Anticancer Effect of Chestnut inner shell extract on MDA-MB-231 by Regulation of AMPK, p53, Bcl-2, and Bax Expression

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract The purpose of this study was to investigate the anticancer properties of chestnut inner shell extract (CSE) by evaluating its effect on the regulation of key apoptosis genes in human breast cancer cells (MDA-MB-231). To evaluate the anticancer effect of CSE, HEK-293 and MDA-MB-231 were treated with 1.0 mg/mL of CSE. The results showed no growth inhibition in HEK-293 cells, while the viability of MDA-MB-231 cells decreased to 82.7%, indicating an anticancer effect of CSE without suppressing the growth of normal cell (HEK-293). CSE treatment resulted in 1.8, 1.3, and 2.6 times enhancement of the expressions of AMPK-α, p53, and Bax, respectively, along with a 1.2 times decrease in Bcl-2, confirming its potential as an anticancer agent through the regulation of key apoptosis genes. The main components of CSE were analyzed using HPLC-MS/MS, and the identification of afzelin, a type of flavonoid glycoside, suggests its potential anticancer properties. Overall, CSE has been shown to effectively upregulate the expression of apoptosis genes and inhibit the growth of human breast cancer cells, making a promising natural candidate with anticancer effects in the fields of food and pharmaceuticals.
Full text 87,047 characters · extracted from preprint-html · click to expand
Anticancer Effect of Chestnut inner shell extract on MDA-MB-231 by Regulation of AMPK, p53, Bcl-2, and Bax Expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Anticancer Effect of Chestnut inner shell extract on MDA-MB-231 by Regulation of AMPK, p53, Bcl-2, and Bax Expression Min Ho Kang, Ha Young Park, Jung Eun Park, Jin Woo Kim This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3869891/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The purpose of this study was to investigate the anticancer properties of chestnut inner shell extract (CSE) by evaluating its effect on the regulation of key apoptosis genes in human breast cancer cells (MDA-MB-231). To evaluate the anticancer effect of CSE, HEK-293 and MDA-MB-231 were treated with 1.0 mg/mL of CSE. The results showed no growth inhibition in HEK-293 cells, while the viability of MDA-MB-231 cells decreased to 82.7%, indicating an anticancer effect of CSE without suppressing the growth of normal cell (HEK-293). CSE treatment resulted in 1.8, 1.3, and 2.6 times enhancement of the expressions of AMPK-α , p53 , and Bax , respectively, along with a 1.2 times decrease in Bcl-2 , confirming its potential as an anticancer agent through the regulation of key apoptosis genes. The main components of CSE were analyzed using HPLC-MS/MS, and the identification of afzelin, a type of flavonoid glycoside, suggests its potential anticancer properties. Overall, CSE has been shown to effectively upregulate the expression of apoptosis genes and inhibit the growth of human breast cancer cells, making a promising natural candidate with anticancer effects in the fields of food and pharmaceuticals. Anticancer Apoptosis Chestnut inner shell MDA-MB-231 Afzelin Figures Figure 1 Figure 2 Figure 3 1. Introduction Breast cancer is caused by a combination of genetic factors and lifestyle habits that affect the body's hormonal levels, such as high fat consumption, irregular eating habits, obesity, exposure to chemicals, pollution, and alcohol consumption. According to the World Cancer Report, breast cancer is the most common diagnosed cancer among women worldwide. In 2020, approximately 22 million women were diagnosed with breast cancer, and an estimated 680,000 women died from it[1,2]. Breast cancer frequently results in invasion and metastasis, with a rate exceeding 25%, and cancerous tumors can metastasize remotely through the lymph nodes and bloodstream from their primary site to other parts of the body such as bones, brain, and lung tissues, thereby increasing the risk of mortality[3]. Additionally, research has shown that over 11% of breast cancer patients suffer from recurrence within 5 years, and this risk increases to 16% after 10 years, leading an increased risk of systemic recurrence beyond the primary site. With the incidence, metastasis, and risk of recurrence of breast cancer increasing, there is an urgent need for advanced and effective anticancer treatments that can specifically target breast cancer and while minimizing the adverse effects on normal cells[4]. Apoptosis, a programmed cell death process, is a fundamental mechanism of cancer cell-targeted chemotherapeutic agents, working through cell death process that inhibits cell growth by inducing changes within the mitochondria, selectively eliminating cancer cells. Apoptosis is triggered by ligand binding to specific receptors, which can occur through endogenous and exogenous pathways. This is essential for cancer treatment efficacy because it selectively targets cancer cells, while sparing normal cells from damage[5]. Modulation in the expression levels of key genes involved in the endogenous apoptosis pathway, such as AMPK-α , p53 , Bcl-2 , and Bax , can regulate the growth of cancer cells. Changes in the expression levels of these genes, whether increased or decreased, can impact the activation of apoptotic signaling pathways, thus regulating cancer cell survival and death[6,7]. The apoptosis-inducing gene, AMPK-α , stimulates catabolism within mitochondria and triggers phosphorylation of the tumor suppressor gene, p53 , leading to the sequential activation of caspase 9 and caspase 3 . This, in turn, causes the release of pro-apoptotic molecules such as cytochrome C from mitochondria into the cytoplasm, ultimately leading to cell apoptosis[8]. As a critical regulator of apoptosis, p53 promotes the transcription of p21 in response to DNA damage, leading to the arrest of cell cycle and DNA synthesis. Simultaneously, it decreases the expression of anti-apoptotic Bcl-2 and enhances apoptosis by elevating the levels of pro-apoptotic Bax. Therefore, p53 , AMPK-α , Bcl-2 , and Bax all play crucial roles in regulating the apoptotic pathway, emphasizing the essentiality of these genes in initiating and executing apoptosis[9,10]. Current chemotherapeutic agents used for cancer treatment primarily induce apoptosis in cancer cells by inhibiting cellular division and stimulating the immune system. While effective, these agents have drawbacks, such as reducing white blood cell count, compromising immunity, neuropathy, cognitive impairment, and increased drug resistance, which can have negative effects on the overall health of cancer patients. Recently, there has been an increasing interest in natural anticancer agents that offer similar anticancer effects to conventional drugs with reduced side effects[11]. Therefore, natural product are gaining value in development of novel anticancer agents because of their safety profile and low side effects, which are inherent to their natural structure and in line with the current trend of pursuing health and safety[12]. Although chestnuts have been a diverse food source for centuries, the inner shells are not typically considered edible due to their high tannin content and tough texture. For centuries, chestnuts have served as a diverse food source. However, the inner shells are typically not considered edible due to their high tannin content and tough texture, posing environmental and economic challenges during disposal[13]. Various studies have been conducted for the utilization of CS, but the high tannin content poses difficulties in using them as animal feed due to the occurrence of digestive problems. Only a fer studies are introducing the potential utilization of cs as a material with skin-whitening, wrinkle-improving, and antioxidant effects[14]. The main objective of this study was to analyze the main components of CS and evaluate the apoptotic effect on breast cancer by studying the expression of genes related to apoptosis, including AMPK-α , p53 , Bcl-2 , and Bax . Finally, this study highlighted the potential of CS for developing substances inhibiting the growth of breast cancer cell, thereby presenting new possibilities for utilizing non-food agricultural byproducts as ingredients in functional foods or medicine. 2. Materials and Methods 2. 1. Raw materials and reagents The chestnut shells used in this study were obtained from chestnuts harvested in the fall of 2023 in the Gongju area of South Korea. They were purchased from a local retail outlet, and the shells were subsequently removed. Then, the CS was dried in convection oven (VS-1202D4N, Vision Bionex, Bucheon, Korea) at 60 ± 1℃ until there was no further weight change, then pulverized to 40 mesh size or smaller (> 0.381 mm) using a food processor (HMF-3000S, Hanil Electric, Seoul, Korea). 2. 2. Ultrasound-assisted extraction For the ultrasound-assisted extraction a mixture of 99.5% ethanol (Duksan, Gapyoung, Korea) and distilled water was used as the solvent. To prepare the extract, 1 g of CS powder was mixed with 10 mL of 50% ethanol in a glass tube (PYREX -1636, Scilab, Seoul, Korea) and subjected to extraction at 40 kHz and 60°C for 30 min using a tabletop ultrasonic extractor (SD-D250H, Sungdong, Hwaseong, Korea). The extract was centrifuged at 4℃ and 2,878 x g for 10 min using a Lobogen 1236R centrifuge (Gyrozen Co, Daejeon, Korea) to separate solid and liquid components and the supernatant obtained was stored at -21℃, diluted as needed, and used for subsequent analysis experiments. 2. 3. Cell culture In this study, fetal bovine serum, Dulbecco's Modified Eagle Medium (DMEM), and trypsin-EDTA provided by Thermo Fisher (Waltham, MA, USA) were used. To evaluate the potential anticancer effect of the chestnut inner shell extract, both normal cells (HEK-293) and human-derived breast cancer cells (MDA-MB-231) were obtained from the Korea Cell Line Bank (KCLB, Seoul, Korea). Cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin, and maintained in a incubator (MCO-5AC, Sanyo, Osaka, Japan) at 37°C with 5% CO 2 . After 72 hr of culturing, the cells were harvested through washing with PBS and dissociating cell with 0.05% trypsin-EDTA for separation. The cells were collected by centrifugation at 460 x g for 2 min at 4℃, and after removing the supernatant, the cells were resuspended in DMEM and seeded in T-50 cell culture flasks at a density of 5.0 × 10 4 cells/mL for the measurement of cytotoxicity and mRNA expression. 2. 4. Evaluation of cancer cells viability The cancer cell growth inhibition effect of CSE was evaluated by measuring cell viability based on the 3-(4, 5-dimethylthiazole-2-yl)-2,5 diphenyl tetrazolium bromide (MTT) oxidation reaction. HEK-293 and MDA-MB-231 were seeded in a 96-well plate at a density of 1 × 10 4 cells/well and incubated for 24 hr. To evaluate the effect of CSE on cell viability, various concentrations of the extract were prepared by diluting it in DMEM, ranging from 0.0 to 2.0 mg/mL. Then, 0.02 mL was added to each well for cytotoxicity assessment, followed by a 72-hr incubation. Subsequently, 100 µL of MTT (0.25 mg/mL) was added to each well and incubated for 4 hrs to initiate the reaction. Subsequently, the absorbance was measured at 450 nm using a microplate reader (Infinite200®, Tecan group, Zurich, Switzerland), and cell viability was calculated as a percentage using the following Eq. 1. 2. 5. Evaluation of anticancer gene expression To evaluate the expression of genes related to anticancer activity at the mRNA level, MDA-MB-231 cells were seeded at 5.0 × 10 3 cells/mL on a 24-well plate, cultured for 24 hr, and treated with CSE ranging from 0.0 to 0.5 mg/mL. Total RNA was extracted from MDA-MB-231 using the Accuprep® universal RNA extraction kit (Bioneer, Daejeon, Korea). The extracted mRNA was reverse transcribed into cDNA using the AmpiRivert cDNA synthesis platinum master mix (GenDEPOT, Barker, TX, USA), and then amplified via RT-PCR using primers specific to AMPK-α , p53 , Bcl-2 , and Bax (Table 1). The process of gene amplification involved denaturation carried out at 95°C for 15 sec, followed by binding at 60°C for 3 sec, and extension at 72°C for 25 sec. Subsequently, the gene expression was visualized by electrophoresis on a 1.5% agarose gel containing GelRed® nucleic acid gel stain (Komabiotech, Seoul, Korea), and the intensity of the band was quantified using Davinch-gel™ (Youngin Lab Plus, Hercules, Seoul, Korea). 2. 6. Analysis of main components HPLC-grade acetonitrile and formic acid (>99.5%) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and were used as solvents in the HPLC-MS/MS analysis for the separation and identification of components in the CSE. Prior to injection of samples, the CSE was filtered using a 0.22 µm syringe filter (Hyundai Micro, Seoul, Korea). Then, the sample was analyzed using a Finnigan TSQ Quantum triple quadrupole mass spectrometer (Thermo Fisher, Waltham, MA, USA) equipped with a reversed-phase C18 column (3 µm particle size, Restek, Bellefonte, PA, USA) measuring 3.0 × 150 mm. The analysis was performed using electrospray ionization (ESI), and the mobile phase A and B consisted of formic acid (1.0% v/v) in water and formic acid (1.0% v/v) in acetonitrile, respectively. The gradient eluent profile was as follows: 0 ˗ 11 min, 95 → 0% A; 11 ˗ 14 min, 0 → 0% A; 14 ˗ 15 min, 0 → 95% A; and 15 ˗ 20 min, 95 → 95% A. For the qualitative analysis of main components in the range of 50 ˗ 800 m/z using the full scan mode, a sample injection volume of 10 µL, a flow rate of 0.2 mL/min, and a column temperature of 30°C were used. 2. 7. Statistical analysis The data were analyzed using Graphpad Prism Software 9 (San Diego, California, USA), and the experiments were repeated three times, and the results were presented as mean ± standard deviation. To determine the statistical significance of the experimental results, one-way analysis of variance was applied. Moreover, an independent samples t-test with a significance level of p < 0.05 was used to evaluate the significance between the two experimental groups. 3. Results and Discussion 3. 1. Evaluation of anticancer effect based on cell viability To confirm the anticancer effects of CSE on cell viability of MDA-MB-231 and HEK-293, cells were treated with CSE at concentrations ranging from 0.0 to 0.2 mg/mL, and the effect of CSE on cell growth was assessed. When HEK-293 cells were treated with 1.0 mg/mL, their viability was 97.6%, indicating that the extract did not impede cell growth. In contrast, treating MDA-MB-231 with 0.5 and 1.0 mg/mL resulted in cell viability of 90.6% and 82.4%, respectively, confirming the anticancer effect of CSE by inhibiting cell growth at 1.0 mg/mL and higher (Fig. 1 ). In comparison to other studies, which showed a cell survival rate of 50.0 ~ 90.0% in HEK-293 treated with 1.0 mg/mL of peanut, Peganum harmala , and averrhoa bilimbi extract, CSE was found to have no cytotoxicity, as evidenced by a cell survival rate of 97.6% in HEK-293 treated with 1.0 mg/mL of CSE. This demonstrates that CSE exhibits no cytotoxicity safety in normal cells compared to traditional natural extracts[15–17]. Furthermore, CSE demonstrated high anti-cancer effects by showing lower cytotoxicity in MDA-MB-231 cells compared to red cabbage, Ficus carica , and Allium willeanum Holmboe bulb , thereby confirming its efficacy over natural substances[18–20]. The study on breast cancer cells (MCF-7) treated with CSE demonstrated significant anticancer properties by inhibiting cell proliferation and inducing apoptosis. Therefore, it was predicted that similar anti-cancer characteristics would be exhibited in MDA-MB-231 cells, leading to the inhibition of cell proliferation[21]. In this research, the treatment of normal cells with CSE at 1.0 mg/mL did not show significant inhibition of cell activity, whereas significant inhibition was observed in breast cancer cells ( p < 0.05). Thus, CSE selectively suppressed the growth of breast cancer cells without adversely affecting the viability of normal cells, indicating its potential as a safe therapeutic agent for breast cancer treatment. 3. 2. Measurement of anticancer gene expression This experiment aims to elucidate the signaling pathways associated with the inhibition of cancer cell proliferation by CSE, building upon the evidence of the anticancer effect observed in our previous research on cancer cell survival suppression. To achieve this, the evaluation of the anticancer effect of CSE on MDA-MB-231 was conducted based on investigating the mRNA expression regulation of key genes involved in apoptosis. The expression of AMPK-α , p53 , and Bax was significantly increased by 1.8, 1.3, and 2.6 times, respectively, at a maximum nontoxic concentration of 0.5 mg/mL(Fig. 2 ). Conversely, the expression of Bcl-2 was decreased by 1.2 times. These results suggest that CSE induces the expression of Bax and inhibits the expression of Bcl-2 , which leads to the promotion of cell death and inhibition of cancer cell growth. Therefore, CSE may exert its anticancer effect by regulating the expression of key genes involved in breast cancer development[22]. Bcl-2 is widely known as an antiapoptotic gene that plays a critical role in regulating cell survival and death through various mechanisms, including the regulation of oxidation-reduction, mitochondrial membrane potential, and intracellular ion distribution. On the other hand, Bax functions as a proapoptotic gene by activating caspases and increasing the levels of caspase-regulated upstream enzyme, AMPK-a . This process leads to the activation of apoptotic pathways through the release of cytochrome C from mitochondria, followed by its binding to apoptosis protease activating factor ( Apaf-1 )[23,24]. Based on the observed increase in levels of proapoptotic Bax and decrease in levels of antiapoptotic Bcl-2 , it is postulated that CSE exerts an anticancer effect on MDA-MB-231 cells by modulating the expression of Bcl-2 and Bax . Given these findings, phytochemicals in CSE are hypothesized to exert their anticancer effects by regulating the expression of key apoptosis-related genes, including AMPK-α , p53 , Bax , and Bcl-2 . The mechanisms by which CSE regulates the expression of apoptosis-related genes, including AMPK-α , p53 , Bax , and Bcl-2 , suggest that it has the potential to inhibit cancer cell growth and proliferation. These findings make CSE a promising candidate for further investigation as a potential anticancer agent. 3. 3. Analysis of main components in CSE The present study demonstrates that plant-derived phytochemicals in CSE modulate the expression of critical anticancer genes and induce cellular apoptosis. To confirm the hypothesis, we used HPLC-MS/MS to quantify and identify the primary constituents of CSE. Analysis of the molecular weight distribution of the components in the anion mode using deprotonated mass-to-charge ratio (m/z) allowed for the identification of two distinct components with molecular weights (MW) of 431.4 and 227.2. Based on its molecular weight, the 431.4 species detected was postulated to be an afzelin derivative with a free hydrogen atom(Fig. 3 ). Afzelin, a flavonoid glycoside containing rhamnosides attached to its flavonoid structure, has been found to exhibit multiple pharmacological effects, including antioxidant, anti-inflammatory, and anticancer activities[26]. According to previous studies, afzelin has been reported to exhibit specific anticancer effects on breast, liver, and prostate cancers. This is achieved by promoting the activation of caspase, controlling the expression of AMPK-α , BCL-2 , and p53 to induce apoptosis, and activating cytochrome C to initiate apoptosis by improving the permeability of the mitochondrial outer membrane[27–29]. Based on the results of our previous experiments and subsequent analyses of the main components in CSE, the plant-derived phytochemicals present in CSE, induce cellular apoptosis by regulating key anticancer genes, with afzelin identified as one of the main components responsible for this effect. 4. Conclusion Breast cancer poses a major health threat to women worldwide and represents a significant global health burden. As a result, there is an increasing demand for discovering novel components from natural sources to develop more effective and less side-effect-prone anticancer therapeutics in the field of oncology. Therefore, natural products have gained considerable interest as potential sources of anticancer agents due to their diverse chemical structures, low side effects, and biological activities. Among these, plant-derived phytochemicals have been extensively studied for their potential anticancer properties. With the growing interest in natural products, there is a need for further research to identify and characterize potential anticancer components from various natural sources, including plants, marine organisms, microorganisms, and agricultural byproducts. This study aimed to verify the potential apoptosis-based anticancer effect of CSE on MDA-MB-231 cells and to elucidate its underlying mechanism of action, which could contribute to the development of novel therapeutic agents for breast cancer treatment. Over the years, there has been growing interest in natural products as potential sources of therapeutic agents for cancer treatment. Among the natural products, plant-derived phytochemicals such as polyphenols and flavonoids have received considerable attention for their potential anticancer properties. These components have been found to modulate various cellular processes, including cell proliferation, differentiation, and apoptosis. The results showed a selective inhibition of MDA-MB-231 cell growth without affecting HEK-293 cell growth, confirming the potential anticancer effect of CSE. The focus of this study was to elucidate the underlying mechanism of CSE in inducing apoptosis in MDA-MB-231 cells. The findings revealed that CSE induces apoptosis through the activation of the mitochondrial pathway, which involves the upregulation of AMPK-α , p53 , and Bax , and the downregulation of Bcl-2 expression. The observed regulation of apoptosis-related genes and the induction of apoptosis provide valuable insight into the underlying mechanism of action of CSE. Additionally, the identification of afzelin as a potential main component responsible for the observed anticancer effect of CSE highlights the potential of this natural product as a source of therapeutic agents for breast cancer. These findings suggest that CSE can be a valuable source of functional food and pharmaceutical materials for breast cancer treatment, offering a natural and safe therapeutic option. Declarations Funding: No funds, grants, or other support was received. Conflicts of interest/Competing interests: The authors have no competing interests to declare that are relevant to the content of this article. Code availability: Not applicable Author contributions: M.H.K. and H.Y.P. conceived the ideas; and designed the experiments. M.H.K., H.Y.P. and J.E.P. performed the experiments. M.H.K. analyzed the data. J.E.P. provided critical materials. M.H.K. and J.W.K. wrote the manuscript. M.H.K. and J.W.K. supervised the study. All the authors have read and approved the final version of the manuscript for publication. Acknowledgments: The authors thank Jin Woo Kim for advice on the experimental design and statistical analysis. This research received no external funding. Data availability: The main data are present in the manuscript. Data details could be obtained upon request to [email protected] . Plant materials procurement: The chestnut shells used in this study were legally purchased from Coupang (Seoul, Korea), a retailer in South Korea, and only the outer shells were separated for use. References Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA. Cancer J. Clin. 2021 , 71 , 209–249. Rho, J.; Choi, S. A Study on the Knowledge, Attitudes, Cancer Preventive Dietary Behavior, and Lifestyles of Adults in the Jeonbuk Area. Korean J. Hum. Ecol. 2013 , 22 , 201–213. Wood, S.L.; Pernemalm, M.; Crosbie, P.A.; Whetton, A.D. The Role of the Tumor-Microenvironment in Lung Cancer-Metastasis and Its Relationship to Potential Therapeutic Targets. Cancer Treat. Rev. 2014 , 40 , 558–566. Son, K.H.; Hwang, J.; Kim, D.; Cho, Y.-E. Effect of Corosolic Acid on Apoptosis and Angiogenesis in MDA-MB-231 Human Breast Cancer Cells. J. Nutr. Heal. 2020 , 53 , 111–120. Un, H.; Ugan, R.A.; Kose, D.; Bayir, Y.; Cadirci, E.; Selli, J.; Halici, Z. A Novel Effect of Aprepitant: Protection for Cisplatin-Induced Nephrotoxicity and Hepatotoxicity. Eur. J. Pharmacol. 2020 , 880 , 173168. Chowdhury, I.; Tharakan, B.; Bhat, G. Current Concepts in Apoptosis: The Physiological Suicide Program Revisited. Cell. Mol. Biol. Lett. 2006 , 11 , 506–525. Che, F.; Chen, J.; Dai, J. On the in Vitro Anti-Myeloma Effect and Mechanism of Andrographolide through PI3K/AKT/MTOR and AMPK/MTOR Dual Signaling Pathways. Int J Clin Exp Med 2019 , 12 , 8374–8380. Roychowdhury, T.; Lu, H.; Hornsby, W.E.; Crone, B.; Wang, G.T.; Guo, D.; Sendamarai, A.K.; Devineni, P.; Lin, M.; Zhou, W. Regulatory Variants in TCF7L2 Are Associated with Thoracic Aortic Aneurysm. Am. J. Hum. Genet. 2021 , 108 , 1578–1589. Zheng, N.; Li, H.; Wang, X.; Zhao, Z.; Shan, D. Oxidative Stress-Induced Cardiomyocyte Apoptosis Is Associated with Dysregulated Akt/P53 Signaling Pathway. J. Recept. Signal Transduct. 2020 , 40 , 599–604. O’Neill, E.J.; Den Hartogh, D.J.; Azizi, K.; Tsiani, E. Anticancer Properties of Carnosol: A Summary of in Vitro and in Vivo Evidence. Antioxidants 2020 , 9 , 961. Kim, Y.-S.; Kim, B.-H.; Kim, G.-S.; Jang, J.-S.; Kim, S.-Y.; Choi, B.-D.; Kim, J.-O.; Ha, Y.-L. Anti-Carcinogenic Actions of Glycoprotein Conjugated with Isoflavones from Submerged-Liquid Culture of Agaricus Blazei Mycelia through Reciprocal Expression of Bcl-2 and Bax Proteins. J. Biomed. Transl. Res. 2014 , 15 , 200–206. Baker, D.D.; Chu, M.; Oza, U.; Rajgarhia, V. The Value of Natural Products to Future Pharmaceutical Discovery. Nat. Prod. Rep. 2007 , 24 , 1225–1244. Morana, A.; Squillaci, G.; Paixão, S.M.; Alves, L.; La Cara, F.; Moura, P. Development of an Energy Biorefinery Model for Chestnut (Castanea Sativa Mill.) Shells. Energies 2017 , 10 , 1504. Liu, T.; Liu, X.; Li, W. Tetrandrine, a Chinese Plant-Derived Alkaloid, Is a Potential Candidate for Cancer Chemotherapy. Oncotarget 2016 , 7 , 40800. Husanu, E.; Mero, A.; Rivera, J.G.; Mezzetta, A.; Ruiz, J.C.; D’Andrea, F.; Pomelli, C.S.; Guazzelli, L. Exploiting Deep Eutectic Solvents and Ionic Liquids for the Valorization of Chestnut Shell Waste. ACS Sustain. Chem. Eng. 2020 , 8 , 18386–18399. Goudarzi, M.; Azimi, H. Antimicrobial Activity of Peganum Harmala against Methicillin-Resistant Staphylococcus Aureus Strains and Assessment of Its Cytotoxicity Effect on HEK-293 Cells. Int. J. Infect. 2017 , 4 . Anantachoke, N.; Lomarat, P.; Praserttirachai, W.; Khammanit, R.; Mangmool, S. Thai Fruits Exhibit Antioxidant Activity and Induction of Antioxidant Enzymes in HEK-293 Cells. Evidence-Based Complement. Altern. Med. 2016 , 2016 . Nam, M.K.; Kang, K.J. The Effect of Red Cabbage (Brassica Oleracea L. Var. Capitata f. Rubra) Extract on the Apoptosis in Human Breast Cancer MDA-MB-231 Cells. J. Korean Soc. Food Sci. Nutr. 2013 , 42 , 8–16. Zhang, Y.; Wan, Y.; Huo, B.; Li, B.; Jin, Y.; Hu, X. Extracts and Components of Ficus Carica Leaves Suppress Survival, Cell Cycle, and Migration of Triple-Negative Breast Cancer MDA-MB-231 Cells. Onco. Targets. Ther. 2018 , 4377–4386. Isbilen, O.; Volkan, E. Allium Willeanum Holmboe Exerts Anticancer Activities on Metastatic Breast Cancer Cells MCF-7 and MDA-MB-231. Heliyon 2021 , 7 . Cacciola, N.A.; Squillaci, G.; D’Apolito, M.; Petillo, O.; Veraldi, F.; Cara, F. La; Peluso, G.; Margarucci, S.; Morana, A. Castanea Sativa Mill. Shells Aqueous Extract Exhibits Anticancer Properties Inducing Cytotoxic and pro-Apoptotic Effects. Molecules 2019 , 24 , 1–12, doi:10.3390/molecules24183401. Gong, Q.; Davis, M.; Chipitsyna, G.; Yeo, C.J.; Arafat, H.A. Blocking Angiotensin II Type 1 Receptor Triggers Apoptotic Cell Death in Human Pancreatic Cancer Cells. Pancreas 2010 , 39 , 581–594. Rongvaux, A.; Jackson, R.; Harman, C.C.D.; Li, T.; West, A.P.; De Zoete, M.R.; Wu, Y.; Yordy, B.; Lakhani, S.A.; Kuan, C.-Y. Apoptotic Caspases Prevent the Induction of Type I Interferons by Mitochondrial DNA. Cell 2014 , 159 , 1563–1577. Jemmerson, R.; Staskus, K.; Higgins, L.; Conklin, K.; Kelekar, A. Intracellular Leucine-Rich Alpha-2-Glycoprotein-1 Competes with Apaf-1 for Binding Cytochrome c in Protecting MCF-7 Breast Cancer Cells from Apoptosis. Apoptosis 2021 , 26 , 71–82. Iqbal, J.; Abbasi, B.A.; Mahmood, T.; Kanwal, S.; Ali, B.; Shah, S.A.; Khalil, A.T. Plant-Derived Anticancer Agents: A Green Anticancer Approach. Asian Pac. J. Trop. Biomed. 2017 , 7 , 1129–1150. Scognamiglio, M.; D’Abrosca, B.; Pacifico, S.; Isidori, M.; Esposito, A.; Fiorentino, A. Mediterranean Wild Plants as Useful Sources of Potential Natural Food Additives. In Emerging Trends in Dietary Components for Preventing and Combating Disease ; ACS Publications, 2012; pp. 209–235 ISBN 1947-5918. Rachmi, E.; Purnomo, B.B.; Endharti, A.T.; Fitri, L.E. In Silico Prediction of Anti-Apoptotic BCL-2 Proteins Modulation by Afzelin in MDA-MB-231 Breast Cancer Cell. Res. J. Pharm. Technol. 2020 , 13 , 905–910. Shin, S.W.; Jung, E.; Kim, S.; Kim, J.-H.; Kim, E.-G.; Lee, J.; Park, D. Antagonizing Effects and Mechanisms of Afzelin against UVB-Induced Cell Damage. PLoS One 2013 , 8 , e61971. Radziejewska, I.; Supruniuk, K.; Czarnomysy, R.; Buzun, K.; Bielawska, A. Anti-Cancer Potential of Afzelin towards Ags Gastric Cancer Cells. Pharmaceuticals 2021 , 14 , 973. Table Table 1. Primer sequences used in RT-PCR analysis to evaluate the expression of major genes related to anticancer activity in MDA-MB-231 Primers Sequences Forward (5’ → 3’) Reverse (3’ → 5’) AMPK-α 1) GACACCAGTTTTGCCTCCAGTA TCCAGAGGCGGAAGTTCTGT P53 CCCATCCTCACCATCATCACAC GCACAAACACGCACCTCAAAG Bcl-2 2) ATTGGGAAGTTTCAAATCACG TCTATTCCTCTGTGATGTGT Bax 3) GAGCTGCAGAGGATGATGATTCG AAGTTGCCGTCAGAAAACACG GAPDH GATGGGCATGAAGCATGAGA TGGCATGGACTGTGGTCATT 1) AMPK-α : AMP-activated protein kinase-α, 2) Bcl-2 : B-cell lymphoma-2, and 3) Bax : Bcl-2 associated Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3869891","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":274249079,"identity":"39981995-9330-43c5-b2ba-1d11e136e25a","order_by":0,"name":"Min Ho Kang","email":"","orcid":"","institution":"Sun Moon University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"Ho","lastName":"Kang","suffix":""},{"id":274249082,"identity":"b05410df-f569-49c4-8e4b-942b9fee1338","order_by":1,"name":"Ha Young Park","email":"","orcid":"","institution":"Sun Moon University","correspondingAuthor":false,"prefix":"","firstName":"Ha","middleName":"Young","lastName":"Park","suffix":""},{"id":274249083,"identity":"bb467387-e7c0-4862-97f0-4867fe7dc006","order_by":2,"name":"Jung Eun Park","email":"","orcid":"","institution":"Sun Moon University","correspondingAuthor":false,"prefix":"","firstName":"Jung","middleName":"Eun","lastName":"Park","suffix":""},{"id":274249084,"identity":"6dd21460-ce65-42e5-9ff8-6566cddc2d5c","order_by":3,"name":"Jin Woo Kim","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYBACCWYGBgMGAwk5fvYGZPEDhLQU2BhL9qCowqcFTH5IS9xwI4FILZLt3AnFPAaHGWfOfP5MujDHRs6cgfnhB4Yz93BqkWbm3WAM1MLML51jJj1zW5qxZQObsQTDjWKcWuRAWnIMDrNJzs5hk+bddjhxwwEGM6BTEwhq4TG4efwZVAv7N7xapCFa0iQMbjCYQbXwAG25gVuLZDNQyx8DGwPJnhxja16gX4A2FksknMGtReL82W2GM/5I1PezH394m3ebjZzB8faNHz4cw60FCNgMUPnAyGXAqwGo5AF++VEwCkbBKBjxAAAvmlAfcXfBSAAAAABJRU5ErkJggg==","orcid":"","institution":"Sun Moon University","correspondingAuthor":true,"prefix":"","firstName":"Jin","middleName":"Woo","lastName":"Kim","suffix":""}],"badges":[],"createdAt":"2024-01-16 13:14:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3869891/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3869891/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51522796,"identity":"70077e07-241e-4bc7-8467-c311acbcb643","added_by":"auto","created_at":"2024-02-23 04:35:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":206110,"visible":true,"origin":"","legend":"\u003cp\u003eAnticancer effect of CSE based on cytotoxicity against HEK-293 and MDA- MB-231. Determination of viability by comparing with the mean and standard deviation of the non-treated (N.T.) group (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-3869891/v1/7a3d68c4e4f6d1ef74fb117a.png"},{"id":51522797,"identity":"fef8bffa-17e7-46a1-9d39-a9a58dbe361c","added_by":"auto","created_at":"2024-02-23 04:35:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":579444,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of treatment of CSE at different concentrations on the expression of anticancer genes including \u003cem\u003eAMPK\u003c/em\u003e (A), \u003cem\u003ep53\u003c/em\u003e (B), \u003cem\u003eBax\u003c/em\u003e (C), and \u003cem\u003eBCL-2\u003c/em\u003e (D), in MDA-MB-231.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-3869891/v1/1b6f24c54caa487b6042e8a6.png"},{"id":51522798,"identity":"3f7eb0a0-1288-45e5-9597-943f8932e6a7","added_by":"auto","created_at":"2024-02-23 04:35:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":112596,"visible":true,"origin":"","legend":"\u003cp\u003eSpectrum graph of HPLC-MS/MS analysis for main components in CSE. Mass spectrometric profile of afzelin, scanning from m/z 50 to 800 pattern, with main molecular ion peak at m/z 431.4 and M.W. of 432.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-3869891/v1/3a8ca32446d2ddd47707f2e9.png"},{"id":56037851,"identity":"53967ec8-249e-4b88-bdba-2f0378884985","added_by":"auto","created_at":"2024-05-07 18:53:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1003566,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3869891/v1/56839ca2-0fa1-420b-83c6-ac1a3489ced1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Anticancer Effect of Chestnut inner shell extract on MDA-MB-231 by Regulation of AMPK, p53, Bcl-2, and Bax Expression","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eBreast cancer is\u0026nbsp;caused by a combination of genetic factors and lifestyle habits that affect the body\u0026apos;s hormonal levels, such as high fat consumption, irregular eating habits, obesity, exposure to chemicals, pollution, and alcohol consumption.\u0026nbsp;According to the World Cancer Report, breast cancer is the most common diagnosed cancer among women worldwide. In 2020, approximately 22 million women were diagnosed with breast cancer, and an estimated 680,000 women died from it[1,2]. Breast cancer frequently results in invasion and metastasis, with a rate exceeding 25%, and cancerous tumors can metastasize remotely through the lymph nodes and bloodstream from their primary site to other parts of the body such as bones, brain, and lung tissues, thereby increasing the risk of mortality[3]. Additionally, research has shown that over 11% of breast cancer patients suffer from recurrence within 5 years, and this risk increases to 16% after 10 years, leading an increased risk of systemic recurrence beyond the primary site. With the incidence, metastasis, and risk of recurrence of breast cancer increasing, there is an urgent need for advanced and effective anticancer treatments that can specifically target breast cancer and while minimizing the adverse effects on normal cells[4].\u003c/p\u003e\n\u003cp\u003eApoptosis, a programmed cell death process, is a fundamental mechanism of cancer cell-targeted chemotherapeutic agents, working through cell death process that inhibits cell growth by inducing changes within the mitochondria, selectively eliminating cancer cells. Apoptosis is triggered by ligand binding to specific receptors, which can\u0026nbsp;occur through endogenous and exogenous pathways. This is essential for cancer treatment efficacy because it selectively targets cancer cells, while sparing normal cells from damage[5]. Modulation in the expression levels of key genes involved in the endogenous apoptosis pathway, such as \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, \u003cem\u003ep53\u003c/em\u003e, \u003cem\u003eBcl-2\u003c/em\u003e, and \u003cem\u003eBax\u003c/em\u003e, can regulate the growth of cancer cells. Changes in the expression levels of these genes, whether increased or decreased, can impact the activation of apoptotic signaling pathways, thus regulating cancer cell survival and death[6,7]. The apoptosis-inducing gene, \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, stimulates catabolism within mitochondria and triggers phosphorylation of the tumor suppressor gene, \u003cem\u003ep53\u003c/em\u003e, leading to the sequential activation of \u003cem\u003ecaspase 9\u003c/em\u003e and \u003cem\u003ecaspase 3\u003c/em\u003e. This, in turn, causes the release of pro-apoptotic molecules such as cytochrome C from mitochondria into the cytoplasm, ultimately leading to cell apoptosis[8]. As a critical regulator of apoptosis, \u003cem\u003ep53\u003c/em\u003e promotes the transcription of\u003cem\u003e\u0026nbsp;p21\u003c/em\u003e in response to DNA damage, leading to the arrest of cell cycle and DNA synthesis. Simultaneously, it decreases the expression of anti-apoptotic \u003cem\u003eBcl-2\u003c/em\u003e and enhances apoptosis by elevating the levels of pro-apoptotic \u003cem\u003eBax.\u003c/em\u003e Therefore, \u003cem\u003ep53\u003c/em\u003e, \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, \u003cem\u003eBcl-2\u003c/em\u003e, and \u003cem\u003eBax\u003c/em\u003e all play crucial roles in regulating the apoptotic pathway, emphasizing the essentiality of these genes in initiating and executing apoptosis[9,10].\u003c/p\u003e\n\u003cp\u003eCurrent chemotherapeutic agents used for cancer treatment primarily induce apoptosis in cancer cells by inhibiting cellular division and stimulating the immune system. While effective, these agents have drawbacks, such as reducing white blood cell count, compromising immunity, neuropathy, cognitive impairment, and increased drug resistance, which can have negative effects on the overall health of cancer patients. Recently, there has been an increasing interest in natural anticancer agents that offer similar anticancer effects to conventional drugs with reduced side effects[11]. Therefore, natural product are gaining value in development of novel anticancer agents because of their safety profile and low side effects, which are inherent to their natural structure and in line with the current trend of pursuing health and safety[12].\u003c/p\u003e\n\u003cp\u003eAlthough chestnuts have been a diverse food source for centuries, the inner shells are not typically considered edible due to their high tannin content and tough texture. For centuries, chestnuts have served as a diverse food source. However, the inner shells are typically not considered edible due to their high tannin content and tough texture, posing environmental and economic challenges during disposal[13]. Various studies have been conducted for the utilization of CS, but the high tannin content poses difficulties in using them as animal feed due to the occurrence of digestive problems. Only a fer studies are introducing the potential utilization of cs as a material with skin-whitening, wrinkle-improving, and antioxidant effects[14]. The main objective of this study was to analyze the main components\u0026nbsp;of CS and evaluate the apoptotic effect on breast cancer by studying the expression of genes related to apoptosis, including \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e,\u003cem\u003e\u0026nbsp;p53\u003c/em\u003e, \u003cem\u003eBcl-2\u003c/em\u003e, and \u003cem\u003eBax\u003c/em\u003e. Finally, this study highlighted the potential of CS for developing substances inhibiting the growth of breast cancer cell, thereby presenting new possibilities for utilizing non-food agricultural byproducts as ingredients in functional foods or medicine.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003e2. 1. Raw materials and reagents\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe chestnut shells used in this study were obtained from chestnuts harvested in the fall of 2023 in the Gongju area of South Korea. They were purchased from a local retail outlet, and the shells were subsequently removed. Then, the CS was dried in convection oven (VS-1202D4N, Vision Bionex, Bucheon, Korea) at 60 \u0026plusmn; 1℃ until there was no further weight change, then pulverized to 40 mesh size or smaller (\u0026gt; 0.381 mm) using a food processor (HMF-3000S, Hanil Electric, Seoul, Korea).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. 2. Ultrasound-assisted extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the ultrasound-assisted extraction a mixture of 99.5% ethanol (Duksan, Gapyoung, Korea) and distilled water was used as the solvent. To prepare the extract, 1 g of CS powder was mixed with 10 mL of 50% ethanol in a glass tube (PYREX -1636, Scilab, Seoul, Korea) and subjected to extraction at 40 kHz and 60\u0026deg;C for 30 min using a tabletop ultrasonic extractor (SD-D250H, Sungdong, Hwaseong, Korea). The extract was centrifuged at 4℃ and 2,878 x g for 10 min using a Lobogen 1236R centrifuge (Gyrozen Co, Daejeon, Korea) to separate solid and liquid components and the supernatant obtained was stored at -21℃, diluted as needed, and used for subsequent analysis\u0026nbsp;experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. 3. Cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, fetal bovine serum, Dulbecco\u0026apos;s Modified Eagle Medium (DMEM), and trypsin-EDTA provided by Thermo Fisher (Waltham, MA, USA) were used. To evaluate the potential anticancer effect of the chestnut inner shell extract, both normal cells (HEK-293) and human-derived breast cancer cells (MDA-MB-231) were obtained from the Korea Cell Line Bank (KCLB, Seoul, Korea). Cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin, and maintained in a incubator (MCO-5AC, Sanyo, Osaka, Japan) at 37\u0026deg;C with\u0026nbsp;5% CO\u003csub\u003e2\u003c/sub\u003e. After 72 hr of culturing, the cells were harvested through washing with PBS and dissociating cell with 0.05% trypsin-EDTA for separation. The cells were collected by centrifugation at 460 x g for 2 min at 4℃, and after removing the supernatant, the cells were resuspended in DMEM and seeded in T-50 cell culture flasks at a density of 5.0 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/mL for the measurement of cytotoxicity and mRNA expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. 4. Evaluation of cancer cells viability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cancer cell growth inhibition effect of CSE was evaluated by measuring cell viability based on the 3-(4, 5-dimethylthiazole-2-yl)-2,5 diphenyl tetrazolium bromide (MTT) oxidation reaction.\u0026nbsp;HEK-293 and MDA-MB-231 were seeded in a 96-well plate at a density of 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well and incubated for 24 hr. To evaluate the effect of CSE on cell viability, various concentrations of the extract were prepared by diluting it in DMEM, ranging from 0.0 to 2.0 mg/mL. Then, 0.02 mL was added to each well for cytotoxicity assessment, followed by a 72-hr incubation. Subsequently, 100 \u0026micro;L of MTT (0.25 mg/mL) was added to each well and incubated for 4 hrs to initiate the reaction. Subsequently, the absorbance was measured at 450 nm using a microplate reader (Infinite200\u0026reg;, Tecan group, Zurich, Switzerland), and cell viability was calculated as a percentage using the following Eq. 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAtgAAABzCAYAAACil3UBAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAABhaVRYdFNuaXBNZXRhZGF0YQAAAAAAeyJjbGlwUG9pbnRzIjpbeyJ4IjowLCJ5IjowfSx7IngiOjcyOCwieSI6MH0seyJ4Ijo3MjgsInkiOjExNX0seyJ4IjowLCJ5IjoxMTV9XX1dozDOAAAZP0lEQVR4Xu3d74sd1f3A8dnvc7GtfWRFJMmTUkTQViEmFgVNUBChwd8UoRLZCEJRE+uPB6JVk2oFoUYDgg/UpEWhFNImCgomiNpaWlR8oBsk2DzyR+0/kO99z85nPXt27ty5987d3bv7fsHs3Jk7c+acMzN7P3Pm3Lkzp3sKSZIkSZ34v2osSZIkqQMG2JI0pH379hUzMzPVlCRJixlgS9IQTpw4URw4cGDhtSRJOQNsSVNp165dKxLgst0XX3yxfH3q1KlyjH//+9/le5IkGWBLmjoEshdccEGxYcOGas7y+Otf/1puc8uWLdWc75Af0H1EkrS++RQRSVOFIPeZZ54pjhw5Us1ZHl999VVxySWXFO+9915x1llnlX2wjx07tiTY3rRpU9nCXReES5LWB1uwJU0Ngtxbb7212Lt3bzVn+fz+978vA3uC6/Dxxx9Xr75DcP3rX/+6mpIkrUcG2JKmxgsvvFBcfPHFC90xlsvx48eLxx57rLjmmmvKlut4gsi3335bjlO0XH/zzTfFoUOHqjmSpPXGAFvS1HjiiSeKu+66q5paPrRIHz58uKBHXQw//elPq3eXuvfee4unnnqqmpIkrTcG2JKmQrQIX3311eV4ucSXFtPt0lWFVurPP/+8mrPYlVdeWfzjH/8onywiSVp/DLAlTYU///nPxVVXXVVNLY/nn3++2LNnTxlMp8HyLbfcUszNzZVBP91HcjxphBbuP/3pT9UcSdJ6YoAtrUEEfTfeeONYLai03K7Us6brvP7668Xll19eTS2PO+64o+wO8tlnny3q980TTJj/9ddf931aCBcD5FmStP4YYGti4uekY2CawK/tc4K3b99eDoF1SaeuxXBckdc2WJZHsTWJ8oa8LAStLDOJL8KRJn2G//CHP4z1ZcDdu3cXN998cxkornRXB7ZPK/JPfvKTas7qd/7555fdRCRJ648BtiaCAJRb6+mXwrB169ZyPAjB6NGjR6up+eC67bqjIJiMPDYhaKZcg5AWaSIvC+hCwDK0MneJeqLVmRbW9HFyDzzwQBnQs1/qgmXySHeIHK2zPHbuF7/4RdnveKX85z//Kcdnn312OW7CPqK8K+2cc84px5O4IGyLZ4anF3YpjgPe47j4wQ9+UFtnrM8xE8eOT0aRpHYMsNU5Ajz6p+YBKwEnzy/u98WwFAHitm3bqqn5QI8f9VhpUYZh5GXpp4vuGI8++mjx+OOPLwquCYo++OCD4ssvvyyfbkGwnIqgie4Qdaj773//++Uj8lbKRx99VI6bfrmRgPFnP/tZeQF05plnVnNXTlwM/O9//yvHgxDMcgzUiWC4LS6GuHjjsYJ1eJ/uNnGh95e//KV8DGF614ULA9bnmGKZnTt3FjfddNOKXjBI0rQwwFanCBD3799fzM7OVnMWi1ZdLUbQQr2Ng7qnpZwnWKTefvvt4oorriiDboJoLn4CgRZB3aCLhttvv704cOBANbX6UHYuLNpezCyHuBiIi4NB+JXIv//970uCbIJrguHbbrutmjPYnXfeWfzmN7/pu1/feOONssvNI488Uk5zEXXDDTcs2sevvPJK+UXNuMvCucuFFvMlSc0MsNWp999/vxxfdtll5bjOs88+W72abz3l9nMMw4r1omtELvo6p8shbo3HOozTftV5vurSTpdJW/5im9EyXId8sAxjlovuLxs3blzIWwyRDttgul9LZtR93spLfjZv3lxNLUYgdt999w3sq03fZwLztt1EonyDhtgfg/zzn/9sDJwpM/WUttxPG/LOBUIaZEdwzTkzTHci6qJpn3LRRfCc1teFF1646OKLL2jmT23hR344niRJzQyw1amTJ09WrwYjCOCDntvPDLR6p0HuIAQhdBthXW5j14lb4KRNa1488YFAhnUJXEgnbz3mVvjBgwfLdRnzfhpYEIhE3nmfbgmUh2UIkpsQVKb9yQmcovsL6ZI30iWgJN9pCyLzeL8OdV8XhFIH77zzTjX1HfLBl/B+9atfLQT1dLFoCqA++eST6lUz6pkyDBpifwzy3//+t3q1tqVBNvt9lOC6DfZxv4uRuOjhWKzrapN/n0CStJQBtlYMX54jcI3WTF7zoT5MC1ncNicoSVvGczwN480336ym5oOI6CPLenmXFoI/ghpajQm2cwTRsT2WI7ClPASzaStgHYLKNv3JH3zwwUWBPQE884ZFSyZlp/WZLzKSV15Td+SZvtVxIUKA/eSTT1ZrKo7NNkNXCHyffvrp4o9//GPZYtx1cD3IGWecUb2qRzcRSVIzA2x1KroitGnJ5tnC0QKdDgR7bdxzzz1lMBsBTlN3A4JathfL0KLbtJ3ojoE2wXDbPA+DPBMMR8BLi/mgFt+6Lhzx5cUf/vCHxe9+97uyJZ+gmtv/pEfwzQUIGHfx7GbqOfZL09C0zyYlz1vavSeXH5tNQ1fi4oc+0XT74cKqa9/73vf6dveJriUE0t9++235OkXQL0lqZoCtTkVQ2PQou+hDTHeQuq4LbUWrawQ3dLtoav3mKQh0JWGZc889t5q7FAEY+Sd4b/ulTNLki4Rdi1Zs8nTeeedVc+tRpn7PXY5uJ1xk4Iknnlj4gluuqQX+xz/+cfWqGcdB7JumYdAFQ2gKCIeV5201ffGWMnJ+cPFDYP3WW2+VXZi6DrLpesKxktYpT/ehX3ao+6Ecjp+LLrqompIk9WOArc5FH2FaB/OAl3nRtYJWOgLZtBWT1sSmIDlF4BHrEigNsmPHjrL/KOu1ue1+6tSpclx3EZB2ZSH4Id2uArW0RTUuWLh4IP9NomVxUP3xRJCXXnqpbx/cNMgK1AHdYvqtM2l8Aa/tj7YQNLZ5FORqE8E13XTiHKE1eZwgmxbouKhK8aQZWqgfeuihcprziPQffvjhchq//OUvyzqP7dK9iF+upM++JGmAXmAiTUQvMCTqXTTk9u7du+h9ppGuy+tjx44tWo5plk2XO3jwYLluE5afnZ2tpuYxHWn0gshyXppu+j7bRZrvWAe9wHthPgN5alMWxHReDt7P89wP6Ucd1nnuuefKZVKkfcMNN5Sv77///tpt9YLuxnQnLeq7CeViX0Q9kmfKs1LiWDh8+HA1pxnL9dvP//rXv5bstyaUm/JHXVAv+fpsL+qLMcdGjnrvBeIL9RnHqiSp2Qx/ev88Ja1StCDyq4BtulPQEnnttdcWn3766ZLWZlq247Z/2mecltNbbrmlbIXvBWHFyy+/vGhdfgDlrrvuKt57770Va8EmD/zoCXcOJtHffRLYF9x56AWlrbvCSJLWBruISKscT/poG6CxHN0L6GqQ9q8FgSndBfIAlaA5+mgzToNonsNMcP3aa6+tWHCNH/3oR+U4uu0st/jSazrw8+J0NcrrOXzxxRfl2OBaktYfA2xpFaLPbQRy0R+3LYI+HvPGj8gQII+KPrcMtHgP+iGaSWP79Bke50ux46B/PX3TZ2dnywsRBn5enLrp9xPyH374YW1/dknS2mcXEUlTIb6YOsqX/brAxc7hw4eLq6++upoz/yQcnk5T9wVXvqxIl5zf/va31RxJ0nphC7akqXDdddd18ozuUcSdgAiu6c/OXQZa1eueqsH7PIHj+uuvr+ZIktYTA2xJUyFasPnC43J79913y3F029lY/Rx+3mc9vPHGG2X3kJXuWiNJWhkG2JKmxn333Vc888wz1dTy4VnU999//0L/a7qK8ANAn3zySbXEYvxi5t13311NSZLWGwNsSVOD7hj8fHj640TLga4pl156aTU131WEVuy//e1v1Zzv0EecriNtfsxIkrQ2GWBLmhp0x+BXKPnJ++VC/+tvvvmmuOSSS6o5888O55ncZ555ZjVnHvP5eXue4iJJWr8MsCVNFVqPeZY3jxBcDvS/pj919LUm4OY547RS5z9fz0+P81QRn30tSeubAbakqcOzwQl0eVrHJLEN+lPzRJD4guPll19ePoKPeemP9sSXL+se2SdJWl98DrYkSZLUIVuwJUmSpA4ZYEuSJEkdMsCWJEmSOmSALUmSJHXIAFuSJEnqkAG2JEmS1CEDbEmSJKlDBtiSJElShwywJUmSpA4ZYEuSJEkdMsCWJEmSOmSALUmSJHXIAFuSJEnqkAG2JEmS1CEDbEmSJKlDBtiSJElShwywJUmSJmD79u3FzMxM32HXrl3VkuNjW5s2baqmtNIMsCVJkibgyJEjxbFjx8rXjE+fPr1oOHHiRPneOEiDYP3o0aPVHK0GBtiSJEkrgAB8XBs2bCiD9dnZ2WqOVgMDbEmSpGW2b9++6pXWIgNsSZKkZXT8+PHq1VL0o44+2nT/oG+1po8BtiRJ0oRt3bp1IXDmdR2C6507dy700d64cWP1jqaNAbYkSdKEpV9yjC8+pg4dOlSOd+/eXY6xbdu26pWmjQG2JEnSGOJJHunQZMuWLdWr75w8ebJ6pbXAAFuSJGkM8SSPdBiElmr6Yvtlx7XJAFuSJGkF0Bd7x44d5evNmzcXc3NziwJuAndNJwNsSZKkCeAJIPGFxvRLjjHQxzqCaLqNHDx4sNizZ8/C+/v37y/fC7R4Mz9v9Y5lCdB53fSUEi2PmdNt7mNIkiRpWcUj+rr4QRotL1uwJUmSpA4ZYEuSJK0ytF4fPXq0HPyxmeljFxFJkiSpQ7ZgS5IkSR0ywJYkSZI6ZIAtSZIkdcgAW5IkSeqQAbYkSZLUIQNsSZIkqUMG2JIkSVKHDLAlSZKkDhlgS5IkSR0ywJYkSZI6ZIAtSZIkdcgAW5IkSeqQAbYkSZLUIQNsSZIkqUMG2JIkSVKHDLAlSZKkDhlgD7Br165i+/bt1dRoDh06VMzMzJTDpk2bynmku1LYduRjHNTL8ePHq6nVq6vyBsrddEzE/h5FHCcxIN8W0/H+vn37yn3ANpGuWzew3IkTJ0aqD7ZVlybDuPXL+ml65JH9xng1iTpoY1rOj2HK1Mag8406iX08SPq/s24g76n0OIpzok7kIYaf//zni6bzIf5fj5r+rbfe2ri8pDXotBpRRQxzc3PVnOEcO3asXJ8xSIfpbdu2ldPLbXZ2ttz+xo0bqzmjIY2DBw9WU6tXV+VtizphewzDiPX27t1bzZmXp0V50rKwPO+n+yLm5TgGI/04Lkc5rllvUD7binxQrhRlHDV/kxL12qacLDMN58cwZepC7G+GYfYtx0N+jMS5nec9zqWmcz7WTdOMvDHOpf+vR02fNNJpSWvb8vxXnVJ8+MQ/yjygaIv164LplQqwQZ6aPhwGIe958ECakwyGxkl/3PIOQr7YRogP4LZYv+kY470oO6/zumc6nRdB0yAEEqPUS11eIzgZ9jxhnbTuUuStLtgZVRfnXJu6rTs/WK/LsuTGOT/aHi+jys+POFaGyS/HQt1xEudaum+Zx7LMz/cD2C7p5WlGvgbtp1HTR92xIWltsotIgwMHDhT33HNP0funWL4exXnnnVccPXp0ya3iI0eOVK+mC7c5P/vss+LGG2+s5szfDt2/f3811b1Jpz+uuH08qieffLIc79ixoxznegFQ9aooeh/axYMPPlhNzWNfpPujDnWYH4NbtmwprrrqqiW32Udx9tlnV6/ai+3efPPN5Tj36KOPVq/GN+4+aqvu/KArxJ49e6qp7q3186MJ9cz/Z/7Hpl1OLrvssnJ+fq7g1VdfHerYqjs/Rk3/2WefLW666aZqStJaZoDdBx9aBB8bNmwobrvttmJubm5JgILoD9uvP+Hu3bvL8datW/v2SyTdtL9e2ueWf+6sR/rxfvzDj+k8XebxQZ/21R3U3zFdtukD8cUXXyx27txZTc0HFJQNBH+Rd8akE30Wo/8h82I7aTnT8jFEmfqlj3T5SD9EefrVeYj8MZCHNH9RzzEv6oV10td8uBPgsEx+jERaab5zr7/+elk2jrU6HEPxHh/cHItp/tp45513qleLESikF49Rb4OOl1zUR3qRQP5IK9834c033yzHBPp1CJ7S99J9w5DiPfKenktRP8xn/7CfmE9+4niLPDKE9Jho2m918vOD/LBvkf4PIF3yHNuKOkrzE8uGmB8Dms6PtBz5sZLWZZM0jbbnB3mIfLB+0/kR6edlHcYVV1xRjt9///1yHPr93+ZiZ9AFacjXTY2SPucx+6nfOSFpDalaspXhVl56q5CqqrtF2RbpkQYDr1O9f7gLt9bT25Rx65aBZZDOA7cjeR23HeM9hsg/68b6oBzpdF1ZIz+5dFsh8kxekJY15oHtpuuSh6hT1onXeZny9MF0iPejDHVppeXNsWwsD7abpk8aUR+kw3vp8un2EOtHGnX5T/FeU/5yUaYY8v2RHiPpEPWTirT65a1Oni7DMPkPUZdt5PsojjEwP/LBfEQdBJaJ99L6i3mBPKX1mS+Tp5vjvXx/xPbS45NphrTeSTuOM7BcbDvNP1g3lq07vihHTMf2I191aTH0w/IMIY7vQPqRlyhbmj6v0/UjvwysG/mrOz4D5UnTSEV+onyM4zXrpXlhfqSTp5nmKx3SfYJR0w/Mq5svaW2xBbsGLTXc5k1bz3r/EMe6DUuXkF59l69p0UlbbNgWrZRpaxSY1/vnXrZ4sAw2b95cjnsfSuU4b/WMbfT+0S/kn1Y1lq9rjaGs5IftRssUonUxFa2a55xzTjnuh7L2PnTKOkvzR/1xezS2Q55ovQXrcPuUPFLeJtH6E+lEndFKy/qUh7TA9slHE1px6/ZtbIeWsWiZZT8Myl+IfRHdJ06dOlWOx0WZSJt9DOo0b6EEy8TAcdRk2LyRXpp+tETW5WNcHHfsH7prhehixfbY1+xjjrmYf+6555bjOtRfnD/pLf7Y32nrYy/oKo+nppbMMO75wZ0EWj/juGa7DKCMrMc2eK8JeaV8HKcsG8fr22+/vVCXcX5g0LExzPkRZWuDPFL+qIMvvviiHA/r5MmT1auluOOT7j/2d3oc1WGfx3HN6yajpI84ViStXQbYNehDxz//+KBjiA+Y+FBpiwAg/WfKP20+0Eg//imTJtvgAzA++LvU1D+WwIoP4PhAiSECla5EHeTbiQsH6oI64AOL+U34QCU4ydPigmSUD+kIqGLfRvpcmID9kgZCXSMgabvf4zY8yDflZv8N+o5AXJhNCscL+RimrzFdsDAo2OgX/LO9zz//vJoaX12gFufOqMHfMDgGGPLjGtQR5wd1Fvu8H/LKMZWnQ1A9ykXeSp8fg0RjwMUXX1yOU5F3/q/wP4YLwWHy2q/7Uhg3fUlrlwF2DYKE/MOJgQ+1+FAZRt43MPpl80HIByctkLSUpK1KXYoP1bpAm3l8qA8KcjBOS1OsGxcVOVqhaZFtE9jTOhkt3/20KU8qAgbyR/p88Y6WKdLhi6qTFK2o/Vp/CWwiuKkrNx/ugwJ0AgUGtlG3D5ouwtoath9ttPTFlzxz5DOtk/w8Qtf7pt+5MKhVGuOcH+D/S10ZQWDNhXlckDYhr9Hy3c+wgfZKnh9NOC/IB/nrF9hSbyxDn+m6LyUOwv/r/FhMjZK+Qbi09hlgZ2gh7HfLNG4HRrDTFgF0GtTEP+po/UB8KPf7gB1WeiFAvvt9ADGP1q5oTQxpS2mKZZtuyfb7EAJ5SLvAIN1OpFsXAAbSp94IhNJ1+aCP95C+x90Hlm8KACNgoJsJaRCMEvBQL21bf8nDsMcG2BbHHBd2eb1TJloI02MlLwcf6tTtINQrLd1pqxzHG+Uc9wOffEeg0xbb5KKK/ZN/mZB65LgluCG/HHecRxH8Uhb2aVysDqPfMRpppecCd7PYdlpnTcY5P/hyZFpGpMdDtNbzfr8LKtKPYzevU9KK9wgGQ9z9oIW8n5U8P/qhPNQX+WhqnEiPkbb7Mcf/rX5P+Rk2fS6S6XYjaY07rQW9D0fux5YDr1N8eSXeS9+PdXofeOV0rhc4leM0bYZULyhZmJ++zoc8D/l0bIvXaTppWdL5vQ+mau78F3JiPkO/8rDNdL0Q68X7MZ3XY14PfLEI5D1dJ9JIy8RA+iB/MY8hzVP+HmWuy3OOZWN74HW+Xlo20kXknffScjDU7bN+qIt0WYY0P2C6rnwhnV835Omxbjovyhf7JZWXLR/q8sr8pjIjLw9DWqbQ7xxK59ftA9JP90Nez3n+0vfS4zdPtw5p5ccMol5JI14zpOmDcsd7DJG3NP+sH2WOesqXR8yLIZXOj20OwjLpPo6ypNJ9EWWLemPZtBwM+XSaPvL38yEtL9K6TfNGurFsXZq9gHfJvHSIsoyaPscg4liXtPbN8Kd3wmsNoSWq909+Uatnl2gZowVsUulredCi2AsS+LSv5nyHltBRWofl+aH+aHWnS43nlrT22UVEQ6OfNN0Smm53a3WjiwXB9VzW1YDgkAs0A4DReX6oTnTZ8dyS1gcD7DWEFsnoR0nfxEl+wPNlK/qENvWX1urEcUILKy3Xed9rgkNvao3P80MpWq455yb1RXZJq49dRCRJkqQO2YItSZIkdcgAW5IkSeqQAbYkSZLUIQNsSZIkqUMG2JIkSVKHDLAlSZKkDhlgS5IkSR0ywJYkSZI6ZIAtSZIkdcgAW5IkSeqQAbYkSZLUIQNsSZIkqUMG2JIkSVKHDLAlSZKkDhlgS5IkSR0ywJYkSZI6ZIAtSZIkdaYo/h8TJzn6X31eNQAAAABJRU5ErkJggg==\"\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. 5. Evaluation of anticancer gene expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the expression of genes related to anticancer activity at the mRNA level, MDA-MB-231 cells were seeded at 5.0 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/mL on a 24-well plate, cultured for 24 hr, and treated with CSE ranging from 0.0 to 0.5 mg/mL. Total RNA was extracted from MDA-MB-231 using the Accuprep\u0026reg; universal RNA extraction kit (Bioneer, Daejeon, Korea). The extracted mRNA was reverse transcribed into cDNA using the AmpiRivert cDNA synthesis platinum master mix (GenDEPOT, Barker, TX, USA), and then amplified via RT-PCR using primers specific to \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, \u003cem\u003ep53\u003c/em\u003e, \u003cem\u003eBcl-2\u003c/em\u003e, and \u003cem\u003eBax\u003c/em\u003e (Table 1). The process of gene amplification involved denaturation carried out at 95\u0026deg;C for 15 sec, followed by binding at 60\u0026deg;C for 3 sec, and extension at 72\u0026deg;C for 25 sec. Subsequently, the gene expression was visualized by electrophoresis on a 1.5% agarose gel containing GelRed\u0026reg; nucleic acid gel stain (Komabiotech, Seoul, Korea), and the intensity of the band was quantified using Davinch-gel\u0026trade; (Youngin Lab Plus, Hercules, Seoul, Korea).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. 6. Analysis of main components\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHPLC-grade acetonitrile and formic acid (\u0026gt;99.5%) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and were used as solvents in the HPLC-MS/MS analysis for the separation and identification of components in the CSE. Prior to injection of samples, the CSE was filtered using a 0.22 \u0026micro;m syringe filter (Hyundai Micro, Seoul, Korea). Then, the sample was analyzed using a Finnigan TSQ Quantum triple quadrupole mass spectrometer (Thermo Fisher, Waltham, MA, USA) equipped with a reversed-phase C18 column (3 \u0026micro;m particle size, Restek, Bellefonte, PA, USA) measuring 3.0 \u0026times; 150 mm. The analysis was performed using electrospray ionization (ESI), and the mobile phase A and B consisted of formic acid (1.0% v/v) in water and formic acid (1.0% v/v) in acetonitrile, respectively. The gradient eluent profile was as follows: 0 ˗ 11 min, 95 \u0026rarr; 0% A; 11 ˗ 14 min, 0 \u0026rarr; 0% A; 14 ˗ 15 min, 0 \u0026rarr; 95% A; and 15 ˗ 20 min, 95 \u0026rarr; 95% A. For the qualitative analysis of main components in the range of 50 ˗ 800 m/z using the full scan mode, a sample injection volume of 10 \u0026micro;L, a flow rate of 0.2 mL/min, and a column temperature of 30\u0026deg;C were used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. 7. Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data were analyzed using Graphpad Prism Software 9 (San Diego, California, USA), and the experiments were repeated three times, and the results were presented as mean \u0026plusmn; standard deviation. To determine the statistical significance of the experimental results, one-way analysis of variance was applied. Moreover, an independent samples t-test with a significance level of \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 was used to evaluate the significance between the two experimental groups.\u003c/p\u003e"},{"header":"3. Results and Discussion","content":"\u003ch3\u003e3. 1. Evaluation of anticancer effect based on cell viability\u003c/h3\u003e\n\u003cp\u003eTo confirm the anticancer effects of CSE on cell viability of MDA-MB-231 and HEK-293, cells were treated with CSE at concentrations ranging from 0.0 to 0.2 mg/mL, and the effect of CSE on cell growth was assessed. When HEK-293 cells were treated with 1.0 mg/mL, their viability was 97.6%, indicating that the extract did not impede cell growth. In contrast, treating MDA-MB-231 with 0.5 and 1.0 mg/mL resulted in cell viability of 90.6% and 82.4%, respectively, confirming the anticancer effect of CSE by inhibiting cell growth at 1.0 mg/mL and higher (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). In comparison to other studies, which showed a cell survival rate of 50.0\u0026thinsp;~\u0026thinsp;90.0% in HEK-293 treated with 1.0 mg/mL of peanut, \u003cem\u003ePeganum harmala\u003c/em\u003e, and \u003cem\u003eaverrhoa bilimbi\u003c/em\u003e extract, CSE was found to have no cytotoxicity, as evidenced by a cell survival rate of 97.6% in HEK-293 treated with 1.0 mg/mL of CSE. This demonstrates that CSE exhibits no cytotoxicity safety in normal cells compared to traditional natural extracts[15\u0026ndash;17].\u003c/p\u003e\n\u003cp\u003eFurthermore, CSE demonstrated high anti-cancer effects by showing lower cytotoxicity in MDA-MB-231 cells compared to red cabbage, \u003cem\u003eFicus carica\u003c/em\u003e, and \u003cem\u003eAllium willeanum Holmboe bulb\u003c/em\u003e, thereby confirming its efficacy over natural substances[18\u0026ndash;20]. The study on breast cancer cells (MCF-7) treated with CSE demonstrated significant anticancer properties by inhibiting cell proliferation and inducing apoptosis. Therefore, it was predicted that similar anti-cancer characteristics would be exhibited in MDA-MB-231 cells, leading to the inhibition of cell proliferation[21]. In this research, the treatment of normal cells with CSE at 1.0 mg/mL did not show significant inhibition of cell activity, whereas significant inhibition was observed in breast cancer cells (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Thus, CSE selectively suppressed the growth of breast cancer cells without adversely affecting the viability of normal cells, indicating its potential as a safe therapeutic agent for breast cancer treatment.\u003c/p\u003e\n\u003ch3\u003e3. 2. Measurement of anticancer gene expression\u003c/h3\u003e\n\u003cp\u003eThis experiment aims to elucidate the signaling pathways associated with the inhibition of cancer cell proliferation by CSE, building upon the evidence of the anticancer effect observed in our previous research on cancer cell survival suppression. To achieve this, the evaluation of the anticancer effect of CSE on MDA-MB-231 was conducted based on investigating the mRNA expression regulation of key genes involved in apoptosis.\u003c/p\u003e\n\u003cp\u003eThe expression of \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, \u003cem\u003ep53\u003c/em\u003e, and \u003cem\u003eBax\u003c/em\u003e was significantly increased by 1.8, 1.3, and 2.6 times, respectively, at a maximum nontoxic concentration of 0.5 mg/mL(Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Conversely, the expression of \u003cem\u003eBcl-2\u003c/em\u003e was decreased by 1.2 times. These results suggest that CSE induces the expression of \u003cem\u003eBax\u003c/em\u003e and inhibits the expression of \u003cem\u003eBcl-2\u003c/em\u003e, which leads to the promotion of cell death and inhibition of cancer cell growth. Therefore, CSE may exert its anticancer effect by regulating the expression of key genes involved in breast cancer development[22].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eBcl-2\u003c/em\u003e is widely known as an antiapoptotic gene that plays a critical role in regulating cell survival and death through various mechanisms, including the regulation of oxidation-reduction, mitochondrial membrane potential, and intracellular ion distribution. On the other hand, \u003cem\u003eBax\u003c/em\u003e functions as a proapoptotic gene by activating caspases and increasing the levels of caspase-regulated upstream enzyme, \u003cem\u003eAMPK-a\u003c/em\u003e. This process leads to the activation of apoptotic pathways through the release of cytochrome C from mitochondria, followed by its binding to apoptosis protease activating factor (\u003cem\u003eApaf-1\u003c/em\u003e)[23,24]. Based on the observed increase in levels of proapoptotic \u003cem\u003eBax\u003c/em\u003e and decrease in levels of antiapoptotic \u003cem\u003eBcl-2\u003c/em\u003e, it is postulated that CSE exerts an anticancer effect on MDA-MB-231 cells by modulating the expression of \u003cem\u003eBcl-2\u003c/em\u003e and \u003cem\u003eBax\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eGiven these findings, phytochemicals in CSE are hypothesized to exert their anticancer effects by regulating the expression of key apoptosis-related genes, including \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, \u003cem\u003ep53\u003c/em\u003e, \u003cem\u003eBax\u003c/em\u003e, and \u003cem\u003eBcl-2\u003c/em\u003e. The mechanisms by which CSE regulates the expression of apoptosis-related genes, including \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, \u003cem\u003ep53\u003c/em\u003e, \u003cem\u003eBax\u003c/em\u003e, and \u003cem\u003eBcl-2\u003c/em\u003e, suggest that it has the potential to inhibit cancer cell growth and proliferation. These findings make CSE a promising candidate for further investigation as a potential anticancer agent.\u003c/p\u003e\n\u003ch3\u003e3. 3. Analysis of main components in CSE\u003c/h3\u003e\n\u003cp\u003eThe present study demonstrates that plant-derived phytochemicals in CSE modulate the expression of critical anticancer genes and induce cellular apoptosis. To confirm the hypothesis, we used HPLC-MS/MS to quantify and identify the primary constituents of CSE. Analysis of the molecular weight distribution of the components in the anion mode using deprotonated mass-to-charge ratio (m/z) allowed for the identification of two distinct components with molecular weights (MW) of 431.4 and 227.2. Based on its molecular weight, the 431.4 species detected was postulated to be an afzelin derivative with a free hydrogen atom(Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eAfzelin, a flavonoid glycoside containing rhamnosides attached to its flavonoid structure, has been found to exhibit multiple pharmacological effects, including antioxidant, anti-inflammatory, and anticancer activities[26]. According to previous studies, afzelin has been reported to exhibit specific anticancer effects on breast, liver, and prostate cancers. This is achieved by promoting the activation of caspase, controlling the expression of \u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e, \u003cem\u003eBCL-2\u003c/em\u003e, and \u003cem\u003ep53\u003c/em\u003e to induce apoptosis, and activating cytochrome C to initiate apoptosis by improving the permeability of the mitochondrial outer membrane[27\u0026ndash;29]. Based on the results of our previous experiments and subsequent analyses of the main components in CSE, the plant-derived phytochemicals present in CSE, induce cellular apoptosis by regulating key anticancer genes, with afzelin identified as one of the main components responsible for this effect.\u003c/p\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eBreast cancer poses a major health threat to women worldwide and represents a significant global health burden. As a result, there is an increasing demand for discovering novel components from natural sources to develop more effective and less side-effect-prone anticancer therapeutics in the field of oncology. Therefore, natural products have gained considerable interest as potential sources of anticancer agents due to their diverse chemical structures, low side effects, and biological activities. Among these, plant-derived phytochemicals have been extensively studied for their potential anticancer properties. With the growing interest in natural products, there is a need for further research to identify and characterize potential anticancer components from various natural sources, including plants, marine organisms, microorganisms, and agricultural byproducts.\u003c/p\u003e \u003cp\u003eThis study aimed to verify the potential apoptosis-based anticancer effect of CSE on MDA-MB-231 cells and to elucidate its underlying mechanism of action, which could contribute to the development of novel therapeutic agents for breast cancer treatment. Over the years, there has been growing interest in natural products as potential sources of therapeutic agents for cancer treatment. Among the natural products, plant-derived phytochemicals such as polyphenols and flavonoids have received considerable attention for their potential anticancer properties. These components have been found to modulate various cellular processes, including cell proliferation, differentiation, and apoptosis. The results showed a selective inhibition of MDA-MB-231 cell growth without affecting HEK-293 cell growth, confirming the potential anticancer effect of CSE. The focus of this study was to elucidate the underlying mechanism of CSE in inducing apoptosis in MDA-MB-231 cells. The findings revealed that CSE induces apoptosis through the activation of the mitochondrial pathway, which involves the upregulation of \u003cem\u003eAMPK-α\u003c/em\u003e, \u003cem\u003ep53\u003c/em\u003e, and \u003cem\u003eBax\u003c/em\u003e, and the downregulation of \u003cem\u003eBcl-2\u003c/em\u003e expression.\u003c/p\u003e \u003cp\u003eThe observed regulation of apoptosis-related genes and the induction of apoptosis provide valuable insight into the underlying mechanism of action of CSE. Additionally, the identification of afzelin as a potential main component responsible for the observed anticancer effect of CSE highlights the potential of this natural product as a source of therapeutic agents for breast cancer. These findings suggest that CSE can be a valuable source of functional food and pharmaceutical materials for breast cancer treatment, offering a natural and safe therapeutic option.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding: No funds, grants, or other support was received.\u003c/p\u003e\n\u003cp\u003eConflicts of interest/Competing interests: The authors have no competing interests to declare that are relevant to the content of this article.\u003c/p\u003e\n\u003cp\u003eCode availability: Not applicable\u003c/p\u003e\n\u003cp\u003eAuthor contributions: M.H.K. and H.Y.P. conceived the ideas; and designed the experiments. M.H.K., H.Y.P. and J.E.P. performed the experiments. M.H.K. analyzed the data. J.E.P. provided critical materials. M.H.K. and J.W.K. wrote the manuscript. M.H.K. and J.W.K. supervised the study. All the authors have read and approved the final version of the manuscript for publication.\u003c/p\u003e\n\u003cp\u003eAcknowledgments: The authors thank Jin Woo Kim for advice on the experimental design and statistical analysis. This research received no external funding.\u003c/p\u003e\n\u003cp\u003eData availability: The main data are present in the manuscript. Data details could be obtained upon request to [email protected].\u003c/p\u003e\n\u003cp\u003ePlant materials procurement: The chestnut shells used in this study were legally purchased from Coupang (Seoul, Korea), a retailer in South Korea, and only the outer shells were separated for use.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. \u003cem\u003eCA. Cancer J. Clin.\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e71\u003c/em\u003e, 209\u0026ndash;249.\u003c/li\u003e\n\u003cli\u003eRho, J.; Choi, S. A Study on the Knowledge, Attitudes, Cancer Preventive Dietary Behavior, and Lifestyles of Adults in the Jeonbuk Area. \u003cem\u003eKorean J. Hum. Ecol.\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e22\u003c/em\u003e, 201\u0026ndash;213.\u003c/li\u003e\n\u003cli\u003eWood, S.L.; Pernemalm, M.; Crosbie, P.A.; Whetton, A.D. The Role of the Tumor-Microenvironment in Lung Cancer-Metastasis and Its Relationship to Potential Therapeutic Targets. \u003cem\u003eCancer Treat. Rev.\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, \u003cem\u003e40\u003c/em\u003e, 558\u0026ndash;566.\u003c/li\u003e\n\u003cli\u003eSon, K.H.; Hwang, J.; Kim, D.; Cho, Y.-E. Effect of Corosolic Acid on Apoptosis and Angiogenesis in MDA-MB-231 Human Breast Cancer Cells. \u003cem\u003eJ. Nutr. Heal.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e53\u003c/em\u003e, 111\u0026ndash;120.\u003c/li\u003e\n\u003cli\u003eUn, H.; Ugan, R.A.; Kose, D.; Bayir, Y.; Cadirci, E.; Selli, J.; Halici, Z. A Novel Effect of Aprepitant: Protection for Cisplatin-Induced Nephrotoxicity and Hepatotoxicity. \u003cem\u003eEur. J. Pharmacol.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e880\u003c/em\u003e, 173168.\u003c/li\u003e\n\u003cli\u003eChowdhury, I.; Tharakan, B.; Bhat, G. Current Concepts in Apoptosis: The Physiological Suicide Program Revisited. \u003cem\u003eCell. Mol. Biol. Lett.\u003c/em\u003e \u003cstrong\u003e2006\u003c/strong\u003e, \u003cem\u003e11\u003c/em\u003e, 506\u0026ndash;525.\u003c/li\u003e\n\u003cli\u003eChe, F.; Chen, J.; Dai, J. On the in Vitro Anti-Myeloma Effect and Mechanism of Andrographolide through PI3K/AKT/MTOR and AMPK/MTOR Dual Signaling Pathways. \u003cem\u003eInt J Clin Exp Med\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 8374\u0026ndash;8380.\u003c/li\u003e\n\u003cli\u003eRoychowdhury, T.; Lu, H.; Hornsby, W.E.; Crone, B.; Wang, G.T.; Guo, D.; Sendamarai, A.K.; Devineni, P.; Lin, M.; Zhou, W. Regulatory Variants in TCF7L2 Are Associated with Thoracic Aortic Aneurysm. \u003cem\u003eAm. J. Hum. Genet.\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e108\u003c/em\u003e, 1578\u0026ndash;1589.\u003c/li\u003e\n\u003cli\u003eZheng, N.; Li, H.; Wang, X.; Zhao, Z.; Shan, D. Oxidative Stress-Induced Cardiomyocyte Apoptosis Is Associated with Dysregulated Akt/P53 Signaling Pathway. \u003cem\u003eJ. Recept. Signal Transduct.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e40\u003c/em\u003e, 599\u0026ndash;604.\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Neill, E.J.; Den Hartogh, D.J.; Azizi, K.; Tsiani, E. Anticancer Properties of Carnosol: A Summary of in Vitro and in Vivo Evidence. \u003cem\u003eAntioxidants\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e9\u003c/em\u003e, 961.\u003c/li\u003e\n\u003cli\u003eKim, Y.-S.; Kim, B.-H.; Kim, G.-S.; Jang, J.-S.; Kim, S.-Y.; Choi, B.-D.; Kim, J.-O.; Ha, Y.-L. Anti-Carcinogenic Actions of Glycoprotein Conjugated with Isoflavones from Submerged-Liquid Culture of Agaricus Blazei Mycelia through Reciprocal Expression of Bcl-2 and Bax Proteins. \u003cem\u003eJ. Biomed. Transl. Res.\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, \u003cem\u003e15\u003c/em\u003e, 200\u0026ndash;206.\u003c/li\u003e\n\u003cli\u003eBaker, D.D.; Chu, M.; Oza, U.; Rajgarhia, V. The Value of Natural Products to Future Pharmaceutical Discovery. \u003cem\u003eNat. Prod. Rep.\u003c/em\u003e \u003cstrong\u003e2007\u003c/strong\u003e, \u003cem\u003e24\u003c/em\u003e, 1225\u0026ndash;1244.\u003c/li\u003e\n\u003cli\u003eMorana, A.; Squillaci, G.; Paix\u0026atilde;o, S.M.; Alves, L.; La Cara, F.; Moura, P. Development of an Energy Biorefinery Model for Chestnut (Castanea Sativa Mill.) Shells. \u003cem\u003eEnergies\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 1504.\u003c/li\u003e\n\u003cli\u003eLiu, T.; Liu, X.; Li, W. Tetrandrine, a Chinese Plant-Derived Alkaloid, Is a Potential Candidate for Cancer Chemotherapy. \u003cem\u003eOncotarget\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e7\u003c/em\u003e, 40800.\u003c/li\u003e\n\u003cli\u003eHusanu, E.; Mero, A.; Rivera, J.G.; Mezzetta, A.; Ruiz, J.C.; D\u0026rsquo;Andrea, F.; Pomelli, C.S.; Guazzelli, L. Exploiting Deep Eutectic Solvents and Ionic Liquids for the Valorization of Chestnut Shell Waste. \u003cem\u003eACS Sustain. Chem. Eng.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e, 18386\u0026ndash;18399.\u003c/li\u003e\n\u003cli\u003eGoudarzi, M.; Azimi, H. Antimicrobial Activity of Peganum Harmala against Methicillin-Resistant Staphylococcus Aureus Strains and Assessment of Its Cytotoxicity Effect on HEK-293 Cells. \u003cem\u003eInt. J. Infect.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e4\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eAnantachoke, N.; Lomarat, P.; Praserttirachai, W.; Khammanit, R.; Mangmool, S. Thai Fruits Exhibit Antioxidant Activity and Induction of Antioxidant Enzymes in HEK-293 Cells. \u003cem\u003eEvidence-Based Complement. Altern. Med.\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e2016\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eNam, M.K.; Kang, K.J. The Effect of Red Cabbage (Brassica Oleracea L. Var. Capitata f. Rubra) Extract on the Apoptosis in Human Breast Cancer MDA-MB-231 Cells. \u003cem\u003eJ. Korean Soc. Food Sci. Nutr.\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e42\u003c/em\u003e, 8\u0026ndash;16.\u003c/li\u003e\n\u003cli\u003eZhang, Y.; Wan, Y.; Huo, B.; Li, B.; Jin, Y.; Hu, X. Extracts and Components of Ficus Carica Leaves Suppress Survival, Cell Cycle, and Migration of Triple-Negative Breast Cancer MDA-MB-231 Cells. \u003cem\u003eOnco. Targets. Ther.\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 4377\u0026ndash;4386.\u003c/li\u003e\n\u003cli\u003eIsbilen, O.; Volkan, E. Allium Willeanum Holmboe Exerts Anticancer Activities on Metastatic Breast Cancer Cells MCF-7 and MDA-MB-231. \u003cem\u003eHeliyon\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e7\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eCacciola, N.A.; Squillaci, G.; D\u0026rsquo;Apolito, M.; Petillo, O.; Veraldi, F.; Cara, F. La; Peluso, G.; Margarucci, S.; Morana, A. Castanea Sativa Mill. Shells Aqueous Extract Exhibits Anticancer Properties Inducing Cytotoxic and pro-Apoptotic Effects. \u003cem\u003eMolecules\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e24\u003c/em\u003e, 1\u0026ndash;12, doi:10.3390/molecules24183401.\u003c/li\u003e\n\u003cli\u003eGong, Q.; Davis, M.; Chipitsyna, G.; Yeo, C.J.; Arafat, H.A. Blocking Angiotensin II Type 1 Receptor Triggers Apoptotic Cell Death in Human Pancreatic Cancer Cells. \u003cem\u003ePancreas\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e39\u003c/em\u003e, 581\u0026ndash;594.\u003c/li\u003e\n\u003cli\u003eRongvaux, A.; Jackson, R.; Harman, C.C.D.; Li, T.; West, A.P.; De Zoete, M.R.; Wu, Y.; Yordy, B.; Lakhani, S.A.; Kuan, C.-Y. Apoptotic Caspases Prevent the Induction of Type I Interferons by Mitochondrial DNA. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, \u003cem\u003e159\u003c/em\u003e, 1563\u0026ndash;1577.\u003c/li\u003e\n\u003cli\u003eJemmerson, R.; Staskus, K.; Higgins, L.; Conklin, K.; Kelekar, A. Intracellular Leucine-Rich Alpha-2-Glycoprotein-1 Competes with Apaf-1 for Binding Cytochrome c in Protecting MCF-7 Breast Cancer Cells from Apoptosis. \u003cem\u003eApoptosis\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e26\u003c/em\u003e, 71\u0026ndash;82.\u003c/li\u003e\n\u003cli\u003eIqbal, J.; Abbasi, B.A.; Mahmood, T.; Kanwal, S.; Ali, B.; Shah, S.A.; Khalil, A.T. Plant-Derived Anticancer Agents: A Green Anticancer Approach. \u003cem\u003eAsian Pac. J. Trop. Biomed.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e7\u003c/em\u003e, 1129\u0026ndash;1150.\u003c/li\u003e\n\u003cli\u003eScognamiglio, M.; D\u0026rsquo;Abrosca, B.; Pacifico, S.; Isidori, M.; Esposito, A.; Fiorentino, A. Mediterranean Wild Plants as Useful Sources of Potential Natural Food Additives. In \u003cem\u003eEmerging Trends in Dietary Components for Preventing and Combating Disease\u003c/em\u003e; ACS Publications, 2012; pp. 209\u0026ndash;235 ISBN 1947-5918.\u003c/li\u003e\n\u003cli\u003eRachmi, E.; Purnomo, B.B.; Endharti, A.T.; Fitri, L.E. In Silico Prediction of Anti-Apoptotic BCL-2 Proteins Modulation by Afzelin in MDA-MB-231 Breast Cancer Cell. \u003cem\u003eRes. J. Pharm. Technol.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 905\u0026ndash;910.\u003c/li\u003e\n\u003cli\u003eShin, S.W.; Jung, E.; Kim, S.; Kim, J.-H.; Kim, E.-G.; Lee, J.; Park, D. Antagonizing Effects and Mechanisms of Afzelin against UVB-Induced Cell Damage. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e, e61971.\u003c/li\u003e\n\u003cli\u003eRadziejewska, I.; Supruniuk, K.; Czarnomysy, R.; Buzun, K.; Bielawska, A. Anti-Cancer Potential of Afzelin towards Ags Gastric Cancer Cells. \u003cem\u003ePharmaceuticals\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e14\u003c/em\u003e, 973.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003eTable 1. Primer sequences used in RT-PCR analysis to evaluate the expression of major genes related to anticancer activity in MDA-MB-231\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"605\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.049586776859504%\" rowspan=\"2\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"85.9504132231405%\" colspan=\"2\"\u003e\n \u003cp\u003eSequences\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50.86705202312139%\"\u003e\n \u003cp\u003eForward (5\u0026rsquo;\u0026nbsp;\u0026rarr;\u0026nbsp;3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"49.13294797687861%\"\u003e\n \u003cp\u003eReverse (3\u0026rsquo;\u0026nbsp;\u0026rarr;\u0026nbsp;5\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.072847682119205%\"\u003e\n \u003cp\u003e\u003cem\u003eAMPK-\u0026alpha;\u003csup\u003e1)\u003c/sup\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.70860927152318%\"\u003e\n \u003cp\u003eGACACCAGTTTTGCCTCCAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.21854304635762%\"\u003e\n \u003cp\u003eTCCAGAGGCGGAAGTTCTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.072847682119205%\"\u003e\n \u003cp\u003e\u003cem\u003eP53\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.70860927152318%\"\u003e\n \u003cp\u003eCCCATCCTCACCATCATCACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.21854304635762%\"\u003e\n \u003cp\u003eGCACAAACACGCACCTCAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.072847682119205%\"\u003e\n \u003cp\u003e\u003cem\u003eBcl-2\u003csup\u003e2)\u003c/sup\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.70860927152318%\"\u003e\n \u003cp\u003eATTGGGAAGTTTCAAATCACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.21854304635762%\"\u003e\n \u003cp\u003eTCTATTCCTCTGTGATGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.072847682119205%\"\u003e\n \u003cp\u003e\u003cem\u003eBax\u003csup\u003e3)\u003c/sup\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.70860927152318%\"\u003e\n \u003cp\u003eGAGCTGCAGAGGATGATGATTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.21854304635762%\"\u003e\n \u003cp\u003eAAGTTGCCGTCAGAAAACACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.072847682119205%\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.70860927152318%\"\u003e\n \u003cp\u003eGATGGGCATGAAGCATGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.21854304635762%\"\u003e\n \u003cp\u003eTGGCATGGACTGTGGTCATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003e1)\u003c/sup\u003e\u003cem\u003eAMPK-\u0026alpha;\u003c/em\u003e: AMP-activated protein kinase-\u0026alpha;, \u003csup\u003e2)\u003c/sup\u003e\u003cem\u003eBcl-2\u003c/em\u003e: B-cell lymphoma-2, and \u003csup\u003e3)\u003c/sup\u003e\u003cem\u003eBax\u003c/em\u003e: Bcl-2 associated\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Anticancer, Apoptosis, Chestnut inner shell, MDA-MB-231, Afzelin","lastPublishedDoi":"10.21203/rs.3.rs-3869891/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3869891/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe purpose of this study was to investigate the anticancer properties of chestnut inner shell extract (CSE) by evaluating its effect on the regulation of key apoptosis genes in human breast cancer cells (MDA-MB-231). To evaluate the anticancer effect of CSE, HEK-293 and MDA-MB-231 were treated with 1.0 mg/mL of CSE. The results showed no growth inhibition in HEK-293 cells, while the viability of MDA-MB-231 cells decreased to 82.7%, indicating an anticancer effect of CSE without suppressing the growth of normal cell (HEK-293). CSE treatment resulted in 1.8, 1.3, and 2.6 times enhancement of the expressions of \u003cem\u003eAMPK-α\u003c/em\u003e, \u003cem\u003ep53\u003c/em\u003e, and \u003cem\u003eBax\u003c/em\u003e, respectively, along with a 1.2 times decrease in \u003cem\u003eBcl-2\u003c/em\u003e, confirming its potential as an anticancer agent through the regulation of key apoptosis genes. The main components of CSE were analyzed using HPLC-MS/MS, and the identification of afzelin, a type of flavonoid glycoside, suggests its potential anticancer properties. Overall, CSE has been shown to effectively upregulate the expression of apoptosis genes and inhibit the growth of human breast cancer cells, making a promising natural candidate with anticancer effects in the fields of food and pharmaceuticals.\u003c/p\u003e","manuscriptTitle":"Anticancer Effect of Chestnut inner shell extract on MDA-MB-231 by Regulation of AMPK, p53, Bcl-2, and Bax Expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-23 04:35:34","doi":"10.21203/rs.3.rs-3869891/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e42bcc90-3155-4804-ae20-ff93a0bada96","owner":[],"postedDate":"February 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-07T18:11:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-23 04:35:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3869891","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3869891","identity":"rs-3869891","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-30T02:00:01.510937+00:00
License: CC-BY-4.0