Preimplantation Genetic Testing for Cornelia de Lange Syndrome with Low-Level Maternal Gonadal Mosaicism using nanopore sequencing and digital PCR

Preimplantation Genetic Testing for Cornelia de Lange Syndrome with Low-Level Maternal Gonadal Mosaicism using nanopore sequencing and digital PCR | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Preimplantation Genetic Testing for Cornelia de Lange Syndrome with Low-Level Maternal Gonadal Mosaicism using nanopore sequencing and digital PCR Lulu Meng, Yan Wang, Ran Zhou, Xingxing Wang, Fengchang Qiao, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5668001/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Presently, to address the limited resolution at the single-cell level within the preimplantation genetic testing for aneuploidy (PGT-A) framework, our institution implemented a preimplantation genetic testing for monogenic disease (PGT-M) strategy based on haplotype linkage analysis for families with copy number variants (CNVs) < 1 Mb. Objective This study aims to deliver an accurate diagnosis for a Chinese family affected by Cornelia de Lange syndrome 5 (CDLS5) resulting from a microdeletion del(X)(q13.1q13.2) in the HDAC8 gene, characterized by notably low-level gonadal mosaicism. Furthermore, we execute preimplantation genetic testing for aneuploidy and monogenic disorders leveraging the diagnostic outcomes. Methods A de novo CNV was identified through chromosomal microarray analysis (CMA) and Whole Exome Sequencing (WES) in a family experiencing two unsuccessful pregnancies, indicating the existence of germline mosaicism. Validation of this CNV was performed via real-time quantitative polymerase chain reaction (PCR). Whole-genome low-coverage mate-pair sequencing (WGL-MPS) was conducted on female peripheral blood to exclude cryptic chromosomal abnormalities or mosaic states. Long-PCR was utilized to amplify the deleted fragment in insufficient miscarriage samples, with primers designed at breakpoints identified through WES and CMA results. After purifying the Long-PCR products, Oxford Nanopore Technology (ONT) third-generation sequencing was employed to pinpoint specific breakpoint positions. Designed primers and probes for droplet-digital polymerase chain reaction (ddPCR) were utilized to confirm the presence and proportion of germline mosaicism in ovarian samples obtained during in vitro fertilization procedures, such as granulosa cells and follicular fluid. Results The disease-causing microdeletion at Xq13.1q13.2 disrupting the HDAC8 Gene in the two male miscarriage tissues was not detected in the parents' peripheral blood cells by CMA, ES, quantitative PCR, and WGL-MPS. The maternal gonadal tissues were assumed to be the source of inheritance as Cornelia de Lange syndrome 5 (CDLS5) is an X-linked dominant disease. Specific breakpoint positions (chrX:g.71666527–71838853, 172 kb) were identified through third-generation sequencing of Long-PCR products. ddPCR quantitatively revealed approximately 1% mosaic state for the deletions in ovarian granulosa cells and none in peripheral blood cells, confirming the presence of CNV-induced gonadal mosaicism, a novel finding in maternal ovarian tissues. PGT investigations indicated 16.7% (1/6) of embryos with the deletion, demonstrating a low-level gonadal mosaicism. Conclusion Our findings underscore the efficacy of PGT-M utilizing haplotype linkage analysis for CNVs < 1 Mb, even in cases of gonadal mosaicism, emphasizing the significance of parental testing in CDLS5 families and the reproductive utility of in vitro fertilization (IVF) with PGT for families affected by low-level parental gonadal mosaicism. By employing a spectrum of methodologies, including NGS-based sequencing, microarray-based comparative genomic hybridization, and ddPCR for precise breakpoint determination, we showcase approaches to address and resolve uncommon genetic mechanisms underlying microdeletions in cases of gonadal mosaicism. Our results advocate for the expanded application of PGT-M based on haplotype linkage analysis for families with minor pathogenic CNVs. Cornelia de Lange syndrome (CDLS) low-level gonadal mosaicism nanopore sequencing droplet-digital PCR haplotype linkage analysis preimplantation genetic testing for monogenic disease (PGT-M). Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Cornelia de Lange syndrome (CdLS; MIM #122470, 300590, 610759, 300882, 614701) is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems with an estimated incidence between 1:10,000 and 1:30,000 live births [ 1 ] (PMID: 29995837); however, the actual incidence is far more than that as some mild cases with atypical symptoms are not clinically diagnosed. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, intrauterine and postnatal growth retardation, and severe intellectual disability with a mean IQ of 53 [ 2 ] (PMID: 20301283). Only 23% of CdLS cases showing manifestations such as fetal skin edema, NT thickening, heart defects could be detected prenatally [ 3 ] (PMID: 28544538), which is consistent with the second pregnancy of our family. Cornelia de Lange syndrome 5 (CDLS5, MIM # 300882) is a rare X-linked dominant hereditary disorder caused by histone deacetylase 8 ( HD CA8, MIM *300269) located on chromosome Xq13.1, which accounts for the 4% of CDLS cases [ 4 ] (PMID: 36011323). HDAC8 encodes a vertebrate SMC3 deacetylase that has roles in catalyzing the deacetylation of SMC3 as well as in efficiently recycling the cohesin. The lack of HDAC8 activity favors the accumulation of acetylated cohesin with reduced affinity to chromatids, subsequently leading to abnormal transcription [ 5 ] (PMID: 29279609). Variations in the HDAC8 phenotype are remarkably nonclassical and wide, but distinctive features of affected individuals in addition to typical CdLS features include a large anterior fontanel, a broad or bulbous nasal tip, tooth anomalies, mosaic patches of hyperpigmented skin, orbital hypertelorism, and happy personalities [ 1 ] (PMID: 29995837). Male individuals were more severely affected than females, while females showed variable clinical symptoms influenced by X inactivation patterns [ 6 ] (PMID: 37377026). About 100 mutations in the HDAC8 gene have been reported (Human Gene Mutation Database: http://www.hgmd.org ). The majority of known disease-causing mutations in HDAC8 are nonsense, missense, splice site variants or CNVs, and predicted to disrupt HDAC8 function, and most of them were shown to be de novo [ 4 , 7 ] (PMID: 36011323;24403048).To date, there have been few reports of HDAC8 microdeletions. Several cases of CNVs involving larger regions of HDAC8 have been reported in individuals with CdLS5, especially intragenic deletions ranging from single to multiple exons. Exons 1, 1–4, 1–9, 3–4, 5–6, 5–7, 5–10, 7, 8-11and 11 are absent from the HDAC8 gene in 13 individuals with CdLS [ 7 – 10 ] (24403048; 30632303; 30293986; 32856424). This is the first report of HDAC8 gene deletion leading to male embryo abortion, suggesting that the deletion of exon 1–9 of HDAC8 gene has a serious male lethal effect. In this case, we reported a family with two male miscarriage tissues carrying the same de novo microdeletion at Xq13.1q13.2 disrupting HDAC8 Gene, thus we suspected the woman was a carrier in the form of gonadal mosaicism. Long-range PCR and nanopore sequencing were performed to definite specific breakpoint positions. ddPCR was utilized to verify the existence and proportion of germline mosaicism on Ovarian samples obtained from IVF procedures, such as granulosa cells and follicular fluid. Our results show that the extended PGT-M based on the haplotype linkage analysis strategy could be applied to families with small pathogenic CNVs. Materials and Methods Patients The female patient experienced a miscarriage at 12 + 2 weeks at the age of 27. The chromosomal microarray (CMA) results of the miscarriage tissue and parental blood revealed a de novo pathogenic deletion at Xq13.1q13.2, disrupting the haploinsufficient gene HDAC8 . Despite the parents being clinically unaffected and showing no symptoms associated with CDLS5, they sought genetic counseling at the Department of Prenatal Diagnosis of Nanjing Women and Children's Healthcare Hospital in Jiangsu, China. Subsequently, they opted for natural conception due to the perceived low incidence of germline mosaicism. During the second pregnancy, the fetus exhibited thickening of the nuchal translucency (NT 6.9mm), congenital heart disease, and fetal edema, especially in the head and trunk at 13 + 1 weeks, the fetus was identified as carrying the same Xq13.1q13.2 deletion with CMA and Trio-ES. Following genetic counseling and considering the previous two unsuccessful pregnancies and male asthenospermia, the couple decided to pursue assisted reproductive technology (ART) at the Department of Reproductive Medicine. The history and medical process for this patient is illustrated in Fig. 1 . Genetic counseling sessions were provided to the family prior to any interventions, and informed consent was obtained. All procedures and protocols undertaken in this study were approved by the Medical Ethics Committee of Nanjing Women and Children's Healthcare Hospital. Genomic DNA sample preparation Genomic DNA (gDNA) from miscarriage tissue and peripheral blood samples was extracted using the whole blood genomic DNA extraction kit (magnetic bead method) (M121; Maibo, China); Genomic DNA from 20-mL amniotic fluid samples was extracted using a QIAamp DNA Mini Kit (51306, Qiagen, Germany). cfDNA extracted from follicular fluid samples using the plasma cell-free DNA extraction kit (magnetic bead method) (M111; Maibo, China). Chromosomal microarray analysis The Affymetrix CytoScan 750K array (901859, Affymetrix, USA), containing about 550,000 oligonucleotide probes and 200,000 single nucleotide polymorphism (SNP) probes, was performed for the whole-genome scan and CNVs were called at a minimal resolution of 50 kb. The 750K array experiments have been described in detail as previously reported. Cytogenetic analysis was performed using Chromosome Analysis Suite Software (Affymetrix, CA) and CNVs coordinates were determined according to the human genome GRCh37/hg19 assembly. The clinical significance of the detected CNVs was evaluated based on the guidelines of the American College of Medical Genetics and Genomics(ACMG) and the Clinical Genome Resource (ClinGen). Whole genome low-coverage mate-pair sequencing (WGL-MPS) To investigate cryptic chromosomal abnormalities or mosaic state, WGL-MPS was performed. gDNA of the female was used to construct a non-size selected mate-pair library and then subjected to 50-bp-end multiplex sequencing by BGISeq-500. After removing reads containing sequencing adapters and low-quality reads, the high-quality pair-end reads were aligned to the NCBI human reference genome (hg19, GRCh37.1) using SOAP2. Only uniquely mapped reads were remained for the subsequent analysis as previously described. Whole Exome sequencing Whole exome sequencing was performed in familial trios. The Agilent SureSelect XT Library Prep Kit and the Agilent SureSelect XT Human All Exon V6 kit (Agilent, Santa Clara, CA, USA) were used to prepare a fragment library and capture gene exons according to the manufacturer’s protocols. The captured regions were enriched by PCR amplification and sequenced on an Illumina Hiseq 2500 platform with a read length of 150 bp. The resultant reads were mapped against GRCh37/hg19 assembly, then analysis were performed as reported previously. PCR amplification and detection of deletion Primer validation strategy designed from the HDAC8 reference sequence (NM_018486.2) at the breakpoints based on miscarriage WES and CMA results, as depicted in Fig. 2 ; Long-PCR method was utilized for amplifying the deleted fragment, where the fragment length governs the detection approach. Primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., with detailed sequences listed in Table 1 . A 25 µL PCR reaction mix was prepared using LongAmp® Taq 2X premix (M0287, NEB, USA). The reaction conditions were as follows: 94°C for 1 min; 94°C for 30 s, 62°C for 30 s, 65°C for 10 min, repeated for 30 cycles. PCR products were electrophoresed on a 0.8% agarose gel at 110 V for 50 min; visualized and captured using a gel imaging system. The appearance of expected specific bands indicates successful amplification. Table 1 PCR primer information for the detection of microdeletion. Name Sequence (5’--3’) Description WT-F AGCTGGGACATTGCTTCTCC Forward primer for wide type amplicon WT-R AAGGTAGTTCCACCCCCTGA Reverse primer for wide type amplicon Del-F AATGCTAAATGACGAGTTAATGAGT Forward primer for mutant type amplicon Del-R TCAGTTCACTTTTACATTGGGCA Reverse primer for mutant type amplicon Third-generation sequencing and analysis of breakpoint Following the purification of long-range PCR products, a third-generation sequencing library was constructed using the sequencing adapter kit (SQK-LSK110, Oxford Nanopore Technologies, UK). The key steps involved utilizing the Ultra II End Prep module (NEB, E7546, USA) for DNA end repair and dA tailing, followed by connecting motor protein-tailed adapters using the Quick Ligation Module (NEB, E6056, USA). The purified product represents the third-generation sequencing library. Sequencing was performed using the Oxford Nanopore MinION sequencer. The sequenced fastq files were aligned with GRCh37/hg19 using minimap2 software with default parameters, and the breakpoint positions were validated using the Interactive Genomics Viewer software. Digital PCR Based on the specific breakpoint positions obtained from ONT third-generation sequencing, primers and probes for ddPCR were designed, with sequence details provided in Table 2 . Following the instructions outlined in the 2×HQ ddPCR Master Mix for Probe kit (Sniper Co., Ltd. Suzhou, China), the reaction mix consisted of 11 µL of 2×HQ ddPCR Master Mix for Probe, 1 µL each of 10 µmol·L upstream and downstream primers, 0.5 µL of 10 µmol·L probe, and 1–5 µL of DNA template. The ddPCR was performed with the DQ24 Digital PCR System (Sniper Co., Ltd. Suzhou, China). The amplification program included reverse transcription at 65°C for 5 minutes, enzyme activation at 95°C for 15 minutes, denaturation at 95°C for 20 seconds, and annealing at 60°C for 30 seconds for 40 cycles. Following amplification, microdroplet data was read using a droplet reader. Analysis was conducted to detect deletion ratios, with miscarriage samples serving as positive controls and buffer solution as negative controls. Table 2 Summary of the PGT results for the patient Embryo ID Grade PGT-A results Haplotyping results/ Carrier status E01 6BB 46, XY, +5q(q11.2→q23.2,~74Mb,×3,mos,~36%), +5q(q23.3→q35.2,~46Mb,×3,mos,~45%) WT E02 5BB 46, XY WT E03 4BB 46, XY WT E04 4BB 45, XX, -22(×1) Carrier, high-risk E05 4BC 46, XY WT E06 4BC 46, XX WT ART procedure The couple conducted in vitro fertilization (IVF) at the Department of Reproductive Medicine. Controlled ovulation, oocytes retrieval, intracytoplasmic sperm injection (ICSI), embryo culture, trophectoderm biopsy, and cryopreservation by vitrification of the blastocysts were conducted following the standard protocol. In this IVF cycle, 6 embryos were cultured to the blastocyst stage, and a total of 3–10 trophectoderm (TE) cells at the blastocyst stage were biopsied on day 5 or 6 and prepared for the next whole-genome amplification (WGA). Whole genome amplification Whole genome amplification (WGA) of the lysed TE cells was performed using the multiple annealing and looping-based amplification cycles (MALBAC). This procedure can amplify the genomic DNA from the picogram level to the nanogram one for the chip experiment. We transferred TE cells to 0.2 µl PCR tubes that contained 4.5 µl of lysis buffer (XK-002, Yikon Genomics, China). The WGA of each embryo biopsy sample was performed using a MALBAC WGA kit (XK-028-24, Yikon Genomics, China), following the manufacturer’s standard protocols. The collected cells were initially lysed in a lysis buffer, followed by MALBAC pre-amplification and exponential amplification, to obtain 2–5 µg of DNA. Next-generation sequencing, CNV analysis, and SNP haplotype linkage analysis Purified WGA products and gDNA were used for SNP and CNV library preparation by an NGS library preparation kit (XK-038, Yikon Genomics, China). All operations followed the manufacturers’ instructions. We employed paired-end sequencing with a read length of 150 base pairs using the MGI T7 platform. The raw data were automatically filtered and analyzed by ChromGo software (Yikon Genomics, China). Chromosomal aneuploidies and genome-wide SNPs were detected simultaneously by using the approach of mutated allele revealed by sequencing with aneuploidy and linkage analyses (MARSALA) [ 11 ] . Embryos showed > 30% mosaic rate would be indicated as mosaic aneuploidy and not fit for transfer. Valid reads of more than 1 Mb and CV < 0.1 (1,000 K bin size) were considered to be within the acceptable range for CNV detection. According to the ESHRE PGT Consortium good practice recommendations for detecting monogenic disorders, informative SNPs were selected and performed for the haplotyping. High-frequency SNPs in the 2 Mb regions upstream and downstream of the pathogenic CNV and within the CNV at Xq13.1q13.2 were screened as genetic markers to construct the haplotype by defining the one X chromosome segment consistent with the fetal X chromosome segment as a “high-risk” haplotype, and the one inconsistent with the fetal chromosome segment but consistent with the other maternal chromosome segment as a “low-risk” haplotype. Embryo transfer and prenatal diagnosis The priority of embryo transfer was based on the results of PGT-M for SNP haplotype linkage analysis, PGT-A for aneuploidy/CNV analysis, and morphological scores according to the Istanbul consensus. One euploid blastocyst with the low-risk haplotype was chosen for transfering. After genetic counseling, a transferable blastocyst was frozen‑thawed and transferred into the uterus. At 18 weeks of gestation, amniotic fluid cells were obtained by amniocentesis for prenatal diagnosis to screen for chromosome aneuploidy and CNVs by CMA. Results CMA results and pathogenicity analysis The CMA results of two miscarriage tissues and the parents revealed a de novo 166 kb deletion on the long arm of chromosome X [arr[hg19] Xq13.1q13.2(71671944×1, 71674803_71840634×0,71841429×1)] involving two OMIM genes ( HDAC8 ex.1–9 and PHKA1 ex.19–32) and mapping to an intergenic region 47.7kb from HDAC8 5′UTR (Fig. 2 a). The sex chromosomes of two miscarriage tissues were both XY. According to the ClinGen Dosage Sensitivity, the HDAC8 gene has a HI score and a pLI score which is intolerant of loss of function (LoF) (HI = 3, pLI = 0.98). Loss of function due to haploinsufficiency of the HDAC8 gene can lead to CDLS and it has been well-documented. The CNVs were considered as “Pathogenic” according to ACMG and ClinGen Technical standards [ 12 ] (PMID:31690835). Real-time quantitative PCR verified the presence of this CNV in this family. The result of WGL-MPS on female peripheral blood was negative, excluding cryptic chromosomal abnormalities or mosaic state on female peripheral blood. ES results A trio-ES on the family was performed in the second pregnancy for genetic factors of fetal abnormal symptoms in addition to HDAC8 deletion. Exome sequencing has an average depth of 159.53× to 172.98×. The qualified reads were mapped to 99.89% ~ 99.97% of the human reference genome. The analysis showed no candidate SNV and InDel variants related to the phenotype of this family, but revealed the same de novo 156 kb hemizygous deletion of chromosome Xq13.1q13.2 [seq[GRCh37] del(X)(q13.1q13.2)chrX:g.71681820_71838708del] encompassing exons 1–9 of the HDAC8 gene and exons 21–32 of the PHKA1 gene in the second miscarriage sample (Fig. 2 b). Breakpoint PCR Using miscarriage gDNA and blood gDNA as templates, PCR amplification was performed with the primers listed in Table 1 . Gel electrophoresis results demonstrated that the amplification results with different primers aligned with the expected outcomes of the experimental design (Fig. 2 c). The F1R1 primer exhibited an amplification product length between 10k and 15k, surpassing the length range of Sanger sequencing, hence the purified amplification product nor insufficient miscarriage sample, was employed for nanopore sequencing. Nanopore sequencing The breakpoint position for the amplification product of the F1R1 primer was verified using the nanopore sequencing. After processing the raw data obtained post-sequencing, data suitable for genome alignment were generated. The results revealed that the breakpoint position was close to the chromosome and ES-reported positions, albeit with greater precision, down to the single-base level (Fig. 2 d). The precise location of the microdeletion in the miscarriage gDNA sample was identified as chrX:g.71666527–71838853. Digital PCR results The results from ddPCR demonstrated the presence of deletion-positive droplets in ovarian granulosa cells and follicular fluid samples (Fig. 4 , Table 3); the copy number concentration in a 22 µL system was 6.22 for granular cell samples, 0.31 for follicular fluid samples, and 0 for blood samples. The positive mutation ratio in ovarian granulosa cells was calculated as 6.22/(6.22 + 627.38) ≈ 0.98%. This indicates the detection of approximately 1% of the deletion segment in the female ovarian granulosa cells, confirming the presence of a germinal mosaic of deletion in the patient; no mosaicism was detected in the female peripheral blood. PGT cycle and Follow-up In this PGT cycle, six embryos were cultured into blastocysts after ICSI and successfully biopsied. Of the six embryos, two were female and four were male (Table 1 ). In the NGS-based PGT-A platform, we only reported CNVs larger than 10 Mb and 30–70% mosaicism (larger than 30 Mb). PGT-A indicated that four of the six embryos were euploids (E02, E03, E05, E06). Of the remaining two embryos, one was a mosaic embryo (E01) with a high percentage of mosaic aneuploidy (> 40%), and the other one (E04) was a carrier embryo with aneuploidy (45, XX, -22). In the haplotype diagram (Fig. 1 ), the blue bar represents the paternal normal haplotype, the dark orange bar represents the maternal low-risk haplotype, and the light orange bar with a diagonal stripe represents the maternal high-risk haplotype. Hence, it is clear that E04 is a high-risk female carrier. E01, E02, E03 and E05 are low-risk males, E06 is a low-risk female, respectively. Therefore, the transfer of E01 and E04 was not recommended, and genetic counseling was suggested prior to transplantation. Four unaffected euploid embryos with low-risk haplotype could be transferred in a subsequent frozen-thawed embryo transfer (FET) cycle. This family underwent the first FET cycle with E03 in April 2022 and achieved clinical pregnancy. An amniocentesis test was conducted and the result of prenatal diagnosis showed no chromosomal abnormalities. After 40 weeks of gestation, this family gave birth to a healthy live baby in February 2023. Discussion Cornelia de Lange syndrome (CdLS) is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. CdLS5 is a rare X-linked dominant hereditary disorder caused by the HDAC8 gene (Xq13.1) and accounts for 4% of CDLS cases [ 9 ] (PMID: 36011323). As a haploinsufficient gene, nonsense/missense variants and CNVs are the main reason of CdLS5. 13 deletion and 1 duplication of HDAC8 gene were reported [ 4 , 7 – 10 ] (PMID: 36011323;24403048;24403048; 30632303; 30293986; 32856424). In this study, we detected two male fetuses with the same deletions in 2 miscarriage tissues, and no deletion was found in maternal peripheral blood, suggesting the existence of maternal gonadal mosaicism. We successfully detected the CNV breakpoints with the miscarriage tissue by the long-range PCR and nanopore sequencing, ddPCR was employed to confirm the result and to determine the ratio of mosaicism of female gonad. Our findings highlight the clinical utility of quantitative assessment of maternal mosaicism with CNVs by identifying precise genomic breakpoints, as well as the analysis of DNA from ovarian granulosa cells and follicular fluid samples taken from women suspected of gonadal mosaicism during routine IVF procedures could be an effective material source to verify the presence of maternal gonadal mosaicism. Mosaicism refers to the presence of two or more cell lines with different genomic information in an individual, resulting from mutations during early embryonic development [ 13 ] (PMID:23594909). Germline mosaicism is the presence of both normal and mutated gametes as a result of gonosomal and gonadal mosaicism [ 13 ] (PMID:23594909). Patients with germline mosaicism are often phenotypically normal, but are at a great risk of repeatedly giving birth to affected children. The first affected child of a parent with germline mosaicism is often misdiagnosed as a case of a de novo mutation, as germline mosaicism is often not suspected until the birth of the second affected child. The recurrence risk depends on whether the mosaic mutation is present in the paternal or maternal germline and the proportion of germ cells carrying the mutation. To date, there have been only three patients about mosaicism for point mutations in HDAC8 [ 14 , 15 ] (PMID:31157197; 30921088) and one case of mosaic deletion [ 5 ] (PMID:29279609). Somatic mosaicism for a CNV disrupting HDAC8 resulting in a CdLS phenotype has been previously reported once [ 16 ] (PMID:26671848). This is the first report of gonadal mosaicism with a deletion involving the HDAC8 gene. All the family members showed none of the typical CdLS symptoms, only our proband had two miscarriages with the same deletion in the HDAC8 gene, indicating that the analysis on DNA from miscarriage tissues as a routine molecular genetic diagnosis of individuals suffering from recurrent miscarriage even without family history of genetic disease. Once germline mosaicism is suspected, considering the severity of the disease, the widely expressed manifestations, and the current lack of cost-effective treatment, proper family planning and prevention through prenatal diagnosis or PGT-M represents two alternative methods for at-risk couples to avoid the birth of affected fetus. As an early form of prenatal diagnosis and the primary prevention of birth defects, PGT-M can identify embryos with low-risk genetic mutations before pregnancy, thereby couples could be free of the mental anguish and physical pain suffering from the termination of affected fetus. However, the detection of smaller CNVs, such as the 170 kb deletion in this particular case, is challenging at the single-cell level due to the limited resolution of NGS-based PGT-A typically exceeding 5–10 Mb [ 17 ] (PMID:32653118). Since the emergence of the NGS which sequenced flanking genetic markers, such as SNPs with higher throughput and quicker than PCR of short tandem repeat (STR). NGS-based SNP analysis has been successfully used in PGT for haplotype linkage analysis of multiple monogenic diseases and matching of human leukocyte antigens. Therefore, the strategy of PGT for families with inherited CNVs < 1 Mb in our center currently is to identify at-risk chromosomes by the detection of SNPs in the 2 Mb regions upstream and downstream of the pathogenic CNVs and to screen for unaffected embryos without at-risk chromosomes. PGT-M for CNVs in a germline mosaic state mainly relies on haplotyping construction to distinguish high-risk haplotype, same as two pregnancies’ segment from low-risk haplotype consistent with the other maternal or paternal chromosome segment. This study is the first to report the strategy of PGT-M for germline mosaicisms of HDAC8 deletion. Usually, it is not recommended to transfer embryos with high-risk haplotype, without knowing if the CNVs really exists. However, this way might lead to the waste of potentially unaffected embryos. With the help of nanopore sequencing and ddPCR, it might be able to distinguish from high-risk embryos whether they actually carry the CNVs. In our study, our patients have only one embryo with high-risk haplotype, and we don’t text it for the reason of enough available embryos. But, for cases with a high proportion of gonadal mosaicism or for cases with a lot of high-risk embryos, this approach can help patients knowing the real available embryos and saving available embryos. The probability of recurrence is influenced by the proportion of gonadal mosaicism, which could be estimated by gonad sampling, such as semen and egg retrieval [ 18 ] (PMID:32643877). The risk and pain of egg retrieval surgery, the limited number of eggs and the precious value of follicle samples for women make it difficult to promote to clinical application than the semen sampling which is easy, convenient and without additional injury or mental pain for man. Therefore, there are little clinical reports of female gonadal mosaicism. In fact, for couples of suspected maternal gonadal mosaicism and needing IVF to help them conceive, as the largest cell group of the follicle, millions of granulosa cells from the outer layer of the oocyte as well as follicular fluid could be taken during the routine procedure of egg retrieval, which have the same genetic background to study. Our ovarian sampling method neither adds additional pain and expense to women, nor increases the failure rate of embryo culture. It provides a good basis for successful proof of gonadal mosaicism innovatively in our study, and will be applied to validate if suspected maternal gonadal mosaicism exists. In summary, a few key insights gained from this case are as follows. Firstly, in cases where couples seek consultation regarding potential germline mosaicism, if there is only one affected child in the family and both partners exhibit no variations in peripheral blood, consideration should initially lean towards the child having a de novo mutation. This can be managed through natural conception along with prenatal diagnosis as a reproductive strategy. However, if there are recurring instances of the same gene variation in children with de novo mutations within the family, or in fetuses, suspicion should be heightened for the possibility of germline mosaicism. Options then include natural conception with prenatal diagnosis or employing PGT-M in conjunction with prenatal diagnosis to prevent such occurrences [ 19 ] (37162432). Secondly, when suspecting the presence of germline mosaicism, efforts should be made to confirm the diagnosis at a technical level. However, given the challenges posed by sample specificity and testing complexities, it is generally not mandatory to do so in accordance with the collective experiences of multiple centers. For families keen on further confirmation, due to limitations in obtaining and testing maternal germ cells, priority can be given to testing the presence of mosaicism in sperm. If there is no mosaicism found in the sperm, attention can be directed towards preserving granulosa cells, follicular fluid, or other potential sample alternatives during ovum retrieval from the female partner undergoing ovarian stimulation for future testing requirements. Thirdly, families with suspicions of germline mosaicism and intentions to opt for reproduction through PGT-M should undergo comprehensive genetic counseling. This should involve full disclosure of various possibilities, such as the clinical complexities and costs associated with diagnosing germline mosaicism, comparisons between PGT-M and natural conception with prenatal diagnosis, issues regarding embryo utilization rates, as well as the economic and emotional investments required from the patient's family. However, this research has limitations, as a lack of samples from the skin and buccal mucosa to validate if somatic CNVs exist, our testing was only performed with the parents’ peripheral blood and female ovarian granulosa cells, so the results may not accurately reflect the mutation of other tissues. Therefore, it also reminds us of the importance of retaining a sufficient number and variety of samples when encountering suspected cases of gonadal mosaicism. Our data demonstrate the effectiveness of PGT-M based on haplotype linkage analysis for CNVs < 1 Mb even in a gonadal mosaic state, and the importance of parental testing in CDLS5 families and reproductive usefulness of IVF with PGT in families with low-level parental gonadal mosaicism. With the use of a variety of techniques, including NGS-based sequencing, array comparative genomic hybridization, nanopore sequencing, and ddPCR to define exact mutation, we show how to face and solve some uncommon genetic mechanisms in the diagnosis of microdeletions in gonadal mosaicism. Declarations Ethic statement Genetic counseling sessions were provided to the family prior to any interventions, and informed consent was obtained. All procedures and protocols undertaken in this study were approved by the Medical Ethics Committee of Nanjing Women and Children's Healthcare Hospital. Conflict of interest The authors declare no conflict of interest. Funding This study was supported by the National Key R&D Program of China (No. 2022YFC2703400) and the Jiangsu Province Capability Improvement Project through Science, Technology and Education Jiangsu Provincial Medical Key Discipline (No. ZDXK202211). Author Contribution LM, YW, JZ, PH and ZX designed the treatment plan and the study protocol. RZ, FQ, JZ, QZ and XL were involved in the treatment process and were responsible for collecting clinical data. XW, CW and SJ designed and conducted the nanopore sequencing and digital PCR experiments. LM, YW, XW and CW prepared the initial draft of the manuscript. PH and ZX critically revised the manuscript for important intellectual content. Acknowledgement We would like to express our deepest gratitude to the family who participated in this study, for their courage and willingness to share their experiences. We are also grateful for the compassionate care provided by our genetic counseling and nursing team. References Kline AD, Moss JF, Selicorni A, et al. Diagnosis and management of Cornelia de Lange syndrome: first international consensus statement [J]. Nat Rev Genet, 2018, 19(10): 649–666. DOI: 10.1038/s41576-018-0031-0 . Deardorff MA, Noon SE, Krantz ID. Cornelia de Lange Syndrome. In: GeneReviews(®). edn. Edited by Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE, Amemiya A; 1993. Avagliano L, Bulfamante GP, Massa V. Cornelia de Lange syndrome: To diagnose or not to diagnose in utero? [J]. Birth Defects Res, 2017, 109(10): 771–777. DOI: 10.1002/bdr2.1045 . Lucia-Campos C, Valenzuela I, Latorre-Pellicer A, et al. A Novel Intragenic Duplication in the HDAC8 Gene Underlying a Case of Cornelia de Lange Syndrome [J]. Genes (Basel), 2022, 13(8). DOI: 10.3390/genes13081413 . Helgeson M, Keller-Ramey J, Knight Johnson A, et al. Molecular characterization of HDAC8 deletions in individuals with atypical Cornelia de Lange syndrome [J]. J Hum Genet, 2018, 63(3): 349–356. DOI: 10.1038/s10038-017-0387-6 . Kaur M, Blair J, Devkota B, et al. Genomic analyses in Cornelia de Lange Syndrome and related diagnoses: Novel candidate genes, genotype-phenotype correlations and common mechanisms [J]. Am J Med Genet A, 2023, 191(8): 2113–2131. DOI: 10.1002/ajmg.a.63247 . Kaiser FJ, Ansari M, Braunholz D, et al. Loss-of-function HDAC8 mutations cause a phenotypic spectrum of Cornelia de Lange syndrome-like features, ocular hypertelorism, large fontanelle and X-linked inheritance [J]. Hum Mol Genet, 2014, 23(11): 2888–2900. DOI: 10.1093/hmg/ddu002 . Salehi Karlslätt K, Pettersson M, Jäntti N, et al. Rare copy number variants contribute pathogenic alleles in patients with intestinal malrotation [J]. Mol Genet Genomic Med, 2019, 7(3): e549. DOI: 10.1002/mgg3.549 . Gross AM, Ajay SS, Rajan V, et al. Copy-number variants in clinical genome sequencing: deployment and interpretation for rare and undiagnosed disease [J]. Genet Med, 2019, 21(5): 1121–1130. DOI: 10.1038/s41436-018-0295-y . Liu C, Li X, Cui J, et al. Analysis of clinical and genetic characteristics in 10 Chinese individuals with Cornelia de Lange syndrome and literature review [J]. Mol Genet Genomic Med, 2020, 8(10): e1471. DOI: 10.1002/mgg3.1471 . Wu H, Shen X, Huang L, et al. Genotyping single-sperm cells by universal MARSALA enables the acquisition of linkage information for combined pre-implantation genetic diagnosis and genome screening [J]. J Assist Reprod Genet, 2018, 35(6): 1071–1078. DOI: 10.1007/s10815-018-1158-9 . Riggs ER, Andersen EF, Cherry AM, et al. Technical standards for the interpretation and reporting of constitutional copy-number variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics (ACMG) and the Clinical Genome Resource (ClinGen) [J]. Genet Med, 2020, 22(2): 245–257. DOI: 10.1038/s41436-019-0686-8 . Biesecker LG, Spinner NB. A genomic view of mosaicism and human disease [J]. Nat Rev Genet, 2013, 14(5): 307–320. DOI: 10.1038/nrg3424 . Krawczynska N, Wierzba J, Wasag B. Genetic Mosaicism in a Group of Patients With Cornelia de Lange Syndrome [J]. Front Pediatr, 2019, 7: 203. DOI: 10.3389/fped.2019.00203 . Jezela-Stanek A, Murcia PV, Jurkiewicz D, et al. Novel variant in HDAC8 gene resulting in the severe Cornelia de Lange phenotype [J]. Clin Dysmorphol, 2019, 28(3): 126–130. DOI: 10.1097/mcd.0000000000000277 . Parenti I, Gervasini C, Pozojevic J, et al. Expanding the clinical spectrum of the 'HDAC8-phenotype' - implications for molecular diagnostics, counseling and risk prediction [J]. Clin Genet, 2016, 89(5): 564–573. DOI: 10.1111/cge.12717 . Chen HF, Chen M, Ho HN. An overview of the current and emerging platforms for preimplantation genetic testing for aneuploidies (PGT-A) in in vitro fertilization programs [J]. Taiwan J Obstet Gynecol, 2020, 59(4): 489–495. DOI: 10.1016/j.tjog.2020.05.004 . Dai C, Cheng D, Li W, et al. Identification of paternal germline mosaicism by MicroSeq and targeted next-generation sequencing [J]. Mol Genet Genomic Med, 2020, 8(9): e1394. DOI: 10.1002/mgg3.1394 . Indications and management of preimplantation genetic testing for monogenic conditions: a committee opinion [J]. Fertil Steril, 2023, 120(1): 61–71. DOI: 10.1016/j.fertnstert.2023.03.003 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5668001","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":391843977,"identity":"ccefdc79-84af-44bd-95a7-cdbd13fa3842","order_by":0,"name":"Lulu Meng","email":"","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lulu","middleName":"","lastName":"Meng","suffix":""},{"id":391843978,"identity":"38e25e18-1d31-47cf-b489-8ac248a9f91e","order_by":1,"name":"Yan Wang","email":"","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Wang","suffix":""},{"id":391843980,"identity":"2e6ae74d-74e9-4e2c-aca7-651f08bcf6b9","order_by":2,"name":"Ran Zhou","email":"","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ran","middleName":"","lastName":"Zhou","suffix":""},{"id":391843981,"identity":"2c8db18b-b1ac-4c88-9b6f-b992850b3321","order_by":3,"name":"Xingxing Wang","email":"","orcid":"","institution":"Yikon Genomics Co. Ltd","correspondingAuthor":false,"prefix":"","firstName":"Xingxing","middleName":"","lastName":"Wang","suffix":""},{"id":391843982,"identity":"9cd1f209-b299-4f63-8118-789a7cd1f191","order_by":4,"name":"Fengchang Qiao","email":"","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Fengchang","middleName":"","lastName":"Qiao","suffix":""},{"id":391843983,"identity":"f1b07386-21cd-4cb5-bdb0-909eba0915b2","order_by":5,"name":"Cheng Wan","email":"","orcid":"","institution":"Yikon Genomics Co. Ltd","correspondingAuthor":false,"prefix":"","firstName":"Cheng","middleName":"","lastName":"Wan","suffix":""},{"id":391843985,"identity":"0e8f3a65-762e-4fef-ac89-1ca4f305b185","order_by":6,"name":"Shujing Jiao","email":"","orcid":"","institution":"Yikon Genomics Co. Ltd","correspondingAuthor":false,"prefix":"","firstName":"Shujing","middleName":"","lastName":"Jiao","suffix":""},{"id":391843986,"identity":"b68c4872-a619-4ed2-92b4-835e3cc5e093","order_by":7,"name":"Junqiang Zhang","email":"","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Junqiang","middleName":"","lastName":"Zhang","suffix":""},{"id":391843989,"identity":"fdca2850-eaa2-4d54-8fd3-79f6dc17328b","order_by":8,"name":"Ping Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYFCCgw+YGXgYEhgYGBsYGCok5OQJazlsgKTljIWxYQNBLcxALQwgLUDA2FaRyHCAgAZzxsNs0gUyh/MMbje3Pfw6TyKBsYH54aMbeLRYNgC1zOA5XGxw52C7sew2iTx2BjZj4xw8WgwOnD8mzcNzOHHDjcQ2acltEsWMDTxs0vi1AG1BaJkjkdhwgBQtkh8biNPCbD2DJz1x5p2DbdIMxySMDZsJ+eXGYcbbhT3WiX23259J/qipk5Nnb374GJ8WBokDLBKMPc1ABjCKeEAizPiUgwB/A/MHhh91YC2MPwipHgWjYBSMghEJAOZaUwQamACRAAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":true,"prefix":"","firstName":"Ping","middleName":"","lastName":"Hu","suffix":""},{"id":391843990,"identity":"7bbc9d69-070b-45af-9464-db5ec1ba4e5f","order_by":9,"name":"Zhengfeng Xu","email":"","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhengfeng","middleName":"","lastName":"Xu","suffix":""},{"id":391843991,"identity":"aa91699e-e2df-4596-95d3-df9493409ed4","order_by":10,"name":"Qinxin Zhang","email":"","orcid":"","institution":"Nanjing Women and Children's Healthcare Hospital, Women's Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qinxin","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-12-18 09:23:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5668001/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5668001/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":72284837,"identity":"110c0065-ea49-44d2-925b-83138e92d274","added_by":"auto","created_at":"2024-12-24 16:49:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":82107,"visible":true,"origin":"","legend":"\u003cp\u003eHistory and medical intervention for the patient with gonadal mosaicism of microdeletion at Xq13.1q13.2.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5668001/v1/7d351e5cc73bbb70c81f841b.png"},{"id":72284843,"identity":"cf97bbc0-916f-4853-8537-32887a1fc192","added_by":"auto","created_at":"2024-12-24 16:49:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":299388,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of the microdeletion del(X)(q13.1q13.2) in miscarriage tissue samples. (a) CMA result for the 1st miscarriage. (b) ES result for the 2nd miscarriage. (c) Agarose gel electrophoresis for the long-range PCR product. M: DL15000 DNA marker, lane 1: PCR product from the miscarriage tissue gDNA, lane 2: PCR product (negative) from the female patient’s blood gDNA; lane 3: Blank control. (d) Nanopore sequencing result for the long-range PCR product, visualized by IGV version 2.9.4.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5668001/v1/ddd7e1a48911923356fc9d9c.png"},{"id":72286059,"identity":"af4022d3-c6a9-4984-a68b-2f062161cd4b","added_by":"auto","created_at":"2024-12-24 16:57:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":156882,"visible":true,"origin":"","legend":"\u003cp\u003eDigital PCR results for the female patient’s samples.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5668001/v1/2ff27c36af98ef40cd947778.png"},{"id":72284844,"identity":"af8ab208-157f-4b43-8bf4-d8191c77ebdf","added_by":"auto","created_at":"2024-12-24 16:49:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":330962,"visible":true,"origin":"","legend":"\u003cp\u003eSNP-based haplotype linkage analysis of the \u003cem\u003eHDAC8\u003c/em\u003emicrodeletion. The Figure displays only part of the SNP results. RS IDs with blue and yellow represent upstream and downstream SNPs of the microdeletion, respectively. M0: maternal high-risk chromosome X. M1: maternal low-risk chromosome X. F1: paternal normal chromosome X. √: transferable embryo. × : untransferable embryo\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5668001/v1/2d8b315ba812799250f1cd29.png"},{"id":72809334,"identity":"953cf08e-118f-46ef-891c-a2d1f2ba7feb","added_by":"auto","created_at":"2025-01-02 11:02:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1377812,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5668001/v1/8da7b659-872d-49b5-9ea3-98ceee13036b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Preimplantation Genetic Testing for Cornelia de Lange Syndrome with Low-Level Maternal Gonadal Mosaicism using nanopore sequencing and digital PCR","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCornelia de Lange syndrome (CdLS; MIM #122470, 300590, 610759, 300882, 614701) is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems with an estimated incidence between 1:10,000 and 1:30,000 live births \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e(PMID: 29995837); however, the actual incidence is far more than that as some mild cases with atypical symptoms are not clinically diagnosed. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, intrauterine and postnatal growth retardation, and severe intellectual disability with a mean IQ of 53 \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e(PMID: 20301283). Only 23% of CdLS cases showing manifestations such as fetal skin edema, NT thickening, heart defects could be detected prenatally\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e(PMID: 28544538), which is consistent with the second pregnancy of our family.\u003c/p\u003e \u003cp\u003eCornelia de Lange syndrome 5 (CDLS5, MIM\u003cb\u003e#\u003c/b\u003e 300882) is a rare X-linked dominant hereditary disorder caused by histone deacetylase 8 (\u003cem\u003eHD\u003c/em\u003eCA8, MIM *300269) located on chromosome Xq13.1, which accounts for the 4% of CDLS cases \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e(PMID: 36011323). \u003cem\u003eHDAC8\u003c/em\u003e encodes a vertebrate SMC3 deacetylase that has roles in catalyzing the deacetylation of SMC3 as well as in efficiently recycling the cohesin. The lack of \u003cem\u003eHDAC8\u003c/em\u003e activity favors the accumulation of acetylated cohesin with reduced affinity to chromatids, subsequently leading to abnormal transcription \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e(PMID: 29279609). Variations in the \u003cem\u003eHDAC8\u003c/em\u003e phenotype are remarkably nonclassical and wide, but distinctive features of affected individuals in addition to typical CdLS features include a large anterior fontanel, a broad or bulbous nasal tip, tooth anomalies, mosaic patches of hyperpigmented skin, orbital hypertelorism, and happy personalities \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e (PMID: 29995837). Male individuals were more severely affected than females, while females showed variable clinical symptoms influenced by X inactivation patterns \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e (PMID: 37377026).\u003c/p\u003e \u003cp\u003eAbout 100 mutations in the \u003cem\u003eHDAC8\u003c/em\u003e gene have been reported (Human Gene Mutation Database: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.hgmd.org\u003c/span\u003e\u003cspan address=\"http://www.hgmd.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The majority of known disease-causing mutations in \u003cem\u003eHDAC8\u003c/em\u003e are nonsense, missense, splice site variants or CNVs, and predicted to disrupt \u003cem\u003eHDAC8\u003c/em\u003e function, and most of them were shown to be de novo \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e(PMID: 36011323;24403048).To date, there have been few reports of \u003cem\u003eHDAC8\u003c/em\u003e microdeletions. Several cases of CNVs involving larger regions of \u003cem\u003eHDAC8\u003c/em\u003e have been reported in individuals with CdLS5, especially intragenic deletions ranging from single to multiple exons. Exons 1, 1\u0026ndash;4, 1\u0026ndash;9, 3\u0026ndash;4, 5\u0026ndash;6, 5\u0026ndash;7, 5\u0026ndash;10, 7, 8-11and 11 are absent from the \u003cem\u003eHDAC8\u003c/em\u003e gene in 13 individuals with CdLS \u003csup\u003e[\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e(24403048; 30632303; 30293986; 32856424). This is the first report of \u003cem\u003eHDAC8\u003c/em\u003e gene deletion leading to male embryo abortion, suggesting that the deletion of exon 1\u0026ndash;9 of \u003cem\u003eHDAC8\u003c/em\u003e gene has a serious male lethal effect.\u003c/p\u003e \u003cp\u003eIn this case, we reported a family with two male miscarriage tissues carrying the same de novo microdeletion at Xq13.1q13.2 disrupting \u003cem\u003eHDAC8\u003c/em\u003e Gene, thus we suspected the woman was a carrier in the form of gonadal mosaicism. Long-range PCR and nanopore sequencing were performed to definite specific breakpoint positions. ddPCR was utilized to verify the existence and proportion of germline mosaicism on Ovarian samples obtained from IVF procedures, such as granulosa cells and follicular fluid. Our results show that the extended PGT-M based on the haplotype linkage analysis strategy could be applied to families with small pathogenic CNVs.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatients\u003c/h2\u003e \u003cp\u003eThe female patient experienced a miscarriage at 12\u0026thinsp;+\u0026thinsp;2 weeks at the age of 27. The chromosomal microarray (CMA) results of the miscarriage tissue and parental blood revealed a de novo pathogenic deletion at Xq13.1q13.2, disrupting the haploinsufficient gene \u003cem\u003eHDAC8\u003c/em\u003e. Despite the parents being clinically unaffected and showing no symptoms associated with CDLS5, they sought genetic counseling at the Department of Prenatal Diagnosis of Nanjing Women and Children's Healthcare Hospital in Jiangsu, China. Subsequently, they opted for natural conception due to the perceived low incidence of germline mosaicism.\u003c/p\u003e \u003cp\u003eDuring the second pregnancy, the fetus exhibited thickening of the nuchal translucency (NT 6.9mm), congenital heart disease, and fetal edema, especially in the head and trunk at 13\u0026thinsp;+\u0026thinsp;1 weeks, the fetus was identified as carrying the same Xq13.1q13.2 deletion with CMA and Trio-ES. Following genetic counseling and considering the previous two unsuccessful pregnancies and male asthenospermia, the couple decided to pursue assisted reproductive technology (ART) at the Department of Reproductive Medicine. The history and medical process for this patient is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Genetic counseling sessions were provided to the family prior to any interventions, and informed consent was obtained. All procedures and protocols undertaken in this study were approved by the Medical Ethics Committee of Nanjing Women and Children's Healthcare Hospital.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGenomic DNA sample preparation\u003c/h3\u003e\n\u003cp\u003eGenomic DNA (gDNA) from miscarriage tissue and peripheral blood samples was extracted using the whole blood genomic DNA extraction kit (magnetic bead method) (M121; Maibo, China); Genomic DNA from 20-mL amniotic fluid samples was extracted using a QIAamp DNA Mini Kit (51306, Qiagen, Germany). cfDNA extracted from follicular fluid samples using the plasma cell-free DNA extraction kit (magnetic bead method) (M111; Maibo, China).\u003c/p\u003e\n\u003ch3\u003eChromosomal microarray analysis\u003c/h3\u003e\n\u003cp\u003eThe Affymetrix CytoScan 750K array (901859, Affymetrix, USA), containing about 550,000 oligonucleotide probes and 200,000 single nucleotide polymorphism (SNP) probes, was performed for the whole-genome scan and CNVs were called at a minimal resolution of 50 kb. The 750K array experiments have been described in detail as previously reported. Cytogenetic analysis was performed using Chromosome Analysis Suite Software (Affymetrix, CA) and CNVs coordinates were determined according to the human genome GRCh37/hg19 assembly. The clinical significance of the detected CNVs was evaluated based on the guidelines of the American College of Medical Genetics and Genomics(ACMG) and the Clinical Genome Resource (ClinGen).\u003c/p\u003e\n\u003ch3\u003eWhole genome low-coverage mate-pair sequencing (WGL-MPS)\u003c/h3\u003e\n\u003cp\u003eTo investigate cryptic chromosomal abnormalities or mosaic state, WGL-MPS was performed. gDNA of the female was used to construct a non-size selected mate-pair library and then subjected to 50-bp-end multiplex sequencing by BGISeq-500. After removing reads containing sequencing adapters and low-quality reads, the high-quality pair-end reads were aligned to the NCBI human reference genome (hg19, GRCh37.1) using SOAP2. Only uniquely mapped reads were remained for the subsequent analysis as previously described.\u003c/p\u003e\n\u003ch3\u003eWhole Exome sequencing\u003c/h3\u003e\n\u003cp\u003eWhole exome sequencing was performed in familial trios. The Agilent SureSelect XT Library Prep Kit and the Agilent SureSelect XT Human All Exon V6 kit (Agilent, Santa Clara, CA, USA) were used to prepare a fragment library and capture gene exons according to the manufacturer\u0026rsquo;s protocols. The captured regions were enriched by PCR amplification and sequenced on an Illumina Hiseq 2500 platform with a read length of 150 bp. The resultant reads were mapped against GRCh37/hg19 assembly, then analysis were performed as reported previously.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePCR amplification and detection of deletion\u003c/h2\u003e \u003cp\u003ePrimer validation strategy designed from the \u003cem\u003eHDAC8\u003c/em\u003e reference sequence (NM_018486.2) at the breakpoints based on miscarriage WES and CMA results, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; Long-PCR method was utilized for amplifying the deleted fragment, where the fragment length governs the detection approach. Primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., with detailed sequences listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A 25 \u0026micro;L PCR reaction mix was prepared using LongAmp\u0026reg; Taq 2X premix (M0287, NEB, USA). The reaction conditions were as follows: 94\u0026deg;C for 1 min; 94\u0026deg;C for 30 s, 62\u0026deg;C for 30 s, 65\u0026deg;C for 10 min, repeated for 30 cycles. PCR products were electrophoresed on a 0.8% agarose gel at 110 V for 50 min; visualized and captured using a gel imaging system. The appearance of expected specific bands indicates successful amplification.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR primer information for the detection of microdeletion.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;--3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDescription\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTGGGACATTGCTTCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward primer for wide type amplicon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGTAGTTCCACCCCCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer for wide type amplicon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDel-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATGCTAAATGACGAGTTAATGAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward primer for mutant type amplicon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDel-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAGTTCACTTTTACATTGGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer for mutant type amplicon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eThird-generation sequencing and analysis of breakpoint\u003c/h3\u003e\n\u003cp\u003eFollowing the purification of long-range PCR products, a third-generation sequencing library was constructed using the sequencing adapter kit (SQK-LSK110, Oxford Nanopore Technologies, UK). The key steps involved utilizing the Ultra II End Prep module (NEB, E7546, USA) for DNA end repair and dA tailing, followed by connecting motor protein-tailed adapters using the Quick Ligation Module (NEB, E6056, USA). The purified product represents the third-generation sequencing library. Sequencing was performed using the Oxford Nanopore MinION sequencer. The sequenced fastq files were aligned with GRCh37/hg19 using minimap2 software with default parameters, and the breakpoint positions were validated using the Interactive Genomics Viewer software.\u003c/p\u003e\n\u003ch3\u003eDigital PCR\u003c/h3\u003e\n\u003cp\u003eBased on the specific breakpoint positions obtained from ONT third-generation sequencing, primers and probes for ddPCR were designed, with sequence details provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Following the instructions outlined in the 2\u0026times;HQ ddPCR Master Mix for Probe kit (Sniper Co., Ltd. Suzhou, China), the reaction mix consisted of 11 \u0026micro;L of 2\u0026times;HQ ddPCR Master Mix for Probe, 1 \u0026micro;L each of 10 \u0026micro;mol\u0026middot;L upstream and downstream primers, 0.5 \u0026micro;L of 10 \u0026micro;mol\u0026middot;L probe, and 1\u0026ndash;5 \u0026micro;L of DNA template. The ddPCR was performed with the DQ24 Digital PCR System (Sniper Co., Ltd. Suzhou, China). The amplification program included reverse transcription at 65\u0026deg;C for 5 minutes, enzyme activation at 95\u0026deg;C for 15 minutes, denaturation at 95\u0026deg;C for 20 seconds, and annealing at 60\u0026deg;C for 30 seconds for 40 cycles. Following amplification, microdroplet data was read using a droplet reader. Analysis was conducted to detect deletion ratios, with miscarriage samples serving as positive controls and buffer solution as negative controls.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary of the PGT results for the patient\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEmbryo ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGrade\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePGT-A results\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHaplotyping results/ Carrier status\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6BB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46, XY, +5q(q11.2\u0026rarr;q23.2,~74Mb,\u0026times;3,mos,~36%), +5q(q23.3\u0026rarr;q35.2,~46Mb,\u0026times;3,mos,~45%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5BB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46, XY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4BB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46, XY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4BB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45, XX, -22(\u0026times;1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCarrier, high-risk\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4BC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46, XY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4BC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46, XX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eART procedure\u003c/h2\u003e \u003cp\u003eThe couple conducted in vitro fertilization (IVF) at the Department of Reproductive Medicine. Controlled ovulation, oocytes retrieval, intracytoplasmic sperm injection (ICSI), embryo culture, trophectoderm biopsy, and cryopreservation by vitrification of the blastocysts were conducted following the standard protocol. In this IVF cycle, 6 embryos were cultured to the blastocyst stage, and a total of 3\u0026ndash;10 trophectoderm (TE) cells at the blastocyst stage were biopsied on day 5 or 6 and prepared for the next whole-genome amplification (WGA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWhole genome amplification\u003c/h2\u003e \u003cp\u003eWhole genome amplification (WGA) of the lysed TE cells was performed using the multiple annealing and looping-based amplification cycles (MALBAC). This procedure can amplify the genomic DNA from the picogram level to the nanogram one for the chip experiment. We transferred TE cells to 0.2 \u0026micro;l PCR tubes that contained 4.5 \u0026micro;l of lysis buffer (XK-002, Yikon Genomics, China). The WGA of each embryo biopsy sample was performed using a MALBAC WGA kit (XK-028-24, Yikon Genomics, China), following the manufacturer\u0026rsquo;s standard protocols. The collected cells were initially lysed in a lysis buffer, followed by MALBAC pre-amplification and exponential amplification, to obtain 2\u0026ndash;5 \u0026micro;g of DNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eNext-generation sequencing, CNV analysis, and SNP haplotype linkage analysis\u003c/h2\u003e \u003cp\u003ePurified WGA products and gDNA were used for SNP and CNV library preparation by an NGS library preparation kit (XK-038, Yikon Genomics, China). All operations followed the manufacturers\u0026rsquo; instructions. We employed paired-end sequencing with a read length of 150 base pairs using the MGI T7 platform. The raw data were automatically filtered and analyzed by ChromGo software (Yikon Genomics, China). Chromosomal aneuploidies and genome-wide SNPs were detected simultaneously by using the approach of mutated allele revealed by sequencing with aneuploidy and linkage analyses (MARSALA) \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Embryos showed\u0026thinsp;\u0026gt;\u0026thinsp;30% mosaic rate would be indicated as mosaic aneuploidy and not fit for transfer. Valid reads of more than 1 Mb and CV\u0026thinsp;\u0026lt;\u0026thinsp;0.1 (1,000 K bin size) were considered to be within the acceptable range for CNV detection. According to the ESHRE PGT Consortium good practice recommendations for detecting monogenic disorders, informative SNPs were selected and performed for the haplotyping. High-frequency SNPs in the 2 Mb regions upstream and downstream of the pathogenic CNV and within the CNV at Xq13.1q13.2 were screened as genetic markers to construct the haplotype by defining the one X chromosome segment consistent with the fetal X chromosome segment as a \u0026ldquo;high-risk\u0026rdquo; haplotype, and the one inconsistent with the fetal chromosome segment but consistent with the other maternal chromosome segment as a \u0026ldquo;low-risk\u0026rdquo; haplotype.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEmbryo transfer and prenatal diagnosis\u003c/h2\u003e \u003cp\u003eThe priority of embryo transfer was based on the results of PGT-M for SNP haplotype linkage analysis, PGT-A for aneuploidy/CNV analysis, and morphological scores according to the Istanbul consensus. One euploid blastocyst with the low-risk haplotype was chosen for transfering. After genetic counseling, a transferable blastocyst was frozen‑thawed and transferred into the uterus. At 18 weeks of gestation, amniotic fluid cells were obtained by amniocentesis for prenatal diagnosis to screen for chromosome aneuploidy and CNVs by CMA.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCMA results and pathogenicity analysis\u003c/h2\u003e \u003cp\u003eThe CMA results of two miscarriage tissues and the parents revealed a de novo 166 kb deletion on the long arm of chromosome X [arr[hg19] Xq13.1q13.2(71671944\u0026times;1, 71674803_71840634\u0026times;0,71841429\u0026times;1)] involving two OMIM genes (\u003cem\u003eHDAC8\u003c/em\u003e ex.1\u0026ndash;9 and \u003cem\u003ePHKA1\u003c/em\u003e ex.19\u0026ndash;32) and mapping to an intergenic region 47.7kb from \u003cem\u003eHDAC8\u003c/em\u003e 5\u0026prime;UTR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The sex chromosomes of two miscarriage tissues were both XY. According to the ClinGen Dosage Sensitivity, the \u003cem\u003eHDAC8\u003c/em\u003e gene has a HI score and a pLI score which is intolerant of loss of function (LoF) (HI\u0026thinsp;=\u0026thinsp;3, pLI\u0026thinsp;=\u0026thinsp;0.98). Loss of function due to haploinsufficiency of the \u003cem\u003eHDAC8\u003c/em\u003e gene can lead to CDLS and it has been well-documented. The CNVs were considered as \u0026ldquo;Pathogenic\u0026rdquo; according to ACMG and ClinGen Technical standards \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e(PMID:31690835). Real-time quantitative PCR verified the presence of this CNV in this family. The result of WGL-MPS on female peripheral blood was negative, excluding cryptic chromosomal abnormalities or mosaic state on female peripheral blood.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eES results\u003c/h2\u003e \u003cp\u003eA trio-ES on the family was performed in the second pregnancy for genetic factors of fetal abnormal symptoms in addition to \u003cem\u003eHDAC8\u003c/em\u003e deletion. Exome sequencing has an average depth of 159.53\u0026times; to 172.98\u0026times;. The qualified reads were mapped to 99.89% ~ 99.97% of the human reference genome. The analysis showed no candidate SNV and InDel variants related to the phenotype of this family, but revealed the same \u003cem\u003ede novo\u003c/em\u003e 156 kb hemizygous deletion of chromosome Xq13.1q13.2 [seq[GRCh37] del(X)(q13.1q13.2)chrX:g.71681820_71838708del] encompassing exons 1\u0026ndash;9 of the \u003cem\u003eHDAC8\u003c/em\u003e gene and exons \u003cem\u003e21\u0026ndash;32\u003c/em\u003e of the \u003cem\u003ePHKA1\u003c/em\u003e gene in the second miscarriage sample (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eBreakpoint PCR\u003c/h2\u003e \u003cp\u003eUsing miscarriage gDNA and blood gDNA as templates, PCR amplification was performed with the primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Gel electrophoresis results demonstrated that the amplification results with different primers aligned with the expected outcomes of the experimental design (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). The F1R1 primer exhibited an amplification product length between 10k and 15k, surpassing the length range of Sanger sequencing, hence the purified amplification product nor insufficient miscarriage sample, was employed for nanopore sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eNanopore sequencing\u003c/h2\u003e \u003cp\u003eThe breakpoint position for the amplification product of the F1R1 primer was verified using the nanopore sequencing. After processing the raw data obtained post-sequencing, data suitable for genome alignment were generated. The results revealed that the breakpoint position was close to the chromosome and ES-reported positions, albeit with greater precision, down to the single-base level (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). The precise location of the microdeletion in the miscarriage gDNA sample was identified as chrX:g.71666527\u0026ndash;71838853.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eDigital PCR results\u003c/h2\u003e \u003cp\u003eThe results from ddPCR demonstrated the presence of deletion-positive droplets in ovarian granulosa cells and follicular fluid samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Table\u0026nbsp;3); the copy number concentration in a 22 \u0026micro;L system was 6.22 for granular cell samples, 0.31 for follicular fluid samples, and 0 for blood samples. The positive mutation ratio in ovarian granulosa cells was calculated as 6.22/(6.22\u0026thinsp;+\u0026thinsp;627.38)\u0026thinsp;\u0026asymp;\u0026thinsp;0.98%. This indicates the detection of approximately 1% of the deletion segment in the female ovarian granulosa cells, confirming the presence of a germinal mosaic of deletion in the patient; no mosaicism was detected in the female peripheral blood.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003ePGT cycle and Follow-up\u003c/h2\u003e \u003cp\u003eIn this PGT cycle, six embryos were cultured into blastocysts after ICSI and successfully biopsied. Of the six embryos, two were female and four were male (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In the NGS-based PGT-A platform, we only reported CNVs larger than 10 Mb and 30\u0026ndash;70% mosaicism (larger than 30 Mb). PGT-A indicated that four of the six embryos were euploids (E02, E03, E05, E06). Of the remaining two embryos, one was a mosaic embryo (E01) with a high percentage of mosaic aneuploidy (\u0026gt;\u0026thinsp;40%), and the other one (E04) was a carrier embryo with aneuploidy (45, XX, -22).\u003c/p\u003e \u003cp\u003eIn the haplotype diagram (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), the blue bar represents the paternal normal haplotype, the dark orange bar represents the maternal low-risk haplotype, and the light orange bar with a diagonal stripe represents the maternal high-risk haplotype. Hence, it is clear that E04 is a high-risk female carrier. E01, E02, E03 and E05 are low-risk males, E06 is a low-risk female, respectively. Therefore, the transfer of E01 and E04 was not recommended, and genetic counseling was suggested prior to transplantation. Four unaffected euploid embryos with low-risk haplotype could be transferred in a subsequent frozen-thawed embryo transfer (FET) cycle. This family underwent the first FET cycle with E03 in April 2022 and achieved clinical pregnancy. An amniocentesis test was conducted and the result of prenatal diagnosis showed no chromosomal abnormalities. After 40 weeks of gestation, this family gave birth to a healthy live baby in February 2023.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eCornelia de Lange syndrome (CdLS) is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. CdLS5 is a rare X-linked dominant hereditary disorder caused by the \u003cem\u003eHDAC8\u003c/em\u003e gene (Xq13.1) and accounts for 4% of CDLS cases \u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e(PMID: 36011323). As a haploinsufficient gene, nonsense/missense variants and CNVs are the main reason of CdLS5. 13 deletion and 1 duplication of \u003cem\u003eHDAC8\u003c/em\u003e gene were reported \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e(PMID: 36011323;24403048;24403048; 30632303; 30293986; 32856424). In this study, we detected two male fetuses with the same deletions in 2 miscarriage tissues, and no deletion was found in maternal peripheral blood, suggesting the existence of maternal gonadal mosaicism. We successfully detected the CNV breakpoints with the miscarriage tissue by the long-range PCR and nanopore sequencing, ddPCR was employed to confirm the result and to determine the ratio of mosaicism of female gonad. Our findings highlight the clinical utility of quantitative assessment of maternal mosaicism with CNVs by identifying precise genomic breakpoints, as well as the analysis of DNA from ovarian granulosa cells and follicular fluid samples taken from women suspected of gonadal mosaicism during routine IVF procedures could be an effective material source to verify the presence of maternal gonadal mosaicism.\u003c/p\u003e \u003cp\u003eMosaicism refers to the presence of two or more cell lines with different genomic information in an individual, resulting from mutations during early embryonic development \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e(PMID:23594909). Germline mosaicism is the presence of both normal and mutated gametes as a result of gonosomal and gonadal mosaicism \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e (PMID:23594909). Patients with germline mosaicism are often phenotypically normal, but are at a great risk of repeatedly giving birth to affected children. The first affected child of a parent with germline mosaicism is often misdiagnosed as a case of a de novo mutation, as germline mosaicism is often not suspected until the birth of the second affected child. The recurrence risk depends on whether the mosaic mutation is present in the paternal or maternal germline and the proportion of germ cells carrying the mutation. To date, there have been only three patients about mosaicism for point mutations in \u003cem\u003eHDAC8\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e(PMID:31157197; 30921088) and one case of mosaic deletion \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e(PMID:29279609). Somatic mosaicism for a CNV disrupting \u003cem\u003eHDAC8\u003c/em\u003e resulting in a CdLS phenotype has been previously reported once \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e (PMID:26671848). This is the first report of gonadal mosaicism with a deletion involving the \u003cem\u003eHDAC8\u003c/em\u003e gene. All the family members showed none of the typical CdLS symptoms, only our proband had two miscarriages with the same deletion in the \u003cem\u003eHDAC8\u003c/em\u003e gene, indicating that the analysis on DNA from miscarriage tissues as a routine molecular genetic diagnosis of individuals suffering from recurrent miscarriage even without family history of genetic disease.\u003c/p\u003e \u003cp\u003eOnce germline mosaicism is suspected, considering the severity of the disease, the widely expressed manifestations, and the current lack of cost-effective treatment, proper family planning and prevention through prenatal diagnosis or PGT-M represents two alternative methods for at-risk couples to avoid the birth of affected fetus. As an early form of prenatal diagnosis and the primary prevention of birth defects, PGT-M can identify embryos with low-risk genetic mutations before pregnancy, thereby couples could be free of the mental anguish and physical pain suffering from the termination of affected fetus. However, the detection of smaller CNVs, such as the 170 kb deletion in this particular case, is challenging at the single-cell level due to the limited resolution of NGS-based PGT-A typically exceeding 5\u0026ndash;10 Mb \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e(PMID:32653118). Since the emergence of the NGS which sequenced flanking genetic markers, such as SNPs with higher throughput and quicker than PCR of short tandem repeat (STR). NGS-based SNP analysis has been successfully used in PGT for haplotype linkage analysis of multiple monogenic diseases and matching of human leukocyte antigens. Therefore, the strategy of PGT for families with inherited CNVs\u0026thinsp;\u0026lt;\u0026thinsp;1 Mb in our center currently is to identify at-risk chromosomes by the detection of SNPs in the 2 Mb regions upstream and downstream of the pathogenic CNVs and to screen for unaffected embryos without at-risk chromosomes. PGT-M for CNVs in a germline mosaic state mainly relies on haplotyping construction to distinguish high-risk haplotype, same as two pregnancies\u0026rsquo; segment from low-risk haplotype consistent with the other maternal or paternal chromosome segment. This study is the first to report the strategy of PGT-M for germline mosaicisms of \u003cem\u003eHDAC8\u003c/em\u003e deletion.\u003c/p\u003e \u003cp\u003eUsually, it is not recommended to transfer embryos with high-risk haplotype, without knowing if the CNVs really exists. However, this way might lead to the waste of potentially unaffected embryos. With the help of nanopore sequencing and ddPCR, it might be able to distinguish from high-risk embryos whether they actually carry the CNVs. In our study, our patients have only one embryo with high-risk haplotype, and we don\u0026rsquo;t text it for the reason of enough available embryos. But, for cases with a high proportion of gonadal mosaicism or for cases with a lot of high-risk embryos, this approach can help patients knowing the real available embryos and saving available embryos.\u003c/p\u003e \u003cp\u003eThe probability of recurrence is influenced by the proportion of gonadal mosaicism, which could be estimated by gonad sampling, such as semen and egg retrieval \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e (PMID:32643877). The risk and pain of egg retrieval surgery, the limited number of eggs and the precious value of follicle samples for women make it difficult to promote to clinical application than the semen sampling which is easy, convenient and without additional injury or mental pain for man. Therefore, there are little clinical reports of female gonadal mosaicism. In fact, for couples of suspected maternal gonadal mosaicism and needing IVF to help them conceive, as the largest cell group of the follicle, millions of granulosa cells from the outer layer of the oocyte as well as follicular fluid could be taken during the routine procedure of egg retrieval, which have the same genetic background to study. Our ovarian sampling method neither adds additional pain and expense to women, nor increases the failure rate of embryo culture. It provides a good basis for successful proof of gonadal mosaicism innovatively in our study, and will be applied to validate if suspected maternal gonadal mosaicism exists.\u003c/p\u003e \u003cp\u003eIn summary, a few key insights gained from this case are as follows. Firstly, in cases where couples seek consultation regarding potential germline mosaicism, if there is only one affected child in the family and both partners exhibit no variations in peripheral blood, consideration should initially lean towards the child having a de novo mutation. This can be managed through natural conception along with prenatal diagnosis as a reproductive strategy. However, if there are recurring instances of the same gene variation in children with de novo mutations within the family, or in fetuses, suspicion should be heightened for the possibility of germline mosaicism. Options then include natural conception with prenatal diagnosis or employing PGT-M in conjunction with prenatal diagnosis to prevent such occurrences \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e (37162432). Secondly, when suspecting the presence of germline mosaicism, efforts should be made to confirm the diagnosis at a technical level. However, given the challenges posed by sample specificity and testing complexities, it is generally not mandatory to do so in accordance with the collective experiences of multiple centers. For families keen on further confirmation, due to limitations in obtaining and testing maternal germ cells, priority can be given to testing the presence of mosaicism in sperm. If there is no mosaicism found in the sperm, attention can be directed towards preserving granulosa cells, follicular fluid, or other potential sample alternatives during ovum retrieval from the female partner undergoing ovarian stimulation for future testing requirements. Thirdly, families with suspicions of germline mosaicism and intentions to opt for reproduction through PGT-M should undergo comprehensive genetic counseling. This should involve full disclosure of various possibilities, such as the clinical complexities and costs associated with diagnosing germline mosaicism, comparisons between PGT-M and natural conception with prenatal diagnosis, issues regarding embryo utilization rates, as well as the economic and emotional investments required from the patient's family.\u003c/p\u003e \u003cp\u003eHowever, this research has limitations, as a lack of samples from the skin and buccal mucosa to validate if somatic CNVs exist, our testing was only performed with the parents\u0026rsquo; peripheral blood and female ovarian granulosa cells, so the results may not accurately reflect the mutation of other tissues. Therefore, it also reminds us of the importance of retaining a sufficient number and variety of samples when encountering suspected cases of gonadal mosaicism.\u003c/p\u003e \u003cp\u003eOur data demonstrate the effectiveness of PGT-M based on haplotype linkage analysis for CNVs\u0026thinsp;\u0026lt;\u0026thinsp;1 Mb even in a gonadal mosaic state, and the importance of parental testing in CDLS5 families and reproductive usefulness of IVF with PGT in families with low-level parental gonadal mosaicism. With the use of a variety of techniques, including NGS-based sequencing, array comparative genomic hybridization, nanopore sequencing, and ddPCR to define exact mutation, we show how to face and solve some uncommon genetic mechanisms in the diagnosis of microdeletions in gonadal mosaicism.\u003c/p\u003e "},{"header":"Declarations","content":"\u003ch2\u003eEthic statement\u003c/h2\u003e\n\u003cp\u003eGenetic counseling sessions were provided to the family prior to any interventions, and informed consent was obtained. All procedures and protocols undertaken in this study were approved by the Medical Ethics Committee of Nanjing Women and Children\u0026apos;s Healthcare Hospital.\u003c/p\u003e\n\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis study was supported by the National Key R\u0026amp;D Program of China (No. 2022YFC2703400) and the Jiangsu Province Capability Improvement Project through Science, Technology and Education Jiangsu Provincial Medical Key Discipline (No. ZDXK202211).\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eLM, YW, JZ, PH and ZX designed the treatment plan and the study protocol. RZ, FQ, JZ, QZ and XL were involved in the treatment process and were responsible for collecting clinical data. XW, CW and SJ designed and conducted the nanopore sequencing and digital PCR experiments. LM, YW, XW and CW prepared the initial draft of the manuscript. PH and ZX critically revised the manuscript for important intellectual content.\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eWe would like to express our deepest gratitude to the family who participated in this study, for their courage and willingness to share their experiences. We are also grateful for the compassionate care provided by our genetic counseling and nursing team.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKline AD, Moss JF, Selicorni A, et al. Diagnosis and management of Cornelia de Lange syndrome: first international consensus statement [J]. Nat Rev Genet, 2018, 19(10): 649\u0026ndash;666. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41576-018-0031-0\u003c/span\u003e\u003cspan address=\"10.1038/s41576-018-0031-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeardorff MA, Noon SE, Krantz ID. Cornelia de Lange Syndrome. In: \u003cem\u003eGeneReviews(\u0026reg;).\u003c/em\u003e edn. Edited by Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE, Amemiya A; 1993.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvagliano L, Bulfamante GP, Massa V. Cornelia de Lange syndrome: To diagnose or not to diagnose in utero? [J]. Birth Defects Res, 2017, 109(10): 771\u0026ndash;777. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bdr2.1045\u003c/span\u003e\u003cspan address=\"10.1002/bdr2.1045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLucia-Campos C, Valenzuela I, Latorre-Pellicer A, et al. A Novel Intragenic Duplication in the HDAC8 Gene Underlying a Case of Cornelia de Lange Syndrome [J]. Genes (Basel), 2022, 13(8). DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/genes13081413\u003c/span\u003e\u003cspan address=\"10.3390/genes13081413\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHelgeson M, Keller-Ramey J, Knight Johnson A, et al. Molecular characterization of HDAC8 deletions in individuals with atypical Cornelia de Lange syndrome [J]. J Hum Genet, 2018, 63(3): 349\u0026ndash;356. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s10038-017-0387-6\u003c/span\u003e\u003cspan address=\"10.1038/s10038-017-0387-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaur M, Blair J, Devkota B, et al. Genomic analyses in Cornelia de Lange Syndrome and related diagnoses: Novel candidate genes, genotype-phenotype correlations and common mechanisms [J]. Am J Med Genet A, 2023, 191(8): 2113\u0026ndash;2131. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ajmg.a.63247\u003c/span\u003e\u003cspan address=\"10.1002/ajmg.a.63247\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaiser FJ, Ansari M, Braunholz D, et al. Loss-of-function HDAC8 mutations cause a phenotypic spectrum of Cornelia de Lange syndrome-like features, ocular hypertelorism, large fontanelle and X-linked inheritance [J]. Hum Mol Genet, 2014, 23(11): 2888\u0026ndash;2900. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/ddu002\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddu002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalehi Karlsl\u0026auml;tt K, Pettersson M, J\u0026auml;ntti N, et al. Rare copy number variants contribute pathogenic alleles in patients with intestinal malrotation [J]. Mol Genet Genomic Med, 2019, 7(3): e549. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/mgg3.549\u003c/span\u003e\u003cspan address=\"10.1002/mgg3.549\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGross AM, Ajay SS, Rajan V, et al. Copy-number variants in clinical genome sequencing: deployment and interpretation for rare and undiagnosed disease [J]. Genet Med, 2019, 21(5): 1121\u0026ndash;1130. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41436-018-0295-y\u003c/span\u003e\u003cspan address=\"10.1038/s41436-018-0295-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Li X, Cui J, et al. Analysis of clinical and genetic characteristics in 10 Chinese individuals with Cornelia de Lange syndrome and literature review [J]. Mol Genet Genomic Med, 2020, 8(10): e1471. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/mgg3.1471\u003c/span\u003e\u003cspan address=\"10.1002/mgg3.1471\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu H, Shen X, Huang L, et al. Genotyping single-sperm cells by universal MARSALA enables the acquisition of linkage information for combined pre-implantation genetic diagnosis and genome screening [J]. J Assist Reprod Genet, 2018, 35(6): 1071\u0026ndash;1078. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10815-018-1158-9\u003c/span\u003e\u003cspan address=\"10.1007/s10815-018-1158-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRiggs ER, Andersen EF, Cherry AM, et al. Technical standards for the interpretation and reporting of constitutional copy-number variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics (ACMG) and the Clinical Genome Resource (ClinGen) [J]. Genet Med, 2020, 22(2): 245\u0026ndash;257. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41436-019-0686-8\u003c/span\u003e\u003cspan address=\"10.1038/s41436-019-0686-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiesecker LG, Spinner NB. A genomic view of mosaicism and human disease [J]. Nat Rev Genet, 2013, 14(5): 307\u0026ndash;320. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrg3424\u003c/span\u003e\u003cspan address=\"10.1038/nrg3424\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrawczynska N, Wierzba J, Wasag B. Genetic Mosaicism in a Group of Patients With Cornelia de Lange Syndrome [J]. Front Pediatr, 2019, 7: 203. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fped.2019.00203\u003c/span\u003e\u003cspan address=\"10.3389/fped.2019.00203\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJezela-Stanek A, Murcia PV, Jurkiewicz D, et al. Novel variant in HDAC8 gene resulting in the severe Cornelia de Lange phenotype [J]. Clin Dysmorphol, 2019, 28(3): 126\u0026ndash;130. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/mcd.0000000000000277\u003c/span\u003e\u003cspan address=\"10.1097/mcd.0000000000000277\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParenti I, Gervasini C, Pozojevic J, et al. Expanding the clinical spectrum of the 'HDAC8-phenotype' - implications for molecular diagnostics, counseling and risk prediction [J]. Clin Genet, 2016, 89(5): 564\u0026ndash;573. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cge.12717\u003c/span\u003e\u003cspan address=\"10.1111/cge.12717\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen HF, Chen M, Ho HN. An overview of the current and emerging platforms for preimplantation genetic testing for aneuploidies (PGT-A) in in vitro fertilization programs [J]. Taiwan J Obstet Gynecol, 2020, 59(4): 489\u0026ndash;495. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tjog.2020.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tjog.2020.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai C, Cheng D, Li W, et al. Identification of paternal germline mosaicism by MicroSeq and targeted next-generation sequencing [J]. Mol Genet Genomic Med, 2020, 8(9): e1394. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/mgg3.1394\u003c/span\u003e\u003cspan address=\"10.1002/mgg3.1394\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIndications and management of preimplantation genetic testing for monogenic conditions: a committee opinion [J]. Fertil Steril, 2023, 120(1): 61\u0026ndash;71. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fertnstert.2023.03.003\u003c/span\u003e\u003cspan address=\"10.1016/j.fertnstert.2023.03.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cornelia de Lange syndrome (CDLS), low-level gonadal mosaicism, nanopore sequencing, droplet-digital PCR, haplotype linkage analysis, preimplantation genetic testing for monogenic disease (PGT-M).","lastPublishedDoi":"10.21203/rs.3.rs-5668001/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5668001/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePresently, to address the limited resolution at the single-cell level within the preimplantation genetic testing for aneuploidy (PGT-A) framework, our institution implemented a preimplantation genetic testing for monogenic disease (PGT-M) strategy based on haplotype linkage analysis for families with copy number variants (CNVs)\u0026thinsp;\u0026lt;\u0026thinsp;1 Mb.\u003c/p\u003e\u003cp\u003e\u003cb\u003eObjective\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study aims to deliver an accurate diagnosis for a Chinese family affected by Cornelia de Lange syndrome 5 (CDLS5) resulting from a microdeletion del(X)(q13.1q13.2) in the \u003cem\u003eHDAC8\u003c/em\u003e gene, characterized by notably low-level gonadal mosaicism. Furthermore, we execute preimplantation genetic testing for aneuploidy and monogenic disorders leveraging the diagnostic outcomes.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA de novo CNV was identified through chromosomal microarray analysis (CMA) and Whole Exome Sequencing (WES) in a family experiencing two unsuccessful pregnancies, indicating the existence of germline mosaicism. Validation of this CNV was performed via real-time quantitative polymerase chain reaction (PCR). Whole-genome low-coverage mate-pair sequencing (WGL-MPS) was conducted on female peripheral blood to exclude cryptic chromosomal abnormalities or mosaic states. Long-PCR was utilized to amplify the deleted fragment in insufficient miscarriage samples, with primers designed at breakpoints identified through WES and CMA results. After purifying the Long-PCR products, Oxford Nanopore Technology (ONT) third-generation sequencing was employed to pinpoint specific breakpoint positions. Designed primers and probes for droplet-digital polymerase chain reaction (ddPCR) were utilized to confirm the presence and proportion of germline mosaicism in ovarian samples obtained during in vitro fertilization procedures, such as granulosa cells and follicular fluid.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe disease-causing microdeletion at Xq13.1q13.2 disrupting the \u003cem\u003eHDAC8\u003c/em\u003e Gene in the two male miscarriage tissues was not detected in the parents' peripheral blood cells by CMA, ES, quantitative PCR, and WGL-MPS. The maternal gonadal tissues were assumed to be the source of inheritance as Cornelia de Lange syndrome 5 (CDLS5) is an X-linked dominant disease. Specific breakpoint positions (chrX:g.71666527\u0026ndash;71838853, 172 kb) were identified through third-generation sequencing of Long-PCR products. ddPCR quantitatively revealed approximately 1% mosaic state for the deletions in ovarian granulosa cells and none in peripheral blood cells, confirming the presence of CNV-induced gonadal mosaicism, a novel finding in maternal ovarian tissues. PGT investigations indicated 16.7% (1/6) of embryos with the deletion, demonstrating a low-level gonadal mosaicism.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOur findings underscore the efficacy of PGT-M utilizing haplotype linkage analysis for CNVs\u0026thinsp;\u0026lt;\u0026thinsp;1 Mb, even in cases of gonadal mosaicism, emphasizing the significance of parental testing in CDLS5 families and the reproductive utility of in vitro fertilization (IVF) with PGT for families affected by low-level parental gonadal mosaicism. By employing a spectrum of methodologies, including NGS-based sequencing, microarray-based comparative genomic hybridization, and ddPCR for precise breakpoint determination, we showcase approaches to address and resolve uncommon genetic mechanisms underlying microdeletions in cases of gonadal mosaicism. Our results advocate for the expanded application of PGT-M based on haplotype linkage analysis for families with minor pathogenic CNVs.\u003c/p\u003e","manuscriptTitle":"Preimplantation Genetic Testing for Cornelia de Lange Syndrome with Low-Level Maternal Gonadal Mosaicism using nanopore sequencing and digital PCR","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-24 16:49:36","doi":"10.21203/rs.3.rs-5668001/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f4180c75-f057-42ff-b685-f5cf53061371","owner":[],"postedDate":"December 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-02T10:54:08+00:00","versionOfRecord":[],"versionCreatedAt":"2024-12-24 16:49:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5668001","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5668001","identity":"rs-5668001","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}