Results
Noteworthy, no significant difference was detected between normal control rats and those that received Azil alone in all assessed parameters.
As shown in Fig. 2 , 3-NP-intoxicated animals displayed behavioral and motor deteriorations, as evidenced by the open field (latency time, ambulation frequency and rearing frequency) and grip strength tests. 3-NP injected rats showed a significant increase of the latency time (about 10 -folds that of the control group), F (4, 40) = 76.45, P < 0.0001. Moreover, 3-NP group rats exhibited a marked decrease in ambulation frequency (12.99% of control group), rearing frequency (23.46% of control group), and grip strength (61.38% of control group), F (4, 40) = 21.66, 32.04, and 22.42 (P < 0.0001), respectively. Treatment with Azil (5 mg/kg) produced a significant decrease in the latency time (17.80% of 3-NP group) along with an increase in ambulation frequency, rearing frequency, and grip strength (about 6-, 3- and 1.6- folds that of the 3-NP group, respectively). Similarly, administration of Azil (10 mg/kg) ameliorated the aforementioned behavioral changes as evidenced by a decrease of latency time (12.32% of 3-NP group), meanwhile the ambulation, rearing frequencies as well as the grip strength were markedly increased (about 7-, 3- and 1.7-folds that of 3-NP-treated rats, respectively). Fig. 2 Effect of Azil (5 or 10 mg/kg) on 3-NP-induced behavioral abnormalities. A Latency time, B Ambulation frequency, C Rearing frequency and D Grip strength. Each bar represents mean ± S.D. (n = 9). Statistical analysis was carried out by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. Azil azilsartan, 3-NP 3-nitropropionic acid
Effect of Azil (5 or 10 mg/kg) on 3-NP-induced behavioral abnormalities. A Latency time, B Ambulation frequency, C Rearing frequency and D Grip strength. Each bar represents mean ± S.D. (n = 9). Statistical analysis was carried out by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. Azil azilsartan, 3-NP 3-nitropropionic acid
As depicted in Fig. 3 , 3-NP-treated rats displayed GABA and glutamate striatal imbalance as shown by the significant rise in glutamate level (about fivefolds that of the control group) and the prominent reduction in GABA level (25.88% of the control rats), F (4, 25) = 628.3 and 96.37, P < 0.0001, respectively. Conversely, Azil (5 mg/kg) administration succeeded to decrease the glutamate level (61.10% of 3-NP group) and replenishing the GABA level (about 2.3-folds that of 3-NP-treated animals). Meanwhile, administration of Azil (10 mg/kg) showed more significant decrease in the elevated glutamate level (34.14% of 3-NP group) and also raised the GABA level to reach (about threefolds that of the 3-NP-treated rats). Fig. 3 Effect of Azil (5 or 10 mg/kg) on 3-NP-induced changes in striatal neurotransmitters A glutamate and B GABA. Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried out by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, GABA γ-amino butyric acid
Effect of Azil (5 or 10 mg/kg) on 3-NP-induced changes in striatal neurotransmitters A glutamate and B GABA. Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried out by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, GABA γ-amino butyric acid
As presented in Fig. 4 A and B, the expression of AT1R and NF-κB p65 were significantly elevated in 3-NP-treated rats (about 6.5-folds that of the control rats, respectively), F (4, 10) = 56.86 and F (4, 25) = 118.6, respectively. In contrast, 3-NP intoxication caused a down-regulation of IκB expression to (30.57% that of the control rats), F (4, 25) = 281, (P < 0.0001) (Fig. 4 C). However, 3-NP-induced increment in AT1R and NF-κB p65 expression were hampered by Azil (5 mg/kg) (51.84% and 40.79% of the 3-NP-treated rats’ values, respectively). Moreover, treatment with Azil (5 mg/kg) mitigated the depletion of the IκB expression (about 2.5-folds the 3-NP-treated rats’ values). The striatal levels of AT1R and NF-κB p65 expression were markedly reduced by Azil (10 mg/kg) administration (40.62% and 31.59% of the 3-NP-treated rats’ values, respectively). Meanwhile, treatment with Azil (10 mg/kg) significantly raised the IκB expression (about threefolds that of 3-NP-treated rats). Fig. 4 Effect of azilsartan (5 or 10 mg/kg) on 3-NP-induced changes in striatal NF-κB signalling pathway parameters. A Densitometric analysis of the Western blots, B ATR1 mRNA expression, C NF-κB p65 expression, D IκB expression, E TNF-α content, F IL-1β content, G COX-2 content, and H iNOS content . Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, AT1R angiotensin II receptor type 1, IκB inhibitor of kappa-B, NF-κB nuclear factor kappa-b P65, TNF-α tumor necrosis factor-alpha, IL-1β interleukin-1 beta, COX-2 cyclooxygenase-2 and iNOS inducible nitric oxide synthases
Effect of azilsartan (5 or 10 mg/kg) on 3-NP-induced changes in striatal NF-κB signalling pathway parameters. A Densitometric analysis of the Western blots, B ATR1 mRNA expression, C NF-κB p65 expression, D IκB expression, E TNF-α content, F IL-1β content, G COX-2 content, and H iNOS content . Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, AT1R angiotensin II receptor type 1, IκB inhibitor of kappa-B, NF-κB nuclear factor kappa-b P65, TNF-α tumor necrosis factor-alpha, IL-1β interleukin-1 beta, COX-2 cyclooxygenase-2 and iNOS inducible nitric oxide synthases
As presented in Fig. 4 D–G, 3-NP intoxication increased the striatal levels of TNF-α, IL-1β, COX2 and iNOS (about 5.3-, 3-, 4.6- and 4.3-folds that of the control rats, respectively), F (4, 25) = 511.1, 383.8, 175.3 and 104.4, respectively. However, 3-NP-induced increment in TNF-α, IL-1β, COX-2 and iNOS was hampered by Azil (5 mg/kg) (41.12%, 51.53%, 41.66% and 50.34% of the 3-NP-treated rats’ values, respectively). Meanwhile, the striatal levels of TNF-α, IL-1β, COX2 and iNOS were markedly reduced by Azil (10 mg/kg) administration (31.60%, 43.49%, 29.45% and 28.55% of the 3-NP-treated rats’ values, respectively).
Data in Fig. 5 shows that 3-NP injection produced a significant upsurge in striatal MDA content and KEAP1 expression (about 4- and 4.8-folds that of the control group, respectively), F (4, 25) = 388.1 and 400.8 P < 0.0001, respectively. However, 3-NP depleted striatal SDH activity, NQO-1, and HO-1 contents as well as Nrf2 expression (38.62%, 46.70% and 29.25%, and 20.73% that of the control group, respectively), F (4, 25) = 92.34, 591.3, 138.8, 253.7, P < 0.0001, respectively. Interestingly, Azil (5 mg/kg/day) administration hampered 3-NP-induced elevation in MDA content and KEAP1 expression (51.20% and 46.90% that of 3-NP group values, respectively). Moreover, striatal SDH, NQO-1, and HO-1 as well as Nrf2 expression were remarkably up-regulated in Azil 5 mg-treated rats (about 2.2-, 2-, 2.5- and 3.2-folds that of 3-NP group values, respectively). Meanwhile, administration of Azil (10 mg/kg) decreased MDA striatal content and KEAP1 expression (38.74% and 36.98% that of the 3-NP-treated rats, respectively). Moreover, striatal contents of SDH, NQO1 and HO1 as well as Nrf2 expression was significantly elevated in Azil 10 mg-treated rats (2.3-, 2-, 3- and 4-folds, that of 3-NP group values, respectively). Fig. 5 Effect of Azil (5 or 10 mg/kg) on 3-NP-induced changes in striatal Nrf2 signalling pathway parameters. A Densitometric analysis of the Western blots, B MDA content, C SDH activity, D KEAP1 expression, E Nrf2 expression, F NQO-1 content, and G HO-1 content. Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the normal control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, MDA malondialdehyde, SDH succinate dehydrogenase, KEAP1 Kelch-like ECH-associated protein -1, Nrf2 nuclear factor erythroid 2-related factor 2, NQO-1: NAD(P)H quinone oxidoreductase-1and HO-1: heme oxygenase-1
Effect of Azil (5 or 10 mg/kg) on 3-NP-induced changes in striatal Nrf2 signalling pathway parameters. A Densitometric analysis of the Western blots, B MDA content, C SDH activity, D KEAP1 expression, E Nrf2 expression, F NQO-1 content, and G HO-1 content. Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the normal control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05. c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, MDA malondialdehyde, SDH succinate dehydrogenase, KEAP1 Kelch-like ECH-associated protein -1, Nrf2 nuclear factor erythroid 2-related factor 2, NQO-1: NAD(P)H quinone oxidoreductase-1and HO-1: heme oxygenase-1
Figure 6 reveals that 3-NP markedly increased striatal caspase-3 and BAX content (about 5.4-and 2.4-folds that of the control group, respectively), F (4, 25) = 215.3 and 574.3, respectively, while increasing Bcl2 content (45.83% of the control), F (4, 25) = 258.2, P < 0.0001, producing a marked elevation in the BAX/BCL2 ratio (about 5-folds that of the control), F (4, 25) = 360.6. On the other hand, treatment with Azil (5 mg/kg) succeeded in reversing the increase in caspase-3, BAX and BAX/BCL2 ratio (54.39%, 56.82% and 34.78% that of the 3-NP-treated group, respectively). Moreover, Azil (5 mg/kg)-treated rats exhibited a 1.7-folds increase in BCL2 as compared to 3-NP-treated rats. Meanwhile, Azil (10 mg/kg)-treated rats demonstrated a decline in striatal caspase-3, BAX as well as, BAX/BCL2 (31.68%, 48.02% and 26.87% that of 3-NP-treated rats, respectively). Furthermore, Azil (10 mg/kg)-treated rats exhibited a 1.8-folds increase in BCL2 as compared to 3-NP-treated animals. Fig. 6 Effect of azilsartan (5 or 10 mg/kg) on 3-NP-induced changes in striatal apoptosis. A caspase-3 content, B BAX content, C BCL2 content, and D BAX/BCL2 ratio. Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried out by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the normal control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05, c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, BAX Bcl-2-associated X protein and BCL2 B-cell lymphoma 2
Effect of azilsartan (5 or 10 mg/kg) on 3-NP-induced changes in striatal apoptosis. A caspase-3 content, B BAX content, C BCL2 content, and D BAX/BCL2 ratio. Each bar represents mean ± S.D. (n = 6). Statistical analysis was carried out by one-way ANOVA followed by Tukey’s multiple comparisons test. a: significantly different from the normal control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05, c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, BAX Bcl-2-associated X protein and BCL2 B-cell lymphoma 2
Microscopic examination of the striatum region of the brain from the control group (Fig. 7 and B) and Azil group (Fig. 7 C and D) showed normal striatal structure. However, brain sections of the 3-NP-treated group (Fig. 7 E and F) revealed congested blood vessels with focal gliosis, numerous dark degenerating neurons, and numerous dilated vessels with perivascular and neural edema. On the other hand, brain sections from 3-NP rats treated with Azil (5 mg/kg) (Fig. 7 G and H) showed few degenerating cells and mild neuronal edema. Besides, brain sections from 3-NP rats treated with Azil (10 mg/kg) (Fig. 7 I and J) showed normal structure with no histopathological changes. Fig. 7 Effect of Azil (5 or 10 mg/kg) on 3-NP-Induced Histopathological Changes. Photomicrographs of sections A and B show normal histological structure of the striatum of rats receiving saline (control group). Photomicrographs of sections C and D show the normal histological structure of the striatum of rats receiving Azil alone. Photomicrograph of sections E of 3-NP treated rats shows congested blood vessels (arrow) with focal gliosis and F neuronal and perivascular lymphocytic infiltration and edema (arrow). Photomicrograph of sections G and H of Azil 5 mg-treated rat shows few degenerating cells (arrow) and H mild neuronal edema. Photomicrograph of section I and J of Azil 10 mg-treated rat shows apparently normal striatum with no histopathological changes
Effect of Azil (5 or 10 mg/kg) on 3-NP-Induced Histopathological Changes. Photomicrographs of sections A and B show normal histological structure of the striatum of rats receiving saline (control group). Photomicrographs of sections C and D show the normal histological structure of the striatum of rats receiving Azil alone. Photomicrograph of sections E of 3-NP treated rats shows congested blood vessels (arrow) with focal gliosis and F neuronal and perivascular lymphocytic infiltration and edema (arrow). Photomicrograph of sections G and H of Azil 5 mg-treated rat shows few degenerating cells (arrow) and H mild neuronal edema. Photomicrograph of section I and J of Azil 10 mg-treated rat shows apparently normal striatum with no histopathological changes
Control group showed mild GFAP expression in the striatum region (Fig. 8 A). Similarly, Azil group exhibited mild GFAP positive staining (Fig. 8 B). In contrast, 3-NP-treated rats exhibited significant increase in GFAP expression (Fig. 8 C). However, 3-NP rats treated with Azil (5 mg/kg) showed less expression levels of GFAP (Fig. 8 D). Similarly, 3-NP rats treated with Azil (10 mg/kg) demonstrated less GFAP expression (Fig. 8 E). Fig. 8 Effect of Azil (5 or 10 mg/kg) on 3-NP-induced changes in GFAP expression. Control ( A ) and Azil ( B ) groups exhibited mild GFAP expression in the striatum region. In contrast. 3-NP group ( C ) exhibited significant increase in GFAP expression. Lower expression levels were detected in 3-NP + Azil 5 ( D ) and 3-NP + Azil 10 ( E ) groups. F : GFAP immunostaining area %. Each bar represents mean ± S.D. (n = 3). Statistical analysis was carried out by Kruskal–Wallis ANOVA followed by Dunn’s multiple comparison test. a: significantly different from the normal control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05, c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, GFAP glial fibrillary acidic protein
Effect of Azil (5 or 10 mg/kg) on 3-NP-induced changes in GFAP expression. Control ( A ) and Azil ( B ) groups exhibited mild GFAP expression in the striatum region. In contrast. 3-NP group ( C ) exhibited significant increase in GFAP expression. Lower expression levels were detected in 3-NP + Azil 5 ( D ) and 3-NP + Azil 10 ( E ) groups. F : GFAP immunostaining area %. Each bar represents mean ± S.D. (n = 3). Statistical analysis was carried out by Kruskal–Wallis ANOVA followed by Dunn’s multiple comparison test. a: significantly different from the normal control group at P ≤ 0.05. b: significantly different from 3-NP-treated group at P ≤ 0.05, c: significantly different from Azil (5 mg/kg)-treated group at P ≤ 0.05. Azil Azilsartan, 3-NP 3-nitropropionic acid, GFAP glial fibrillary acidic protein
Material
Adult male Wistar rats (200–250 g) were purchased from the animal colony of the Faculty of Pharmacy, Cairo University, Egypt. Rats were kept under the proper conditions of suitable humidity (60–70%), ventilation (10–20 changes/h), temperature (25 ± 2 °C), and constant 12/12 h light/dark cycle with free access to a standard rodent chow diet and water. The study adheres to the Guide for Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 2011) and was approved by the Ethics Committee for Animal Experimentation at the Faculty of Pharmacy, Cairo University (Permit Number: PT 2503).
3-NP was bought from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA), while Azil was procured from Rameda Pharmaceutical (Egypt). 3-NP and Azil were dissolved in normal saline (0.9%) for intraperitoneal (i.p.) injection and oral (p.o.) administration, respectively. All other chemicals used in the study were from the top grade available commercially.
As depicted in Fig. 1 , rats were randomly assigned into 5 groups, 9 rats per group and treated for 14 days as follows: Group I (Control) received i.p. injection of normal saline and served as the normal control group; Group II (Azil) received Azil (10 mg/kg, p.o.); Group III (3-NP) received i.p. injection of 3-NP (10 mg/kg/day, i.p.) [ 33 ]; Group IV (3-NP + Azil 5) received azil (5 mg/kg, p.o.) [ 34 ] 1 h before 3-NP injection and Group V (3-NP + Azil 10) received Azil (10 mg/kg, p.o.) [ 35 ] 1 h before 3-NP injection. Fig. 1 Timeline of the experimental design. 3-NP 3-nitropropionic acid, Azil azilsartan
Timeline of the experimental design. 3-NP 3-nitropropionic acid, Azil azilsartan
Twenty-four hours after the last 3-NP injection, rats were subjected to behavioural tests namely; open field and grip strength tests.
Open field test was done to assess behavioural responses like spontaneous locomotor activity and exploratory behaviour of rats [ 36 ]. The test was done in an 80 × 80 cm wooden box with a height of 40 cm. The floor of the box was divided into 16 squares with white lines separating them. The test was done in a quiet room under white light. Each rat was placed in the centre of the open field box gently and the locomotor activity was recorded for 3 min. The box was cleaned with 10% isopropyl alcohol and dried carefully for each animal to avoid any disturbing substances left by the previous animal. The following parameters were recorded for each animal during the 3 min assessment period [ 37 , 38 ]. The latency time: time passed until the animal decides to move from the starting point (the central area) measured in seconds. Ambulation frequency: the number of squares crossed over by the animals. Rearing frequency: number of times the animal stood, stretched on its hind limbs with or without the support of the forelimb.
The latency time: time passed until the animal decides to move from the starting point (the central area) measured in seconds.
Ambulation frequency: the number of squares crossed over by the animals.
Rearing frequency: number of times the animal stood, stretched on its hind limbs with or without the support of the forelimb.
The grip strength of rats was evaluated by a rat grip strength meter (Model 47200, Ugo Basile, Comerio, Italy) [ 39 ]. Rats were carefully placed over a base plate forward-facing a triangle bar. When the rat gripped the bar by its forelimbs, it was gently dragged by its tail horizontally backward away from the triangle bar until its forelimbs are released. The maximum pulling force (g) was recorded when the animal lost its grip on the grasping bar (when its front paws grasping the bar were released). For each rat, the average of three values was recorded.
After the behavioural assessments, rats were sacrificed by decapitation under anaesthesia with thiopental. Brains were quickly removed and rinsed with ice-cold saline. Two sets of rats were designated for each group: one for histological examination and the other for biochemical parameters. In the first set of samples (n = 3), brains were fixed in 10% (v/v) buffered formalin for 72 h to perform staining with haematoxylin and eosin (H&E) for the histopathological examination. In the second set of samples (n = 6), right striatum was properly separated and homogenized in ice-cold saline to prepare a 10% homogenate for the assessment of malondialdehyde (MDA), succinate dehydrogenase (SDH) by colorimetric technique, glutamate, gamma-aminobutyric acid (GABA), haem oxygenase-1 (HO-1), NAD(P)H: quinone oxidoreductase-1, tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), cyclooxygenase-2 (COX-2), inducible nitric oxide synthases (iNOS), caspase-3, Bcl-2-associated X protein (BAX) and B-cell lymphoma 2 (BCL2) by using rat ELISA kits. Left striatum of the second set was used for assessment of IκB, NF-κB p65, KEAP1 and Nrf2 by Western blot analysis as well as AT1R using RT-PCR.
MDA content and SDH activity were determined in the striatal homogenate colorimetrically using a specific kit (Biodiagnostic, Egypt, Cat. No. MD25 28 and Biovision, USA, Cat. No. K660-100), respectively.
In ice-cold phosphate-buffered saline, striata were homogenized to yield 10% homogenates and the content of each parameter in the striatum was determined using the matching rat-specific commercial kits according to the manufacturer’s instructions. TNF-α, BAX, and BCL2 were assessed using Cusabio (Wuhan, China) ELISA kits (Cat. No. CSB-E11987r, CSB-EL002573RA and CSB-E08854r, respectively). Moreover, MyBiosource (San Diego, CA, USA) ELISA kits were used for determination of glutamate, GABA, IL-1β, NQO1, HO-1, COX-2, caspase-3 and iNOS (Cat. No. MBS756400, MBS045103, MBS825017, MBS7606601, MBS 764989, MBS 266603, MBS7244630 and MBS 263618, respectively).
Using RIPA lysis buffer, the separated striatal tissues were lysed and their protein content was determined using the Bradford protein assay kit (Thermo Fisher Scientific Inc., MA, USA) according to the method of Bradford [ 40 ]. After protein quantification of striata, 10 μg of total protein was separated by Sodium Dodecyl Sulfate PolyAcrylamide Gel Electrophoresis gel (SDS-PAGE) and transferred onto polyvinylidene difluoride membranes (Pierce, Rockford, IL, USA). To block the non-specific binding sites, membranes were soaked in tris-buffered saline with Tween 20 (TEST) buffer and 3% bovine serum albumin (BSA) at room temperature for 1 h. Afterward, membranes were incubated overnight at 4 °C with the primary antibodies directed against IκB (Cat. no. MA5-15132), NF-κB p65 (Cat. no. 436700), KEAP1 (Cat. no. PA5-99434), Nrf2 (Cat. no. PA5-27882) and β-actin (Cat. no. MA5-15,739). The blots were incubated with horseradish peroxidase-conjugated secondary antibody (Dianova, Hamburg, Germany) at 37 °C and left for 1 h after washing them many times. Protein bands were obtained by an enhanced chemiluminescence substrate reaction (Amersham Biosciences, Arlington Heights, IL, USA). Using densitometric analysis utilizing a scanning laser densitometer (Biomed Instrument, Inc., CA, USA), the corresponding intensities of the protein bands were measured. The results were expressed as arbitrary units relative to the intensity of the corresponding β-actin bands.
Striatal AT1R gene expression was detected by RT-PCR. SV total RNA extraction kit (Invitrogen, CA, USA) was used to extract RNA from the striatal tissues. The extracted RNA was reverse transcribed into cDNA using RT-PCR kit (Thermo Fisher Scientific, MA, USA) according to the manufacturer’s instructions. The primer sequences were as follows: AT1R, F: GCACACTGGCAATGTAATGC, R: GTTGAACAGAACAAGTGACC and ß-Actin, F: CCCATCTATGAGGGTTACGC, R: TTTAATGTCACGCACGATTTC. The PCR reactions were set up in 50 µl reaction mixtures, which contained 25 μl SYBR green mix, 0.5 μl cDNA, 2 μl primer pair mix (5 pmol/μl each primer) and 22.5 μl RNAse free water. PCR program was set up as follows: 95 °C for 10 min, followed by 45 cycles of 15 s (denaturation) and 1 min at 60 °C (annealing/extension). The target gene’s relative expression was estimated using the 2 − ΔΔCT formula. β-Actin was used as a housekeeping gene to normalize the mRNA levels of the target gene.
Brains were washed and fixed in 10% (v\v) buffered formalin for 72 h. Then, samples were processed to be embedded in paraffin with the preparation of 3 μm sections. Tissue sections were stained by hematoxylin and eosin (H&E) as a general staining method and inspected microscopically by light microscope (magnification × 200 and × 400). Images were captured and processed using Adobe Photoshop (version 8.0).
Immunohistochemical staining of glial fibrillary acidic protein (GFAP) was performed using a rat monoclonal antibody (Santa Cruz Biotechnology, TX, USA). All procedures were performed according to the manufacturer’s instructions. The extent of positive immunostaining in five random non-overlapping fields per tissue section was calculated as the area percentage of expression using cellSens Dimension software (Olympus software).
The results were analysed by one-way ANOVA followed by Tukey's multiple comparisons tests, except for the GFAP area%, which were analysed using Kruskal–Wallis ANOVA followed by Dunn's multiple comparison test. All results were expressed as mean ± S.D. Statistical analysis was achieved using GraphPad Prism software (version 6). A probability level of < 0.05 was accepted in all statistical tests as statistically significant.
Discussion
The current study verified the potential neuroprotective effect of both doses of Azil (5 or 10 mg/kg) in 3-NP-induced neurotoxicity in rats. This notion is evidenced by (i) an improvement in 3-NP-induced motor dysfunction; (ii) the increase of striatal GABA content and the decrease of glutamate content; (iii) the mitigation of 3-NP-induced striatal inflammation evidenced by the inhibition of NF-κB with its downstream inflammatory pathway, (v) the alleviation of 3-NP-induced striatal oxidative stress evidenced by the activation of Nrf2 with its downstream anti-oxidant pathway (vi) the improvement of 3-NP-induced striatal apoptosis and (vii) the improvement in striatal histopathological changes mediated by 3-NP.
Injection of 3-NP to rats is considered as a well-established experimental model of HD. When given systemically, 3-NP can easily cross the BBB [ 41 ] and cause bilateral striata lesions [ 42 ] and therefore, mimics the symptoms and neuropathology of HD in humans [ 43 – 45 ]. Herein, 3-NP intoxication resulted in diminished locomotor activity and loss of grip strength as proved by the results of the open field and grip strength tests, indicating motor impairment and striatal neurodegeneration, like that established in the late stages in HD patients [ 46 ]. These results go in line with previous studies demonstrating similar pattern of behavioural and motor abnormalities after 3-NP injection [ 47 – 49 ]. 3-NP-induced neurodegeneration was further confirmed by the histopathological examination, where the striatum of 3-NP-treated rats presented numerous degenerating neurons and congested blood vessels with focal gliosis, confirmed by the significant increase in GFAP immunoexpression. GFAP is an acidic protein that exclusively exists in the astrocytes and plays a significant role in astrogliosis in central nervous systems injuries and neurodegeneration [ 50 ]. Such neuronal damage is similar to what reported by prior studies [ 49 , 51 , 52 ]. However, Azil administration 1 h before 3-NP successfully diminished the striatal degeneration as well as motor impairment induced by 3-NP. These were evidenced by the marked improvement of locomotor activity and grip strength of those rats as compared to 3-NP-treated rats. Moreover, Azil prevented 3-NP-induced histopathological changes, where sections from stria of treated rats were apparently normal with no pathological changes and demonstrated less striatal GFAP expression. The neuroprotective effect of Azil was previously reported against rotenone-induced rat model of Parkinson’s disease [ 34 ], cerebral ischemia rat model [ 52 ] and aluminium chloride-induced neurobehavioral and pathological changes in rats [ 53 ].
The involvement of striatal neurotransmitters, GABA and glutamate, in HD pathogenesis as well as in 3-NP-induced experimental neurotoxic model is well reported [ 54 ]. 3-NP-induced neurotoxicity is known to be selective to the GABAergic neurons of the striatum [ 22 ]. Moreover, it is well recognized that 3-NP-triggered neurotoxicity incorporates glutamate-related excitotoxicity [ 55 ], where 3-NP was reported to produce an excessive release of glutamate in experimental rat striatal tissues [ 51 ]. Taken together, 3-NP-induced neurotoxicity could partially be due to the imbalance between the excitatory glutamate and the inhibitory GABA neurotransmitter in the striatum. This complies with the outcomes of the present study, where 3-NP-treated rats demonstrated elevation of striatal glutamate content along with decline of GABA content in the striatum. In contrast, Azil succeeded to restore the neurotransmitters balance, further confirming its neuroprotective potential in 3-NP-induced neurotoxicity.
The dysregulation of RAS was reported to be implicated in several neurodegenerative disorders [ 56 , 57 ]. The mRNA expression of AT1R is reported to be elevated in all brain areas in a transgenic model of HD [ 57 ]. Similarly, in the current study, the expression of AT1R was significantly increased in 3-NP-treated rats. NF-ĸB is a critical player in the pathogenesis of several neurodegenerative disorders [ 58 , 59 ]. The downstream signalling of AT1R is proven to lead to the activation of NF-κB [ 60 ]. In addition, it was reported that NF-κB activity is significantly up-regulated in the striatum of wild-type animals following 3-NP intoxication [ 33 , 61 ] and in cultured mHtt-expressing cells [ 62 ]. Therefore, blocking NF-κB signal pathway is believed to be a potential target that could partially diminish 3-NP-induced striatal toxicity. In the resting state, NF-ĸB is held in the cytoplasm through association with IĸB proteins. Stimuli that trigger the stimulation of the IKK, result in phosphorylation and degradation of IĸB proteins with the consequent translocation of NF-ĸB to the nucleus, where it indorses the transcription of target genes encoding pro-inflammatory cytokines such as IL-1β, TNF-α and IL-6 [ 63 ]. It is also described that the elevation in TNF-α can also induce NF-κB activation [ 64 , 65 ]. The results of the present study confirmed the implication of neuroinflammation initiated by AT1R/NF-ĸB pathway activation in 3-NP-induced neurotoxicity. 3-NP-treated rats showed elevated expression of AT1R and NF-ĸB p65 along with diminished IκB expression in the striatum with the consequent elevation of downstream pro-inflammatory cytokines including TNF-α and IL-1β. These results are in line with previous ones demonstrating significant elevation of NF-ĸB and pro-inflammatory mediators in 3-NP-treated rats [ 66 , 67 ]. However, Azil showed an anti-inflammatory activity via reducing the AT1R and NF-ĸB p65 expression and the TNF-α and IL-1β levels along with increasing the expression of IκB. In line, Azil was previously reported to inhibit NF-κB and its downstream inflammatory mediators in renal ischemia reperfusion rat model [ 30 ].
The up-regulated expression of COX-2 has been considered as a significant cause of the neurotoxicity accompanied with inflammation [ 68 , 69 ]. Herein, 3-NP-treated rats demonstrated significant elevation in striatal COX-2 content, which is in line with previous results [ 59 , 70 ]. However, treatment with Azil lead to suppression of striatal COX-2 level as compared with 3-NP group. In agreement, Azil was previously reported to down-regulate COX-2 in a rat model of experimental periodontitis [ 28 ] and endometriosis [ 71 ]. Since it is well identified that COX-2 expression is mediated by NF-ĸB activation [ 72 ], the suppressing effect of Azil on COX-2 level could be explained by its NF-ĸB inhibitory action and this effect also contributes to its anti-inflammatory properties.
Additionally, iNOS is an enzyme which is induced during inflammatory conditions and it has been reported to be involved in neurodegenerative diseases [ 73 ]. iNOS can binds to COX-2 and boost its activity [ 74 ]. Thus, increased iNOS level, as reported herein in 3-NP-treated rats, leads to rise in COX-2 activation. In parallel, increased iNOS striatal content was previously reported in 3-NP-induced neurotoxicity in rats [ 75 ]. However, treatment with Azil successfully down-regulated iNOS expression compared to 3-NP-treated rats. Therefore, iNOS inhibition by Azil may have further reduced COX-2 level as well as inflammatory deterioration in striatum. A previous study reported that Azil suppress iNOS expression in lipopolysaccharide-activated microglia [ 76 ].
Mitochondrial dysfunction is a major hallmark of HD in human and it is considered as one of the key features of 3-NP-induced HD in animal models [ 49 , 77 ]. 3-NP irreversibly inhibits SDH enzyme which is a crucial enzyme in the electron transport chain, Krebs cycle and superoxide control [ 78 ]. Inhibition of SDH leads to impeding energy production [ 7 , 79 , 80 ], triggers mitochondrial dysfunction [ 47 ], and causes excessive oxidative stress response that consequently leads to neuronal injury [ 22 ]. Since striatal neurons are extremely sensitive to derangement in energy metabolism, such mitochondrial dysfunction increase the susceptibility of striatum to acute intoxication with mitochondrial toxins such as 3-NP in both experimental and clinical studies [ 80 ]. Herein, 3-NP administration was associated with inhibition of striatal SDH activity in rats which go in line with previous studies [ 49 , 67 , 80 ], an effect that was reversed by Azil restoring mitochondrial activity. These findings comply with previous ones demonstrating that treatment with Azil significantly decreased the activity of SDH in high-fat diet (HFD)-induced sarcopenic obesity in rats [ 81 ]. Azil has been also reported to attenuate oxidative injury in brain endothelial cells via regulating mitochondrial activity [ 29 ]. A previous study also showed that pretreatment with Azil restores mitochondrial viability as well as the activities of mitochondrial complexes in cerebral ischemia in rats [ 52 ].
Further, the 3-NP-triggered oxidative stress was evident in the current study by the increased MDA striatal level signifying elevated lipid peroxidation. However, treatment with Azil reduced MDA level in striatum of 3-NP-treated rats, demonstrating its anti-oxidant properties that could contribute to its neuroprotective potential. Azil was previously reported to ameliorate oxidative stress in ethanol-induced gastric ulcers in rats [ 82 ] and cerebral ischemia reperfusion at model [ 83 ].
The oxidative stress injurious effects are usually offset by Nrf2, which is a major controller of the antioxidant-response that up-regulates genes of phase II detoxifying enzymes, such as HO-1 and NQO-1 [ 84 ]. These enzymes guard against the ROS-induced body damage [ 85 ]. Ubiquitination and degradation of Nrf2 in the cytoplasm is mediated by KEAP1, so that activation of Nrf2 depends on KEAP1 dissociation [ 86 ]. Upon activation, Nrf2 translocates into the nucleus and binds to antioxidant response elements (ARE) promoting the transcription of many antioxidant-related genes [ 87 ]. The vital role of Nrf2 signalling in hampering oxidative stress in HD animal models has been reported [ 26 , 88 ]. In the present study, striatum of 3-NP-treated rats showed suppression of Nrf2 expression and up-regulation of KEAP1 expression along with decrease in level of Nrf2-targeted anti-oxidant enzymes (HO-1 and NOQ-1). This finding is consistent with a preceding study reporting that Nrf2 expression was significantly diminished in the striatum of 3-NP rats [ 75 ]. Contrariwise, Azil administration was associated with a significant decrease of the repressor KEAP1 and increase in Nrf2 expression compared to 3-NP treated group. This increase in Nrf2 expression was accompanied by an increase in HO-1 and NOQ-1 levels. In line with those results, it was reported that Azil diminishes lipopolysaccharide-induced acute lung injury in mice via increasing the expression of both Nrf2 and HO-1 [ 89 ]. These results suggest that activation of Nrf2 signalling pathway may be a possible mechanism by which Azil can alleviate oxidative stress.
Nrf2 and NF-κB signalling pathways are engaged in functional cross-talk [ 90 ]. For instance, the absenteeism of Nrf2 can aggravate NF-κB stimulation which leads to amplified cytokine production, while NF-κB can regulate the transcription and activity of Nrf2 [ 90 ] and thus can affect the antioxidant machinery [ 72 ]. Both of those transcription factors can form a crossing point to control the expression of many target proteins [ 91 , 92 ]. Therefore, the neuroprotective effect showed by Azil in the current study could be, in part, attributed to the cross talk between NF-ĸB and Nrf2 signalling pathways.
Additionally, our results displayed that 3-NP injection potentiated striatal apoptosis as indicated by the upsurge in the level of caspase-3 and BAX/BCL2 ratio, which is in line with former studies [ 22 , 47 ]. The potentiated apoptotic pathway associated with 3-NP administration could be attributed to generation of superoxide radicals following SDH inhibition [ 93 ]. In contrast, administration of Azil controlled the level of these apoptotic proteins in the striatum indicating a significant anti-apoptotic effect. The anti-apoptotic potential of Azil was also previously reported in renal ischemia reperfusion injury in rat [ 30 ]
Finally, our study is limited by the idea that the blood vessels congestion in brain striatum elicited by 3-NP could have facilitated the access of Azil into brain striatum. Additionally, Azil might be protective against the diffusion of 3-NP into the striatum of the rat brains analysed in the present study. These assumptions need to be investigated in future studies.
In conclusion, the current study demonstrates the potential neuroprotective effects of Azil, an ARB, against 3-NP-induced behavioural, histopathological, and biochemical changes in the striatum of rats. These findings might be attributed to inhibition of ATR1/NF-κB signalling, modulation of Nrf2/KEAP1 signalling, anti-inflammatory, anti-oxidant, and anti-apoptotic properties.
Introduction
Huntington’s disease (HD) is an autosomal-dominant neurodegenerative disorder caused by the expansion of the CAG trinucleotide repeat in the Huntingtin (Htt) gene leading to the production of a mutant huntingtin protein (mHtt) [ 1 – 3 ]. Clinical symptoms of HD include motor, psychiatric and cognitive [ 4 – 6 ]. 3-Nitropropionic acid (3-NP) is a mitochondrial toxin that can effectively produce the symptoms of HD in animals and serve as an experimental model of HD [ 7 , 8 ]. 3-NP can cross the blood–brain barrier (BBB) and inhibit succinate dehydrogenase (SDH) enzyme irreversibly, blocking the electron transport chain and leading to ATP depletion, up-surge in reactive oxygen species (ROS) and depletion of endogenous antioxidants thus producing mitochondrial dysfunction and neuronal apoptosis [ 9 – 11 ].
Nuclear factor-kappa B (NF-κB) is a transcription factor principally involved in immune, inflammatory, and stress responses [ 12 ]. NF-κB is also involved in neuronal injury, making it a potential therapeutic target for managing neurodegenerative disorders [ 13 ]. Besides its role in the regulation of the transcription of the genes responsible for inflammation, NF-κB regulates the transcription of genes implicated in the apoptotic process [ 14 ]. In the basal status, NF-κB is maintained in an inactive form in the cytosol by binding to a repressive protein, an inhibitor of nuclear factor kappa B (IκB), to form an inactive protein complex that inhibits the nuclear translocation of NF-κB [ 15 ]. Numerous pro-inflammatory stimuli can activate NF-κB, mainly through inhibitor of κB kinase (IKK)-based phosphorylation and degradation of IκB proteins [ 16 ], where such inflammatory stimuli as well as, cellular stresses result in IκB phosphorylation by IKK leading to the activation and nuclear translocation of NF-ĸB [ 17 , 18 ]. Then, NF-κB activates the transcription of growth factors, chemokines, cytokines and pro-apoptotic factors-encoding genes [ 19 , 20 ].
The nuclear factor erythroid 2-related factor 2 (Nrf2) is considered a vital controller of redox homeostasis that coordinates the endogenous antioxidant cellular response [ 21 , 22 ]. In normal circumstances, Nrf2 levels are preserved low in the cytoplasm by binding to Kelch-like ECH-associated protein 1 (KEAP1). Exposure to ROS disrupts the KEAP1-Nrf2 complex with consequent release of Nrf2 which translocates into the nucleus to bind to antioxidant response elements (ARE) promoting the transcription of numerous antioxidative stress-related genes including haem oxygenase-1 (HO-1) and NAD(P)H: quinone oxidoreductase-1 (NQO-1) [ 23 , 24 ]. The Nrf2 signalling pathway is also involved in the inhibition of NF-ĸB as well as, its downstream inflammatory cytokines [ 25 ]. The key role of Nrf2 in hindering oxidative stress in HD has been suggested because Nrf2 knocked out mice proved to be more susceptible to striatal lesions induced by 3-NP [ 26 ].
Azilsartan (Azil) is an angiotensin II type 1 receptor blocker (ARB) that is used as an antihypertensive drug [ 27 ]. Azil has been shown to possess anti-inflammatory, anti-oxidant and anti-apoptotic effects that are associated with neuroprotection via blocking brain angiotensin II type 1 receptors (AT1R) [ 28 – 31 ]. Besides, the downstream signalling pathway of renin–angiotensin–aldosterone system (RAS) has been associated with NF-kB activation [ 32 ]. Thus, the current study aimed to investigate the potential neuroprotective effect of Azil against 3-NP-induced neurotoxicity in rats via assessing various behavioural, biochemical, and histopathological parameters. Moreover, we also investigated the effect of Azil on the interplay between IĸB/NF-ĸB and KEAP1/Nrf2 signalling pathways.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.