acid, nitrofurantoin, polymyxin-B, bacitracin, tetracycline and oxytetracycline. The percentage of antibiotic resistance bacterial isolates against 38 antibiotics tested are given in Table 1. Out of 38 antibiotics, sulphafurazole and ciprofloxacin exhibited susceptibility to all the isolates from ornamental fish samples collected from Chennai, Madurai and Tiruvarur. The antibiotics exhibiting susceptibility towards all the bacterial isolates from fish samples collected from Chennai, Madurai and Tiruvarur are given in Table 4. Screening of AMR gene cassettes In the present study, out of 86 bacterial isolates recovered from infected fish samples, class 1 integron was detected 71 isolates, whereas class 2 integron was detected in 3 isolates only. Class 2 integrons were detected in K. aerogenes isolated from Kadango and A. nosocomialis and A. hydrophila recovered from Flower horn with the product size of 1000 bp. Plasmids of all the representative bacteria were given positive amplicons for class 1 integrons and the results were similar to amplicons of integrons in respective bacterial genomic DNA. Both plasmid and genomic DNA were found to have the integron gene indicating which is of plasmid- borne. Discussion Bacterial diversity in infected fishes There is a need to ascertain the status of AMR patterns across humans, livestock, fish and the related environmental aspects in the country to provide meaningful input for one health concept. Considering the diversity and growth potential, the freshwater system was selected for the study. Bacterial diversity in infected ornamental fish samples was determined by molecular characterization. The diversity of bacteria in infected fish will aid in advancing disease management strategies. Gram-negative bacteria were dominant in all the infected fish samples used in the study. Most of the diseases in aquaculture systems are caused by gram-negative microorganisms (Lewbart 2001; Pereira et al. 2022). Bacteria belonging to Aeromonadaceae , Enterobacteriaceae , Planococcaceae , Comamonadaceae , Bacillaceae and Moraxellaceae were predominant in all the fish samples used in the study. Among Aeromonadaceae, Aeromonas veronii , A. hydrophila , A. sobria and A. caviae were dominant. Aeromonads are opportunistic pathogens associated with poor water quality (Padrós and Furones 2002; Abdelsalam et al. 2021). Aeromonas sp., which includes A. hydrophila, A. veronii , and A. caviae , is responsible for a wide spectrum of diseases in aquaculture (Lewbart 2001)and most cultured fishes are commonly affected by A. hydrophila (Palmeiro and Roberts 2009). It was found that A. veronii was the dominant species in the infected fish samples used in this study. Among fish pathogenic aeromonads, A. veronii was reported as the dominant organism in several studies (Sreedharan et al. 2011, 2013; Hu et al. 2012; Jagoda et al. 2014). A. hydrophila has also been reported as the dominant fish pathogen in the freshwater system (Schmidt et al. 2001; Dias et al. 2012). Yi et al. (2013) reported a higher occurrence of A. veronii over A. hydrophila among the bacteria isolated from diseased eels in the Republic of Korea. Recently, some opportunistic pathogens in the aquaculture system have been identified as the causative agent for severe disease outbreaks (Martins et al. 2008). One among them is Enterococcus sp. Similarly, in the present study also, the occurrence of E. faecalis has been encountered in 10 fish samples collected from 3 different locations in Tamil Nadu. It was reported that E. faecalis causes streptococcal infection in tilapia cultured in Thailand fish farms (Petersen and Dalsgaard 2003). The occurrence of Enterobacter sp. in ornamental fishes has been reported in several studies (Trust and Bartlett 1974; Preena et al. 2020a). K. aerogenes, C. freundii , C. cronae and E. cloacae were isolated from infected fish samples, indicating faecal contamination in the sampling site (Gufe et al. 2019). The faecal matter from birds and animals may be the source of enteropathogens in the culture system. Hence, it was found that ornamental fish culture systems act as the site for human pathogens. In addition, gram-positive microorganisms such as Bacillus cereus, B. paramycoides , B. drentensis, and Niallia circulans were also isolated from ornamental fish samples. The diseases caused by Bacillus sp. in fishes and humans are limited to a few species. The most important species implicated in serious infections are B. cereus , B. mycoides , B. thuringiensis , B. anthracis , B. subtilis and B. pseudomycoides (Nakamura 1998). Of these, B. cereus is recognized as a major food poisoning organism in humans. It produces a range of virulence factors, can enter the gastrointestinal tract, and causes diarrhea and vomiting in humans (Song et al. 2019). B. cereus is the causative agent responsible for skin ulcers in African catfish, Clarias gariepinus (Yu et al. 2019)and mass mortality in stinging catfish , Heteropneustes fossilis (Chandra et al. 2015). It was also found that zoonotic pathogens such as A. hydrophila and A. sobria , the causative agent for human enteritis and fatal septicemia, were isolated from 13 and 4 fish species, respectively (Shiina et al. 2004). Another zoonotic pathogen, Edwardsiella tarda, was also isolated from 9 fish samples in this study. E. tarda was considered zoonotic and there is no successful remedy for treating this infection in cultured fishes (Xu and Zhang 2014). Acinetobacter sp. and Citrobacter sp. are also reported as zoonotic and facultative and can cause severe infections without exhibiting any symptoms in cultured fishes (Walczak et al. 2017). Shannon Weiner diversity index and phylogenetic analysis Species richness, evenness and dominance could directly influence the Shannon-Wiener diversity index of the recovered isolates (Kim et al. 2017). Goldfish sample collected from Tiruvarur was found to have higher bacterial diversity (1.99) than all the other samples. The management of culture practices of farms are different, hence the possibility of differential microbial load between the farms. Increased demand for ornamental fishes leads to the culture of these fishes in high stocking density, and also, human handling was more in ornamental fish culture systems. Due to this stress, ornamental fishes were severely affected by several bacterial infections. This might be the reason for higher bacterial diversity in Goldfish. The UPGMA tree of 16S rRNA gene sequences of bacterial isolates constructed established that similar genera were clustered under the same nodes while different genera were clustered under separate nodes. The nodes were supported by high bootstrap values (90–99%). Similar findings were observed in bacterial strains isolated from Nile tilapia (Preena et al. 2020a) and Koi carp & Goldfish samples (Preena et al. 2019a). Antimicrobial Susceptibility Global use of antibiotics is a common practice to control bacterial infections in humans and animals. To control bacterial infections in cultured fishes, antimicrobial agents used in aquaculture systems increase bacterial resistance to antibiotics, thereby increasing the possible transfer of resistance determinants to commensal bacteria associated with the environment. This horizontal gene transfer (HGT) becomes the reason for multiple antibiotic resistance. The AMR genes located on mobile genetics elements increase the possibility of spreading ARGs to human and fish pathogenic bacteria (Ramesh and Souissi 2018). Antimicrobial resistance is gaining more attention due to its adverse effect on human health, and aquaculture systems have been recognized as a hotspot for AMR determinants (Zainab et al. 2020). Several studies have reported the presence of AMR bacteria in ornamental fishes collected from different aquaculture farms (Singh et al. 2009; Elhadi 2014; Dharmaratnam et al. 2017; Preena et al. 2019b; Anjur et al. 2021). Antibiotics for AST were selected based on their importance and common use in disease prevention and treatment in fish farms and human clinics. All the resolved isolates were subjected to AST using 38 commercially available antibiotics since the individual isolate of the same species might have different antimicrobial susceptibility patterns. However, there was not much variation in the zone of inhibition produced by each bacterial species. The AST of bacterial isolates revealed that all the Aeromonas sp . exhibited high resistance to β-lactam antibiotics, penicillin, and cephalosporin. The higher percentage of resistance towards β-lactam antibiotics was found due to the natural production of chromosomal β-lactamases (Taylor et al. 2011). Amoxicillin and ampicillin were ineffective against more than 60% of isolates from ornamental fish samples collected from Chennai, Madurai and Tiruvarur fish farms. This result is similar to Hossain et al. (2018) and Hossain et al. (2020), where the majority of Aeromonas sp. isolated from Goldfish and Guppy, respectively, exhibited resistance against these antibiotics. It was also found that most isolates exhibited resistance to cephalosporin 1 st and 2 nd generation antibiotics, erythromycin and azithromycin from macrolides. The resistance of Gram-negative bacteria to erythromycin and azithromycin is to be expected because many organisms possess intrinsic resistance to macrolide antibiotics (Akinbowale et al. 2006). Similar to our study results, AST of Aeromonas sp. isolated from diseased freshwater fishes in Thailand fish farms revealed resistance against amoxicillin (99%), ampicillin (98%), oxytetracycline (77%), trimethoprim-sulfamethoxazole (24%), and enrofloxacin (21%) (Mursalim et al. 2022). Tetracycline, rifamycin, quinolone, polypeptide, glycopeptide, nitrofuran and cephalosporin 1 st generation antibiotics were ineffective against most of the isolates recovered from ornamental fish samples collected from all the farms. Indeed, these antibiotics have been extensively used in veterinary, agriculture and clinical medicine for decades, contributing to the highest resistance level in bacterial isolates (Hossain et al. 2020). The tetracycline group was ineffective against 100% of bacterial isolates recovered from ornamental fish samples from Chennai. Similar results were reported by (Preena et al. 2019b) in bacterial pathogens isolated from infected guppy samples collected from Kerala. Antibiotics belong to the tetracycline group, and especially oxytetracycline was the most frequently used antibiotic in the aquaculture and veterinary sector in many parts of the world (Guz and Kozinska 2004). In this study, tetracycline and oxytetracycline were used to determine the AMR pattern in bacterial isolates. Resistance to tetracycline antibiotics was found due to active efflux of tetracycline from the bacterial cell or ribosomal protection from the action of these antibiotics or, in some rare cases, mutation in 16S rRNA that prevent binding of tetracycline to the ribosome (Taylor and Chau 1996; Schmidt et al. 2001; Billington et al. 2002). In contrast, B. drentensis isolated from Swordtail and Platy exhibited susceptibility to all the antibiotics tested. Similar results were reported in B. drentensis isolated from infected freshwater Koi at the ornamental fish farm, Cochin (Preena et al. 2019a). Pathogenic and non-pathogenic bacterial isolates from other fish species exhibited resistance against the new-generation antibiotic, cefepime, except for the bacterial isolates recovered from Flower horn and Longfin tetra. The occurrence of resistance to new-generation antibiotics with highly virulent ARG-carrying fish pathogens in ornamental fish poses a significant threat to humans since the resistance determinants can be transmitted to pathogenic and human commensal bacteria via HGT (Bello-López et al. 2019). Resistance to new generation antibiotics compels the need for surveillance and monitoring programs to control the indiscriminate use of antibiotics in aquaculture and for sustainable use of new generation antibiotics. It was also found that all the bacterial isolates recovered from infected fish samples collected from different parts of Tamil Nadu were susceptible to ciprofloxacin and sulphafurazole. The effectiveness of ciprofloxacin against fish pathogens was studied by (Akinbowale et al. 2006; Preena et al. 2019a). Besides ciprofloxacin, sulphafurazole was also effective for bacterial pathogens isolated from ornamental fish samples collected from all the locations. This suggests the possible application of these antibiotics in aquaculture to treat bacterial infections. The MAR index calculated in this study was very high, increasing the risk to human health since these bacteria are facultative or "opportunistic" pathogens to susceptible hosts. This implies the severe use of antimicrobials in the fish farm or entry of antibiotics from other external sources, as Krumperman (1983) stated. MAR index was also higher in some non-pathogenic bacteria. Though these bacteria do not cause any diseases in animals and humans, the resistance gene responsible for AMR in these bacterial isolates may transmit to other bacteria belonging to the same species or even to different genera via HGT (Bouki et al. 2013; Kołodziejska et al. 2013; Tomova et al. 2015). Most of the isolates from this study showed resistance to commonly used antimicrobials in veterinary and human medicine. The bacteria with MAR index value ≥ 0.2 are suggested to originate from a high-risk source where antibiotics are used frequently (Krumperman 1983; Amalina et al. 2019). Therefore, the MAR index values (≥ 0.20) demonstrated by the bacterial strains isolated from different locations in Tamil Nadu indicate the abusive use of the antimicrobials. In the present study, the MAR index varied between 0 to 0.79, with more than 0.2 in 88.6% of bacterial strains isolated. Similar findings were reported by Mursalim et al. (2022), where 99% of the isolates exhibited MAR values of more than 0.2. Indiscriminate use of antibiotics in aquaculture could be the reason for this increased MAR index in fish pathogens (Serrano 2005). Screening of AMR gene cassettes Out of 86 bacterial strains 71 were positive for Class 1 integron. Class 1 integrons encompassing gene cassettes with antibiotic resistant genes play a vital role in the wider dissemination of AMR in aquaculture systems (Gao et al. 2012). It was reported that class 1 integrons are the most predominant gene cassette in aquaculture systems (Stalder et al. 2012). Schmidt et al. (2001) and Verner-Jeffreys et al. (2009) reported that 50% of the isolates from freshwater fish farms carried class 1 integrons with AMR gene cassettes. However, there are reports that integrons without gene cassettes in Y. ruckeri (Balta et al. 2010) and A. salmonicida (Schmidt et al. 2001) were also isolated from rainbow trout. Hence, further molecular characterization is necessary to confirm different resistance genes present in the gene cassettes. Some of the bacterial isolates were negative for both class 1 and class 2 integrons. This may be because the genes responsible for AMR are not located on the gene cassettes carrying integrons. However, AMR genes may be located in their mobile genetic elements like transposons. Class 1 and class 2 integrons were also detected in the plasmid DNA isolated from most bacterial isolates. Both plasmid and genomic DNA were found to have the integron gene indicating which is of plasmid- borne. Mobile integrons (MI) are the most responsible entities which carry the AMR determinants than the chromosomal integrons (Stalder et al. 2012). The presence of integrons with AMR gene cassettes in mobile genetic elements in fish pathogens increases the risk of AMR gene dissemination to pathogenic and human commensal bacteria via HGT (Jacobs and Chenia 2007). The presence of AMR genes in integron gene cassettes can be detected by further molecular characterization studies. Conclusion The findings of the present study suggest that ornamental fish culture systems may act as the reservoir of MAR pathogens and it may result in the dissemination of resistance genes to pathogenic and human commensal bacteria via HGT. This study will also be helpful to understand the antimicrobial resistance patterns of bacterial pathogens in freshwater aquaculture systems and the development of alternative measures to control bacterial infections in fishes. This study also indicates the need for surveillance and monitoring programs to control antibiotic use in aquaculture. The One Health Concept and approach could be strengthened and applied in the ornamental fish culture systems for better prevention of ARG dissemination. The information obtained from this study will also serve as the basic input for developing policy guidelines. Declarations Acknowledgments The authors acknowledge the Institute of Fisheries Post Graduate Studies, TNJFU, for the support. Author contribution H.N. performed the work as part of her Ph.D. research work and drafted the manuscript; S.S.A. provided overall guidance; K.A. conceptualized and designed the experiment; D.A. analyzed the data; S.E. extended help with data acquisition and revising the manuscript critically for important intellectual content. Funding:None Conflicts of interest/ Competing interests:The authors declared no conflict of interest. Data availability statement:All the required data are provided in the table and figures. References Abdelsalam M, Ewiss MAZ, Khalefa HS, et al (2021) Coinfections of Aeromonas spp., Enterococcus faecalis, and Vibrio alginolyticus isolated from farmed Nile tilapia and African catfish in Egypt, with an emphasis on poor water quality. Microbial Pathogenesis 160:105213. https://doi.org/10.1016/j.micpath.2021.105213 Akinbowale O l., Peng H, Barton MD (2006) Antimicrobial resistance in bacteria isolated from aquaculture sources in Australia. J Appl Microbiol 100:1103–1113. https://doi.org/10.1111/j.1365-2672.2006.02812.x Amalina NZ, Santha S, Zulperi D, et al (2019) Prevalence, antimicrobial susceptibility and plasmid profiling of Vibrio spp. isolated from cultured groupers in Peninsular Malaysia. BMC Microbiol 19:251. https://doi.org/10.1186/s12866-019-1624-2 Anjur N, Sabran SF, Daud HM, Othman NZ (2021) An update on the ornamental fish industry in Malaysia: Aeromonas hydrophila-associated disease and its treatment control. Vet World 14: Balta F, Sandalli C, Kayis S, Ozgumus OB (2010) Molecular analysis of antimicrobial resistance in Yersinia ruckeri strains isolated from rainbow trout (Oncorhynchus mykiss) grown in commercial fish farms in Turkey. Bull Eur Ass Fish Pathol 30:211–219 Bauer K (1966) Antimicrobial susceptibility testing by Kirby Bauer disc diffusion method. American Journal of Biological Technology 1:50–55 Bello-López JM, Cabrero-Martínez OA, Ibáñez-Cervantes G, et al (2019) Horizontal Gene Transfer and Its Association with Antibiotic Resistance in the Genus Aeromonas spp. Microorganisms 7:363. https://doi.org/10.3390/microorganisms7090363 Billington SJ, Songer JG, Jost BH (2002) Widespread Distribution of a Tet W Determinant among Tetracycline-Resistant Isolates of the Animal Pathogen Arcanobacterium pyogenes. Antimicrobial Agents and Chemotherapy 46:1281–1287. https://doi.org/10.1128/AAC.46.5.1281-1287.2002 Bouki C, Venieri D, Diamadopoulos E (2013) Detection and fate of antibiotic resistant bacteria in wastewater treatment plants: A review. Ecotoxicol Environ Saf 91:1–9. https://doi.org/10.1016/j.ecoenv.2013.01.016 Chandra G, Bhattacharjee I, Chatterjee S (2015) Bacillus cereus infection in stinging catfish, Heteropneustes fossilis (Siluriformes: Heteropneustidae) and their recovery by Argemone mexicana seed extract. Iran J Fish Sci 14:741–753. https://doi.org/10.22092/ijfs.2018.114479 Clarke KR, Gorley RN (2015) PRIMER version 7: User manual/tutorial. PRIMER-E 192: CLSI (2018) Performance standards for antimicrobial susceptibility testing, 28th edn. CLSI supplement M100. CLSI supplement M100 Cowan ST, Steel KJ (1965) Manual for the Identification of Medical Bacteria. Manual for the Identification of Medical Bacteria 217 Dharmaratnam, Kumar R, Basheer VS, et al (2017) Isolation and characterisation of virulent Serratia marcescens associated with a disease outbreak in farmed ornamental fish, Poecilia reticulata in Kerala, India. Indian Fish 64:71–79. http://dx.doi.org/10.21077/ijf.2017.64.4.71261-10 Dias C, Mota V, Martinez-Murcia A, Saavedra MJ (2012) Antimicrobial resistance patterns of Aeromonas spp. Isolated from ornamental fish. J Aquac Res Dev 3:. https://doi.org/10.4172/2155-9546.1000131 Elhadi N (2014) Prevalence and antimicrobial resistance of Salmonella spp. in raw retail frozen imported freshwater fish to Eastern Province of Saudi Arabia. Asian Pacific Journal of Tropical Biomedicine 4:234–238. https://doi.org/10.1016/S2221-1691(14)60237-9 EUCAST (2021) European Committee on Antimicrobial Susceptibility Testing, Breakpoint tables for interpretation of MICs and zone diameters. Version 5.0, 2015 Gao P, Mao D, Luo Y, et al (2012) Occurrence of sulfonamide and tetracycline-resistant bacteria and resistance genes in aquaculture environment. Water Res 46:2355–2364. https://doi.org/10.1016/j.watres.2012.02.004 Gufe C, Canaan Hodobo T, Mbonjani B, et al (2019) Antimicrobial Profiling of Bacteria Isolated from Fish Sold at Informal Market in Mufakose, Zimbabwe. Int J Microbiol 2019:e8759636. https://doi.org/10.1155/2019/8759636 Guz L, Kozinska A (2004) Antibiotic susceptibility of Aeromonas hydrophila and A. sobria isolated from farmed carp (Cyprinus carpio L.). Bulletin of the Veterinary Institute in Pulawy 48:391–395 Haenen OLM, Evans JJ, Berthe F (2013) Bacterial infections from aquatic species: potential for and prevention of contact zoonoses. Rev Sci Tech 32:497–507. https://doi.org/10.20506/rst.32.2.2245 Hemamalini N, Shanmugam SA, Kathirvelpandian A, et al (2021) A critical review on the antimicrobial resistance, antibiotic residue and metagenomics-assisted antimicrobial resistance gene detection in freshwater aquaculture environment. Aquaculture Research 53:344–366. https://doi.org/10.1111/are.15601 Hemamalini N, Shanmugam SA, Kathirvelpandian A, et al (2022a) Prevalence, Antimicrobial Susceptibility and Resistance Gene Detection in Bacteria Isolated from Goldfish and Tiger Barb from Ornamental Fish Farms of Tamil Nadu. Indian J Microbiol. https://doi.org/10.1007/s12088-022-01023-y Hemamalini N, Shanmugam SA, Kathirvelpandian A, et al (2022b) Prevalence, Antimicrobial Resistance and Resistance Gene Cassettes Detection in Bacterial Pathogens Isolated from Freshwater Ornamental Fishes. Indian J Anim Res 1:. https://doi.org/10.18805/IJAR.B-4903 Hossain S, De Silva BCJ, Dahanayake PS, et al (2020) Phylogenetic characteristics, virulence properties and antibiogram profile of motile Aeromonas spp. isolated from ornamental guppy (Poecilia reticulata). Arch Microbiol 202:501–509. https://doi.org/10.1007/s00203-019-01762-5 Hossain S, De Silva BCJ, Wimalasena SHMP, et al (2018) Distribution of Antimicrobial Resistance Genes and Class 1 Integron Gene Cassette Arrays in Motile Aeromonas spp. Isolated from Goldfish (Carassius auratus). Microb Drug Resist 24:1217–1225. https://doi.org/10.1089/mdr.2017.0388 Hu M, Wang N, Pan Z h., et al (2012) Identity and virulence properties of Aeromonas isolates from diseased fish, healthy controls and water environment in China. Letters in Applied Microbiology 55:224–233. https://doi.org/10.1111/j.1472-765X.2012.03281.x Jacobs L, Chenia HY (2007) Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture systems. Int J Food Microbiol 114:295–306. https://doi.org/10.1016/j.ijfoodmicro.2006.09.030 Jagoda S de S, Wijewardana TG, Arulkanthan A, et al (2014) Characterization and antimicrobial susceptibility of motile aeromonads isolated from freshwater ornamental fish showing signs of septicaemia. Dis Aquat Org 109:127–137. https://doi.org/10.3354/dao02733 Kim B-R, Shin J, Guevarra RB, et al (2017) Deciphering Diversity Indices for a Better Understanding of Microbial Communities. J Microbiol Biotechnol 27:2089–2093. https://doi.org/10.4014/jmb.1709.09027 Kołodziejska M, Maszkowska J, Białk-Bielińska A, et al (2013) Aquatic toxicity of four veterinary drugs commonly applied in fish farming and animal husbandry. Chemosphere 92:1253–1259. https://doi.org/10.1016/j.chemosphere.2013.04.057 Krumperman PH (1983) Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Applied and Environmental Microbiology 46:165–170. https://doi.org/10.1128/aem.46.1.165-170.1983 Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33:1870–1874. https://doi.org/10.1093/molbev/msw054 Lévesque C, Piché L, Larose C, Roy PH (1995) PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 39:185–191. https://doi.org/10.1128/AAC.39.1.185 Lewbart GA (2001) Bacteria and ornamental fish. Semin Avian Exot Pet Med 10:48–56. https://doi.org/10.1053/saep.2001.19543 Martins ML, Mouriño JLP, Amaral GV, et al (2008) Haematological changes in Nile tilapia experimentally infected with Enterococcus sp. Braz J Biol 68:657–661. https://doi.org/10.1590/S1519-69842008000300025 Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215 Mursalim MF, Budiyansah H, Raharjo HM, et al (2022) Diversity and antimicrobial susceptibility profiles of Aeromonas spp. isolated from diseased freshwater fishes in Thailand. Journal of Fish Diseases n/a: https://doi.org/10.1111/jfd.13650 Nakamura LK (1998) Bacillus pseudomycoides sp. nov. Int J Syst Evol Microbiol 48:1031–1035. https://doi.org/10.1099/00207713-48-3-1031 Padrós F, Furones MD (2002) Patología bacteriana en piscicultura. Temas de Actualidad SEM 13–21 Palmeiro B, Roberts H (2009) Bacterial disease in fish. Clinical Veterinary Advisor: Exotic Medicine Elsevier 17–19 Pereira AL, de Oliveira PM, Faria-Junior C, et al (2022) Environmental spreading of clinically relevant carbapenem-resistant gram-negative bacilli: the occurrence of blaKPC-or-NDM strains relates to local hospital activities. BMC Microbiol 22:6. https://doi.org/10.1186/s12866-021-02400-1 Petersen A, Dalsgaard A (2003) Antimicrobial resistance of intestinal Aeromonas spp. and Enterococcus spp. in fish cultured in integrated broiler-fish farms in Thailand. Aquaculture 219:71–82. https://doi.org/10.1016/S0044-8486(03)00018-8 Preena PG, Dharmaratnam A, Raj NS, et al (2020a) Antibiotic-resistant Enterobacteriaceae from diseased freshwater goldfish. Arch Microbiol 203:219–231. https://doi.org/10.1007/s00203-020-02021-8 Preena PG, Dharmaratnam A, Raj NS, et al (2019a) Diversity of antimicrobial-resistant pathogens from a freshwater ornamental fish farm. Lett Appl Microbiol 71:108–116. https://doi.org/10.1111/lam.13231 Preena PG, Dharmaratnam A, Raj NS, et al (2019b) Antibiotic susceptibility pattern of bacteria isolated from freshwater ornamental fish, guppy showing bacterial disease. Biologia 74:1055–1062. https://doi.org/10.2478/s11756-019-00261-8 Preena PG, Swaminathan TR, Kumar VJR, Singh ISB (2020b) Antimicrobial resistance in aquaculture: a crisis for concern. Biologia 75:1497–1517. https://doi.org/10.2478/s11756-020-00456-4 Ramesh D, Souissi S (2018) Antibiotic resistance and virulence traits of bacterial pathogens from infected freshwater fish, Labeo rohita. Microbial Pathogenesis 116:113–119. https://doi.org/10.1016/j.micpath.2018.01.019 Rohlf F (1998) NTSYSpc Version 2.0: User Guide. Appl Biostat 1–38 Schmidt AS, Bruun MS, Dalsgaard I, Larsen JL (2001) Incidence, Distribution, and Spread of Tetracycline Resistance Determinants and Integron-Associated Antibiotic Resistance Genes among Motile Aeromonads from a Fish Farming Environment. Appl Environ Microbiol 67:5675–5682. https://doi.org/10.1128/AEM.67.12.5675-5682.2001 Serrano PH (2005) Responsible use of antibiotics in aquaculture. Food & Agriculture Org. Shiina Y, Ii K, Iwanaga M (2004) An Aeromonas veronii biovar sobria infection with disseminated intravascular gas production. J Infect Chemother 10:37–41. https://doi.org/10.1007/s10156-003-0274-2 Singh AK, Rathore G, Singh V, et al (2009) Bacterial resistance to oxytetracycline in different life stages of Indian freshwater carp aquaculture system Song Z, Zhao Q, Zhu L, et al (2019) Draft genome sequence of multidrug-resistant β-lactamase-producing Bacillus cereus S66 isolated from China. J Glob Antimicrob Resist 17:23–24. https://doi.org/10.1016/j.jgar.2019.02.019 Soufi L, Sáenz Y, Vinué L, et al (2011) Escherichia coli of poultry food origin as reservoir of sulphonamide resistance genes and integrons. Int J Food Microbiol 144:497–502. https://doi.org/10.1016/j.ijfoodmicro.2010.11.008 Sreedharan K, Philip R, Singh ISB (2011) Isolation and characterization of virulent Aeromonas veronii from ascitic fluid of oscar Astronotus ocellatus showing signs of infectious dropsy. Diseases of Aquatic Organisms 94:29–39. https://doi.org/10.3354/dao02304 Sreedharan K, Philip R, Singh ISB (2013) Characterization and virulence potential of phenotypically diverse Aeromonas veronii isolates recovered from moribund freshwater ornamental fishes of Kerala, India. Antonie van Leeuwenhoek 103:53–67. https://doi.org/10.1007/s10482-012-9786-z Stalder T, Barraud O, Casellas M, et al (2012) Integron Involvement in Environmental Spread of Antibiotic Resistance. Front Microbiol 3:119 Taylor DE, Chau A (1996) Tetracycline resistance mediated by ribosomal protection. Antimicrob Agents Chemother 40:1–5. https://doi.org/10.1128/aac.40.1.1 Taylor NGH, Verner-Jeffreys DW, Baker-Austin C (2011) Aquatic systems: maintaining, mixing and mobilising antimicrobial resistance? Trends Ecol Evol 26:278–284. https://doi.org/10.1016/j.tree.2011.03.004 Tomova A, Ivanova L, Buschmann AH, et al (2015) Antimicrobial resistance genes in marine bacteria and human uropathogenic Escherichia coli from a region of intensive aquaculture. Environ Microbiol Rep 7:803–809. https://doi.org/10.1111/1758-2229.12327 Trust TJ, Bartlett KH (1974) Occurrence of potential pathogens in water containing ornamental fishes. Appl Microbiol 28:35–40. https://doi.org/10.1128/am.28.1.35-40.1974 Verner-Jeffreys DW, Welch TJ, Schwarz T, et al (2009) High Prevalence of Multidrug-Tolerant Bacteria and Associated Antimicrobial Resistance Genes Isolated from Ornamental Fish and Their Carriage Water. PLOS One 4:e8388. https://doi.org/10.1371/journal.pone.0008388 Walczak N, Puk K, Guz L (2017) Bacterial Flora Associated with Diseased Freshwater Ornamental Fish. J Vet Res 61:445–449. https://doi.org/10.1515/jvetres-2017-0070 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697–703. https://doi.org/10.1128/jb.173.2.697-703.1991 White PA, McIver CJ, Rawlinson WD (2001) Integrons and Gene Cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother 45:2658–2661. https://doi.org/10.1128/AAC.45.9.2658-2661.2001 Xu T, Zhang X-H (2014) Edwardsiella tarda: an intriguing problem in aquaculture. Aquaculture 431:129–135. https://doi.org/10.1016/j.aquaculture.2013.12.001 Yi S-W, You M-J, Cho H-S, et al (2013) Molecular characterization of Aeromonas species isolated from farmed eels (Anguilla japonica). Veterinary Microbiology 164:195–200. https://doi.org/10.1016/j.vetmic.2013.02.006 Yu S, Yu P, Wang J, et al (2019) A Study on Prevalence and Characterization of Bacillus cereus in Ready-to-Eat Foods in China. Front Microbiol 10:3043. https://doi.org/10.3389/fmicb.2019.03043 Zainab SM, Junaid M, Xu N, Malik RN (2020) Antibiotics and antibiotic resistant genes (ARGs) in groundwater: A global review on dissemination, sources, interactions, environmental and human health risks. Water Res 187:116455. https://doi.org/10.1016/j.watres.2020.116455 Tables Tables 1 to 4 are available in the Supplementary Files section Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.docx Tables.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4434353","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":308363099,"identity":"ea3b4b41-315c-44e3-bae7-265de3b5c604","order_by":0,"name":"Nallaiah Hemamalini","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIiWNgGAWjYBACAwhlwcPAzP/wwcc/NkAOY+MBIrRIALXwMBvObEgDaWkgSgsQ87AJ8zYcBnPxajFn7078dKNGQsacnfcYM++O83Zr2w8DbamxicalxbLn7GbpnGMSPJbNfGkP5565nbztTCJQy7G03AZcDruRu0E6h02Cx+Awg7nBG7bbyWYHgFoYGw7j1nL/7ebfOf/AWswkeNjOJZudf0hAyw3ebdK5bSAtPGaSvG0H7MxuELLlTO4269w+kBa2ZMMZZ5ITzG4AbUnA55fjZzffzvlmY29w/vDBBx8q7OzNzqc/fPChxganFgyQCFaZQKxyELAnRfEoGAWjYBSMDAAA5R1litdrH/AAAAAASUVORK5CYII=","orcid":"","institution":"TNJFU-Institute of Fisheries Post Graduate Studies","correspondingAuthor":true,"prefix":"","firstName":"Nallaiah","middleName":"","lastName":"Hemamalini","suffix":""},{"id":308363100,"identity":"b18b1158-2d31-4f48-865f-8760a83bd180","order_by":1,"name":"Seerappalli Aran Shanmugam","email":"","orcid":"","institution":"TNJFU-Institute of Fisheries Post Graduate Studies","correspondingAuthor":false,"prefix":"","firstName":"Seerappalli","middleName":"Aran","lastName":"Shanmugam","suffix":""},{"id":308363102,"identity":"4a995894-2bab-43d5-b193-ed3a7d0fae40","order_by":2,"name":"Ayyathurai Kathirvelpandian","email":"","orcid":"","institution":"ICAR-National Bureau of Fish Genetic Resources, CMFRI Campus","correspondingAuthor":false,"prefix":"","firstName":"Ayyathurai","middleName":"","lastName":"Kathirvelpandian","suffix":""},{"id":308363103,"identity":"8efb5d84-4f6d-4eb1-a103-3fbad0125716","order_by":3,"name":"Agarwal Deepak","email":"","orcid":"","institution":"TNJFU-Institute of Fisheries Post Graduate Studies","correspondingAuthor":false,"prefix":"","firstName":"Agarwal","middleName":"","lastName":"Deepak","suffix":""},{"id":308363105,"identity":"204451da-a5b7-40ac-97e7-417f9d0fa7a1","order_by":4,"name":"Eswaran Suresh","email":"","orcid":"","institution":"TNJFU-Institute of Fisheries Post Graduate Studies","correspondingAuthor":false,"prefix":"","firstName":"Eswaran","middleName":"","lastName":"Suresh","suffix":""}],"badges":[],"createdAt":"2024-05-17 05:25:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4434353/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4434353/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57468529,"identity":"a14e75dc-9836-4fe7-9fd6-d593c2cf3fbc","added_by":"auto","created_at":"2024-05-31 05:41:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":50427,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePercentage of bacterial resistance towards different classes of antibiotics (Ornamental fishes from Chennai)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4434353/v1/a4c11cda59a89be1de5e6fbf.png"},{"id":57468932,"identity":"9d26b29c-ecb6-4147-b274-648940cc8352","added_by":"auto","created_at":"2024-05-31 05:49:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":429009,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea. Percentage of bacterial resistance towards different classes \u0026nbsp;\u0026nbsp;of antibiotics (Ornamental fishes from Madurai)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb. Percentage of bacterial resistance towards different classes \u0026nbsp;\u0026nbsp;of antibiotics (Ornamental fishes from Madurai)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4434353/v1/fe56b8206196e270ee9ea97a.png"},{"id":57468534,"identity":"40c591b5-e1a3-4bcc-949a-e1ccdac14fde","added_by":"auto","created_at":"2024-05-31 05:41:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":278048,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea. Percentage of bacterial resistance towards different classes \u0026nbsp;\u0026nbsp;of antibiotics (Ornamental fishes from Tiruvarur)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb. Percentage of bacterial resistance towards different classes \u0026nbsp;\u0026nbsp;of antibiotics (Ornamental fishes from Tiruvarur)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4434353/v1/a8fa0435c33097e668c820b9.png"},{"id":62842758,"identity":"99cfb580-32e2-4792-bed9-6999cefe8a81","added_by":"auto","created_at":"2024-08-20 06:51:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1316769,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4434353/v1/a3a16634-2710-45aa-a4d6-2e1875c42d1a.pdf"},{"id":57468533,"identity":"2c1d16c2-5745-4bbd-af59-72d86674606c","added_by":"auto","created_at":"2024-05-31 05:41:56","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":995017,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-4434353/v1/edaf9be531b7c6c234757e43.docx"},{"id":57468532,"identity":"08ba7fb1-b840-40bc-88d5-715f879b5d34","added_by":"auto","created_at":"2024-05-31 05:41:56","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":43980,"visible":true,"origin":"","legend":"","description":"","filename":"Tables.docx","url":"https://assets-eu.researchsquare.com/files/rs-4434353/v1/093eaba61a598fd38a97a2bc.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Incidence, antimicrobial resistance and distribution of class 1 and class 2 integron gene cassette arrays in bacteria isolated from ornamental fishes cultured in three districts of Tamil Nadu","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOrnamental fish production has a significant role in the economy of the country. Over 4,500 fish species are involved in the global ornamental fish industry, of which 60% are of freshwater origin. In India, freshwater ornamental fishes contribute about 80% to the ornamental fish trade. The ornamental fish exports from India showed an increasing trend and exponential growth over the years. One of the major constraints in the aquaculture sector is disease occurrence (Hemamalini et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Most of the diseases in the aquaculture sector are caused by bacteria (Hemamalini et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e). Bacterial disease outbreak causes less profitability in the aquaculture facility. Hence, the farmers are compelled to use antibiotics in the aquaculture system. Antibiotics have been widely used in aquaculture to treat various bacterial diseases in cultured fish globally (Hemamalini et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). The drugs used to control bacterial infections in fish farms are usually the same as those used in human and animal husbandry.\u003c/p\u003e \u003cp\u003eProlonged usage of antibiotics in aquaculture leads to the emergence of antimicrobial resistance (AMR) in the bacteria associated with the system. Resistance from the animal can be transmitted to human commensal and pathogenic bacteria via horizontal gene transfer (HGT). This indicates the possibility of spreading AMR from aquatic to non-aquatic environments, which could seriously impact global health concerns. The development and spread of AMR are widely documented in human, veterinary, and fish pathogens due to its exposure to antimicrobials. AMR has been recognized as a worldwide risk to human health since the resistance can spread from animals to humans via the food chain, handling and environment. Fish handlers are often infected by zoonotic bacteria such as \u003cem\u003eMycobacterium\u003c/em\u003e sp., \u003cem\u003eA. hydrophilia\u003c/em\u003e, \u003cem\u003eStreptococcus iniae\u003c/em\u003e, \u003cem\u003eVibrio vulnificus\u003c/em\u003e, and \u003cem\u003ePhotobacterium damselae\u003c/em\u003e present in the aquaculture system (Haenen et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The occurrence of AMR in these bacteria are quite common, which in the case of causing the disease in humans, cannot be treated anymore. Human contact with resistant bacteria in ornamental fish has severe consequences for humans and the environment. As a consequence of the One Health Approach, AMR monitoring should limit not only food fishes but also ornamental fishes.\u003c/p\u003e \u003cp\u003eAntimicrobial resistance gene dissemination in bacterial pathogens is mainly mediated by integron. It is also believed that integron plays a significant role in the rapid dissemination of MAR among bacteria. The presence of class 1 and class 2 integrons were reported in aquaculture systems (Soufi et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Of which class 1 integron was the most predominant gene cassette in aquaculture systems. Ornamental fish culture sectors are now widely accepted as one of the major contributors to the rise in AMR and its resistance determinants in microorganisms (Preena et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e; Hemamalini et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Hence, the antimicrobial resistance magnitude in ornamental fishes should be studied thoroughly to formulate the necessary measures to solve the crisis. The present study focused on bacterial diversity determination, antibiogram profile and resistance gene cassette detection from infected ornamental fish samples collected from different fish farms of Tamil Nadu for successful treatment of bacterial infection.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, has approved the procedures and methodologies followed in the present study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Based on the freshwater ornamental fish production in Tamil Nadu, major ornamental fish producing districts such as Chennai, Madurai and Tiruvarur were selected for this study. Two ornamental fish farms were selected from each district, and freshly dead and moribund were collected. Commercially important ornamental fishes such as Flower horn and Kadango (Cichlid) from Chennai; Sailfin molly, Swordtail, Koi carp, Angelfish, Tiger barb and Longfin tetra from Madurai; Goldfish, Koi carp, Guppy, Cichlid and Platy from Tiruvarur were collected. Thirty infected moribund fish specimens from each species were collected and transported to the laboratory in aerated plastic bags containing pond water and euthanized immediately using 0.3 mg/ml of tricaine methane sulfonate (MS-222, Sigma Aldrich, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial isolation and phenotypic characterization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe infected tissue samples were dissected aseptically and pooled for bacterial isolation, according to the species and sampling location. The excised tissues were homogenized with sterile physiological saline and inoculated into the sterile nutrient agar plates in triplicate (Himedia, India), and incubated overnight at 37°C. The isolated distinctive colonies were selected and sub cultured on nutrient agar slants and further undergone various biochemical tests (gram staining, motility, catalase, oxidase, sugar fermentation (glucose and mannitol), indole, Voges-Proskauer and citrate utilization)\u0026nbsp;for presumptive identification\u0026nbsp;(Cowan and Steel 1965).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDendrogram construction and diversity analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The result of the biochemical tests was recorded as numerical values in an excel spreadsheet. Positive results were recorded as “1” and negative as “0”. For dendrogram construction, the biochemical test results were analysed in NTedit, version 1.2 and NTSYSpc, version 2.10e (Exeter Software, Setauket, NY, USA)\u0026nbsp;(Rohlf 1998). Thus, clusters were generated based on the similarities, and the representative isolates from each cluster were taken for molecular characterization. The Shannon- wiener diversity index was calculated using Primer E software. Species richness, evenness and dominance are the three important factors which influence the diversity index of the microbial community and which were also determined\u0026nbsp;(Clarke and Gorley 2015).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular identification and Phylogenetic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe genomic DNA of bacterial isolates from infected fish samples was extracted following the salting-out method\u0026nbsp;(Miller et al. 1988). The quality and quantity of the DNA were checked using nanodrop spectrophotometer (Thermo Scientific, Waltham, USA) at 260 and 280 nm. The Polymerase chain reaction (PCR) was performed in a thermal cycler (Eppendorf, Germany) using PCR master mix (Ampliqon, Denmark). For molecular 16S rRNA gene amplification was performed by using universal primers fD1 (5’ CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG 3′) and rD1 (5’ CCCGGGATCCAAGCTTAAGGAGGTGATCCAGCC 3′)\u0026nbsp;(Weisburg et al. 1991).\u0026nbsp;Phylogenetic trees were constructed using UPGMA statistical method with Kimura 2- parameter substitution model with 1000 bootstrap replications in\u0026nbsp;MEGA 7.0 software\u0026nbsp;(Kumar et al. 2016).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial resistance profiling and determination of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emultiple antibiotic resistance (MAR) index\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAntimicrobial resistance patterns of all the bacterial isolates were carried out using thirty eight antibiotics\u0026nbsp;(Himedia, India)\u0026nbsp;belonging to 16 classes. The\u0026nbsp;list of antibiotics used in the study are provided in Table 1.\u0026nbsp;Antimicrobial susceptibility test (AST) was performed following the Kirby-Bauer disc diffusion method on Muller Hinton agar (MHA) plates(Bauer 1966). 0.5 McFarland standards were prepared for all the isolates and inoculated into MHA agar plates. CLSI reference strain,\u003cem\u003e\u0026nbsp;Escherichia coli\u003c/em\u003e ATCC 25922, was used as a control. The zone of inhibition (mm) was measured and interpreted by\u0026nbsp;CLSI (2018),\u0026nbsp;EUCAST (2021)\u0026nbsp;and manufacturer guidelines.\u0026nbsp;The multiple antibiotic resistance (MAR) index was determined by following the procedure described by\u0026nbsp;Krumperman (1983).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of AMR gene cassettes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlasmids from the resistant isolates were extracted using the HiPurA plasmid DNA miniprep purification kit (Himedia, India) as per the manufacturer’s protocol. The presence of class 1 and class 2 integron gene cassettes in both genomic and plasmid DNA of all the isolates were detected using class 1 integron primers 5’CSF (5’GGCATCCAAGCAGCAAG3’) and 3’CSR (5’AAGCAGACTTGACCTGA3’) (Lévesque et al. 1995) and class 2 integron primers Hep74F (5’CGGGATCCCCGGCATGCACGATTTGTA3’) and Hep51R (5′GATGCCATCGCAAGTACGAG3′) \u0026nbsp;(White et al. 2001). The amplified PCR products were checked on 1% agarose gel stained with ethidium bromide.\u0026nbsp;\u003c/p\u003e"},{"header":"Results ","content":"\u003cp\u003e\u003cstrong\u003eIsolation and identification of bacterial isolates from ornamental fishes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The tissue samples\u0026nbsp;from 13 ornamental fish species provided more than 200 bacterial colonies. The\u0026nbsp;isolated distinctive colonies were selected, sub-cultured,\u0026nbsp;and further identified by various biochemical tests.\u0026nbsp;Biochemical test results of the recovered isolates revealed that most of the bacterial strains isolated from infected ornamental fish samples were gram-negative.\u0026nbsp;The bacterial diversity was higher in the Goldfish sample (1.99) collected from Tiruvarur, followed by Flower horn (1.98) from Chennai and Cichlid (1.97) from Tiruvarur (Table 2). Whereas the lowest bacterial diversity (1.50) was observed in Angelfish samples collected from Madurai. Unique biochemical characteristics aided to differentiate the isolates and identified the representatives through dendrogram construction. Among the 258 isolates selected for the phenotypic study, only 86 types were identified on the basis of dendrogram. Thus, a total of 86 representative isolates were subjected to molecular identification.\u0026nbsp;\u0026nbsp;The 16S rRNA genes were identified and submitted to the GenBank database.\u0026nbsp;The list of bacterial isolates recovered from infected fish samples and their accession numbers are provided in Table 3.\u0026nbsp;The phylogenetic tree was constructed using MEGA 7.0 software.\u0026nbsp;The bacterial isolates belonging to the same genera are represented in sister clades, and the species belonging to the different genera are in a separate clade (Fig.S1 to Fig.S3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntibiogram profile\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChennai\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Antimicrobial susceptibility test results revealed that bacterial isolates of Flower horn were resistant to minimum of 5 and maximum of 18 antibiotics tested. Bacterial isolates from Kadango showed resistance to at least 5 and up to 20 antibiotics used in this study. The most dominant group, \u003cem\u003eA. hydrophila\u003c/em\u003e from Flower horn and Kadango, showed resistance to more than 11 antibiotics with the MAR index of 0.29. In Kadango, the highest MAR index was recorded in \u003cem\u003eB. cereus\u003c/em\u003e (0.5) and the lowest in \u003cem\u003eC. freundii\u0026nbsp;\u003c/em\u003e(0.14). In Flower horn, \u003cem\u003eP. entomophila\u0026nbsp;\u003c/em\u003eshowed the highest MAR index (0.48) and the lowest was recorded in \u003cem\u003eK. gibsonii\u0026nbsp;\u003c/em\u003e(0.14). The MAR index of various bacterial strains isolated from infected ornamental fish samples are shown in Table 3.\u003c/p\u003e\n\u003cp\u003eAll the bacterial isolates from Flower horn and Kadango exhibited resistance toward tetracycline and oxytetracycline. 75% of isolates from Flower horn and 84% from Kadango exhibited resistance against bacitracin. Besides that, amoxicillin, ampicillin, cefalexin, cefixime/clavulanic acid, trimethoprim, sulphadiazine and furazolidone were also ineffective for \u0026gt;50% of the bacterial isolates from Flower horn. In the case of Kadango, \u0026gt;50% of isolates were resistant towards amoxicillin, ampicillin, cefazolin, cephalothin, cefalexin, cefoxitin, trimethoprim, sulphadiazine, nitrofurantoin, furazolidone and rifampicin. Most of the isolates from Flower horn exhibited resistance against at least one of the cephalosporin antibiotics.\u0026nbsp;It was observed that\u0026nbsp;\u003cem\u003eB. cereus\u003c/em\u003e from Kadango exhibited resistance against 4\u003csup\u003eth\u003c/sup\u003e generation cephalosporin antibiotic, cefepime. The percentage of resistant strains isolated from infected ornamental fishes at Chennai fish farms are depicted in Table 1. The graph depicting the percentage of antimicrobial resistance towards different classes of antibiotics is shown in Fig.1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMadurai\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe fish samples such as Sailfin molly, Swordtail, Koi carp, Angelfish, Tiger barb and Longfin tetra were collected from ornamental fish farms of Madurai. The results revealed that the bacterial isolates of Sailfin molly were resistant to minimum of 4 and maximum of 22 antibiotics tested. Bacterial isolates from Swordtail exhibited resistance to minimum of 0 and maximum of 16 antibiotics used in this study. The bacterial isolates from Koi carp exhibited resistance against minimum of 3 and maximum of 27 antibiotics tested. Minimum of 9 and maximum of 19 antibiotics were ineffective for the bacterial isolates recovered from Angelfish. Bacterial isolates from Tiger barb were resistant to at least 9 and up to 30 antibiotics; isolates from Longfin tetra were resistant to minimum of 7 and maximum of 15 antibiotics tested.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe highest MAR index was exhibited by \u003cem\u003eC.\u003c/em\u003e \u003cem\u003ecronae\u0026nbsp;\u003c/em\u003e(0.56) from Sailfin molly, \u003cem\u003eB. subtilis\u0026nbsp;\u003c/em\u003e(0.43) from Swordtail, \u003cem\u003eE. alcedinis\u0026nbsp;\u003c/em\u003e(0.69) from Koi carp, \u003cem\u003eP. entomophila\u003c/em\u003e (0.48) from Angelfish, \u003cem\u003eP. penneri\u0026nbsp;\u003c/em\u003e(0.77) from Tiger barb and \u003cem\u003eA. caviae\u0026nbsp;\u003c/em\u003e(0.37) from Longfin tetra.\u0026nbsp;In this study, 86% of the isolates recovered from infected ornamental fish samples collected from fish farms in Madurai\u0026nbsp;possessed a MAR index of ≥0.2. In contrast, \u003cem\u003eB. drentensis\u003c/em\u003e from Swordtail exhibited susceptibility to all the antibiotics tested. The MAR index of bacterial isolates recovered from ornamental fish samples collected at Madurai is shown in Table 3.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;It was observed that more than 50% of bacterial isolates from Sailfin molly were resistant to amoxicillin, ampicillin, cefixime/clavulanic acid, ceftazidime, cefoperazone, cefepime, aztreonam, bacitracin, tetracycline and oxytetracycline. Similarly, antibiotics such as cephalothin, rifampicin, tetracycline and oxytetracycline were ineffective against more than 50% of isolates derived from Koi carp. All the bacterial strains from Koi carp were resistant to bacitracin and more than 50% of bacterial isolates from Koi carp exhibited resistance against amoxicillin, ampicillin, amoxiclav, cephalothin, cefixime/clavulanic acid, aztreonam, kanamycin, nitrofurantoin, rifampicin and oxytetracycline. Similarly, all the bacterial strains isolated from Angelfish exhibited resistance to amoxicillin, and bacitracin. 50% of the isolates were resistant to ampicillin, cefotaxime, streptomycin, furazolidone, rifampicin, tetracycline and oxytetracycline. All the bacterial strains from Tiger barb were resistant to aztreonam and only 50% of the isolates were resistant to ampicillin, cefazolin, cefixime/clavulanic acid, ceftazidime, cefotaxime, nalidixic acid, nitrofurantoin, bacitracin, rifampicin and oxytetracycline. Ampicillin was resistant to all the bacterial isolates derived from Longfin tetra. Over 50% of bacterial isolates recovered from Longfin tetra were resistant to furazolidone, bacitracin, rifampicin, tetracycline and oxytetracycline. It was found that more than 50% of bacterial isolates from all the fish samples collected from Madurai were resistant to oxytetracycline.\u0026nbsp;It was\u0026nbsp;also\u0026nbsp;found that some bacterial isolates from ornamental fish samples, except the isolates from Longfin tetra collected from Madurai, exhibited resistance towards 4\u003csup\u003eth\u003c/sup\u003e generation cephalosporin antibiotic cefepime. The percentage of antibiotic resistance bacterial isolates against 38 antibiotics tested are given in Table 1.\u0026nbsp;The graph depicting the percentage of AMR towards different classes of antibiotics is shown in Fig. 2a\u0026amp; Fig. 2b.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTiruvarur\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ornamental fish samples such as Goldfish, Koi carp, Guppy, Cichlids and Platy were collected from ornamental fish farms of Tiruvarur. Antimicrobial susceptibility test results revealed that 8 representative isolates of Goldfish were resistant to at least 6 and up to 27 antibiotics tested. Six representative isolates from Koi carp showed resistance to at least 9 and up to 18 antibiotics used in this study. Representative Guppy isolates showed resistance to at least 13 and up to 31 of the tested antibiotics. Bacterial isolates from Cichlids were resistant to at least 11 and up to 19 antibiotics, and isolates from Platy were resistant to minimum of 0 and maximum of 19 antibiotics tested. The MAR index of most bacterial strains isolated from the ornamental fish samples at Tiruvarur fish farms was reported as \u0026gt;0.25. In contrast, \u003cem\u003eB. drentensis\u003c/em\u003e from Platy exhibited susceptibility to all the antibiotics tested. \u003cem\u003eE. alcedinis\u003c/em\u003e from Goldfish possessed a higher MAR index (0.69);\u0026nbsp;The highest MAR index was exhibited by \u003cem\u003eC\u003c/em\u003e. \u003cem\u003ecronae\u0026nbsp;\u003c/em\u003e(0.45) from Koi carp, \u003cem\u003eP. vulgaris\u003c/em\u003e (0.79) from Guppy, \u003cem\u003eK. aerogenes\u0026nbsp;\u003c/em\u003e(0.48) from Cichlid and Platy. The MAR index of bacterial isolates from ornamental fish samples collected at Tiruvarur is shown in\u0026nbsp;Table 3.\u0026nbsp;The graph depicting the percentage of AMR towards different classes of antibiotics is shown in Fig. 3a \u0026amp; Fig. 3b.\u003c/p\u003e\n\u003cp\u003eMore than 50% of the isolates from infected Goldfish were resistant to\u0026nbsp;amoxicillin, ampicillin, piperacillin, amoxiclav, cefalexin, trimethoprim, sulphadiazine, furazolidone, bacitracin, tetracycline and oxytetracycline. More than 50% of the bacterial isolates from Koi carp were resistant to amoxicillin, ampicillin, cefalexin,\u0026nbsp;cefixime/clavulanic acid, ceftazidime, polymyxin-B, bacitracin and\u0026nbsp;rifampicin. All the isolates from Guppy exhibited susceptibility to bacitracin, and more than 50% of the isolates exhibited resistance to amoxicillin, ampicillin,\u0026nbsp;cefazolin, cephalothin, cefalexin, cefoperazone, aztreonam, trimethoprim, sulphadiazine, rifampicin, tetracycline and oxytetracycline. Antibiotics such as ampicillin, cefazolin, cephalothin, cefalexin,\u0026nbsp;cefoperazone, cefpodoxime, trimethoprim, sulphadiazine, nalidixic acid, furazolidone, nitrofurantoin, bacitracin, rifampicin, tetracycline and oxytetracycline were ineffective against 50% bacterial isolates from Cichlid. More than 50% of the bacterial isolates from Platy exhibited resistance against ampicillin,\u0026nbsp;cefalexin,\u0026nbsp;trimethoprim, nalidixic acid, nitrofurantoin, polymyxin-B, bacitracin, tetracycline and oxytetracycline. The percentage of antibiotic resistance bacterial isolates against 38 antibiotics tested are given in Table 1.\u003c/p\u003e\n\u003cp\u003eOut of 38 antibiotics, sulphafurazole and ciprofloxacin exhibited susceptibility to all the isolates from ornamental fish samples collected from Chennai, Madurai and Tiruvarur. The antibiotics exhibiting susceptibility towards all the bacterial isolates from fish samples collected from Chennai, Madurai and Tiruvarur are given in Table 4.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScreening of AMR gene cassettes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the present study, out of 86 bacterial isolates recovered from infected fish samples, class 1 integron was detected 71 isolates, whereas class 2 integron was detected in 3 isolates only. Class 2 integrons were detected in \u003cem\u003eK. aerogenes\u003c/em\u003e isolated from Kadango and \u003cem\u003eA. nosocomialis\u003c/em\u003e and \u003cem\u003eA. hydrophila\u003c/em\u003e recovered from Flower horn with the product size of 1000 bp. Plasmids of all the representative bacteria were given positive amplicons for class 1 integrons and the results were similar to amplicons of integrons in respective bacterial genomic DNA. Both plasmid and genomic DNA were found to have the integron gene indicating which is of plasmid- borne.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cstrong\u003eBacterial diversity in infected fishes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;There is a need to ascertain the status of AMR patterns across humans, livestock, fish and the related environmental aspects in the country to provide meaningful input for one health concept. Considering the diversity and growth potential, the freshwater system was selected for the study.\u0026nbsp;Bacterial diversity in infected ornamental fish samples was determined by molecular characterization. The diversity of bacteria in infected fish will aid in advancing disease management strategies. Gram-negative bacteria were dominant in all the infected fish samples used in the study. Most of the diseases in aquaculture systems are caused by gram-negative microorganisms\u0026nbsp;(Lewbart 2001; Pereira et al. 2022). Bacteria belonging to \u003cem\u003eAeromonadaceae\u003c/em\u003e, \u003cem\u003eEnterobacteriaceae\u003c/em\u003e,\u0026nbsp;\u003cem\u003ePlanococcaceae\u003c/em\u003e, \u003cem\u003eComamonadaceae\u003c/em\u003e, \u003cem\u003eBacillaceae\u003c/em\u003e and \u003cem\u003eMoraxellaceae\u0026nbsp;\u003c/em\u003ewere predominant in all the fish samples used in the study. Among \u003cem\u003eAeromonadaceae, Aeromonas\u0026nbsp;\u003c/em\u003e\u003cem\u003everonii\u003c/em\u003e, \u003cem\u003eA. hydrophila\u003c/em\u003e, \u003cem\u003eA. sobria\u0026nbsp;\u003c/em\u003eand \u003cem\u003eA. caviae\u003c/em\u003e were dominant. Aeromonads are opportunistic pathogens associated with poor water quality\u0026nbsp;(Padrós and Furones 2002; Abdelsalam et al. 2021). \u003cem\u003eAeromonas\u003c/em\u003e sp., which includes\u0026nbsp;\u003cem\u003eA. hydrophila, A. veronii\u003c/em\u003e, and\u0026nbsp;\u003cem\u003eA. caviae\u003c/em\u003e, is responsible for a wide spectrum of diseases in aquaculture\u0026nbsp;(Lewbart 2001)and most cultured fishes are commonly affected by \u003cem\u003eA. hydrophila\u0026nbsp;\u003c/em\u003e(Palmeiro and Roberts 2009). It was found that\u0026nbsp;\u003cem\u003eA. veronii\u003c/em\u003e was the dominant species in the infected fish samples used in this study. Among fish pathogenic aeromonads,\u0026nbsp;\u003cem\u003eA. veronii\u003c/em\u003e was reported as the dominant organism in several studies\u0026nbsp;(Sreedharan et al. 2011, 2013; Hu et al. 2012; Jagoda et al. 2014).\u0026nbsp;\u003cem\u003eA. hydrophila\u003c/em\u003e has also been reported as the dominant fish pathogen in the freshwater system\u0026nbsp;(Schmidt et al. 2001; Dias et al. 2012).\u0026nbsp;Yi et al. (2013)\u0026nbsp;reported a higher occurrence of\u0026nbsp;\u003cem\u003eA. veronii\u0026nbsp;\u003c/em\u003eover\u0026nbsp;\u003cem\u003eA. hydrophila\u003c/em\u003e among the bacteria isolated from diseased eels in the Republic of Korea.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Recently, some opportunistic pathogens in the aquaculture system have been identified as the causative agent for severe disease outbreaks\u0026nbsp;(Martins et al. 2008). One among them is \u003cem\u003eEnterococcus\u003c/em\u003e sp. Similarly, in the present study also, the occurrence of \u003cem\u003eE. faecalis\u003c/em\u003e has been encountered in 10 fish samples collected from 3 different locations in Tamil Nadu. It was reported that \u003cem\u003eE. faecalis\u003c/em\u003e causes streptococcal infection in tilapia cultured in Thailand fish farms\u0026nbsp;(Petersen and Dalsgaard 2003).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The occurrence of \u003cem\u003eEnterobacter\u003c/em\u003e sp. in ornamental fishes has been reported in several studies\u0026nbsp;(Trust and Bartlett 1974; Preena et al. 2020a). \u003cem\u003eK.\u003c/em\u003e \u003cem\u003eaerogenes, C. freundii\u003c/em\u003e,\u0026nbsp;\u003cem\u003eC. cronae\u003c/em\u003e and\u0026nbsp;\u003cem\u003eE. cloacae\u0026nbsp;\u003c/em\u003ewere isolated from infected fish samples, indicating faecal contamination in the sampling site\u0026nbsp;(Gufe et al. 2019). The faecal matter from birds and animals may be the source of enteropathogens in the culture system. Hence, it was found that ornamental fish culture systems act as the site for human pathogens.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;In addition, gram-positive microorganisms such as \u003cem\u003eBacillus cereus,\u003c/em\u003e \u003cem\u003eB. paramycoides\u003c/em\u003e,\u0026nbsp;\u003cem\u003eB. drentensis,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Niallia circulans\u003c/em\u003e were also isolated from ornamental fish samples. The diseases caused by \u003cem\u003eBacillus\u0026nbsp;\u003c/em\u003esp. in fishes and humans are limited to a few species. The most important species implicated in serious infections are \u003cem\u003eB. cereus\u003c/em\u003e, \u003cem\u003eB. mycoides\u003c/em\u003e, \u003cem\u003eB. thuringiensis\u003c/em\u003e, \u003cem\u003eB. anthracis\u003c/em\u003e, \u003cem\u003eB. subtilis\u003c/em\u003e and \u003cem\u003eB. pseudomycoides\u0026nbsp;\u003c/em\u003e(Nakamura 1998). Of these, \u003cem\u003eB. cereus\u003c/em\u003e is recognized as a major food poisoning organism in humans. It produces a range of virulence factors, can enter the gastrointestinal tract, and causes diarrhea and vomiting in humans\u0026nbsp;(Song et al. 2019). \u003cem\u003eB. cereus\u0026nbsp;\u003c/em\u003eis the causative agent responsible for skin ulcers in African catfish, \u003cem\u003eClarias gariepinus\u0026nbsp;\u003c/em\u003e(Yu et al. 2019)and mass mortality in stinging catfish\u003cem\u003e, Heteropneustes fossilis\u0026nbsp;\u003c/em\u003e(Chandra et al. 2015).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;It was also found that zoonotic pathogens such as \u003cem\u003eA. hydrophila\u0026nbsp;\u003c/em\u003eand \u003cem\u003eA. sobria\u003c/em\u003e, the causative agent for human enteritis and fatal septicemia, were isolated from 13 and 4 fish species, respectively\u0026nbsp;(Shiina et al. 2004). Another zoonotic pathogen, \u003cem\u003eEdwardsiella tarda,\u0026nbsp;\u003c/em\u003ewas also isolated from 9 fish samples in this study.\u0026nbsp;\u003cem\u003eE. tarda\u0026nbsp;\u003c/em\u003ewas considered zoonotic and there is no successful remedy for treating this infection in cultured fishes\u0026nbsp;(Xu and Zhang 2014). \u003cem\u003eAcinetobacter\u003c/em\u003e sp. and \u003cem\u003eCitrobacter\u003c/em\u003e sp. are also reported as zoonotic and facultative and can cause severe infections without exhibiting any symptoms in cultured fishes\u0026nbsp;(Walczak et al. 2017). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eShannon Weiner diversity index and phylogenetic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Species richness, evenness and dominance could directly influence the Shannon-Wiener diversity index of the recovered isolates\u0026nbsp;(Kim et al. 2017). Goldfish sample collected from Tiruvarur was found to have higher bacterial diversity (1.99) than all the other samples. The management of culture practices of farms are different, hence the possibility of differential microbial load between the farms. Increased demand for ornamental fishes leads to the culture of these fishes in high stocking density, and also, human handling was more in ornamental fish culture systems. Due to this stress, ornamental fishes were severely affected by several bacterial infections. This might be the reason for higher bacterial diversity in Goldfish.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The UPGMA tree of 16S rRNA gene sequences of bacterial isolates constructed established that similar genera were clustered under the same nodes while different genera were clustered under separate nodes. The nodes were supported by high bootstrap values (90–99%). Similar findings were observed in bacterial strains isolated from Nile tilapia\u0026nbsp;(Preena et al. 2020a)\u0026nbsp;and Koi carp \u0026amp; Goldfish samples\u0026nbsp;(Preena et al. 2019a). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial Susceptibility\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGlobal use of antibiotics is a common practice to control bacterial infections in humans and animals. To control bacterial infections in cultured fishes, antimicrobial agents used in aquaculture systems increase bacterial resistance to antibiotics, thereby increasing the possible transfer of resistance determinants to commensal bacteria associated with the environment. This horizontal gene transfer (HGT) becomes the reason for multiple antibiotic resistance. The AMR genes located on mobile genetics elements increase the possibility of spreading ARGs to human and fish pathogenic bacteria\u0026nbsp;(Ramesh and Souissi 2018).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Antimicrobial resistance is gaining more attention due to its adverse effect on human health, and aquaculture systems have been recognized as a hotspot for AMR determinants\u0026nbsp;(Zainab et al. 2020). Several studies have reported the presence of AMR bacteria in ornamental fishes collected from different aquaculture farms\u0026nbsp;(Singh et al. 2009; Elhadi 2014; Dharmaratnam et al. 2017; Preena et al. 2019b; Anjur et al. 2021).\u0026nbsp;Antibiotics for AST were selected based on their importance and common use in disease prevention and treatment in fish farms and human clinics. All the resolved isolates were subjected to AST\u0026nbsp;using 38 commercially available antibiotics\u0026nbsp;since the individual isolate of the same species might have different antimicrobial susceptibility patterns. However, there was not much variation in the zone of inhibition produced by each bacterial species.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The AST of bacterial isolates revealed that all the \u003cem\u003eAeromonas sp\u003c/em\u003e. exhibited high resistance to β-lactam antibiotics, penicillin, and cephalosporin. The higher percentage of resistance towards β-lactam antibiotics was found due to the natural production of chromosomal β-lactamases\u0026nbsp;(Taylor et al. 2011). Amoxicillin and ampicillin were ineffective against more than 60% of isolates from ornamental fish samples collected from Chennai, Madurai and Tiruvarur fish farms. This result is similar to\u0026nbsp;Hossain et al. (2018)\u0026nbsp;and\u0026nbsp;Hossain et al. (2020), where the majority of \u003cem\u003eAeromonas\u003c/em\u003e sp. isolated from Goldfish and Guppy, respectively, exhibited resistance against these antibiotics. It was also found that most isolates exhibited resistance to cephalosporin 1\u003csup\u003est\u003c/sup\u003e and 2\u003csup\u003end\u003c/sup\u003e generation antibiotics, erythromycin and azithromycin from macrolides. The resistance of Gram-negative bacteria to erythromycin and azithromycin is to be expected because many organisms possess intrinsic resistance to macrolide antibiotics\u0026nbsp;(Akinbowale et al. 2006). Similar to our study results, AST of \u003cem\u003eAeromonas\u003c/em\u003e sp. isolated from diseased freshwater fishes in Thailand fish farms revealed resistance against amoxicillin (99%), ampicillin (98%), oxytetracycline (77%), trimethoprim-sulfamethoxazole (24%), and enrofloxacin (21%)\u0026nbsp;(Mursalim et al. 2022).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Tetracycline, rifamycin, quinolone, polypeptide, glycopeptide, nitrofuran and cephalosporin 1\u003csup\u003est\u003c/sup\u003e generation antibiotics were ineffective against most of the isolates recovered from ornamental fish samples collected from all the farms. Indeed, these antibiotics have been extensively used in veterinary, agriculture and clinical medicine for decades, contributing to the highest resistance level in bacterial isolates\u0026nbsp;(Hossain et al. 2020). The tetracycline group was ineffective against 100% of bacterial isolates recovered from ornamental fish samples from Chennai. Similar results were reported by\u0026nbsp;(Preena et al. 2019b)\u0026nbsp;in bacterial pathogens isolated from infected guppy samples collected from Kerala. Antibiotics belong to the tetracycline group, and especially oxytetracycline was the most frequently used antibiotic in the aquaculture and veterinary sector in many parts of the world\u0026nbsp;(Guz and Kozinska 2004). In this study, tetracycline and oxytetracycline were used to determine the AMR pattern in bacterial isolates. Resistance to tetracycline antibiotics was found due to active efflux of tetracycline from the bacterial cell or ribosomal protection from the action of these antibiotics or, in some rare cases, mutation in 16S rRNA that prevent binding of tetracycline to the ribosome\u0026nbsp;(Taylor and Chau 1996; Schmidt et al. 2001; Billington et al. 2002). In contrast, \u003cem\u003eB. drentensis\u003c/em\u003e isolated from Swordtail and Platy exhibited susceptibility to all the antibiotics tested. Similar results were reported in \u003cem\u003eB. drentensis\u0026nbsp;\u003c/em\u003eisolated from infected freshwater Koi at the ornamental fish farm, Cochin\u0026nbsp;(Preena et al. 2019a).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Pathogenic and non-pathogenic bacterial isolates from other fish species exhibited resistance against the new-generation antibiotic, cefepime, except for the bacterial isolates recovered from Flower horn and Longfin tetra.\u0026nbsp;The occurrence of resistance to\u0026nbsp;new-generation antibiotics\u0026nbsp;with highly virulent ARG-carrying fish pathogens in ornamental fish poses a significant threat to humans since the resistance determinants can be transmitted to pathogenic and human commensal bacteria via HGT\u0026nbsp;(Bello-López et al. 2019).\u0026nbsp;Resistance to new generation antibiotics compels the need for surveillance and monitoring programs to control the indiscriminate use of antibiotics in aquaculture and for sustainable use of new generation antibiotics.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;It was also found that all the bacterial isolates recovered from infected fish samples collected from different parts of Tamil Nadu were susceptible to ciprofloxacin and sulphafurazole. The effectiveness of ciprofloxacin against fish pathogens was studied by\u0026nbsp;(Akinbowale et al. 2006; Preena et al. 2019a). Besides ciprofloxacin, sulphafurazole was also effective for bacterial pathogens isolated from ornamental fish samples collected from all the locations. This suggests the possible application of these antibiotics in aquaculture to treat bacterial infections.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The MAR index calculated in this study was very high, increasing the risk to human health since these bacteria are facultative or \"opportunistic\" pathogens to susceptible hosts.\u0026nbsp;This implies the severe use of antimicrobials in the fish farm or entry of antibiotics from other external sources, as Krumperman (1983) stated.\u0026nbsp;MAR index was also higher in some non-pathogenic bacteria. Though these bacteria do not cause any diseases in animals and humans, the resistance gene responsible for AMR in these bacterial isolates may transmit to other bacteria belonging to the same species or even to different genera via HGT\u0026nbsp;(Bouki et al. 2013; Kołodziejska et al. 2013; Tomova et al. 2015).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Most of the isolates from this study showed resistance to commonly used antimicrobials in veterinary and human medicine. The bacteria with MAR index value ≥ 0.2 are suggested to originate from a high-risk source where antibiotics are used frequently\u0026nbsp;(Krumperman 1983; Amalina et al. 2019). Therefore, the MAR index values (≥ 0.20) demonstrated by the bacterial strains isolated from different locations in Tamil Nadu indicate the abusive use of the antimicrobials. In the present study, the MAR index varied between 0 to 0.79, with more than 0.2 in 88.6% of bacterial strains isolated. Similar findings were reported by\u0026nbsp;Mursalim et al. (2022),\u0026nbsp;where 99% of the isolates exhibited MAR values of more than 0.2. Indiscriminate use of antibiotics in aquaculture could be the reason for this increased MAR index in fish pathogens\u0026nbsp;(Serrano 2005).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScreening of AMR gene cassettes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Out of 86 bacterial strains 71 were positive for Class 1 integron. Class 1 integrons encompassing gene cassettes with antibiotic resistant genes play a vital role in the wider dissemination of AMR in aquaculture systems\u0026nbsp;(Gao et al. 2012). It was reported that class 1 integrons are the most predominant gene cassette in aquaculture systems\u0026nbsp;(Stalder et al. 2012).\u0026nbsp;Schmidt et al. (2001) and Verner-Jeffreys et al. (2009)\u0026nbsp;reported that 50% of the isolates from freshwater fish farms carried class 1 integrons with AMR gene cassettes. However, there are reports that integrons without gene cassettes in \u003cem\u003eY. ruckeri\u003c/em\u003e (Balta et al. 2010)\u0026nbsp;and \u003cem\u003eA. salmonicida\u0026nbsp;\u003c/em\u003e(Schmidt et al. 2001) were also isolated from rainbow trout. Hence, further molecular characterization is necessary to confirm different resistance genes present in the gene cassettes. Some of the bacterial isolates were negative for both class 1 and class 2 integrons. This may be because the genes responsible for AMR are not located on the gene cassettes carrying integrons. However, AMR genes may be located in their mobile genetic elements like transposons. Class 1 and class 2 integrons were also detected in the plasmid DNA isolated from most bacterial isolates. Both plasmid and genomic DNA were found to have the integron gene indicating which is of plasmid- borne. Mobile integrons (MI) are the most responsible entities which carry the AMR determinants than the chromosomal integrons (Stalder et al. 2012). The presence of integrons with AMR gene cassettes in mobile genetic elements in fish pathogens increases the risk of AMR gene dissemination to pathogenic and human commensal bacteria via HGT (Jacobs and Chenia 2007). The presence of AMR genes in integron gene cassettes can be detected by further molecular characterization studies.\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe findings of the present study suggest that ornamental fish culture systems may act as the reservoir of MAR pathogens and it may result in the dissemination of resistance genes to pathogenic and human commensal bacteria via HGT. This study will also be helpful to understand the antimicrobial resistance patterns of bacterial pathogens in freshwater aquaculture systems and the development of alternative measures to control bacterial infections in fishes. This study also indicates the need for surveillance and monitoring programs to control antibiotic use in aquaculture. The One Health Concept and approach could be strengthened and applied in the ornamental fish culture systems for better prevention of ARG dissemination. The information obtained from this study will also serve as the basic input for developing policy guidelines.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors acknowledge the Institute of Fisheries Post Graduate Studies, TNJFU, for the support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH.N. performed the work as part of her Ph.D. research work and drafted the manuscript; S.S.A. provided overall guidance; K.A. conceptualized and designed the experiment; D.A. analyzed the data; S.E. extended help with data acquisition and revising the manuscript critically for important intellectual content.\u003c/p\u003e\n\u003cp\u003eFunding:None\u003c/p\u003e\n\u003cp\u003eConflicts of interest/ Competing interests:The authors declared no conflict of interest.\u003c/p\u003e\n\u003cp\u003eData availability statement:All the required data are provided in the table and figures.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbdelsalam M, Ewiss MAZ, Khalefa HS, et al (2021) Coinfections of Aeromonas spp., Enterococcus faecalis, and Vibrio alginolyticus isolated from farmed Nile tilapia and African catfish in Egypt, with an emphasis on poor water quality. Microbial Pathogenesis 160:105213. https://doi.org/10.1016/j.micpath.2021.105213\u003c/li\u003e\n \u003cli\u003eAkinbowale O l., Peng H, Barton MD (2006) Antimicrobial resistance in bacteria isolated from aquaculture sources in Australia. J Appl Microbiol 100:1103\u0026ndash;1113. https://doi.org/10.1111/j.1365-2672.2006.02812.x\u003c/li\u003e\n \u003cli\u003eAmalina NZ, Santha S, Zulperi D, et al (2019) Prevalence, antimicrobial susceptibility and plasmid profiling of Vibrio spp. isolated from cultured groupers in Peninsular Malaysia. BMC Microbiol 19:251. https://doi.org/10.1186/s12866-019-1624-2\u003c/li\u003e\n \u003cli\u003eAnjur N, Sabran SF, Daud HM, Othman NZ (2021) An update on the ornamental fish industry in Malaysia: Aeromonas hydrophila-associated disease and its treatment control. Vet World 14:\u003c/li\u003e\n \u003cli\u003eBalta F, Sandalli C, Kayis S, Ozgumus OB (2010) Molecular analysis of antimicrobial resistance in Yersinia ruckeri strains isolated from rainbow trout (Oncorhynchus mykiss) grown in commercial fish farms in Turkey. Bull Eur Ass Fish Pathol 30:211\u0026ndash;219\u003c/li\u003e\n \u003cli\u003eBauer K (1966) Antimicrobial susceptibility testing by Kirby Bauer disc diffusion method. American Journal of Biological Technology 1:50\u0026ndash;55\u003c/li\u003e\n \u003cli\u003eBello-L\u0026oacute;pez JM, Cabrero-Mart\u0026iacute;nez OA, Ib\u0026aacute;\u0026ntilde;ez-Cervantes G, et al (2019) Horizontal Gene Transfer and Its Association with Antibiotic Resistance in the Genus Aeromonas spp. Microorganisms 7:363. https://doi.org/10.3390/microorganisms7090363\u003c/li\u003e\n \u003cli\u003eBillington SJ, Songer JG, Jost BH (2002) Widespread Distribution of a Tet W Determinant among Tetracycline-Resistant Isolates of the Animal Pathogen Arcanobacterium pyogenes. Antimicrobial Agents and Chemotherapy 46:1281\u0026ndash;1287. https://doi.org/10.1128/AAC.46.5.1281-1287.2002\u003c/li\u003e\n \u003cli\u003eBouki C, Venieri D, Diamadopoulos E (2013) Detection and fate of antibiotic resistant bacteria in wastewater treatment plants: A review. Ecotoxicol Environ Saf 91:1\u0026ndash;9. https://doi.org/10.1016/j.ecoenv.2013.01.016\u003c/li\u003e\n \u003cli\u003eChandra G, Bhattacharjee I, Chatterjee S (2015) Bacillus cereus infection in stinging catfish, Heteropneustes fossilis (Siluriformes: Heteropneustidae) and their recovery by Argemone mexicana seed extract. Iran J Fish Sci 14:741\u0026ndash;753. https://doi.org/10.22092/ijfs.2018.114479\u003c/li\u003e\n \u003cli\u003eClarke KR, Gorley RN (2015) PRIMER version 7: User manual/tutorial. PRIMER-E 192:\u003c/li\u003e\n \u003cli\u003eCLSI (2018) Performance standards for antimicrobial susceptibility testing, 28th edn. CLSI supplement M100. CLSI supplement M100\u003c/li\u003e\n \u003cli\u003eCowan ST, Steel KJ (1965) Manual for the Identification of Medical Bacteria. Manual for the Identification of Medical Bacteria 217\u003c/li\u003e\n \u003cli\u003eDharmaratnam, Kumar R, Basheer VS, et al (2017) Isolation and characterisation of virulent Serratia marcescens associated with a disease outbreak in farmed ornamental fish, Poecilia reticulata in Kerala, India. Indian \u0026nbsp;Fish 64:71\u0026ndash;79. http://dx.doi.org/10.21077/ijf.2017.64.4.71261-10\u003c/li\u003e\n \u003cli\u003eDias C, Mota V, Martinez-Murcia A, Saavedra MJ (2012) Antimicrobial resistance patterns of Aeromonas spp. Isolated from ornamental fish. J Aquac Res Dev 3:. https://doi.org/10.4172/2155-9546.1000131\u003c/li\u003e\n \u003cli\u003eElhadi N (2014) Prevalence and antimicrobial resistance of Salmonella spp. in raw retail frozen imported freshwater fish to Eastern Province of Saudi Arabia. Asian Pacific Journal of Tropical Biomedicine 4:234\u0026ndash;238. https://doi.org/10.1016/S2221-1691(14)60237-9\u003c/li\u003e\n \u003cli\u003eEUCAST (2021) European Committee on Antimicrobial Susceptibility Testing, Breakpoint tables for interpretation of MICs and zone diameters. Version 5.0, 2015\u003c/li\u003e\n \u003cli\u003eGao P, Mao D, Luo Y, et al (2012) Occurrence of sulfonamide and tetracycline-resistant bacteria and resistance genes in aquaculture environment. Water Res 46:2355\u0026ndash;2364. https://doi.org/10.1016/j.watres.2012.02.004\u003c/li\u003e\n \u003cli\u003eGufe C, Canaan Hodobo T, Mbonjani B, et al (2019) Antimicrobial Profiling of Bacteria Isolated from Fish Sold at Informal Market in Mufakose, Zimbabwe. Int J Microbiol 2019:e8759636. https://doi.org/10.1155/2019/8759636\u003c/li\u003e\n \u003cli\u003eGuz L, Kozinska A (2004) Antibiotic susceptibility of Aeromonas hydrophila and A. sobria isolated from farmed carp (Cyprinus carpio L.). Bulletin of the Veterinary Institute in Pulawy 48:391\u0026ndash;395\u003c/li\u003e\n \u003cli\u003eHaenen OLM, Evans JJ, Berthe F (2013) Bacterial infections from aquatic species: potential for and prevention of contact zoonoses. Rev Sci Tech 32:497\u0026ndash;507. https://doi.org/10.20506/rst.32.2.2245\u003c/li\u003e\n \u003cli\u003eHemamalini N, Shanmugam SA, Kathirvelpandian A, et al (2021) A critical review on the antimicrobial resistance, antibiotic residue and metagenomics-assisted antimicrobial resistance gene detection in freshwater aquaculture environment. Aquaculture Research 53:344\u0026ndash;366. https://doi.org/10.1111/are.15601\u003c/li\u003e\n \u003cli\u003eHemamalini N, Shanmugam SA, Kathirvelpandian A, et al (2022a) Prevalence, Antimicrobial Susceptibility and Resistance Gene Detection in Bacteria Isolated from Goldfish and Tiger Barb from Ornamental Fish Farms of Tamil Nadu. Indian J Microbiol. https://doi.org/10.1007/s12088-022-01023-y\u003c/li\u003e\n \u003cli\u003eHemamalini N, Shanmugam SA, Kathirvelpandian A, et al (2022b) Prevalence, Antimicrobial Resistance and Resistance Gene Cassettes Detection in Bacterial Pathogens Isolated from Freshwater Ornamental Fishes. Indian J Anim Res 1:. https://doi.org/10.18805/IJAR.B-4903\u003c/li\u003e\n \u003cli\u003eHossain S, De Silva BCJ, Dahanayake PS, et al (2020) Phylogenetic characteristics, virulence properties and antibiogram profile of motile Aeromonas spp. isolated from ornamental guppy (Poecilia reticulata). Arch Microbiol 202:501\u0026ndash;509. https://doi.org/10.1007/s00203-019-01762-5\u003c/li\u003e\n \u003cli\u003eHossain S, De Silva BCJ, Wimalasena SHMP, et al (2018) Distribution of Antimicrobial Resistance Genes and Class 1 Integron Gene Cassette Arrays in Motile Aeromonas spp. Isolated from Goldfish (Carassius auratus). Microb Drug Resist 24:1217\u0026ndash;1225. https://doi.org/10.1089/mdr.2017.0388\u003c/li\u003e\n \u003cli\u003eHu M, Wang N, Pan Z h., et al (2012) Identity and virulence properties of Aeromonas isolates from diseased fish, healthy controls and water environment in China. Letters in Applied Microbiology 55:224\u0026ndash;233. https://doi.org/10.1111/j.1472-765X.2012.03281.x\u003c/li\u003e\n \u003cli\u003eJacobs L, Chenia HY (2007) Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture systems. Int J Food Microbiol 114:295\u0026ndash;306. https://doi.org/10.1016/j.ijfoodmicro.2006.09.030\u003c/li\u003e\n \u003cli\u003eJagoda S de S, Wijewardana TG, Arulkanthan A, et al (2014) Characterization and antimicrobial susceptibility of motile aeromonads isolated from freshwater ornamental fish showing signs of septicaemia. Dis Aquat Org 109:127\u0026ndash;137. https://doi.org/10.3354/dao02733\u003c/li\u003e\n \u003cli\u003eKim B-R, Shin J, Guevarra RB, et al (2017) Deciphering Diversity Indices for a Better Understanding of Microbial Communities. J Microbiol Biotechnol 27:2089\u0026ndash;2093. https://doi.org/10.4014/jmb.1709.09027\u003c/li\u003e\n \u003cli\u003eKołodziejska M, Maszkowska J, Białk-Bielińska A, et al (2013) Aquatic toxicity of four veterinary drugs commonly applied in fish farming and animal husbandry. Chemosphere 92:1253\u0026ndash;1259. https://doi.org/10.1016/j.chemosphere.2013.04.057\u003c/li\u003e\n \u003cli\u003eKrumperman PH (1983) Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Applied and Environmental Microbiology 46:165\u0026ndash;170. https://doi.org/10.1128/aem.46.1.165-170.1983\u003c/li\u003e\n \u003cli\u003eKumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33:1870\u0026ndash;1874. https://doi.org/10.1093/molbev/msw054\u003c/li\u003e\n \u003cli\u003eL\u0026eacute;vesque C, Pich\u0026eacute; L, Larose C, Roy PH (1995) PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 39:185\u0026ndash;191. https://doi.org/10.1128/AAC.39.1.185\u003c/li\u003e\n \u003cli\u003eLewbart GA (2001) Bacteria and ornamental fish.\u0026nbsp;Semin Avian Exot Pet Med 10:48\u0026ndash;56. https://doi.org/10.1053/saep.2001.19543\u003c/li\u003e\n \u003cli\u003eMartins ML, Mouri\u0026ntilde;o JLP, Amaral GV, et al (2008) Haematological changes in Nile tilapia experimentally infected with Enterococcus sp. Braz J Biol 68:657\u0026ndash;661. https://doi.org/10.1590/S1519-69842008000300025\u003c/li\u003e\n \u003cli\u003eMiller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215\u003c/li\u003e\n \u003cli\u003eMursalim MF, Budiyansah H, Raharjo HM, et al (2022) Diversity and antimicrobial susceptibility profiles of Aeromonas spp. isolated from diseased freshwater fishes in Thailand. Journal of Fish Diseases n/a: https://doi.org/10.1111/jfd.13650\u003c/li\u003e\n \u003cli\u003eNakamura LK (1998) Bacillus pseudomycoides sp. nov. Int J Syst Evol Microbiol 48:1031\u0026ndash;1035. https://doi.org/10.1099/00207713-48-3-1031\u003c/li\u003e\n \u003cli\u003ePadr\u0026oacute;s F, Furones MD (2002) Patolog\u0026iacute;a bacteriana en piscicultura. Temas de Actualidad SEM 13\u0026ndash;21\u003c/li\u003e\n \u003cli\u003ePalmeiro B, Roberts H (2009) Bacterial disease in fish. Clinical Veterinary Advisor: Exotic Medicine Elsevier 17\u0026ndash;19\u003c/li\u003e\n \u003cli\u003ePereira AL, de Oliveira PM, Faria-Junior C, et al (2022) Environmental spreading of clinically relevant carbapenem-resistant gram-negative bacilli: the occurrence of blaKPC-or-NDM strains relates to local hospital activities. BMC Microbiol 22:6. https://doi.org/10.1186/s12866-021-02400-1\u003c/li\u003e\n \u003cli\u003ePetersen A, Dalsgaard A (2003) Antimicrobial resistance of intestinal Aeromonas spp. and Enterococcus spp. in fish cultured in integrated broiler-fish farms in Thailand. Aquaculture 219:71\u0026ndash;82. https://doi.org/10.1016/S0044-8486(03)00018-8\u003c/li\u003e\n \u003cli\u003ePreena PG, Dharmaratnam A, Raj NS, et al (2020a) Antibiotic-resistant Enterobacteriaceae from diseased freshwater goldfish. Arch Microbiol 203:219\u0026ndash;231. https://doi.org/10.1007/s00203-020-02021-8\u003c/li\u003e\n \u003cli\u003ePreena PG, Dharmaratnam A, Raj NS, et al (2019a) Diversity of antimicrobial-resistant pathogens from a freshwater ornamental fish farm. Lett Appl Microbiol 71:108\u0026ndash;116. https://doi.org/10.1111/lam.13231\u003c/li\u003e\n \u003cli\u003ePreena PG, Dharmaratnam A, Raj NS, et al (2019b) Antibiotic susceptibility pattern of bacteria isolated from freshwater ornamental fish, guppy showing bacterial disease. Biologia 74:1055\u0026ndash;1062. https://doi.org/10.2478/s11756-019-00261-8\u003c/li\u003e\n \u003cli\u003ePreena PG, Swaminathan TR, Kumar VJR, Singh ISB (2020b) Antimicrobial resistance in aquaculture: a crisis for concern. Biologia 75:1497\u0026ndash;1517. https://doi.org/10.2478/s11756-020-00456-4\u003c/li\u003e\n \u003cli\u003eRamesh D, Souissi S (2018) Antibiotic resistance and virulence traits of bacterial pathogens from infected freshwater fish, Labeo rohita. Microbial Pathogenesis 116:113\u0026ndash;119. https://doi.org/10.1016/j.micpath.2018.01.019\u003c/li\u003e\n \u003cli\u003eRohlf F (1998) NTSYSpc Version 2.0: User Guide. Appl Biostat 1\u0026ndash;38\u003c/li\u003e\n \u003cli\u003eSchmidt AS, Bruun MS, Dalsgaard I, Larsen JL (2001) Incidence, Distribution, and Spread of Tetracycline Resistance Determinants and Integron-Associated Antibiotic Resistance Genes among Motile Aeromonads from a Fish Farming Environment. Appl Environ Microbiol 67:5675\u0026ndash;5682. https://doi.org/10.1128/AEM.67.12.5675-5682.2001\u003c/li\u003e\n \u003cli\u003eSerrano PH (2005) Responsible use of antibiotics in aquaculture. Food \u0026amp; Agriculture Org.\u003c/li\u003e\n \u003cli\u003eShiina Y, Ii K, Iwanaga M (2004) An Aeromonas veronii biovar sobria infection with disseminated intravascular gas production. J Infect Chemother 10:37\u0026ndash;41. https://doi.org/10.1007/s10156-003-0274-2\u003c/li\u003e\n \u003cli\u003eSingh AK, Rathore G, Singh V, et al (2009) Bacterial resistance to oxytetracycline in different life stages of Indian freshwater carp aquaculture system\u003c/li\u003e\n \u003cli\u003eSong Z, Zhao Q, Zhu L, et al (2019) Draft genome sequence of multidrug-resistant \u0026beta;-lactamase-producing Bacillus cereus S66 isolated from China. J Glob Antimicrob Resist 17:23\u0026ndash;24. https://doi.org/10.1016/j.jgar.2019.02.019\u003c/li\u003e\n \u003cli\u003eSoufi L, S\u0026aacute;enz Y, Vinu\u0026eacute; L, et al (2011) Escherichia coli of poultry food origin as reservoir of sulphonamide resistance genes and integrons. Int J Food Microbiol 144:497\u0026ndash;502. https://doi.org/10.1016/j.ijfoodmicro.2010.11.008\u003c/li\u003e\n \u003cli\u003eSreedharan K, Philip R, Singh ISB (2011) Isolation and characterization of virulent Aeromonas veronii from ascitic fluid of oscar Astronotus ocellatus showing signs of infectious dropsy. Diseases of Aquatic Organisms 94:29\u0026ndash;39. https://doi.org/10.3354/dao02304\u003c/li\u003e\n \u003cli\u003eSreedharan K, Philip R, Singh ISB (2013) Characterization and virulence potential of phenotypically diverse Aeromonas veronii isolates recovered from moribund freshwater ornamental fishes of Kerala, India. Antonie van Leeuwenhoek 103:53\u0026ndash;67. https://doi.org/10.1007/s10482-012-9786-z\u003c/li\u003e\n \u003cli\u003eStalder T, Barraud O, Casellas M, et al (2012) Integron Involvement in Environmental Spread of Antibiotic Resistance. Front Microbiol 3:119\u003c/li\u003e\n \u003cli\u003eTaylor DE, Chau A (1996) Tetracycline resistance mediated by ribosomal protection. Antimicrob Agents Chemother 40:1\u0026ndash;5. https://doi.org/10.1128/aac.40.1.1\u003c/li\u003e\n \u003cli\u003eTaylor NGH, Verner-Jeffreys DW, Baker-Austin C (2011) Aquatic systems: maintaining, mixing and mobilising antimicrobial resistance? Trends Ecol Evol 26:278\u0026ndash;284. https://doi.org/10.1016/j.tree.2011.03.004\u003c/li\u003e\n \u003cli\u003eTomova A, Ivanova L, Buschmann AH, et al (2015) Antimicrobial resistance genes in marine bacteria and human uropathogenic Escherichia coli from a region of intensive aquaculture. Environ Microbiol Rep 7:803\u0026ndash;809. https://doi.org/10.1111/1758-2229.12327\u003c/li\u003e\n \u003cli\u003eTrust TJ, Bartlett KH (1974) Occurrence of potential pathogens in water containing ornamental fishes. Appl Microbiol 28:35\u0026ndash;40. https://doi.org/10.1128/am.28.1.35-40.1974\u003c/li\u003e\n \u003cli\u003eVerner-Jeffreys DW, Welch TJ, Schwarz T, et al (2009) High Prevalence of Multidrug-Tolerant Bacteria and Associated Antimicrobial Resistance Genes Isolated from Ornamental Fish and Their Carriage Water. PLOS One 4:e8388. https://doi.org/10.1371/journal.pone.0008388\u003c/li\u003e\n \u003cli\u003eWalczak N, Puk K, Guz L (2017) Bacterial Flora Associated with Diseased Freshwater Ornamental Fish. J Vet Res 61:445\u0026ndash;449. https://doi.org/10.1515/jvetres-2017-0070\u003c/li\u003e\n \u003cli\u003eWeisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697\u0026ndash;703. https://doi.org/10.1128/jb.173.2.697-703.1991\u003c/li\u003e\n \u003cli\u003eWhite PA, McIver CJ, Rawlinson WD (2001) Integrons and Gene Cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother 45:2658\u0026ndash;2661. https://doi.org/10.1128/AAC.45.9.2658-2661.2001\u003c/li\u003e\n \u003cli\u003eXu T, Zhang X-H (2014) Edwardsiella tarda: an intriguing problem in aquaculture. Aquaculture 431:129\u0026ndash;135. https://doi.org/10.1016/j.aquaculture.2013.12.001\u003c/li\u003e\n \u003cli\u003eYi S-W, You M-J, Cho H-S, et al (2013) Molecular characterization of Aeromonas species isolated from farmed eels (Anguilla japonica). Veterinary Microbiology 164:195\u0026ndash;200. https://doi.org/10.1016/j.vetmic.2013.02.006\u003c/li\u003e\n \u003cli\u003eYu S, Yu P, Wang J, et al (2019) A Study on Prevalence and Characterization of Bacillus cereus in Ready-to-Eat Foods in China. Front Microbiol 10:3043. https://doi.org/10.3389/fmicb.2019.03043\u003c/li\u003e\n \u003cli\u003eZainab SM, Junaid M, Xu N, Malik RN (2020) Antibiotics and antibiotic resistant genes (ARGs) in groundwater: A global review on dissemination, sources, interactions, environmental and human health risks. Water Res 187:116455. https://doi.org/10.1016/j.watres.2020.116455\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 4 are available in the Supplementary Files section\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Antimicrobial resistance gene, Antimicrobial resistance, Bacterial diversity, Multiple antimicrobial resistance, Ornamental fishes","lastPublishedDoi":"10.21203/rs.3.rs-4434353/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4434353/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAntimicrobial resistance (AMR) is an emerging problem in the aquaculture sector. Further, it connects livestock and human health through possible horizontal gene transfer. In the present study, 258 bacterial isolates were recovered from ornamental fish samples collected from fish farms in Chennai, Madurai and Tiruvarur districts of Tamil Nadu. 16S rRNA sequencing of the isolates revealed the presence of 86 different bacterial strains in the infected fish samples. The highest diversity index was observed in the Goldfish sample (1.99) collected from Tiruvarur, followed by Flower horn (1.98) sample from Chennai. All the bacterial isolates were susceptible to ciprofloxacin and sulphafurazole. The highest resistance was recorded against oxytetracycline, followed by bacitracin, tetracycline and ampicillin. Some of the bacterial isolates exhibited resistance against the new-generation antibiotic, cefepime. Resistance to new generation antibiotics indicates the need for surveillance and monitoring programs to control the indiscriminate use of antibiotics in aquaculture and develop new generation antibiotics. The highest MAR index was recorded in \u003cem\u003eP. vulgaris\u003c/em\u003e(0.79) from Guppy (Tiruvarur). MAR index values, ≥ 0.20 exhibited by the bacterial strains isolated from different locations in Tamil Nadu indicate the abusive use of the antimicrobials. Class 1 and Class 2 integrons were detected in the genomic and plasmid DNA of 71 and 3 isolates, respectively. The findings of the present study indicate that ornamental fish may act as the reservoir of MAR bacteria and threaten the human and animal health through dissemination ARGs via horizontal gene transfer.\u003c/p\u003e","manuscriptTitle":"Incidence, antimicrobial resistance and distribution of class 1 and class 2 integron gene cassette arrays in bacteria isolated from ornamental fishes cultured in three districts of Tamil Nadu","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-31 05:41:51","doi":"10.21203/rs.3.rs-4434353/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5c457d45-e379-452c-a5f8-7a6718836742","owner":[],"postedDate":"May 31st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-20T06:43:47+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-31 05:41:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4434353","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-4434353","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}