Cloning, expression and characterisation of short-chain dehydrogenase/reductase SDR12 (A0A7I5E7J1) from a parasitic nematode Haemonchus contortus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Cloning, expression and characterisation of short-chain dehydrogenase/reductase SDR12 (A0A7I5E7J1) from a parasitic nematode Haemonchus contortus Nikola Rychlá, Martina Navrátilová, Eliška Kohoutová, Lucie Raisová Stuchlíková, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7362067/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Mar, 2026 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Short-chain dehydrogenases/reductases (SDRs) play a crucial role in xenobiotic and eobiotic metabolism in all organisms. In the parasitic nematode Haemonchus contortus , SDRs represent potential contributors to drug resistance and potential drug targets. Among them, Hco_sdr12 (WormBaseAcc: HCON_0049110) seemed to be the most interesting as its constitutive expression was higher in all developmental stages of H. contortus from the drug-resistant strain in comparison to the drug-susceptible strain. Moreover, Hco_sdr12 was inducible by exposure of H. contortus adult males with the anthelmintic drug flubendazole. With an aim to know more about this enzyme, Hco_ SDR12 (UniprotAcc: A0A7I5E7J1) was cloned, purified and characterised. The corresponding gene was cloned into the pET22b(+) vector system, the protein was overexpressed in E. coli and purified by Ni-affinity chromatography. The various xenobiotic and eobiotic compounds, including flubendazole, were tested as potential substrates of Hco_ SDR12. Although this enzyme did not reduce flubendazole, significant reductase activities toward many other substrates were found with a preference for NADPH as a coenzyme. Glyceraldehyde, metyrapone and ketoprofen were used for kinetic studies. According to bioinformatic analysis, Hco_ SDR12 shares the highest similarity with hydroxysteroid dehydrogenase-like protein 2, which indicates its involvement in lipid metabolism. Even though Hco_ SDR12 cannot deactivate flubendazole, it can deactivate other xenobiotics with a carbonyl group. Its higher expression might help nematodes to protect themselves against reactive compounds and to gain energy from lipides more effectively. Biological sciences/Biochemistry Biological sciences/Drug discovery Biological sciences/Microbiology anthelmintics drug biotransformation helminths parasite Figures Figure 1 Figure 2 Figure 3 Introduction Short-chain dehydrogenases/reductases (SDRs) are one of the largest and oldest enzyme superfamilies, with more than a hundred thousand members, and more than 650 known crystal structures. In human, 202 SDR isoforms were found, with 77 SDRs well-annotated in Swiss-Prot [ 1 ]. SDRs play an important role in the biosynthesis of steroid hormones, prostaglandins, and retinoids, they are also involved in detoxifying endogenous compounds such as AGEs, lipid peroxidation products or α-dicarbonyls. Many SDRs participate in xenobiotic metabolism, catalysing mainly the reduction of carbonyl-bearing compounds [ 2 – 5 ]. SDR enzymes are included in several enzyme classes, from typical oxidoreductases, lyases to isomerases [ 6 ] with high divergence and low pair-wise sequence similarity (about 20–30% only). However, SDRs share a typical NAD(P)H binding site (TGxxxGxG) and catalytic triad/ tetrad, which is highly conserved ((Tyr, Lys, Ser, (Ans)). The three-dimensional structure among all SDR enzymes displays the so-called Rossman motif with α/β folding pattern [ 6 ]. On the other hand, the C-terminus of most SDR enzymes contains highly variable regions, allowing broad substrate specificity. Due to their crucial role in essential metabolic pathways, SDRs are ubiquitously present in Archaea, Bacteria and Eukaryota, including nematodes [ 7 , 8 ]. Parasitic nematodes (roundworms) represent a prominent group that infects plants, animals, and humans, causing serious diseases that are detrimental to human health and agriculture. Haemonchus contortus (barber’s pole worm) is a gastrointestinal nematode affecting small ruminants, like sheep and goats. It can also be found in wildlife such as deer, which were probably infected after contact with infectious livestock. The pharmacotherapy using anthelmintics still represents the gold standard in the treatment of haemonchosis despite efforts to introduce other non-pharmacological procedures, such as grazing management, or feeding biologically active plants. However, drug resistance in H. contortus decreases the effectiveness of anthelmintics and complicates the haemonchosis treatment. For this reason, the revealing of the mechanisms of drug resistance development as well as the identification of novel drug targets in nematodes represents a major concern worldwide [ 9 – 11 ]. Among others, SDRs are attracting attention, as they could be found to be both potential drug targets and contributors to drug resistance In our previous study, genome localization, phylogenetic analysis and transcriptomic analysis of SDRs in all developmental stages of H. contortus were performed [ 11 ]. In addition, protein expression of SDRs and their inducibility by anthelmintic drug flubendazole (FLU) was tested in H. contortus . FLU is deactivated via carbonyl reduction in nematodes [ 12 ], and thus increased expression/activity of SDRs (or other carbonyl reducing enzymes) could contribute to higher FLU tolerance in nematodes. The results showed several SDRs with higher constitutive expression in the benzimidazole-resistant strain IRE than drug-susceptible strain ISE. Moreover, contact of adult males of H. contortus with sublethal doses of FLU increased expression of certain SDRs. Among FLU-inducible SDRs, Hco_sdr12 seems to be the most interesting, as its constitutive expression in all juvenile stages and adult males is higher in the drug-resistant IRE strain than in the ISE strain [ 11 ]. In view of these facts, the present study was designed to characterise Hco_ SDR12 using bioinformatic analysis, to prepare recombinant enzyme, to test its activity toward potential substrates (including FLU) and to determine basic kinetic parameters. Materials and Methods Materials Materials for molecular-based method (Reverse transcriptase, dNTPs, Taq polymerase, buffers for RT, PCR, restriction endonucleases, DTT, 1 kbp ladder and loading buffer) were obtained from New England Biolabs, USA. Kits for PCR and gel cleans up, mini and midi prep of plasmid were purchased at Macherey-Nagel GmbH & Co. KG and Zymo Research, USA. The pGEM®-T Easy Vector Systems, pET22b(+) vector system, with T4 ligase and buffers, were obtained from Promega, USA. Ampicillin, X-gal and IPTG were purchased at Duchefa Farma B.V., Netherland. Cultivation LB media broth and agar were obtained from VWR International, USA. Chemicals (menadione, metyrapone, naloxone, ketoprofen, acenaftenol, hydrocortisone, cortisone, 4-pyridinylcarboxaldehyde, 4-nitrobenzaldehyde) and Amicon® Ultra-4 10,000 MWCO Centrifugal Filters were purchased from Sigma-Aldrich, USA. TRI reagent, dimethyl sulfoxide (DMSO), formic acid (FA) (LC‒MS LiChopur™, 97.5–98.5%) and acetonitrile (ACN) (UHPLC-MS grade) were obtained from VWR International s.r.o. (Prague, Czech Republic). Ultrapure water was prepared from deionised water using a Milli-Q ultrapure water purification system (Millipore, Bedford, MA, USA). Amersham ECL Prime Western Blotting Detection Reagent and HisTrapTM FF column were obtained from Cytiva (Uppsala, Sweden). Pierce™ BCA™ Protein assay kit was purchased from ThermoFisher Scientific, USA. Bioinformatic analysis The NCBI BLASTp was used to search for similar proteins of the gene product corresponding to Hco _ sdr12 (HCON_0049110) designated as Hco _SDR12 (A0A7I5E7J1_HAECO). First, all available proteins from non-redundant protein database were explored and second, the most similar protein among human proteins was searched. The domain identification was performed using the NCBI CD-search tool. The pairwise comparison with human hydroxysteroid dehydrogenase-like protein 2 was performed using Emboss Needle pairwise sequence comparison tool [ 13 ], both identified domains were compared independently. Bacterial strains and culture conditions The E. coli TOP10 strain was used for high-efficiency cloning, ensuring the propagation of plasmids at elevated copy numbers. BL21(DE3) E. coli strain was used for the production of Hco_ SDR12 protein. Both strains obtained from ThermoFisher Scientific were cultivated in Luria-Bertani (LB) broth or on agar, supplemented with ampicillin (100 mg/mL) as a selective agent, and maintained at 37°C under standard aerobic conditions. Cloning of Hco_sdr12 gene The RNA was isolated from a mixture of 10 female and 15 male adult worms of Haemonchus contortus (ISE strain, MHco3) using TRI reagent. The isolated RNA was treated with DNase I and quantified by spectrophotometer (TECAN SPARK), and reverse transcription was performed to obtain cDNA as described before [ 14 ]. The specific amplification of the target gene was performed using specific forward and reverse primers (Generi Biotech, Czech Republic) with sites for restriction endonucleases (F_ Nde I TTG CATATG TTTAATACAGGGAAGTTC and R_ Xho I TAT CTCGAG GCCTTGGAAGTACAGGTTCTCCAATTTACTCTTGTTC). The PCR reactions contained 1 ng of cDNA template, forward and reverse primers at a final concentration of 0.250 µM, 1x buffer for Taq polymerase, dNTPs at a final concentration of 0.200 µM and 1.25 U of Taq polymerase in a total volume of 50 µl. The conditions of the PCR reaction were as follows: 15 s at 94°C, 20 s at 55°C, and 1 min at 68°C. The correct length of amplicons was checked by agarose gel. The gel was visualised in the UV spectrum with the use of Alliance Q9 Advanced Chemiluminescence Imager (Thistle Scientific Ltd, UK). The PCR products were cleaned up with a commercial kit (NucleoSpin) and sub-cloned into the pGEM®-T easy vector for sequencing verification. The ligation was carried out using pre-prepared PCR products, pGEM®-T Easy Vector (50 ng), 2X Rapid Ligation Buffer and T4 DNA Ligase (3 Weiss units/µl) and purified PCR product (20–200 ng). The mixture was incubated overnight at 4°C. On the second day, chemically competent E. coli TOP10 was used for heat shock transformation. For E. coli growth, AMP (at a final concentration of 100 mg/ml), X-Gal (20 mg/ml) and IPTG (1 mM) were added to the LB agar plate. E. coli cells were seeded on the prepared plates in volumes ranging from 25 µl to 150 µl and incubated overnight at 37°C. The colony PCR was used to detect positive colonies. The presence of amplicons of the desired length was visualised by agarose gel. Positive colonies were inoculated into 3 ml of LB medium containing AMP (100 mg/ml) and incubated overnight at 37°C. The culture was centrifuged at 3 400 x g for 10 min, and plasmids were isolated and checked by sequencing at Eurofins Genomics ( https://eurofinsgenomics.eu/ ). For further cloning into an expression plasmid pET-22b(+), a restriction mixture with Nde I and Xho l was prepared and incubated for 2 h at 37°C. The fragments were separated by agarose gel electrophoresis, and fragments of the desired length were visualised under a UV transilluminator, manually excised and isolated from the gel. The expression vector pET-22b(+) was similarly restricted and purified using the NucleoSpin gel and PCR product purification kit. The ligation mixture contained 50 ng of restricted pET-22b(+) vector, 10X ligase buffer, 10 mM DTT, 1 mM ATP, T4 DNA ligase (0.2–0.4 Weiss units) and the amount of insert prepared was calculated using the insert: vector molar ratio of 1:3 and 1:10 (36, 120 ng, respectively) and ddH 2 O in a total volume of 20 µl. The mixture was incubated overnight at 16°C. The next day, E. coli TOP10 cells were subjected to heat shock transformation and inoculated onto LB agar plates containing AMP (100 mg/ml). The following day, the positive colonies were verified as described above, and the plasmid was isolated using the ZymoPURE™ II Plasmid Midiprep Kit (Zymo Research, USA). Correct cloning of prepared plasmids was definitively confirmed by control restriction and sequencing. Heterologous expression of recombinant protein Hco_ SDR12 For heterologous expression, the prepared plasmid pET-22b(+) with target gene Hco _ sdr12 was transformed into competent E. coli BL21 using the heat shock method. After regeneration in SOC medium, the culture was inoculated onto LB agar plates with AMP (100 mg/ml) for antibiotic selection. The cultures were incubated overnight at 37°C. On the following day, the success of the transformation was checked by colony PCR and the correct length of the amplicons was confirmed by agarose gel electrophoresis, as previously described. For larger-scale protein production, positive colonies were picked and inoculated into 5 ml of LB media with AMP (100 mg/ml) and incubated overnight at 37°C, the next day 500 µl of culture was added to 100 ml of LB media (AMP 100 mg/ml) and incubated at 220 rpm, 37°C until optical density OD 600 = 0.4–0.6. After reaching the desired OD, the negative sample was collected for Western blotting. Protein expression was initiated by adding isopropyl-ß-D-1-thiogalactopyranoside (IPTG) at a final concentration of 500 µM. The culture was incubated for a further 4–5 h at 220 rpm, 37°C. After incubation, the culture was harvested and centrifuged at 10 000 x g, 4°C, for 10 min, and prepared for protein extraction. The pellet was collected and weighed, and 5 ml of BugBuster® Protein Extraction Reagent per 1 gram of cells was added, mixed well, and incubated on a roller for approx. 20 min. The lysate was centrifuged at 16 000 x g, 4°C, for 20 min. The supernatant was collected into clean tubes and stored at – 20°C for further purification. Purification of SDR12 The supernatant was centrifuged at 16 000 x g, 4°C and adjusted to 30 mM imidazole at the final concentration. The purification was carried out with an ÄKTA Purifier low-pressure LC system and 1 ml HisTrapTM FF column (Cytiva, Uppsala, Sweden). The buffers contained: buffer A – 20 mM TRIS, 150 mM NaCl, 20% (v/v) glycerol, 30 mM imidazole; buffer B – 20 mM TRIS, 150 mM NaCl, 20% (v/v) glycerol and 500 mM imidazole. Both buffers were adjusted to pH 7,4 and filtered with 0.22 µm filters. The samples were loaded into the column and washed with 5–10 ml of buffer A, and the clean protein was eluted with buffer B (gradient up to 60% within 20 min) with high imidazole content. The protein was eluted with a high concentration of imidazole; thus, to obtain pure and stable protein, the desalting using the Amicon® Ultra-4 10,000 MWCO Centrifugal Filter Devices was performed. The samples were repeatedly filtered and exchanged with 0.1 M K-phosphate buffer, pH 6, till the content of salt was low enough. The pure protein was stored in 20% (v/v) glycerol at – 80°C for further analysis. The protein concentration was determined with the standard BCA assay. Characterisation of recombinant protein Hco_ SDR12 Western blotting For western blotting, samples were prepared by lysis with lysate buffer containing protein inhibitors cocktail and PMSF (phenylmethylsulfonyl fluoride). The samples were denatured, mixed with 4x SDS buffer and separated in a 12.5% gel in SDS-polyacrylamide agarose gel electrophoresis. The gel ran at 90 V, approximately, for 1.5 h. The proteins were semi-wet transferred with the use of polyvinylidene difluoride (PVDF) membrane and fixed in 5% (w/v) skimmed milk solution in TBST buffer for 1 hour. Then the membrane was incubated with the primary rabbit anti-Histag antibody (1:1000) overnight. The next day, the membrane was washed in TBST buffer for 15 min and repeated at least 4 times. Finally, the membrane was incubated with a secondary goat anti-rabbit antibody (1:10,000) for 1 h and washed in TBST buffer repeatedly. The detection was performed with the use of Amersham ECL Prime Western Blotting Detection Reagent. The second SDS-PAGE gel was stained with Coomassie blue to check the purity of the protein. Screening of catalytical activity For the screening of activity, various substrates with a carbonyl group were chosen. All reactions were based on the conversion of cofactor NADPH to NADP, and the absorbance decrease at 340 nm. The reaction mixture contained 5 µg of pure protein Hco_ SDR12, substrates in concentrations ranging from 500 µM to 5 mM (menadione, metyrapone, naloxone, glyceraldehyde, ketoprofen, acenaftenol, 4-pyridinkarboxaldehyde, hydrocortisone, cortisone and 4-nitrobenzaldehyde), NAD(P)(H) ranging from 100 µM to 250 µM, 0,1 M Na-Phosphate buffer, pH 7.4 and DMSO no higher than 1% in the reaction. The reactions were carried out at 37°C, 5 min, and the measurements were set up as a continual kinetic loop at 340 nm (n = 9). Enzymatic kinetics Enzymatic kinetics were performed using glyceraldehyde, ketoprofen and metyrapone, which were the best substrates identified during the substrate screening for Hco_ SDR12. The reaction contained glyceraldehyde in the range of 0.3-1 mM, metyrapone and ketoprofen in the range 0.3-5 mM, 5 µg protein per reaction, NADPH at 200 µM, 0.1 M Na-phosphate buffer, pH 7.4 and DMSO not more than 1% in the reaction. Reactions were carried out at 37°C for 5 min, and the measurement was set up as a continuous kinetic loop at 340 nm (n = 6). Results Bioinformatic analysis The gene product corresponding to Hco_ SDR12 (HCON_0049110, A0A7I5E7J1_HAECO), comprising 415 amino acid residues with an estimated molecular weight of 45.09 kDa, exhibits the highest degree of sequence similarity (81.93%) to the predicted enoyl-CoA hydratase/isomerase family protein from hookworm Ancylostoma caninum (GenBank: RCN41671.1). Notably, neither Hco_ SDR12 nor the protein with the highest similarity have ever been biochemically characterised. Therefore, the most similar human protein was identified, and the hydroxysteroid dehydrogenase-like 2 protein was compared. The presence of functional domains and the active site of Hco _SDR12 was confirmed through prediction using NCBI CD-Search tool, which identified the HSDL2_SDR-c domain, the sterol-binding domain of SCP2, and the NAD(P) binding motif (Rossmann-fold) critical for the enzyme's catalytic activity (overview in Supplementary materials Fig. S1 ). As previously confirmed the N-terminal cofactor (NAD(P)/NAD(P)H) binding region is the most conserved part of the protein. The pairwise comparison revealed 63.5% identity and 73.0% similarity of the N-terminal part of Hco _SDR12 and human HSDL2, on the other hand the variable C-terminal part showed only 29.5% and 45.9% of identity and similarity, respectively. The cofactor-binding site and the active site are conserved between the two proteins (Fig. 1 ). Consequently, Hco_ SDR12 can be classified within the oxidoreductase superfamily (EC 1) and the short-chain dehydrogenase/reductase (SDR) family (EC 1.1.1.-) ( https://www.brenda-enzymes.org/ ). Cloning and purification of Hco_ SDR12 For cloning, cDNA from adult H. contortus was prepared and subcloned into the sequencing vector pGEM-T easy. Subsequently, for recombinant protein production, the Hco_sdr12 was cloned into the inducible vector, pET-22b(+). The final vector was checked by restriction analysis and verified by sequencing (Supplementary Fig. S2 and S3). The protein was overexpressed in the E. coli expression system and purified with a yield of 13 mg/ml. The purity of recombinant protein was checked by SDS-PAGE (Fig. 2 A) and detected with specific anti-Histag antibody (Fig. 2 B). The enzyme has an estimated molecular weight 45.09 kDa corresponding to the expected molecular weight calculated from the Hco_ SDR12 amino acid sequence (45.09 kDa). Full images available in Supplementary materials Fig. S4 and S5. Activity of Hco_ SDR12 towards FLU Since the FLU reduction was our initial interest, we have analysed the activity of Hco_ SDR12 using FLU as a substrate using various settings and used UHPLC/MS to detect FLU and its metabolites (the detailed methodology is given in the Supplementary files). However, no reduced FLU was detected after any incubation, regardless of substrate concentration, coenzyme concentration, and incubation time. Substrate screening Various xenobiotic and endogenous substrates were tested for reductase and dehydrogenase activity of Hco_ SDR12. The specific activities for all substrates are given in Table 1 . Reductase activity Hco_ SDR12 was detected toward all tested substrates with the exception of 4-nitrobenzaldehyde. The highest activity was observed with coenzyme NADPH and D,L-glyceraldehyde, ketoprofen and menadione as substrates. Weak dehydrogenase activity was detected with hydrocortisone and cortisone as substrates, but xenobiotic compound acenaphtenol was not oxidized by Hco_ SDR12. Table 1 Substrate screening (reductase and dehydrogenase activity of Hco_ SDR12) Reductase activity (NADPH) Substrate concentration Specific activity (nmol/min − 1 /mg − 1 ) Aldehydes D, L-glyceraldehyde 5 mM 95.28 4-pyridinkarboxaldehyd 1 mM 15.22 4-nitrobenzaldehyd 1 mM n.d Alkaloids Naloxone 1 mM 22.19 Quinones Menadione 0.5 mM 35.43 Aromatic compounds Metyrapone 1 mM 32.87 Propionic acid derivative Ketoprofen 1 mM 39.21 Steroid hormones Hydrocortisone 20 mM 5.1 Cortisone 2 mM 8.2 Dehydrogenase activity (NADP+, NAD+) Aromatic compounds Acenaphtenol 1 mM n.d Steroid hormones Hydrocortisone 20 mM 3.5 Cortisone 2 mM 2.8 Enzyme kinetics Three substrates, D, L-glyceraldehyde, ketoprofen and metyrapone, were selected for enzyme kinetic study (Fig. 3 ). The kinetic parameters for Hco_ SDR12 and selected substrates are represented in Table 2 . According to calculated Michaelis-Menten constants, Hco_ SDR12 has the highest affinity to metyrapone, while the velocity of reaction is highest with D, L-glyceraldehyde as a substrate Table 2 –Kinetic parameters of Hco_ SDR12 toward chosen substrates. Substrates Km Vmax (mM) (nmol/min − 1 /mg − 1 ) D, L-glyceraldehyde 0.463 ± 0.142 135.061 ± 17.713 Ketoprofen 0.478 ± 0.193 45.99 ± 4.726 Metyrapone 0.183 ± 0.082 89.701 ± 6.679 Discussion Helminthiases afflict livestock worldwide and they are accompanied with huge economic losses for farmers. There are many approaches to treat helminthiasis, including non-pharmacological methods such as pasture management and the use of biologically active plants in the diet. However, pharmacotherapy is still the most common approach, although its effectiveness is decreasing due to anthelmintic resistance development in helminths. Anthelmintic resistance, particularly in gastrointestinal nematodes, has been a growing concern due to its significant impact on livestock health and productivity. Therefore, there is an urgent necessity for identifying the mechanisms behind anthelmintic resistance and novel molecular targets for designing new anthelmintics to combat drug-resistant parasites effectively [ 15 – 17 ]. SDR members in nematodes are interesting in both views; SDRs deactivating carbonyl-bearing anthelmintics might contribute to drug resistance development in nematodes, while nematode-specific SDRs with important physiological function might represent promising molecular targets of novel anthelmintic drugs. SDRs´ functionality is diverse but centred on managing energy production and detoxification under various conditions that the organisms may encounter [ 18 ]. In nematodes, these enzymes have been studied to understand their structure and function within the context of physiology and adaptation to diverse environmental conditions [ 19 – 21 ]. In our study, we focused on Hco_sdr12 , as its expression was enhanced in H. contortus drug-resistant strain and inducible by FLU in drug-sensitive strain [ 11 ]. Bioinformatic analysis revealed the highest similarity (54.68%) with human hydroxysteroid dehydrogenase-like 2 ( Hsa _HSDL2, NP_115679.2, Q6YN16) enzyme involved in fatty acid metabolism [ 22 ] and inducible by fasting [ 23 ]. HSDL2 knockdown reduced mitochondrial respiration, fatty acid oxidation, TCA cycle activity and cholesterol conversion to bile acids [ 23 ]. When comparing the sequence Hco_ SDR12 with Hsa _HSDL2), a match in the typical TGxxxGxG motif for NAD(P)H binding could be seen. Hco_ SDR12 active site is fully identical to the active site of Hsa _HSDL2. This is in agreement with the observed relatedness of both enzymes within the phylogenetic tree published earlier [ 11 ]. To know more about Hco_ SDR12, the corresponding gene was successfully cloned and the enzyme with molecular mass 45.09 kDa was purified. Various eobiotic and xenobiotic substrates were used for screening of Hco_ SDR12 enzyme activities. Contrary to our assumption, this enzyme was not able to reduce FLU. However, a relatively high reductase activity toward many other xenobiotic substrates with various structures was found. Metyrapone, a typical substrate (competitive inhibitor) for 11β-HSD, was a good substrate for Hco_ SDR12. The reductase activity of Hco_ SDR12 toward cortisone, an eobiotic substrate of 11β-HSD1, was detected, but it was lower than the activity toward other substrates. The highest reductase activity Hco_ SDR12, was observed toward D, L-glyceraldehyde. Several enzymes participating in carbohydrate metabolism were described to catalyze the reduction of glyceraldehyde using NADPH as a coenzyme, mainly aldose reductase (EC 1.1.1.21), glyceraldehyde reductase (EC 1.1.1.72), and aldehyde reductase (EC 1.1.1.2) (KEGG PATHWAY Database). Based on our results, Hco_ SDR12 belongs among them. However, kinetic study performed with three substrates (D, L-glyceraldehyde, ketoprofen, metyrapone) revealed the highest affinity (the lowest K M ) of Hco_ SDR12 toward metyrapone, a clinically used drug for decreasing cortisol formation, which indicates the important role of Hco_ SDR12 in deactivation of xenobiotic carbonyls. According to kinetic parameters, Hco_ SDR12 is able to deactivate metyrapone more effectively than human 11β-HSD 1[ 24 ]. Concerning potential dehydrogenase activity of Hco_ SDR12, low activity was detected toward cortisone and hydrocortisone, but not toward xenobiotic substrate acenaphtenol. Taken together, Hco_ SDR12 is an interesting, multifunctional enzyme with increased expression in drug-resistant strain of nematodes and in nematodes under FLU-mediated stress. Although it does not deactivate FLU and therefore, it cannot participate directly in the protection of nematodes against FLU and in drug-resistance development, it might be helpful in different ways. Based on bioinformatic study and substrate screening, we can conclude that Hco_ SDR12 activity protects nematodes against harmful reactive xenobiotic carbonyls, metabolizing them into less toxic forms. In addition, Hco_ SDR12 play an important role in their energy metabolism and steroid hormone signalling pathway. Declarations Availability of data and material All data generated or analysed during this study are included in this published article [and its supplementary information files]. Funding This study was supported by the Czech Science Foundation (Grant No. 20-14581Y) and by Charles University project SVV 260 664. Authors’ contributions NR and PM designed the project, LS and BS supervised the project and contributed to the data analysis, NR performed all the experiments and evaluated the experimental data, EK extracted all the samples prior to analysis, MN and LRS performed the LC–MS analysis. NR wrote the manuscript, and PM and LS revised the manuscript. All the authors read and approved the final manuscript. Declaration of competing interests The authors declare that they have no competing interests. Acknowledgements Not applicable. References Short-chain Dehydrogenases/Reductases Databases. http://sdr-enzymes.org/. Accessed 23.7.2024. Rychlá N, Navrátilová M, Kohoutová E, Stuchliková LR, Sterbová K, Krátky J, Matousková P, Szotáková B, and Skálová L (2024) Flubendazole carbonyl reduction in drug-susceptible and drug-resistant strains of the parasitic nematode: changes during the life cycle and possible inhibition. Vet Res 55(1) Skarydová L,Wsól V (2012) Human microsomal carbonyl reducing enzymes in the metabolism of xenobiotics: well-known and promising members of the SDR superfamily. Drug Metab Rev 44(2): 173-191 Oppermann U (2007) Carbonyl reductases: The complex relationships of mammalian carbonyland quinone-reducing enzymes and their role in physiology. Annual Review of Pharmacology and Toxicology 47: 293-322 Kallberg Y, Oppermann U,Persson B (2010) Classification of the short-chain dehydrogenase/reductase superfamily using hidden Markov models. Febs J 277(10): 2375-86 Filling C, Berndt KD, Benach J, Knapp S, Prozorovski T, Nordling E, Ladenstein R, Jornvall H, and Oppermann U (2002) Critical residues for structure and catalysis in short-chain dehydrogenases/reductases. Journal of Biological Chemistry 277(28): 25677-25684 Kavanagh K, Jornvall H, Persson B,Oppermann U (2008) The SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. Cellular and Molecular Life Sciences 65(24): 3895-3906 Persson B,Kallberg Y (2013) Classification and nomenclature of the superfamily of short-chain dehydrogenases/reductases (SDRs). Chemico-Biological Interactions 202(1-3): 111-115 Kaminsky R, Ducray P, Jung M, Clover R, Rufener L, Bouvier J, Weber SS, Wenger A, Wieland-Berghausen S, Goebel T, Gauvry N, Pautrat F, Skripsky T, Froelich O, Komoin-Oka C, Westlund B, Sluder A, and Mäser P (2008) A new class of anthelmintics effective against drug-resistant nematodes. Nature 452(7184): 176-U19 Nguyen LT, Zajícková M, Masátová E, Matousková P,Skálová L (2021) The ATP bioluminescence assay: a new application and optimization for viability testing in the parasitic nematode. Vet Res 52(1) Sterbová K, Rychlá N, Matousková P, Skálová L,Stuchlíková LR (2023) Short-chain dehydrogenases in: changes during life cycle and in relation to drug-resistance. Vet Res 54(1) Stuchlíková LR, Matousková P, Vokrál I, Lamka J, Szotáková B, Seckarová A, Dimunová D, Nguyen LT, Várady M, and Skálová L (2018) Metabolism of albendazole, ricobendazole and flubendazole in Haemonchus contortus adults: Sex differences, resistance-related differences and the identification of new metabolites. International Journal for Parasitology-Drugs and Drug Resistance 8(1): 50-58 Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R,Butcher S (2024) The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic acids research 52(W1): W521-W525 Sterbová K, Rychlá N, Stuchlíková LR, Matousková PM,Skálová L (2023) Flubendazole-induced changes in the expression of selected SDR genes throughout the developmental stages of Haemonchus contortus. Journal of Veterinary Pharmacology and Therapeutics 46: 114-114 Clarke NE, Doi SAR, Wangdi K, Chen Y, Clements ACA,Nery SV (2019) Efficacy of anthelminthic drugs and drug combinations against soil-transmitted helminths: A systematic review and network meta-analysis. Clinical Infectious Diseases 68(1): 96-105 Fissiha W,Kinde MZ (2021) Anthelmintic Resistance and Its Mechanism: A Review. Infect Drug Resist 14: 5403-5410 Nixon SA, Welz C, Woods DJ, Costa-Junior L, Zamanian M,Martin RJ (2020) Where are all the anthelmintics? Challenges and opportunities on the path to new anthelmintics. Int J Parasitol Drugs Drug Resist 14: 8-16 Beck KR, Kaserer T, Schuster D,Odermatt A (2017) Virtual screening applications in short-chain dehydrogenase/reductase research. Journal of Steroid Biochemistry and Molecular Biology 171: 157-177 Jones LM, Rayson SJ, Flemming AJ,Urwin PE (2013) Adaptive and Specialised Transcriptional Responses to Xenobiotic Stress in Caenorhabditis elegans Are Regulated by Nuclear Hormone Receptors. Plos One 8(7) Li YX, Feng YQ, Wang X, Cui J, Deng X,Zhang XY (2020) Adaptation of pine wood nematode Bursaphelenchus xylophilus to β-pinene stress. Bmc Genomics 21(1) Menzel R, Yeo HL, Rienau S, Li S, Steinberg CEW,Stürzenbaum SR (2007) Cytochrome P450s and short-chain dehydrogenases mediate the toxicogenomic response of PCB52 in the nematode Caenorhabditis elegans . Journal of Molecular Biology 370(1): 1-13 Kowalik D, Haller F, Adamski J,Moeller G (2009) In search for function of two human orphan SDR enzymes: Hydroxysteroid dehydrogenase like 2 (HSDL2) and short-chain dehydrogenase/reductase-orphan (SDR-O). Journal of Steroid Biochemistry and Molecular Biology 117(4-5): 117-124 Samson N, Bosoi CR, Roy C, Turcotte L, Tribouillard L, Mouchiroud M, Berthiaume L, Trottier J, Silva HCG, Guerbette T, Plata-Gomez AB, Besse-Patin A, Montoni A, Ilacqua N, Lamothe J, Citron YR, Gelinas Y, Gobeil S, Zoncu R, Caron A, Morissette M, Pellegrini L, Rochette PJ, Estall JL, Efeyan A, Shum M, Audet-Walsh E, Barbier O, Marette A, and Laplante M (2024) HSDL2 links nutritional cues to bile acid and cholesterol homeostasis. Science Advances 10(22) Bannenberg G, Martin HJ, Bélai I,Maser E (2003) 11β-hydroxysteroid dehydrogenase type 1:: tissue-specific expression and reductive metabolism of some anti-insect agent azole analogues of metyrapone. Chemico-Biological Interactions 143: 449-457 Additional Declarations No competing interests reported. Supplementary Files SupplementarymaterialsR.docx supplementaryF2.docx Cite Share Download PDF Status: Published Journal Publication published 31 Mar, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 11 Dec, 2025 Reviews received at journal 03 Nov, 2025 Reviews received at journal 25 Sep, 2025 Reviewers agreed at journal 29 Aug, 2025 Reviewers agreed at journal 28 Aug, 2025 Reviewers invited by journal 28 Aug, 2025 Editor assigned by journal 27 Aug, 2025 Editor invited by journal 27 Aug, 2025 Submission checks completed at journal 19 Aug, 2025 First submitted to journal 19 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7362067","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":509264449,"identity":"f47b8a74-c90d-4918-bdbe-43bd8406373e","order_by":0,"name":"Nikola Rychlá","email":"","orcid":"","institution":"Charles University","correspondingAuthor":false,"prefix":"","firstName":"Nikola","middleName":"","lastName":"Rychlá","suffix":""},{"id":509264450,"identity":"bb3a76b4-57bf-4f47-9fea-20b4df0dfeeb","order_by":1,"name":"Martina Navrátilová","email":"","orcid":"","institution":"Charles University","correspondingAuthor":false,"prefix":"","firstName":"Martina","middleName":"","lastName":"Navrátilová","suffix":""},{"id":509264455,"identity":"32faaceb-328e-42b3-aa7d-1e1e4791889c","order_by":2,"name":"Eliška Kohoutová","email":"","orcid":"","institution":"Charles University","correspondingAuthor":false,"prefix":"","firstName":"Eliška","middleName":"","lastName":"Kohoutová","suffix":""},{"id":509264456,"identity":"61297d59-b955-4845-b544-00758175f330","order_by":3,"name":"Lucie Raisová Stuchlíková","email":"","orcid":"","institution":"Charles University","correspondingAuthor":false,"prefix":"","firstName":"Lucie","middleName":"Raisová","lastName":"Stuchlíková","suffix":""},{"id":509264457,"identity":"a8d851ec-6ab4-4c38-ae3f-8d8142731777","order_by":4,"name":"Barbora Szotáková","email":"","orcid":"","institution":"Charles University","correspondingAuthor":false,"prefix":"","firstName":"Barbora","middleName":"","lastName":"Szotáková","suffix":""},{"id":509264458,"identity":"0051fbae-4bb5-417a-9913-c0df502a992c","order_by":5,"name":"Lenka Skálová","email":"","orcid":"","institution":"Charles University","correspondingAuthor":false,"prefix":"","firstName":"Lenka","middleName":"","lastName":"Skálová","suffix":""},{"id":509264459,"identity":"98abd38d-b5c3-4f4d-9d7e-11f1d8424d13","order_by":6,"name":"Petra Matoušková","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIie3QvQrCMBDA8SuBc4m6Cj6D0BKogy+T0sFNEFfBAyGOrjqIr6BvUAlkElwdBJWCk0PdO/hBxUWibg75DUeG+5MQAMf5Y4MxSyC7n/DzMntMb6qkN/ktWZgi+agx2qxSnu+YMOxI0NedCrA0syXhOmairE4YGgwIjO4hoO9bkyTGepk0D/fUPHikIwUcpDXZpFjnua4JVbrQM0msyfZ2C0ft+8iDZ+KRPUlFMFMnWTO8S9K0I8VQ2Irbw6Lj4ZzvZFWVlpT1W9F8NLT/WKF4vLwP9sX+K3Ecx3HeuQLdmEnFMCaeXAAAAABJRU5ErkJggg==","orcid":"","institution":"Charles University","correspondingAuthor":true,"prefix":"","firstName":"Petra","middleName":"","lastName":"Matoušková","suffix":""}],"badges":[],"createdAt":"2025-08-13 07:38:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7362067/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7362067/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-026-45685-w","type":"published","date":"2026-03-31T15:59:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90805152,"identity":"080edc02-9361-4539-ba96-4397e42d4ae8","added_by":"auto","created_at":"2025-09-08 10:44:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":535194,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe comparison of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHco_\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eSDR12 with human hydroxysteroid dehydrogenase-like protein 2 (UniprotAcc: Q6YN16).\u003c/strong\u003e Multiple comparison was carried out using Clustal Omega. The NAD(P)H amino binding sites (TGxxxGxG) are marked by blue triangles and identified typical amino acids (N-P-Y-K) in active sites of proteins are marked by red triangles.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7362067/v1/4f934027477daaf9518eeec5.png"},{"id":90803597,"identity":"d6718134-1497-40b7-a10a-6715ab5093af","added_by":"auto","created_at":"2025-09-08 10:36:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":93762,"visible":true,"origin":"","legend":"\u003cp\u003eSDS-PAGE analysis of purified fractions (\u003cstrong\u003eFig. 2A\u003c/strong\u003e) and corresponding Western blot (\u003cstrong\u003eFig. 2B\u003c/strong\u003e) confirmed the presence of the \u003cem\u003eHco_\u003c/em\u003eSDR12 (~45.09 kDa). A distinct band of the expected molecular weight was detected, with the strongest signal observed in the elution fractions (samples 6–9). A weaker signal was also visible in the unpurified sample (sample 1), indicating partial presence of the protein before purification.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7362067/v1/522f9cceae47e5e1216f8114.png"},{"id":90805153,"identity":"49e8b0ea-7203-4328-81f9-2402116518af","added_by":"auto","created_at":"2025-09-08 10:44:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":140576,"visible":true,"origin":"","legend":"\u003cp\u003eEnzyme kinetics of \u003cem\u003eHco_\u003c/em\u003eSDR12 with D, L-glyceraldehyde (GLH), ketoprofen (KET) and metyrapone (MET) as substrate and coenzyme NADPH at saturation concentration.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7362067/v1/537d43ef95ce7638ebb6c78f.png"},{"id":106343733,"identity":"4385bfef-7e1b-4e91-abbf-56871164ca7a","added_by":"auto","created_at":"2026-04-07 16:08:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1591343,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7362067/v1/ac9099a9-8fe2-47ad-b17c-68cb094ff158.pdf"},{"id":90803600,"identity":"0a36a4ec-2713-4421-ba2a-77c958e671b2","added_by":"auto","created_at":"2025-09-08 10:36:03","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1150069,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialsR.docx","url":"https://assets-eu.researchsquare.com/files/rs-7362067/v1/f6baaff2f9c73002b3011c65.docx"},{"id":90805154,"identity":"df94e34e-7353-49bb-901b-1d3a83fe5ff2","added_by":"auto","created_at":"2025-09-08 10:44:03","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":475961,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryF2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7362067/v1/75600004e6b217e351a9bcce.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cloning, expression and characterisation of short-chain dehydrogenase/reductase SDR12 (A0A7I5E7J1) from a parasitic nematode Haemonchus contortus","fulltext":[{"header":"Introduction","content":"\u003cp\u003eShort-chain dehydrogenases/reductases (SDRs) are one of the largest and oldest enzyme superfamilies, with more than a hundred thousand members, and more than 650 known crystal structures. In human, 202 SDR isoforms were found, with 77 SDRs well-annotated in Swiss-Prot [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. SDRs play an important role in the biosynthesis of steroid hormones, prostaglandins, and retinoids, they are also involved in detoxifying endogenous compounds such as AGEs, lipid peroxidation products or α-dicarbonyls. Many SDRs participate in xenobiotic metabolism, catalysing mainly the reduction of carbonyl-bearing compounds [\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. SDR enzymes are included in several enzyme classes, from typical oxidoreductases, lyases to isomerases [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] with high divergence and low pair-wise sequence similarity (about 20\u0026ndash;30% only). However, SDRs share a typical NAD(P)H binding site (TGxxxGxG) and catalytic triad/ tetrad, which is highly conserved ((Tyr, Lys, Ser, (Ans)). The three-dimensional structure among all SDR enzymes displays the so-called Rossman motif with α/β folding pattern [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. On the other hand, the C-terminus of most SDR enzymes contains highly variable regions, allowing broad substrate specificity. Due to their crucial role in essential metabolic pathways, SDRs are ubiquitously present in Archaea, Bacteria and Eukaryota, including nematodes [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eParasitic nematodes (roundworms) represent a prominent group that infects plants, animals, and humans, causing serious diseases that are detrimental to human health and agriculture. \u003cem\u003eHaemonchus contortus\u003c/em\u003e (barber\u0026rsquo;s pole worm) is a gastrointestinal nematode affecting small ruminants, like sheep and goats. It can also be found in wildlife such as deer, which were probably infected after contact with infectious livestock. The pharmacotherapy using anthelmintics still represents the gold standard in the treatment of haemonchosis despite efforts to introduce other non-pharmacological procedures, such as grazing management, or feeding biologically active plants. However, drug resistance in \u003cem\u003eH. contortus\u003c/em\u003e decreases the effectiveness of anthelmintics and complicates the haemonchosis treatment. For this reason, the revealing of the mechanisms of drug resistance development as well as the identification of novel drug targets in nematodes represents a major concern worldwide [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Among others, SDRs are attracting attention, as they could be found to be both potential drug targets and contributors to drug resistance\u003c/p\u003e\u003cp\u003eIn our previous study, genome localization, phylogenetic analysis and transcriptomic analysis of SDRs in all developmental stages of \u003cem\u003eH. contortus\u003c/em\u003e were performed [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In addition, protein expression of SDRs and their inducibility by anthelmintic drug flubendazole (FLU) was tested in \u003cem\u003eH. contortus\u003c/em\u003e. FLU is deactivated via carbonyl reduction in nematodes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and thus increased expression/activity of SDRs (or other carbonyl reducing enzymes) could contribute to higher FLU tolerance in nematodes. The results showed several SDRs with higher constitutive expression in the benzimidazole-resistant strain IRE than drug-susceptible strain ISE. Moreover, contact of adult males of \u003cem\u003eH. contortus\u003c/em\u003e with sublethal doses of FLU increased expression of certain SDRs. Among FLU-inducible SDRs, \u003cem\u003eHco_sdr12\u003c/em\u003e seems to be the most interesting, as its constitutive expression in all juvenile stages and adult males is higher in the drug-resistant IRE strain than in the ISE strain [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In view of these facts, the present study was designed to characterise \u003cem\u003eHco_\u003c/em\u003eSDR12 using bioinformatic analysis, to prepare recombinant enzyme, to test its activity toward potential substrates (including FLU) and to determine basic kinetic parameters.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eMaterials\u003c/h2\u003e\n \u003cp\u003eMaterials for molecular-based method (Reverse transcriptase, dNTPs, Taq polymerase, buffers for RT, PCR, restriction endonucleases, DTT, 1 kbp ladder and loading buffer) were obtained from New England Biolabs, USA. Kits for PCR and gel cleans up, mini and midi prep of plasmid were purchased at Macherey-Nagel GmbH \u0026amp; Co. KG and Zymo Research, USA. The pGEM\u0026reg;-T Easy Vector Systems, pET22b(+) vector system, with T4 ligase and buffers, were obtained from Promega, USA. Ampicillin, X-gal and IPTG were purchased at Duchefa Farma B.V., Netherland. Cultivation LB media broth and agar were obtained from VWR International, USA. Chemicals (menadione, metyrapone, naloxone, ketoprofen, acenaftenol, hydrocortisone, cortisone, 4-pyridinylcarboxaldehyde, 4-nitrobenzaldehyde) and Amicon\u0026reg; Ultra-4 10,000 MWCO Centrifugal Filters were purchased from Sigma-Aldrich, USA. TRI reagent, dimethyl sulfoxide (DMSO), formic acid (FA) (LC‒MS LiChopur\u0026trade;, 97.5\u0026ndash;98.5%) and acetonitrile (ACN) (UHPLC-MS grade) were obtained from VWR International s.r.o. (Prague, Czech Republic). Ultrapure water was prepared from deionised water using a Milli-Q ultrapure water purification system (Millipore, Bedford, MA, USA). Amersham ECL Prime Western Blotting Detection Reagent and HisTrapTM FF column were obtained from Cytiva (Uppsala, Sweden). Pierce\u0026trade; BCA\u0026trade; Protein assay kit was purchased from ThermoFisher Scientific, USA.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eBioinformatic analysis\u003c/h3\u003e\n\u003cp\u003eThe NCBI BLASTp was used to search for similar proteins of the gene product corresponding to \u003cem\u003eHco\u003c/em\u003e_\u003cem\u003esdr12\u003c/em\u003e (HCON_0049110) designated as \u003cem\u003eHco\u003c/em\u003e_SDR12 (A0A7I5E7J1_HAECO). First, all available proteins from non-redundant protein database were explored and second, the most similar protein among human proteins was searched. The domain identification was performed using the NCBI CD-search tool. The pairwise comparison with human hydroxysteroid dehydrogenase-like protein 2 was performed using Emboss Needle pairwise sequence comparison tool [\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e], both identified domains were compared independently.\u003c/p\u003e\n\u003ch3\u003eBacterial strains and culture conditions\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eE. coli\u003c/em\u003e TOP10 strain was used for high-efficiency cloning, ensuring the propagation of plasmids at elevated copy numbers. BL21(DE3) \u003cem\u003eE. coli\u003c/em\u003e strain was used for the production of \u003cem\u003eHco_\u003c/em\u003eSDR12 protein. Both strains obtained from ThermoFisher Scientific were cultivated in Luria-Bertani (LB) broth or on agar, supplemented with ampicillin (100 mg/mL) as a selective agent, and maintained at 37\u0026deg;C under standard aerobic conditions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCloning of\u003c/strong\u003e \u003cstrong\u003eHco_sdr12\u003c/strong\u003e \u003cstrong\u003egene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe RNA was isolated from a mixture of 10 female and 15 male adult worms of \u003cem\u003eHaemonchus contortus\u003c/em\u003e (ISE strain, MHco3) using TRI reagent. The isolated RNA was treated with DNase I and quantified by spectrophotometer (TECAN SPARK), and reverse transcription was performed to obtain cDNA as described before [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]. The specific amplification of the target gene was performed using specific forward and reverse primers (Generi Biotech, Czech Republic) with sites for restriction endonucleases (F_\u003cem\u003eNde\u003c/em\u003eI TTG\u003cem\u003eCATATG\u003c/em\u003eTTTAATACAGGGAAGTTC and R_\u003cem\u003eXho\u003c/em\u003eI TAT\u003cem\u003eCTCGAG\u003c/em\u003eGCCTTGGAAGTACAGGTTCTCCAATTTACTCTTGTTC). The PCR reactions contained 1 ng of cDNA template, forward and reverse primers at a final concentration of 0.250 \u0026micro;M, 1x buffer for \u003cem\u003eTaq\u003c/em\u003e polymerase, dNTPs at a final concentration of 0.200 \u0026micro;M and 1.25 U of \u003cem\u003eTaq\u003c/em\u003e polymerase in a total volume of 50 \u0026micro;l. The conditions of the PCR reaction were as follows: 15 s at 94\u0026deg;C, 20 s at 55\u0026deg;C, and 1 min at 68\u0026deg;C. The correct length of amplicons was checked by agarose gel. The gel was visualised in the UV spectrum with the use of Alliance Q9 Advanced Chemiluminescence Imager (Thistle Scientific Ltd, UK). The PCR products were cleaned up with a commercial kit (NucleoSpin) and sub-cloned into the pGEM\u0026reg;-T easy vector for sequencing verification. The ligation was carried out using pre-prepared PCR products, pGEM\u0026reg;-T Easy Vector (50 ng), 2X Rapid Ligation Buffer and T4 DNA Ligase (3 Weiss units/\u0026micro;l) and purified PCR product (20\u0026ndash;200 ng). The mixture was incubated overnight at 4\u0026deg;C. On the second day, chemically competent \u003cem\u003eE. coli\u003c/em\u003e TOP10 was used for heat shock transformation. For \u003cem\u003eE. coli\u003c/em\u003e growth, AMP (at a final concentration of 100 mg/ml), X-Gal (20 mg/ml) and IPTG (1 mM) were added to the LB agar plate. \u003cem\u003eE. coli\u003c/em\u003e cells were seeded on the prepared plates in volumes ranging from 25 \u0026micro;l to 150 \u0026micro;l and incubated overnight at 37\u0026deg;C. The colony PCR was used to detect positive colonies. The presence of amplicons of the desired length was visualised by agarose gel. Positive colonies were inoculated into 3 ml of LB medium containing AMP (100 mg/ml) and incubated overnight at 37\u0026deg;C. The culture was centrifuged at 3 400 x g for 10 min, and plasmids were isolated and checked by sequencing at Eurofins Genomics (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://eurofinsgenomics.eu/\u003c/span\u003e\u003c/span\u003e). For further cloning into an expression plasmid pET-22b(+), a restriction mixture with \u003cem\u003eNde\u003c/em\u003eI and \u003cem\u003eXho\u003c/em\u003el was prepared and incubated for 2 h at 37\u0026deg;C. The fragments were separated by agarose gel electrophoresis, and fragments of the desired length were visualised under a UV transilluminator, manually excised and isolated from the gel. The expression vector pET-22b(+) was similarly restricted and purified using the NucleoSpin gel and PCR product purification kit. The ligation mixture contained 50 ng of restricted pET-22b(+) vector, 10X ligase buffer, 10 mM DTT, 1 mM ATP, T4 DNA ligase (0.2\u0026ndash;0.4 Weiss units) and the amount of insert prepared was calculated using the insert: vector molar ratio of 1:3 and 1:10 (36, 120 ng, respectively) and ddH\u003csub\u003e2\u003c/sub\u003eO in a total volume of 20 \u0026micro;l. The mixture was incubated overnight at 16\u0026deg;C. The next day, \u003cem\u003eE. coli\u003c/em\u003e TOP10 cells were subjected to heat shock transformation and inoculated onto LB agar plates containing AMP (100 mg/ml). The following day, the positive colonies were verified as described above, and the plasmid was isolated using the ZymoPURE\u0026trade; II Plasmid Midiprep Kit (Zymo Research, USA). Correct cloning of prepared plasmids was definitively confirmed by control restriction and sequencing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHeterologous expression of recombinant protein\u003c/strong\u003e \u003cstrong\u003eHco_\u003c/strong\u003e\u003cstrong\u003eSDR12\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor heterologous expression, the prepared plasmid pET-22b(+) with target gene \u003cem\u003eHco\u003c/em\u003e_\u003cem\u003esdr12\u003c/em\u003e was transformed into competent \u003cem\u003eE. coli\u003c/em\u003e BL21 using the heat shock method. After regeneration in SOC medium, the culture was inoculated onto LB agar plates with AMP (100 mg/ml) for antibiotic selection. The cultures were incubated overnight at 37\u0026deg;C. On the following day, the success of the transformation was checked by colony PCR and the correct length of the amplicons was confirmed by agarose gel electrophoresis, as previously described. For larger-scale protein production, positive colonies were picked and inoculated into 5 ml of LB media with AMP (100 mg/ml) and incubated overnight at 37\u0026deg;C, the next day 500 \u0026micro;l of culture was added to 100 ml of LB media (AMP 100 mg/ml) and incubated at 220 rpm, 37\u0026deg;C until optical density OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.4\u0026ndash;0.6. After reaching the desired OD, the negative sample was collected for Western blotting. Protein expression was initiated by adding isopropyl-\u0026szlig;-D-1-thiogalactopyranoside (IPTG) at a final concentration of 500 \u0026micro;M. The culture was incubated for a further 4\u0026ndash;5 h at 220 rpm, 37\u0026deg;C. After incubation, the culture was harvested and centrifuged at 10 000 x g, 4\u0026deg;C, for 10 min, and prepared for protein extraction. The pellet was collected and weighed, and 5 ml of BugBuster\u0026reg; Protein Extraction Reagent per 1 gram of cells was added, mixed well, and incubated on a roller for approx. 20 min. The lysate was centrifuged at 16 000 x g, 4\u0026deg;C, for 20 min. The supernatant was collected into clean tubes and stored at \u0026ndash; 20\u0026deg;C for further purification.\u003c/p\u003e\n\u003ch3\u003ePurification of SDR12\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eThe supernatant was centrifuged at 16 000 x g, 4\u0026deg;C and adjusted to 30 mM imidazole at the final concentration. The purification was carried out with an \u0026Auml;KTA Purifier low-pressure LC system and 1 ml HisTrapTM FF column (Cytiva, Uppsala, Sweden). The buffers contained: buffer A \u0026ndash; 20 mM TRIS, 150 mM NaCl, 20% (v/v) glycerol, 30 mM imidazole; buffer B \u0026ndash; 20 mM TRIS, 150 mM NaCl, 20% (v/v) glycerol and 500 mM imidazole. Both buffers were adjusted to pH 7,4 and filtered with 0.22 \u0026micro;m filters. The samples were loaded into the column and washed with 5\u0026ndash;10 ml of buffer A, and the clean protein was eluted with buffer B (gradient up to 60% within 20 min) with high imidazole content. The protein was eluted with a high concentration of imidazole; thus, to obtain pure and stable protein, the desalting using the Amicon\u0026reg; Ultra-4 10,000 MWCO Centrifugal Filter Devices was performed. The samples were repeatedly filtered and exchanged with 0.1 M K-phosphate buffer, pH 6, till the content of salt was low enough. The pure protein was stored in 20% (v/v) glycerol at \u0026ndash; 80\u0026deg;C for further analysis. The protein concentration was determined with the standard BCA assay.\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eCharacterisation of recombinant protein\u003c/strong\u003e \u003cstrong\u003eHco_\u003c/strong\u003e\u003cstrong\u003eSDR12\u003c/strong\u003e\u003c/p\u003e\n\u003ch3\u003eWestern blotting\u003c/h3\u003e\n\u003cp\u003eFor western blotting, samples were prepared by lysis with lysate buffer containing protein inhibitors cocktail and PMSF (phenylmethylsulfonyl fluoride). The samples were denatured, mixed with 4x SDS buffer and separated in a 12.5% gel in SDS-polyacrylamide agarose gel electrophoresis. The gel ran at 90 V, approximately, for 1.5 h. The proteins were semi-wet transferred with the use of polyvinylidene difluoride (PVDF) membrane and fixed in 5% (w/v) skimmed milk solution in TBST buffer for 1 hour. Then the membrane was incubated with the primary rabbit anti-Histag antibody (1:1000) overnight. The next day, the membrane was washed in TBST buffer for 15 min and repeated at least 4 times. Finally, the membrane was incubated with a secondary goat anti-rabbit antibody (1:10,000) for 1 h and washed in TBST buffer repeatedly. The detection was performed with the use of Amersham ECL Prime Western Blotting Detection Reagent. The second SDS-PAGE gel was stained with Coomassie blue to check the purity of the protein.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eScreening of catalytical activity\u003c/h2\u003e\n \u003cp\u003eFor the screening of activity, various substrates with a carbonyl group were chosen. All reactions were based on the conversion of cofactor NADPH to NADP, and the absorbance decrease at 340 nm. The reaction mixture contained 5 \u0026micro;g of pure protein \u003cem\u003eHco_\u003c/em\u003eSDR12, substrates in concentrations ranging from 500 \u0026micro;M to 5 mM (menadione, metyrapone, naloxone, glyceraldehyde, ketoprofen, acenaftenol, 4-pyridinkarboxaldehyde, hydrocortisone, cortisone and 4-nitrobenzaldehyde), NAD(P)(H) ranging from 100 \u0026micro;M to 250 \u0026micro;M, 0,1 M Na-Phosphate buffer, pH 7.4 and DMSO no higher than 1% in the reaction. The reactions were carried out at 37\u0026deg;C, 5 min, and the measurements were set up as a continual kinetic loop at 340 nm (n\u0026thinsp;=\u0026thinsp;9).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eEnzymatic kinetics\u003c/h3\u003e\n\u003cp\u003eEnzymatic kinetics were performed using glyceraldehyde, ketoprofen and metyrapone, which were the best substrates identified during the substrate screening for \u003cem\u003eHco_\u003c/em\u003eSDR12. The reaction contained glyceraldehyde in the range of 0.3-1 mM, metyrapone and ketoprofen in the range 0.3-5 mM, 5 \u0026micro;g protein per reaction, NADPH at 200 \u0026micro;M, 0.1 M Na-phosphate buffer, pH 7.4 and DMSO not more than 1% in the reaction. Reactions were carried out at 37\u0026deg;C for 5 min, and the measurement was set up as a continuous kinetic loop at 340 nm (n\u0026thinsp;=\u0026thinsp;6).\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eBioinformatic analysis\u003c/h2\u003e\u003cp\u003eThe gene product corresponding to \u003cem\u003eHco_\u003c/em\u003eSDR12 (HCON_0049110, A0A7I5E7J1_HAECO), comprising 415 amino acid residues with an estimated molecular weight of 45.09 kDa, exhibits the highest degree of sequence similarity (81.93%) to the predicted enoyl-CoA hydratase/isomerase family protein from hookworm \u003cem\u003eAncylostoma caninum\u003c/em\u003e (GenBank: RCN41671.1). Notably, neither \u003cem\u003eHco_\u003c/em\u003eSDR12 nor the protein with the highest similarity have ever been biochemically characterised. Therefore, the most similar human protein was identified, and the hydroxysteroid dehydrogenase-like 2 protein was compared. The presence of functional domains and the active site of \u003cem\u003eHco\u003c/em\u003e_SDR12 was confirmed through prediction using NCBI CD-Search tool, which identified the HSDL2_SDR-c domain, the sterol-binding domain of SCP2, and the NAD(P) binding motif (Rossmann-fold) critical for the enzyme's catalytic activity (overview in Supplementary materials Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). As previously confirmed the N-terminal cofactor (NAD(P)/NAD(P)H) binding region is the most conserved part of the protein. The pairwise comparison revealed 63.5% identity and 73.0% similarity of the N-terminal part of \u003cem\u003eHco\u003c/em\u003e_SDR12 and human HSDL2, on the other hand the variable C-terminal part showed only 29.5% and 45.9% of identity and similarity, respectively. The cofactor-binding site and the active site are conserved between the two proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Consequently, \u003cem\u003eHco_\u003c/em\u003eSDR12 can be classified within the oxidoreductase superfamily (EC 1) and the short-chain dehydrogenase/reductase (SDR) family (EC 1.1.1.-) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.brenda-enzymes.org/\u003c/span\u003e\u003cspan address=\"https://www.brenda-enzymes.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCloning and purification of\u003c/b\u003e \u003cb\u003eHco_\u003c/b\u003e\u003cb\u003eSDR12\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFor cloning, cDNA from adult \u003cem\u003eH. contortus\u003c/em\u003e was prepared and subcloned into the sequencing vector pGEM-T easy. Subsequently, for recombinant protein production, the \u003cem\u003eHco_sdr12\u003c/em\u003e was cloned into the inducible vector, pET-22b(+). The final vector was checked by restriction analysis and verified by sequencing (Supplementary Fig.\u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e and S3). The protein was overexpressed in the \u003cem\u003eE. coli\u003c/em\u003e expression system and purified with a yield of 13 mg/ml. The purity of recombinant protein was checked by SDS-PAGE (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) and detected with specific anti-Histag antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The enzyme has an estimated molecular weight 45.09 kDa corresponding to the expected molecular weight calculated from the \u003cem\u003eHco_\u003c/em\u003eSDR12 amino acid sequence (45.09 kDa). Full images available in Supplementary materials Fig. S4 and S5.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eActivity of\u003c/b\u003e \u003cb\u003eHco_\u003c/b\u003e\u003cb\u003eSDR12 towards FLU\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSince the FLU reduction was our initial interest, we have analysed the activity of \u003cem\u003eHco_\u003c/em\u003eSDR12 using FLU as a substrate using various settings and used UHPLC/MS to detect FLU and its metabolites (the detailed methodology is given in the Supplementary files). However, no reduced FLU was detected after any incubation, regardless of substrate concentration, coenzyme concentration, and incubation time.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eSubstrate screening\u003c/h2\u003e\u003cp\u003eVarious xenobiotic and endogenous substrates were tested for reductase and dehydrogenase activity of \u003cem\u003eHco_\u003c/em\u003eSDR12. The specific activities for all substrates are given in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Reductase activity \u003cem\u003eHco_\u003c/em\u003eSDR12 was detected toward all tested substrates with the exception of 4-nitrobenzaldehyde. The highest activity was observed with coenzyme NADPH and D,L-glyceraldehyde, ketoprofen and menadione as substrates. Weak dehydrogenase activity was detected with hydrocortisone and cortisone as substrates, but xenobiotic compound acenaphtenol was not oxidized by \u003cem\u003eHco_\u003c/em\u003eSDR12.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSubstrate screening (reductase and dehydrogenase activity of \u003cem\u003eHco_\u003c/em\u003e SDR12)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReductase activity (NADPH)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSubstrate concentration\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpecific activity\u003c/p\u003e\u003cp\u003e(nmol/min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e/mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAldehydes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eD, L-glyceraldehyde\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e95.28\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e4-pyridinkarboxaldehyd\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15.22\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e4-nitrobenzaldehyd\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003en.d\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAlkaloids\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNaloxone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e22.19\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eQuinones\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMenadione\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.5 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e35.43\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAromatic compounds\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMetyrapone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e32.87\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePropionic acid derivative\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eKetoprofen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e39.21\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSteroid hormones\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHydrocortisone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e20 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e5.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCortisone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e8.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eDehydrogenase activity\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e(NADP+, NAD+)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAromatic compounds\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAcenaphtenol\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003en.d\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSteroid hormones\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHydrocortisone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e20 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3.5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCortisone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2 mM\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eEnzyme kinetics\u003c/h2\u003e\u003cp\u003eThree substrates, D, L-glyceraldehyde, ketoprofen and metyrapone, were selected for enzyme kinetic study (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The kinetic parameters for \u003cem\u003eHco_\u003c/em\u003eSDR12 and selected substrates are represented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. According to calculated Michaelis-Menten constants, \u003cem\u003eHco_\u003c/em\u003eSDR12 has the highest affinity to metyrapone, while the velocity of reaction is highest with D, L-glyceraldehyde as a substrate\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u0026ndash;Kinetic parameters of \u003cem\u003eHco_\u003c/em\u003eSDR12 toward chosen substrates.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e\u003cp\u003eSubstrates\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eKm\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eVmax\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(mM)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(nmol/min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e/mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eD, L-glyceraldehyde\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e0.463\u0026thinsp;\u0026plusmn;\u0026thinsp;0.142\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e135.061\u0026thinsp;\u0026plusmn;\u0026thinsp;17.713\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eKetoprofen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e0.478\u0026thinsp;\u0026plusmn;\u0026thinsp;0.193\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e45.99\u0026thinsp;\u0026plusmn;\u0026thinsp;4.726\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMetyrapone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e0.183\u0026thinsp;\u0026plusmn;\u0026thinsp;0.082\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e89.701\u0026thinsp;\u0026plusmn;\u0026thinsp;6.679\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eHelminthiases afflict livestock worldwide and they are accompanied with huge economic losses for farmers. There are many approaches to treat helminthiasis, including non-pharmacological methods such as pasture management and the use of biologically active plants in the diet. However, pharmacotherapy is still the most common approach, although its effectiveness is decreasing due to anthelmintic resistance development in helminths. Anthelmintic resistance, particularly in gastrointestinal nematodes, has been a growing concern due to its significant impact on livestock health and productivity. Therefore, there is an urgent necessity for identifying the mechanisms behind anthelmintic resistance and novel molecular targets for designing new anthelmintics to combat drug-resistant parasites effectively [\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSDR members in nematodes are interesting in both views; SDRs deactivating carbonyl-bearing anthelmintics might contribute to drug resistance development in nematodes, while nematode-specific SDRs with important physiological function might represent promising molecular targets of novel anthelmintic drugs. SDRs\u0026acute; functionality is diverse but centred on managing energy production and detoxification under various conditions that the organisms may encounter [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In nematodes, these enzymes have been studied to understand their structure and function within the context of physiology and adaptation to diverse environmental conditions [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In our study, we focused on \u003cem\u003eHco_sdr12\u003c/em\u003e, as its expression was enhanced in \u003cem\u003eH. contortus\u003c/em\u003e drug-resistant strain and inducible by FLU in drug-sensitive strain [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBioinformatic analysis revealed the highest similarity (54.68%) with human hydroxysteroid dehydrogenase-like 2 (\u003cem\u003eHsa\u003c/em\u003e_HSDL2, NP_115679.2, Q6YN16) enzyme involved in fatty acid metabolism [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and inducible by fasting [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. HSDL2 knockdown reduced mitochondrial respiration, fatty acid oxidation, TCA cycle activity and cholesterol conversion to bile acids [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. When comparing the sequence \u003cem\u003eHco_\u003c/em\u003eSDR12 with \u003cem\u003eHsa\u003c/em\u003e_HSDL2), a match in the typical TGxxxGxG motif for NAD(P)H binding could be seen. \u003cem\u003eHco_\u003c/em\u003eSDR12 active site is fully identical to the active site of \u003cem\u003eHsa\u003c/em\u003e_HSDL2. This is in agreement with the observed relatedness of both enzymes within the phylogenetic tree published earlier [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo know more about \u003cem\u003eHco_\u003c/em\u003eSDR12, the corresponding gene was successfully cloned and the enzyme with molecular mass 45.09 kDa was purified. Various eobiotic and xenobiotic substrates were used for screening of \u003cem\u003eHco_\u003c/em\u003eSDR12 enzyme activities. Contrary to our assumption, this enzyme was not able to reduce FLU. However, a relatively high reductase activity toward many other xenobiotic substrates with various structures was found. Metyrapone, a typical substrate (competitive inhibitor) for 11β-HSD, was a good substrate for \u003cem\u003eHco_\u003c/em\u003eSDR12. The reductase activity of \u003cem\u003eHco_\u003c/em\u003eSDR12 toward cortisone, an eobiotic substrate of 11β-HSD1, was detected, but it was lower than the activity toward other substrates.\u003c/p\u003e\u003cp\u003eThe highest reductase activity \u003cem\u003eHco_\u003c/em\u003eSDR12, was observed toward D, L-glyceraldehyde. Several enzymes participating in carbohydrate metabolism were described to catalyze the reduction of glyceraldehyde using NADPH as a coenzyme, mainly aldose reductase (EC 1.1.1.21), glyceraldehyde reductase (EC 1.1.1.72), and aldehyde reductase (EC 1.1.1.2) (KEGG PATHWAY Database). Based on our results, \u003cem\u003eHco_\u003c/em\u003eSDR12 belongs among them. However, kinetic study performed with three substrates (D, L-glyceraldehyde, ketoprofen, metyrapone) revealed the highest affinity (the lowest K\u003csub\u003eM\u003c/sub\u003e) of \u003cem\u003eHco_\u003c/em\u003eSDR12 toward metyrapone, a clinically used drug for decreasing cortisol formation, which indicates the important role of \u003cem\u003eHco_\u003c/em\u003e SDR12 in deactivation of xenobiotic carbonyls. According to kinetic parameters, \u003cem\u003eHco_\u003c/em\u003e SDR12 is able to deactivate metyrapone more effectively than human 11β-HSD 1[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Concerning potential dehydrogenase activity of \u003cem\u003eHco_\u003c/em\u003eSDR12, low activity was detected toward cortisone and hydrocortisone, but not toward xenobiotic substrate acenaphtenol.\u003c/p\u003e\u003cp\u003eTaken together, \u003cem\u003eHco_\u003c/em\u003eSDR12 is an interesting, multifunctional enzyme with increased expression in drug-resistant strain of nematodes and in nematodes under FLU-mediated stress. Although it does not deactivate FLU and therefore, it cannot participate directly in the protection of nematodes against FLU and in drug-resistance development, it might be helpful in different ways. Based on bioinformatic study and substrate screening, we can conclude that \u003cem\u003eHco_\u003c/em\u003eSDR12 activity protects nematodes against harmful reactive xenobiotic carbonyls, metabolizing them into less toxic forms. In addition, \u003cem\u003eHco_\u003c/em\u003eSDR12 play an important role in their energy metabolism and steroid hormone signalling pathway.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Czech Science Foundation (Grant No. 20-14581Y) and by Charles University project SVV 260 664.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNR and PM designed the project, LS and BS supervised the project and contributed to the data analysis, NR performed all the experiments and evaluated the experimental data, EK extracted all the samples prior to analysis, MN and LRS performed the LC\u0026ndash;MS analysis. NR wrote the manuscript, and PM and LS revised the manuscript. All the authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eShort-chain Dehydrogenases/Reductases Databases. http://sdr-enzymes.org/. Accessed 23.7.2024.\u003c/li\u003e\n\u003cli\u003eRychl\u0026aacute; N, Navr\u0026aacute;tilov\u0026aacute; M, Kohoutov\u0026aacute; E, Stuchlikov\u0026aacute; LR, Sterbov\u0026aacute; K, Kr\u0026aacute;tky J, Matouskov\u0026aacute; P, Szot\u0026aacute;kov\u0026aacute; B, and Sk\u0026aacute;lov\u0026aacute; L (2024) Flubendazole carbonyl reduction in drug-susceptible and drug-resistant strains of the parasitic nematode: changes during the life cycle and possible inhibition. Vet Res 55(1)\u003c/li\u003e\n\u003cli\u003eSkarydov\u0026aacute; L,Ws\u0026oacute;l V (2012) Human microsomal carbonyl reducing enzymes in the metabolism of xenobiotics: well-known and promising members of the SDR superfamily. Drug Metab Rev 44(2):\u003cem\u003e173-191\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eOppermann U (2007) Carbonyl reductases: The complex relationships of mammalian carbonyland quinone-reducing enzymes and their role in physiology. Annual Review of Pharmacology and Toxicology 47:\u003cem\u003e293-322\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eKallberg Y, Oppermann U,Persson B (2010) Classification of the short-chain dehydrogenase/reductase superfamily using hidden Markov models. Febs J 277(10):\u003cem\u003e2375-86\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eFilling C, Berndt KD, Benach J, Knapp S, Prozorovski T, Nordling E, Ladenstein R, Jornvall H, and Oppermann U (2002) Critical residues for structure and catalysis in short-chain dehydrogenases/reductases. Journal of Biological Chemistry 277(28):\u003cem\u003e25677-25684\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eKavanagh K, Jornvall H, Persson B,Oppermann U (2008) The SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. Cellular and Molecular Life Sciences 65(24):\u003cem\u003e3895-3906\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003ePersson B,Kallberg Y (2013) Classification and nomenclature of the superfamily of short-chain dehydrogenases/reductases (SDRs). Chemico-Biological Interactions 202(1-3):\u003cem\u003e111-115\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eKaminsky R, Ducray P, Jung M, Clover R, Rufener L, Bouvier J, Weber SS, Wenger A, Wieland-Berghausen S, Goebel T, Gauvry N, Pautrat F, Skripsky T, Froelich O, Komoin-Oka C, Westlund B, Sluder A, and M\u0026auml;ser P (2008) A new class of anthelmintics effective against drug-resistant nematodes. Nature 452(7184):\u003cem\u003e176-U19\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eNguyen LT, Zaj\u0026iacute;ckov\u0026aacute; M, Mas\u0026aacute;tov\u0026aacute; E, Matouskov\u0026aacute; P,Sk\u0026aacute;lov\u0026aacute; L (2021) The ATP bioluminescence assay: a new application and optimization for viability testing in the parasitic nematode. Vet Res 52(1)\u003c/li\u003e\n\u003cli\u003eSterbov\u0026aacute; K, Rychl\u0026aacute; N, Matouskov\u0026aacute; P, Sk\u0026aacute;lov\u0026aacute; L,Stuchl\u0026iacute;kov\u0026aacute; LR (2023) Short-chain dehydrogenases in: changes during life cycle and in relation to drug-resistance. Vet Res 54(1)\u003c/li\u003e\n\u003cli\u003eStuchl\u0026iacute;kov\u0026aacute; LR, Matouskov\u0026aacute; P, Vokr\u0026aacute;l I, Lamka J, Szot\u0026aacute;kov\u0026aacute; B, Seckarov\u0026aacute; A, Dimunov\u0026aacute; D, Nguyen LT, V\u0026aacute;rady M, and Sk\u0026aacute;lov\u0026aacute; L (2018) Metabolism of albendazole, ricobendazole and flubendazole in \u003cem\u003eHaemonchus contortus\u003c/em\u003e adults: Sex differences, resistance-related differences and the identification of new metabolites. International Journal for Parasitology-Drugs and Drug Resistance 8(1):\u003cem\u003e50-58\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eMadeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R,Butcher S (2024) The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic acids research 52(W1):\u003cem\u003eW521-W525\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eSterbov\u0026aacute; K, Rychl\u0026aacute; N, Stuchl\u0026iacute;kov\u0026aacute; LR, Matouskov\u0026aacute; PM,Sk\u0026aacute;lov\u0026aacute; L (2023) Flubendazole-induced changes in the expression of selected SDR genes throughout the developmental stages of Haemonchus contortus. Journal of Veterinary Pharmacology and Therapeutics 46:\u003cem\u003e114-114\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eClarke NE, Doi SAR, Wangdi K, Chen Y, Clements ACA,Nery SV (2019) Efficacy of anthelminthic drugs and drug combinations against soil-transmitted helminths: A systematic review and network meta-analysis. Clinical Infectious Diseases 68(1):\u003cem\u003e96-105\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eFissiha W,Kinde MZ (2021) Anthelmintic Resistance and Its Mechanism: A Review. Infect Drug Resist 14:\u003cem\u003e5403-5410\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eNixon SA, Welz C, Woods DJ, Costa-Junior L, Zamanian M,Martin RJ (2020) Where are all the anthelmintics? Challenges and opportunities on the path to new anthelmintics. Int J Parasitol Drugs Drug Resist 14:\u003cem\u003e8-16\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eBeck KR, Kaserer T, Schuster D,Odermatt A (2017) Virtual screening applications in short-chain dehydrogenase/reductase research. Journal of Steroid Biochemistry and Molecular Biology 171:\u003cem\u003e157-177\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eJones LM, Rayson SJ, Flemming AJ,Urwin PE (2013) Adaptive and Specialised Transcriptional Responses to Xenobiotic Stress in \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e Are Regulated by Nuclear Hormone Receptors. Plos One 8(7)\u003c/li\u003e\n\u003cli\u003eLi YX, Feng YQ, Wang X, Cui J, Deng X,Zhang XY (2020) Adaptation of pine wood nematode \u003cem\u003eBursaphelenchus xylophilus\u003c/em\u003e to \u0026beta;-pinene stress. Bmc Genomics 21(1)\u003c/li\u003e\n\u003cli\u003eMenzel R, Yeo HL, Rienau S, Li S, Steinberg CEW,St\u0026uuml;rzenbaum SR (2007) Cytochrome P450s and short-chain dehydrogenases mediate the toxicogenomic response of PCB52 in the nematode \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e. Journal of Molecular Biology 370(1):\u003cem\u003e1-13\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eKowalik D, Haller F, Adamski J,Moeller G (2009) In search for function of two human orphan SDR enzymes: Hydroxysteroid dehydrogenase like 2 (HSDL2) and short-chain dehydrogenase/reductase-orphan (SDR-O). Journal of Steroid Biochemistry and Molecular Biology 117(4-5):\u003cem\u003e117-124\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eSamson N, Bosoi CR, Roy C, Turcotte L, Tribouillard L, Mouchiroud M, Berthiaume L, Trottier J, Silva HCG, Guerbette T, Plata-Gomez AB, Besse-Patin A, Montoni A, Ilacqua N, Lamothe J, Citron YR, Gelinas Y, Gobeil S, Zoncu R, Caron A, Morissette M, Pellegrini L, Rochette PJ, Estall JL, Efeyan A, Shum M, Audet-Walsh E, Barbier O, Marette A, and Laplante M (2024) HSDL2 links nutritional cues to bile acid and cholesterol homeostasis. Science Advances 10(22)\u003c/li\u003e\n\u003cli\u003eBannenberg G, Martin HJ, B\u0026eacute;lai I,Maser E (2003) 11\u0026beta;-hydroxysteroid dehydrogenase type 1:: tissue-specific expression and reductive metabolism of some anti-insect agent azole analogues of metyrapone. Chemico-Biological Interactions 143:\u003cem\u003e449-457\u003c/em\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"anthelmintics, drug biotransformation, helminths, parasite","lastPublishedDoi":"10.21203/rs.3.rs-7362067/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7362067/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eShort-chain dehydrogenases/reductases (SDRs) play a crucial role in xenobiotic and eobiotic metabolism in all organisms. In the parasitic nematode \u003cem\u003eHaemonchus contortus\u003c/em\u003e, SDRs represent potential contributors to drug resistance and potential drug targets. Among them, \u003cem\u003eHco_sdr12\u003c/em\u003e (WormBaseAcc: HCON_0049110) seemed to be the most interesting as its constitutive expression was higher in all developmental stages of \u003cem\u003eH. contortus\u003c/em\u003e from the drug-resistant strain in comparison to the drug-susceptible strain. Moreover, \u003cem\u003eHco_sdr12\u003c/em\u003e was inducible by exposure of \u003cem\u003eH. contortus\u003c/em\u003e adult males with the anthelmintic drug flubendazole. With an aim to know more about this enzyme, \u003cem\u003eHco_\u003c/em\u003eSDR12 (UniprotAcc: A0A7I5E7J1) was cloned, purified and characterised. The corresponding gene was cloned into the pET22b(+) vector system, the protein was overexpressed in \u003cem\u003eE. coli\u003c/em\u003e and purified by Ni-affinity chromatography. The various xenobiotic and eobiotic compounds, including flubendazole, were tested as potential substrates of \u003cem\u003eHco_\u003c/em\u003eSDR12. Although this enzyme did not reduce flubendazole, significant reductase activities toward many other substrates were found with a preference for NADPH as a coenzyme. Glyceraldehyde, metyrapone and ketoprofen were used for kinetic studies. According to bioinformatic analysis, \u003cem\u003eHco_\u003c/em\u003eSDR12 shares the highest similarity with hydroxysteroid dehydrogenase-like protein 2, which indicates its involvement in lipid metabolism. Even though \u003cem\u003eHco_\u003c/em\u003eSDR12 cannot deactivate flubendazole, it can deactivate other xenobiotics with a carbonyl group. Its higher expression might help nematodes to protect themselves against reactive compounds and to gain energy from lipides more effectively.\u003c/p\u003e","manuscriptTitle":"Cloning, expression and characterisation of short-chain dehydrogenase/reductase SDR12 (A0A7I5E7J1) from a parasitic nematode Haemonchus contortus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-08 10:35:59","doi":"10.21203/rs.3.rs-7362067/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-11T05:40:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-03T13:15:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-26T01:44:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"120233125716581427473604965098135582584","date":"2025-08-29T12:08:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"134239393680842285455616302187448174696","date":"2025-08-28T15:17:41+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-28T14:47:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-27T15:21:53+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-08-27T15:13:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-19T05:32:35+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-08-19T05:28:56+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c576ab32-9797-4d20-84bc-73cd43c7b6cb","owner":[],"postedDate":"September 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":54088583,"name":"Biological sciences/Biochemistry"},{"id":54088584,"name":"Biological sciences/Drug discovery"},{"id":54088585,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2026-04-07T16:04:14+00:00","versionOfRecord":{"articleIdentity":"rs-7362067","link":"https://doi.org/10.1038/s41598-026-45685-w","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-03-31 15:59:04","publishedOnDateReadable":"March 31st, 2026"},"versionCreatedAt":"2025-09-08 10:35:59","video":"","vorDoi":"10.1038/s41598-026-45685-w","vorDoiUrl":"https://doi.org/10.1038/s41598-026-45685-w","workflowStages":[]},"version":"v1","identity":"rs-7362067","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7362067","identity":"rs-7362067","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.