Vortioxetine mitigates methotrexate-induced oral mucosa injury via sirtuin 1 pathway and intrinsic apoptosis signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Vortioxetine mitigates methotrexate-induced oral mucosa injury via sirtuin 1 pathway and intrinsic apoptosis signaling Mustafa Karaca, Burcu Bakir, Aybike Imeci, Esma Selcuk, Halil Asci, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8273479/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Mar, 2026 Read the published version in BMC Oral Health → Version 1 posted 11 You are reading this latest preprint version Abstract Background Methotrexate (MTX) commonly causes oral mucositis by inducing epithelial cytotoxicity and inflammation, leading to functional impairment and treatment limitations. Therefore, agents that can protect oral tissues without reducing MTX efficacy are needed. Vortioxetine (VOR), with its reported anti-inflammatory and antioxidant actions, may offer such therapeutic potential. Methods Thirty-two adults female Wistar rats were divided into four groups: Control, MTX, VOR and MTX + VOR (n = 8 each). VOR (10 mg/kg/day, intraperitoneally [i.p.]) was administered continuously for five days and a single dose of MTX (20 mg/kg, i.p.) was injected 30 minutes after the first VOR dose on day 1. Maxillary gingiva and tongue tissues were harvested on day 5 for histopathological, immunohistochemical (caspase-3 [CAS-3], tumor necrosis factor [TNF-α]) and molecular (sirtuin 1 [SIRT1], nuclear factor erythroid 2-related factor 2 [NRF2], peroxisome proliferator-activated receptor gamma coactivator 1-alpha [PGC1α], B-cell lymphoma 2 [BCL2], and BCL2-associated X protein [BAX]) analyses. Results MTX treatment caused increased TNF-α and CAS-3 immunoexpressing, leading to severe epithelial degeneration, hyperemia and inflammatory cell infiltration in the oral mucosa. Gene expression analysis supported that there was a significant upregulation of proapoptotic (BAX, CAS-3) and inflammatory markers (TNF-α) whereas a downregulation of mitochondrial regulators (SIRT1, NRF2, PGC1α, BCL2). Co-treatment with VOR markedly reversed these changes. Conclusion VOR significantly ameliorated the damage caused by MTX to the oral mucosa by interfering with the SIRT1/NRF2/PGC1α antioxidant axis and suppressing the BAX/BCL2/CAS-3 apoptotic pathway. These results indicate that VOR can be used as a valuable therapeutic agent that can be combined with chemotherapy to alleviate side effects in the oral mucosa by restoring redox homeostasis, mitochondrial integrity and cellular survival signals. Methotrexate Vortioxetine Oral mucositis Oxidative stress Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background The treatment of neoplastic and autoimmune diseases such as acute lymphoblastic leukemia, rheumatoid arthritis, and psoriasis is performed with commonly using methotrexate (MTX), a folic acid antagonist (Cronstein and Aune 2020 ). Despite its clinical efficacy, MTX may provoke certain side effects, including hepatotoxicity, nephrotoxicity, and oral mucositis (Hu, Escalera-Joy et al. 2024 ). Oral mucositis, characterized by epithelial cell loss, inflammation, ulceration, and pain, is one of the most common dose-limiting toxicities affecting patients' nutrition, speech, and quality of life (Sonis 2004 , Georgiou, Patapatiou et al. 2012 ). The cytotoxic effects of MTX trigger epithelial cell damage in the gingival connective tissue, leading to a local inflammatory response (Seymour, Thomason and Ellis 1996 , Pedrazas, Azevedo and Torres 2010 , Martu, Maftei et al. 2021 ). In addition, these cytotoxic effects can cause a process that spreads from the gums to the periodontal ligament and even the alveolar bone (Yoshinari, Kameyama et al. 1994 , Dahab and Morsy 2024 ). Given the central role of oxidative stress and mitochondrial dysfunction in MTX-induced oral mucosal injury, understanding the key molecular regulators of these pathways becomes essential. Nuclear factor erythroid 2–related factor 2 (NRF2) promotes the transcription of antioxidant genes and thereby serves as a critical component of the cellular defense system. NRF2 activation enhances the expression of anti-apoptotic proteins such as B-cell lymphoma 2 (BCL2) while suppressing pro-apoptotic mediators like BCL2-associated X protein (BAX) (Niture and Jaiswal 2012 ). The balance between these apoptotic regulators is closely linked to mitochondrial resilience, as BAX-driven mitochondrial permeabilization directly triggers caspase-3 (CAS-3) activation. In this context, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) plays a pivotal role in maintaining mitochondrial biogenesis and energy homeostasis, while Sirtuin 1 (SIRT1), an NAD⁺-dependent deacetylase, activates PGC-1α to further enhance mitochondrial function and elevate the apoptotic threshold (Zhou, Wang et al. 2018). Through this integrated signaling network, cells mount a coordinated response to oxidative stress and DNA damage, stabilizing the BAX/BCL2 ratio and limiting CAS-3–mediated apoptosis (Zhou, Wang et al. 2018, Ebrahimnezhad, Nayebifar et al. 2023 ). Therefore, identifying therapeutic agents capable of modulating these antioxidant and apoptotic pathways is crucial for reducing MTX-associated oral toxicity (Fig. 1 ). MTX triggers oxidative stress, inflammation and intrinsic apoptosis through downregulation of SIRT1/NRF2/PGC-1α and upregulation of TNF-α, BAX, and CAS-3, whereas VOR counteracts these pathways to preserve mitochondrial function and epithelial integrity. MTX: Methotrexate, SIRT1: Sirtuin 1, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha, NRF2: Nuclear factor erythroid 2-related factor 2, BCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein, TNF-α: Tumor necrosis factor alpha. Given these mechanistic insights, vortioxetine (VOR) emerges as a potential agent capable of modulating MTX-induced mucosal injury. VOR is a multimodal serotonergic antidepressant for the treatment of major depressive disorder (Sanchez, Asin and Artigas 2015 ). Beyond its psychotropic effects, recent studies have reported anti-inflammatory, antioxidant, and neuroprotective properties in both central and peripheral tissues (Talmon, Rossi et al. 2018 ). Although dry mouth has been reported as a clinical side effect, preclinical data indicate that VOR can influence cytokine-mediated inflammatory pathways (Baldwin, Chrones et al. 2016 , Talmon, Rossi et al. 2018 ). In this context, the present study aimed to determine whether VOR can attenuate MTX-induced inflammatory and apoptotic responses in the oral mucosa. To address this objective, gingival and tongue tissues were comprehensively evaluated using histopathological, immunohistochemical, and molecular approaches. Methods Animals and Experimental Design A total of 32 female Wistar albino rats (300–350 g) were obtained from the Suleyman Demirel University Experimental Animal Research Center (Isparta, Türkiye). The study was approved by the SDU Animal Experiments Local Ethics Committee (approval no: HADYEK 6/559, date: 12.06.2025). Rats were kept at 20–24°C for 12 hours under day and night conditions. They were fed under optimal conditions with unrestricted access to food and water. Four groups, each consisting of eight rats, were assigned for the experimental model: Control group Rats in this group received sterile 0.9% saline (1 mL/kg, intraperitoneally [i.p.]) once daily for five consecutive days. This group served as a negative control to account for handling and injection stress associated with the experimental procedures. MTX group Animals were injected with a single dose of 20 mg/kg i.p. MTX (Koçak Farma, Türkiye) on day 1. These rats were administered sterile saline (1 mL/kg, i.p.) once daily between days 1 and 5 to ensure operational equivalence. As explained in previous preclinical studies, the single high-dose MTX model was selected to reliably induce systemic toxicity within five days (Samdanci, et al., 2019). VOR group Rats were treated with VOR (PharmaVision, Türkiye) at 10 mg/kg/day i.p. for five consecutive days (days 1–5) and did not receive MTX. This group was included to assess the baseline safety and tissue compatibility of VOR on oral structures and inflammatory parameters (Barbosa-Méndez et al., 2022). MTX + VOR group Animals received VOR (10 mg/kg/day, i.p.) once a day for five days (days 1–5), along with a single MTX dose (20 mg/kg, i.p.) administered 30 minutes after the first VOR injection on day 1. This pre-treatment paradigm was aimed at analysing its potential beneficial effect of VOR when given concurrently with the MTX insult and during the subsequent inflammatory and oxidative phases of tissue injury. On day 5, rats were anesthetized with ketamine (90 mg/kg, Doğa İlaç, Türkiye) and xylazine (10 mg/kg, Bioveta, Czech Republic) and sacrificed by surgical exsanguination via the inferior vena cava. Maxillary gingiva and tongue tissues were immediately harvested for analyses. Histopathological Analysis After fixation, maxillary and tongue tissues were decalcified (for jaw), dehydrated in graded ethanol, and embedded in paraffin. Longitudinal sections (5 µm thick) were stained with hematoxylin and eosin (H&E). Histopathological parameters, including epithelial degeneration, submucosal hyperemia, inflammatory infiltration, mast cell presence (in tongue muscle) and hemorrhage, were evaluated under ×20 and ×40 magnification using a light microscope. Semi-quantitative scoring (0 = absent, 1 = mild, 2 = moderate, 3 = severe) was performed blindly by an expert pathologist for each parameter. Cell counts for polymorphonuclear leukocytes (PMNLs) and lymphocytes were conducted using CellSens Life Science Imaging software (Olympus, Japan), as previously described (Kirzioglu et al., 2017; Yoshinaga et al., 2014). Immunohistochemical Analysis Immunohistochemical staining was performed using rabbit monoclonal antibodies against CAS-3 (ab184787, Abcam, UK) and TNF-α (ab307164, Abcam, UK), both diluted 1:100. The Mouse-Specific HRP/DAB Detection IHC Kit (ab64259, Abcam) was used for secondary detection. Tissue sections were incubated with primary antibodies for one hour. Subsequently, they were reacted with streptavidin-biotin conjugate and DAB chromogen for visualisation. Negative controls were processed in the same manner, but without the addition of primary antibody. The staining level was estimated semi-quantitatively as 0 (no staining), 1 (weak), 2 (moderate), and 3 (strong). Image analysis was performed with ImageJ software (NIH, Bethesda, USA) and morphometric evaluation was conducted using CellSens software. Reverse Transcription Quantitative Polymerase Chain Reaction Harvested gingival and tongue tissues were placed into DNase/RNase-free, pre-labeled tubes and stored at − 80°C until analysis. Total RNA was extracted after homogenization in 1000 µL GeneAll RiboEx™ solution (Seoul, Korea) using a low-speed sonicator, followed by purification with the GeneAll Ribospin RNA isolation kit according to the manufacturer’s protocol. RNA quantity and purity were assessed by Nanodrop spectrophotometry, and only samples with 260/280 ratios between 1.8 and 2.0 were used for downstream analyses. RNA concentrations were standardized to 1000 ng/µL and stored at − 80°C. cDNA synthesis was performed in a thermal cycler using the A.B.T.™ cDNA Synthesis Kit (Atlas Biotechnology, Türkiye) in a final reaction volume of 20 µL prepared on ice. Primer sequences for target genes were designed based on reference mRNA regions and validated using NCBI databases (Table 1 ); lyophilized primers were reconstituted in RNase-free water (100 µM) and diluted to working concentrations. Quantitative real-time PCR was performed using 2× SYBR Green master mix (Nepenthe, Türkiye) on a Bio-Rad CFX96 system (California, USA) in 0.1 mL PCR tubes. Reactions (20 µL) were run in triplicate under the following conditions: initial denaturation at 94°C for 10 min, followed by 40 cycles of 95°C for 15 s and 55°C for 30 s. GAPDH was used as the housekeeping gene for normalization. Ct values were recorded for each sample, and relative gene expression was calculated using the 2^−ΔΔCt method for subsequent statistical analyses. Table 1 Primary sequences, product size and accession numbers of genes Genes Primary sequence product size accession number GAPDH (HouseKeeping) F: AGTGCCAGCCTCGTCTCATA 248 bp NM_017008.4 R: GATGGTGATGGGTTTCCCGT SIRT1 F: GGTAGTTCCTCGGTGTCCT 152 bp NM_001414959.1 R:ACCCAATAACAATGAGGAGGTC PGC-1α F: TTCAGGAGCTGGATGGCTTG 104 bp NM_031347.1 R: AGATCTGGGCAAAGAGGCTG NRF2 F: GCCTTCCTCTGCTGCCATTAGTC 126 bp NM_001399173.1 R:TCATTGAACTCCACCGTGCCTTC BAX F: CACGTCTGCGGGGAGTCAC 419 bp NM_017059.2 R: TAGAAAAGGGCAACCACCCG BCL2 F: CATCTCATGCCAAGGGGGAA 284 bp NM_016993.2 R: TATCCCACTCGTAGCCCCTC F: Forward, R: Reverse, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, SIRT1: Sirtuin 1, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha, NRF2: Nuclear factor erythroid 2-related factor 2, BCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein. Statistical analysis For statistical analysis, histopathological, immunohistochemical and genetic scores were compared between the groups. Initially, the Shapiro-Wilk method was employed to assess the normality of the data distribution. ANOVA was employed as a means of comparing the groups since the data showed a normal distribution (P > 0.05). For this purpose, the One-way ANOVA with Tukey’s multiple comparison tests was used by the GraphPad Prism version 10.1 (GraphPad Software, USA) package program. The level of significance was considered at (p < 0.05) Results Histopathological Findings In the control and VOR groups, a normal periodontal structure was observed. In the MXT group, degenerative changes were detected in the epithelial cells of the gingival tissues, along with thinning of the epithelial layer and dense bacterial accumulations on the epithelial surface. Both intraepithelial and submucosal inflammatory cell infiltrations, predominantly composed of neutrophils and lymphocytes, were observed. Additionally, subepithelial edema was prominent in this group, and microhemorrhages were noted in some rats. Treatment with VOR resulted in a marked improvement in all pathological findings (Fig. 2). Fig. 2: Histopathological appearance of the interdental papilla of rats between the groups. (A) Normal gingival epithelium (arrow) in the control group. (B) Marked hyperemia (thin arrow head) in the submucosa, bacteria clusters (thick arrow head) and necrosis in MTX group. (C) Decreased hyperemia (thin arrow head) and slight erosion in gingival tissue (thin arrow) in MTX + VOR group. (D) Normal gingival appearance in VOR group, HE, scale bars = 50µm. In the control group rats, the tongue mucosa, submucosa and muscle layer appeared normal. In the MTX group, there were degenerative modifications in the epithelial cells of the tongue mucosa and distinct bacterial clusters on the epithelial surface. Additionally, a marked accumulation of mast cells was noted in the muscle layer of the tongue in the MTX group. Treatment with VOR significantly reduced all pathological findings (Fig. 3 ). Semi-quantitative scoring showed significantly elevated hyperemia and mast cell infiltration scores in the MTX group compared to control (p < 0.001). In the MTX + VOR group, these scores were significantly reduced for both parameters (p < 0.001), and the VOR group showed no significant deviation from the control. Even though oedema, hemorrhage, and neutrophilic infiltration scores were slightly increased in the MTX and MTX + VOR groups, there was no statistically significant difference between the groups (Fig. 4 ). Bar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots displays the individual scores of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. * p < 0.05, *** p < 0.001. MTX: Methotrexate, VOR: Vortioxetine. Immunohistochemical findings Immunohistochemical analysis of gingival tissue, especially periodontal ligament, showed elevated CAS-3 and TNF-α expression levels in the MTX group. Treatment with VOR effectively normalized these expressions. The expression was particularly prominent in osteoblastic cells, with osteoclasts and mesenchymal cells also showing higher levels compared to epithelial cells. Additionally, increased expression was observed in inflammatory cells (Fig. 5 ). (A) Minimal to no expression in the control group. (B) Marked increase in expression (arrows) in the MTX group. (C) Reduced expression in the MTX + VOR treatment group. (D) Negative to minimal expression in the VOR group. Streptavidin-biotin peroxidase method, Scale bars = 50 µm. Immunohistochemical examination of the tongue mucosa revealed that while slight to negative CAS-3 and TNF-α expressions observed in the control group, marked increased expressions were observed in the epithelial layer in the MTX group. In addition, some mesenchymal and muscle cells were also showed positive immunoexpressions in this group. VOR treatment decreased the expressions in the MTX + VOR group. VOR group had negative expressions (Fig. 6 ). (A) Negative to slight expression in the control group. (B) Marked increase in expression (arrows) in the MTX group. (C) Reduced expression in the MTX + VOR treatment group. (D) Negative to slight expression in the VOR group. Streptavidin-biotin peroxidase method, Scale bars = 50 µm. Immunohistochemical staining of the control group showed no or very little CAS-3 and TNF-α expression. CAS-3 and TNF-α expression increased significantly in the MTX group compared to the control group (p < 0.001 for both). After MTX-VOR treatment, TNF-α and CAS-3 expression also decreased significantly (p < 0.001 for both). The VOR group showed similar TNF-α expression patterns but significantly lower CAS-3 expressions compared to the control group (p < 0.001). The results of the statistical analysis of immunohistochemical expression are shown in Fig. 7 . Bar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. ** p < 0.01, *** p < 0.001. MTX: Methotrexate, VOR: Vortioxetine, CAS-3: Caspase 3, TNF-α: Tumor necrosis factor alpha. Oxidative Stress Pathway MTX exposure led to a significant suppression of antioxidant defence genes in oral tissues. Specifically, SIRT1 and NRF2 mRNA levels were dramatically reduced in the MTX group compared to the control group (p < 0.001 for both). Co-administration of VOR significantly reversed these changes (p < 0.001 for both vs. MTX). The VOR group displayed normal or slightly increased expression of these genes (Fig. 8 ). Bar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. *** p < 0.001. MTX: Methotrexate, VOR: Vortioxetine, SIRT1: Sirtuin 1, NRF2: Nuclear factor erythroid 2-related factor 2. Mitochondrial Biogenesis and Apoptotic Pathway MTX exposure significantly disrupted the mitochondrial and apoptotic gene balance in oral tissues. BAX expression increased approximately threefold, while BCL2 levels decreased significantly (p < 0.001 for both). Concomitant treatment with VOR effectively rebalanced this ratio by suppressing BAX transcription and increasing BCL2 expression (p < 0.001 for both vs. MTX) (Fig. 9 ). Bar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. *** p < 0.001. MTX: Methotrexate, VOR: Vortioxetine, BCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha. Furthermore, rats treated with MTX displayed a significant downregulation of PGC1α compared to the control (p < 0.001). VOR application recovered PGC-1α expression when compared to the MTX group (p < 0.001). Discussion MTX is frequently used in autoimmune and neoplastic diseases. Unfortunately, its toxic effect on rapidly dividing cells causes undesirable side effects such as oral mucositis and epithelial degeneration (Rampon, Henkin et al. 2018 , Koźmiński, Halik et al. 2020 ). In this study, MTX treatment caused significant epithelial thinning, hyperemia, inflammatory cell infiltration, and mast cell accumulation in gingival and lingual tissues. These data are coherent with prior reports indicating that MTX disrupts mucosal integrity through direct cytotoxicity and excessive ROS production (Sonis 2004 , Hu, Escalera-Joy et al. 2024 ). The significant upregulation of TNF-α and CAS-3 immunoreactivity strongly emphasized the simultaneous activation of inflammatory and apoptotic cascades, a typical example of chemotherapy-induced mucosal damage (Huang, Yang et al. 2017 , Bayramoglu, Mokhtare et al. 2022 ). Treatment with VOR significantly reversed these histopathological lesions. In animals receiving MTX + VOR, epithelial morphology was preserved, hyperemia was reduced, and inflammatory and mast cell infiltration was markedly decreased. As evidenced by the reduction in TNF-α and CAS-3 expression, a decrease in inflammatory response and apoptosis at both the structural and molecular levels accompanied these histological changes. This is in agreement with preliminary studies indicating that VOR possesses antioxidant and anti-inflammatory properties as well as central serotonergic effects (Sanchez, Asin and Artigas 2015 , Talmon, Rossi et al. 2018 ). At the molecular level, the current qRT-PCR results demonstrate that MTX exposure strongly upregulates BAX and CAS-3, accompanied by a significant downregulation of BCL2, which is interpreted as activating the intrinsic mitochondrial apoptosis pathway. These findings are consistent with previous reports (Kolli, Abraham et al. 2009 , Asci, Ozmen et al. 2017 ). This anti-apoptotic change supports the notion that VOR stabilizes mitochondrial membranes and preserves the cell survival signal. Thus, the findings of these studies explain the reversal of inflammatory effects in the periodontal ligament and tongue epithelium with the additional application of VOR. In our study, it was observed that VOR not only inhibits apoptosis but also significantly increases PGC-1α, the primary transcription coactivator that directs mitochondrial replication and oxidative phosphorylation, therefore improving mitochondrial biogenesis and energy metabolism. The recovery of PGC1α expression observed in the MTX + VOR group suggests that VOR is not only a substance that limits damage, but also a substance that triggers damage, enabling mitochondrial regeneration and adaptive remodeling. This finding can be correlated with the literature showing that serotonergic modulation improves mitochondrial function and redox homeostasis. (Bhargava and Schnellmann 2017 , Ľupták, Fišar and Hroudová 2022 ). (Talmon, Rossi et al. 2018 ) showed that serotonin receptor agonists can activate SIRT1–PGC-1α signaling and restore mitochondrial integrity under oxidative stress, which is like the results of our study. MTX exposure has led to a marked suppression of SIRT1 and NRF2, two central regulators of redox balance and cellular defense. SIRT1 deacetylates NRF2, promoting its nuclear translocation and the transcription of antioxidant enzymes such as heme oxygenase-1 (HO-1) and glutathione peroxidase 4 (GPX4) (Ma 2013 ). The downregulation of these genes observed in cases of MTX toxicity indicates that oxidative stress is one of the primary causes of tissue damage. On the other hand, VOR application significantly upregulated both SIRT1 and NRF2 expressions, thus restoring the antioxidant defense system. This result is consistent with the extensive evidence that VOR can recover mitochondrial respiration and reduce oxidative stress. (Talmon, Rossi et al. 2018 , Ľupták, Fišar and Hroudová 2022 ). In our study, the normalization of TNF-α levels in the MTX + VOR group demonstrates that VOR breaks the vicious cycle between oxidative stress and cytokine-induced apoptosis by interfering with this inflammatory pathway. The accumulation of mast cells, especially in the tongue muscle in the MTX group, also reveals the role of neuroimmune interaction in mucosal inflammation. Serotonin and mast cells share mutually regulatory pathways; serotonin can suppress mast cell degranulation, while mast cell mediators influence the serotonin cycle (Kushnir-Sukhov, Gilfillan et al. 2006 ). Therefore, the decrease in mast cell density in tissues treated with VOR may stem directly from serotonergic stabilization of mucosal immune balance. This represents an innovative dimension of VOR's therapeutic effect and extends its efficacy from neuronal systems to epithelial systems. The concurrent activation of the SIRT1/NRF2/PGC-1α pathways and suppression of the TNF-α/BAX/CAS-3 apoptotic cascade collectively contributes to the restoration of mitochondrial homeostasis and redox balance. In the MTX + VOR group, this coordinated molecular modulation underlies the observed histopathological improvement. Consequently, the epithelial architecture remains largely preserved, while hyperemia and inflammatory cell infiltration are markedly reduced compared to MTX alone. Vortioxetine is an FDA-approved antidepressant with a well-established safety profile, which supports its potential repositioning as an adjunctive agent for protecting the oral mucosa. This may be particularly relevant for patients receiving chronic MTX therapy, as both depression and MTX-induced oral toxicity have been shown to negatively affect quality of life and treatment adherence (Valer, Curra et al. 2021 ). The present findings suggest that VOR may confer benefits beyond its psychotropic effects, exhibiting additional anti-inflammatory and anti-apoptotic actions within oral tissues, thereby offering a dual therapeutic advantage. This study has several limitations. First, the research was conducted in an experimental rat model, and although this model effectively simulates MTX-induced oral mucositis, it may not fully reflect the complex pathophysiological processes seen in humans. Secondly, the study utilized only a single dose of methotrexate and a fixed VOR regimen; consequently, the dose-response relationship and long-term effects could not be evaluated. Additionally, the study focused primarily on oxidative stress, inflammation, and mitochondrial apoptotic pathways; other possible mechanisms such as angiogenesis, autophagy, or changes in oral microbiota were not investigated. Moreover, the assessments were conducted at a single point in time; thereby, the dynamic changes in the development and healing process of mucositis could not be demonstrated. In future studies, the inclusion of different time points, varying drug doses, and complementary mechanical analyses with clinical validation are essential to confirm and expand upon these findings. Conclusions Finally, this study supports the concept that targeting mitochondrial signal transduction and antioxidant transcription factors offers a viable strategy for preventing drug-induced oral mucositis. Future research should expand on these findings by evaluating downstream antioxidants, mitochondrial ultrastructure by electron microscopy, and long-term effects on epithelial regeneration. However, our integrated analysis including histology, immunohistochemistry and gene expression convincingly demonstrates that VOR provides comprehensive protection against MTX-induced oral toxicity by restoring cellular homeostasis. Abbreviations MTX Methotrexate VOR Vortioxetine CAS-3 Caspase-3 TNF-α Tumor necrosis factor SIRT1 Sirtuin 1 NRF2 Nuclear factor erythroid 2-related factor 2 PGC1α Peroxisome proliferator-activated receptor gamma coactivator 1-alpha BCL2 B-cell lymphoma 2 BAX BCL2-associated X protein H&E Hematoxylin and eosin PMNLs Polymorphonuclear leukocytes F Forward R Reverse GAPDH Glyceraldehyde-3-phosphate dehydrogenase Declarations Ethics approval and consent to participate The study was approved by the SDU Animal Experiments Local Ethics Committee (approval no: HADYEK 6/559, date: 12.06.2025). Consent for publication Not applicable. Availability of data and materials Data related to the study results are accessible through the corresponding author on request. Competing interests The corresponding author and co-authors declare no financial or ethical conflicts of interest related to this study Funding The study was funded by the Suleyman Demirel University [grant number: TSG-2024-9556]. Declaration of Generative AI Use: During the preparation of this work, the authors used ChatGPT-5.1 to improve language and readability. After using this tool/service, the authors reviewed and edited the content as needed and took full responsibility for the content of the publication. Author Contributions: Conceptualization, M.K., B.B., A.I., and H.A.; methodology, M.K., B.B., E.S., H.A., and O.O.; validation, M.K., H.A., and O.O.; formal analysis, O.O. and E.S.; investigation, M.K., B.B., A.I.; resources, M.K., H.A., data curation, M.K., B.B., A.I., and E.S.; writing—original draft preparation, M.K., A.I., E.S., H.A., and O.O.; writing—review and editing, M.K., A.I., E.S., H.A., and O.O.; visualization, A.I., H.A., and O.O.; supervision, O.O. and H.A.; project administration, M.K., B.B., and H.A. All authors have read and agreed to the published version of the manuscript. Acknowledgements Not applicable. References Asci H, Ozmen O, Ellidag HY, Aydin B, Bas E, Yilmaz N. The impact of gallic acid on methotrexate-induced kidney damage in rats. J Food Drug Anal. 2017;25(4):890–7. Baldwin DS, Chrones L, Florea I, Nielsen R, Nomikos GG, Palo W, et al. The safety and tolerability of vortioxetine: analysis of data from randomized placebo-controlled trials and open-label extension studies. J Psychopharmacol. 2016;30(3):242–52. Bayramoglu Z, Mokhtare B, Mendil AS, Coban TA, Mammadov R, Bulut S, et al. Effect of taxifolin on methotrexate-induced oxidative and inflammatory oral mucositis in rats: biochemical and histopathological evaluation. J Appl Oral Sci. 2022;30:e20220115. Bhargava P, Schnellmann RG. Mitochondrial energetics in the kidney. Nat Rev Nephrol. 2017;13(10):629–46. Cronstein BN, Aune TM. Methotrexate and its mechanisms of action in inflammatory arthritis. Nat Rev Rheumatol. 2020;16(3):145–54. Dahab MM, Morsy SM. Evaluation of the prophylactic effect of pomegranate peel extract and pumpkin seed oil on the periodontium of rats receiving methotrexate: histologic and immunohistochemical study. Egypt Dent J. 2024;70(3):2281–94. Ebrahimnezhad N, Nayebifar S, Soltani Z, Khoramipour K. High-intensity interval training reduced oxidative stress and apoptosis in the hippocampus of male rats with type 2 diabetes: the role of the PGC1α-Keap1-Nrf2 signaling pathway. Iran J Basic Med Sci. 2023;26(11):1313. Georgiou M, Patapatiou G, Domoxoudis S, Pistevou-Gompaki K, Papanikolaou A. Oral mucositis: understanding the pathology and management. Hippokratia. 2012;16(3):215. Hu Z, Escalera-Joy AM, Ashcraft E, Acharya R, Jeha S, Cheng C, et al. Clinical risk factors for high-dose methotrexate-induced oral mucositis following individualized dosing. Cancer Med. 2024;13(21):e70351. Huang JS, Yang CM, Wang JS, Liou HH, Hsieh IC, Li GC, et al. Caspase-3 expression in tumorigenesis and prognosis of buccal mucosa squamous cell carcinoma. Oncotarget. 2017;8(48):84237–46. Kolli VK, Abraham P, Isaac B, Selvakumar D. Neutrophil infiltration and oxidative stress may play a critical role in methotrexate-induced renal damage. Chemotherapy. 2009;55(2):83–90. Koźmiński P, Halik PK, Chesori R, Gniazdowska E. Overview of dual-acting drug methotrexate in different neurological diseases, autoimmune pathologies and cancers. Int J Mol Sci. 2020;21(10):3483. Kushnir-Sukhov NM, Gilfillan AM, Coleman JW, Brown JM, Bruening S, Toth M, et al. 5-hydroxytryptamine induces mast cell adhesion and migration. J Immunol. 2006;177(9):6422–32. Ľupták M, Fišar Z, Hroudová J. Agomelatine, ketamine and vortioxetine attenuate energy cell metabolism-In vitro study. Int J Mol Sci. 2022;23(22):13824. Ma Q. Role of Nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 2013;53:401–26. Martu MA, Maftei GA, Luchian I, Stefanescu OM, Scutariu MM, Solomon SM. The effect of acknowledged and novel anti-rheumatic therapies on periodontal tissues: a narrative review. Pharmaceuticals. 2021;14(12):1209. Niture SK, Jaiswal AK. Nrf2 protein up-regulates antiapoptotic protein Bcl-2 and prevents cellular apoptosis. J Biol Chem. 2012;287(13):9873–86. Pedrazas CHS, Azevedo MNL, Torres SR. Oral events related to low-dose methotrexate in rheumatoid arthritis patients. Brazilian Oral Res. 2010;24:368–73. Rampon G, Henkin C, Jorge VM, Almeida HL Jr. Methotrexate-induced mucositis with extra-mucosal involvement after accidental overdose. An Bras Dermatol. 2018;93:155–6. Sanchez C, Asin KE, Artigas F. Vortioxetine, a novel antidepressant with multimodal activity: review of preclinical and clinical data. Pharmacol Ther. 2015;145:43–57. Seymour R, Thomason J, Ellis J. The pathogenesis of drug-induced gingival overgrowth. J Clin Periodontol. 1996;23(3):165–75. Sonis ST. The pathobiology of mucositis. Nat Rev Cancer. 2004;4(4):277–84. Talmon M, Rossi S, Pastore A, Cattaneo CI, Brunelleschi S, Fresu LG. Vortioxetine exerts anti-inflammatory and immunomodulatory effects on human monocytes/macrophages. Br J Pharmacol. 2018;175(1):113–24. Valer JB, Curra M, Gabriel AF, Schmidt TR, Ferreira MBC, Roesler R, et al. Oral mucositis in childhood cancer patients receiving high-dose methotrexate: prevalence, relationship with other toxicities and methotrexate elimination. Int J Pediatr Dent. 2021;31(2):238–46. Yoshinari N, Kameyama Y, Aoyama Y, Nishiyama H, Noguchi T. Effect of long-term methotrexate-induced neutropenia on experimental periodontal lesion in rats. J Periodontal Res. 1994;29(6):393–400. Zhou Y, Wang S, Li Y, Yu S, Zhao Y. SIRT1/PGC-1α signaling promotes mitochondrial functional recovery and reduces apoptosis after intracerebral hemorrhage in rats. Frontier Mol Neurosci. 2017;10:443. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 27 Mar, 2026 Read the published version in BMC Oral Health → Version 1 posted Editorial decision: Revision requested 17 Feb, 2026 Reviews received at journal 10 Feb, 2026 Reviews received at journal 31 Jan, 2026 Reviewers agreed at journal 30 Jan, 2026 Reviewers agreed at journal 28 Jan, 2026 Reviewers agreed at journal 28 Jan, 2026 Reviewers invited by journal 28 Jan, 2026 Editor invited by journal 28 Jan, 2026 Editor assigned by journal 09 Dec, 2025 Submission checks completed at journal 09 Dec, 2025 First submitted to journal 03 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8273479","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":582079662,"identity":"8c31f642-ca5c-452d-a9b0-e4c74f827b1a","order_by":0,"name":"Mustafa Karaca","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABO0lEQVRIie2RMUvDQBiGLxSa5Uo2+YrF/AIhR+CsEPwtVwrJEnAoiKC0CQWnuguV/oZ2yVwINMvhHDiQduqSIVkkQgXTajuYBnFzuGc4Xt67h/uOQ0gi+bdYyPgKt+g7zUFD+1xG8ZC93+S7Y0Uzh6a3y+wXRXk4KKhSOX9y1sucXZnaOFyl75Pg7OIkjJY5bwNShwEo+etPhcYu8UesS+HFNpuPgTAvx3bHH8UACC9uALHeEUXxGnnNKp5BUSMQnalwiYdT6CNwaaGUJqOxs/I3bGDpXH1TPp7FYCquM3+TFrfoSYXCyBCzkBoc01rDE8wQrjLE28EAH1d4QsYtFpmE495payHIVNhFwwHq2O61mV1WImeZJeyOTLg6y5J7oRuiWzSLPmhqOItT6+jHVFDfLn8RJBKJRHLgE1FvdW007YUeAAAAAElFTkSuQmCC","orcid":"","institution":"Burdur Mehmet Akif Ersoy University","correspondingAuthor":true,"prefix":"","firstName":"Mustafa","middleName":"","lastName":"Karaca","suffix":""},{"id":582079663,"identity":"ede81eb8-0cfb-4b58-81d1-adda7185c938","order_by":1,"name":"Burcu Bakir","email":"","orcid":"","institution":"Burdur Mehmet Akif Ersoy University","correspondingAuthor":false,"prefix":"","firstName":"Burcu","middleName":"","lastName":"Bakir","suffix":""},{"id":582079664,"identity":"79b5b6bf-d26e-49fe-b31a-65f72113964a","order_by":2,"name":"Aybike Imeci","email":"","orcid":"","institution":"Private Diş Dostu Dental Healtcare Clinic","correspondingAuthor":false,"prefix":"","firstName":"Aybike","middleName":"","lastName":"Imeci","suffix":""},{"id":582079665,"identity":"d6fdfce5-b73e-4e2c-a246-cdeefcbf78fb","order_by":3,"name":"Esma Selcuk","email":"","orcid":"","institution":"Süleyman Demirel University","correspondingAuthor":false,"prefix":"","firstName":"Esma","middleName":"","lastName":"Selcuk","suffix":""},{"id":582079666,"identity":"ec2cff47-5063-4416-a1ed-714961efdb13","order_by":4,"name":"Halil Asci","email":"","orcid":"","institution":"Süleyman Demirel University","correspondingAuthor":false,"prefix":"","firstName":"Halil","middleName":"","lastName":"Asci","suffix":""},{"id":582079667,"identity":"701bca13-275d-48a6-a400-63981bc97460","order_by":5,"name":"Ozlem Ozmen","email":"","orcid":"","institution":"Burdur Mehmet Akif Ersoy University","correspondingAuthor":false,"prefix":"","firstName":"Ozlem","middleName":"","lastName":"Ozmen","suffix":""}],"badges":[],"createdAt":"2025-12-03 20:08:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8273479/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8273479/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12903-026-08149-1","type":"published","date":"2026-03-27T16:10:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":101491264,"identity":"4ae60703-35ee-441c-b3c2-2d167ccf7244","added_by":"auto","created_at":"2026-01-30 10:23:16","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":110167,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProposed mechanism of MTX-induced oral and periodontal toxicity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMTX triggers oxidative stress, inflammation and intrinsic apoptosis through downregulation of SIRT1/NRF2/PGC-1α and upregulation of TNF-α, BAX, and CAS-3, whereas VOR counteracts these pathways to preserve mitochondrial function and epithelial integrity. MTX: Methotrexate, SIRT1: Sirtuin 1, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha, NRF2: Nuclear factor erythroid 2-related factor 2, BCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein, TNF-α: Tumor necrosis factor alpha.\u003c/p\u003e","description":"","filename":"figure1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/dd440437972e1c92c9e50b31.jpeg"},{"id":101491265,"identity":"879ea3c8-3e07-433b-b39e-7c3eb5def12c","added_by":"auto","created_at":"2026-01-30 10:23:16","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1045651,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistopathological appearance of the interdental papilla of rats between the groups.\u003c/strong\u003e (A) Normal gingival epithelium (arrow) in the control group. (B) Marked hyperemia (thin arrow head) in the submucosa, bacteria clusters (thick arrow head) and necrosis in MTX group. (C) Decreased hyperemia (thin arrow head) and slight erosion in gingival tissue (thin arrow) in MTX+VOR group. (D) Normal gingival appearance in VOR group, HE, scale bars= 50μm.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/55250146b74e671ff27bcce4.jpg"},{"id":101491272,"identity":"8865ae3b-8301-4283-9040-85d71bbbf5ff","added_by":"auto","created_at":"2026-01-30 10:23:16","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4167341,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistopathological changes in the tongue mucosa (top row) and muscle layer (bottom row). \u003c/strong\u003e(A) Normal tongue mucosa and muscle layer in a rat from the control group. (B) Marked inflammatory cell infiltrations (arrows) at the submucosae and increased mast cell infiltration (arrow heads) in the muscle layer in the MTX group. (C) Reduced pathological findings in the MTX+VOR treatment group. (D) Preserved tissue architecture in the VOR group, HE, Scale bars = 50 μm.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/38e94511194fb1f8a6191ca7.jpg"},{"id":101491269,"identity":"7e1c79f1-c6d4-44aa-b619-1221ecb17626","added_by":"auto","created_at":"2026-01-30 10:23:16","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":173034,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistopathological scoring comparisons across groups for five pathological parameters.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots displays the individual scores of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. * p\u0026lt;0.05, *** p\u0026lt;0.001. MTX: Methotrexate, VOR: Vortioxetine.\u003c/p\u003e","description":"","filename":"figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/c242976556144274f64bcfbf.jpg"},{"id":101491268,"identity":"ad78d9c8-ded3-428f-98d0-2f7ff74bdff1","added_by":"auto","created_at":"2026-01-30 10:23:16","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3654024,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical expression of CAS-3 (top row) and TNF-α (bottom row) in periodontal ligament across the groups.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Minimal to no expression in the control group. (B) Marked increase in expression (arrows) in the MTX group. (C) Reduced expression in the MTX+VOR treatment group. (D) Negative to minimal expression in the VOR group. Streptavidin-biotin peroxidase method, Scale bars = 50 μm.\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/a92d2959b9dddb581792addc.jpg"},{"id":101752787,"identity":"dd6549cb-dc05-483a-a4bd-c8d55ed99d85","added_by":"auto","created_at":"2026-02-03 10:32:30","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3394233,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical expression of CAS-3 (top row) and TNF-α (bottom row) in tongue tissue across the groups.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Negative to slight expression in the control group. (B) Marked increase in expression (arrows) in the MTX group. (C) Reduced expression in the MTX+VOR treatment group. (D) Negative to slight expression in the VOR group. Streptavidin-biotin peroxidase method, Scale bars = 50 μm.\u003c/p\u003e","description":"","filename":"Fig.6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/5aba98107fe777b447d33b08.jpg"},{"id":101491271,"identity":"1384e8c9-6269-4b35-a1bb-85d03ff0b402","added_by":"auto","created_at":"2026-01-30 10:23:16","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":112368,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmune expression level comparisons of CAS-3 and TNF-α across the groups.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. ** p\u0026lt;0.01, *** p\u0026lt;0.001. MTX: Methotrexate, VOR: Vortioxetine, CAS-3: Caspase 3, TNF-α: Tumor necrosis factor alpha.\u003c/p\u003e","description":"","filename":"figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/45b59bfc64266daeb6c49056.jpg"},{"id":101752274,"identity":"cd74d178-5295-4cad-a922-e5e8fcfdb75e","added_by":"auto","created_at":"2026-02-03 10:26:29","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":92541,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRelative mRNA expression levels of oxidative stress-related genes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. *** p\u0026lt;0.001. MTX: Methotrexate, VOR: Vortioxetine, SIRT1: Sirtuin 1, NRF2: Nuclear factor erythroid 2-related factor 2.\u003c/p\u003e","description":"","filename":"figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/0c521e9bf2dc58c46c766575.jpg"},{"id":101491267,"identity":"14f6078c-b29b-4fad-831f-006efbcbe3ac","added_by":"auto","created_at":"2026-01-30 10:23:16","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":136809,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRelative mRNA expression levels of mitochondrial biogenesis and apoptosis-related genes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean ± SD (n = 8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test. *** p\u0026lt;0.001. MTX: Methotrexate, VOR: Vortioxetine,\u003cstrong\u003e \u003c/strong\u003eBCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha.\u003c/p\u003e","description":"","filename":"figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/4e413e44b799e44aedfe0145.jpg"},{"id":105755904,"identity":"93ce85e3-d823-4feb-a463-ca000356443d","added_by":"auto","created_at":"2026-03-30 16:32:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13987491,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8273479/v1/c083979c-f332-4fde-b511-3b40b5043e63.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Vortioxetine mitigates methotrexate-induced oral mucosa injury via sirtuin 1 pathway and intrinsic apoptosis signaling","fulltext":[{"header":"Background","content":"\u003cp\u003eThe treatment of neoplastic and autoimmune diseases such as acute lymphoblastic leukemia, rheumatoid arthritis, and psoriasis is performed with commonly using methotrexate (MTX), a folic acid antagonist (Cronstein and Aune \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Despite its clinical efficacy, MTX may provoke certain side effects, including hepatotoxicity, nephrotoxicity, and oral mucositis (Hu, Escalera-Joy et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Oral mucositis, characterized by epithelial cell loss, inflammation, ulceration, and pain, is one of the most common dose-limiting toxicities affecting patients' nutrition, speech, and quality of life (Sonis \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Georgiou, Patapatiou et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The cytotoxic effects of MTX trigger epithelial cell damage in the gingival connective tissue, leading to a local inflammatory response (Seymour, Thomason and Ellis \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1996\u003c/span\u003e, Pedrazas, Azevedo and Torres \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, Martu, Maftei et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In addition, these cytotoxic effects can cause a process that spreads from the gums to the periodontal ligament and even the alveolar bone (Yoshinari, Kameyama et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1994\u003c/span\u003e, Dahab and Morsy \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGiven the central role of oxidative stress and mitochondrial dysfunction in MTX-induced oral mucosal injury, understanding the key molecular regulators of these pathways becomes essential. Nuclear factor erythroid 2\u0026ndash;related factor 2 (NRF2) promotes the transcription of antioxidant genes and thereby serves as a critical component of the cellular defense system. NRF2 activation enhances the expression of anti-apoptotic proteins such as B-cell lymphoma 2 (BCL2) while suppressing pro-apoptotic mediators like BCL2-associated X protein (BAX) (Niture and Jaiswal \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe balance between these apoptotic regulators is closely linked to mitochondrial resilience, as BAX-driven mitochondrial permeabilization directly triggers caspase-3 (CAS-3) activation. In this context, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) plays a pivotal role in maintaining mitochondrial biogenesis and energy homeostasis, while Sirtuin 1 (SIRT1), an NAD⁺-dependent deacetylase, activates PGC-1α to further enhance mitochondrial function and elevate the apoptotic threshold (Zhou, Wang et al. 2018). Through this integrated signaling network, cells mount a coordinated response to oxidative stress and DNA damage, stabilizing the BAX/BCL2 ratio and limiting CAS-3\u0026ndash;mediated apoptosis (Zhou, Wang et al. 2018, Ebrahimnezhad, Nayebifar et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Therefore, identifying therapeutic agents capable of modulating these antioxidant and apoptotic pathways is crucial for reducing MTX-associated oral toxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMTX triggers oxidative stress, inflammation and intrinsic apoptosis through downregulation of SIRT1/NRF2/PGC-1α and upregulation of TNF-α, BAX, and CAS-3, whereas VOR counteracts these pathways to preserve mitochondrial function and epithelial integrity. MTX: Methotrexate, SIRT1: Sirtuin 1, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha, NRF2: Nuclear factor erythroid 2-related factor 2, BCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein, TNF-α: Tumor necrosis factor alpha.\u003c/p\u003e \u003cp\u003eGiven these mechanistic insights, vortioxetine (VOR) emerges as a potential agent capable of modulating MTX-induced mucosal injury. VOR is a multimodal serotonergic antidepressant for the treatment of major depressive disorder (Sanchez, Asin and Artigas \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Beyond its psychotropic effects, recent studies have reported anti-inflammatory, antioxidant, and neuroprotective properties in both central and peripheral tissues (Talmon, Rossi et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Although dry mouth has been reported as a clinical side effect, preclinical data indicate that VOR can influence cytokine-mediated inflammatory pathways (Baldwin, Chrones et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Talmon, Rossi et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this context, the present study aimed to determine whether VOR can attenuate MTX-induced inflammatory and apoptotic responses in the oral mucosa. To address this objective, gingival and tongue tissues were comprehensively evaluated using histopathological, immunohistochemical, and molecular approaches.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and Experimental Design\u003c/h2\u003e \u003cp\u003eA total of 32 female Wistar albino rats (300\u0026ndash;350 g) were obtained from the Suleyman Demirel University Experimental Animal Research Center (Isparta, T\u0026uuml;rkiye). The study was approved by the SDU Animal Experiments Local Ethics Committee (approval no: HADYEK 6/559, date: 12.06.2025). Rats were kept at 20\u0026ndash;24\u0026deg;C for 12 hours under day and night conditions. They were fed under optimal conditions with unrestricted access to food and water. Four groups, each consisting of eight rats, were assigned for the experimental model:\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eControl group\u003c/strong\u003e \u003cp\u003eRats in this group received sterile 0.9% saline (1 mL/kg, intraperitoneally [i.p.]) once daily for five consecutive days. This group served as a negative control to account for handling and injection stress associated with the experimental procedures.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMTX group\u003c/strong\u003e \u003cp\u003eAnimals were injected with a single dose of 20 mg/kg i.p. MTX (Ko\u0026ccedil;ak Farma, T\u0026uuml;rkiye) on day 1. These rats were administered sterile saline (1 mL/kg, i.p.) once daily between days 1 and 5 to ensure operational equivalence. As explained in previous preclinical studies, the single high-dose MTX model was selected to reliably induce systemic toxicity within five days (Samdanci, et al., 2019).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eVOR group\u003c/strong\u003e \u003cp\u003eRats were treated with VOR (PharmaVision, T\u0026uuml;rkiye) at 10 mg/kg/day i.p. for five consecutive days (days 1\u0026ndash;5) and did not receive MTX. This group was included to assess the baseline safety and tissue compatibility of VOR on oral structures and inflammatory parameters (Barbosa-M\u0026eacute;ndez et al., 2022).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMTX\u0026thinsp;+\u0026thinsp;VOR group\u003c/strong\u003e \u003cp\u003eAnimals received VOR (10 mg/kg/day, i.p.) once a day for five days (days 1\u0026ndash;5), along with a single MTX dose (20 mg/kg, i.p.) administered 30 minutes after the first VOR injection on day 1. This pre-treatment paradigm was aimed at analysing its potential beneficial effect of VOR when given concurrently with the MTX insult and during the subsequent inflammatory and oxidative phases of tissue injury.\u003c/p\u003e \u003c/p\u003e \u003cp\u003eOn day 5, rats were anesthetized with ketamine (90 mg/kg, Doğa İla\u0026ccedil;, T\u0026uuml;rkiye) and xylazine (10 mg/kg, Bioveta, Czech Republic) and sacrificed by surgical exsanguination via the inferior vena cava. Maxillary gingiva and tongue tissues were immediately harvested for analyses.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eHistopathological Analysis\u003c/h3\u003e\n\u003cp\u003eAfter fixation, maxillary and tongue tissues were decalcified (for jaw), dehydrated in graded ethanol, and embedded in paraffin. Longitudinal sections (5 \u0026micro;m thick) were stained with hematoxylin and eosin (H\u0026amp;E). Histopathological parameters, including epithelial degeneration, submucosal hyperemia, inflammatory infiltration, mast cell presence (in tongue muscle) and hemorrhage, were evaluated under \u0026times;20 and \u0026times;40 magnification using a light microscope. Semi-quantitative scoring (0\u0026thinsp;=\u0026thinsp;absent, 1\u0026thinsp;=\u0026thinsp;mild, 2\u0026thinsp;=\u0026thinsp;moderate, 3\u0026thinsp;=\u0026thinsp;severe) was performed blindly by an expert pathologist for each parameter. Cell counts for polymorphonuclear leukocytes (PMNLs) and lymphocytes were conducted using CellSens Life Science Imaging software (Olympus, Japan), as previously described (Kirzioglu et al., 2017; Yoshinaga et al., 2014).\u003c/p\u003e\n\u003ch3\u003eImmunohistochemical Analysis\u003c/h3\u003e\n\u003cp\u003eImmunohistochemical staining was performed using rabbit monoclonal antibodies against CAS-3 (ab184787, Abcam, UK) and TNF-α (ab307164, Abcam, UK), both diluted 1:100. The Mouse-Specific HRP/DAB Detection IHC Kit (ab64259, Abcam) was used for secondary detection. Tissue sections were incubated with primary antibodies for one hour. Subsequently, they were reacted with streptavidin-biotin conjugate and DAB chromogen for visualisation. Negative controls were processed in the same manner, but without the addition of primary antibody. The staining level was estimated semi-quantitatively as 0 (no staining), 1 (weak), 2 (moderate), and 3 (strong). Image analysis was performed with ImageJ software (NIH, Bethesda, USA) and morphometric evaluation was conducted using CellSens software.\u003c/p\u003e\n\u003ch3\u003eReverse Transcription Quantitative Polymerase Chain Reaction\u003c/h3\u003e\n\u003cp\u003eHarvested gingival and tongue tissues were placed into DNase/RNase-free, pre-labeled tubes and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until analysis. Total RNA was extracted after homogenization in 1000 \u0026micro;L GeneAll RiboEx\u0026trade; solution (Seoul, Korea) using a low-speed sonicator, followed by purification with the GeneAll Ribospin RNA isolation kit according to the manufacturer\u0026rsquo;s protocol. RNA quantity and purity were assessed by Nanodrop spectrophotometry, and only samples with 260/280 ratios between 1.8 and 2.0 were used for downstream analyses. RNA concentrations were standardized to 1000 ng/\u0026micro;L and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. cDNA synthesis was performed in a thermal cycler using the A.B.T.\u0026trade; cDNA Synthesis Kit (Atlas Biotechnology, T\u0026uuml;rkiye) in a final reaction volume of 20 \u0026micro;L prepared on ice.\u003c/p\u003e \u003cp\u003ePrimer sequences for target genes were designed based on reference mRNA regions and validated using NCBI databases (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e); lyophilized primers were reconstituted in RNase-free water (100 \u0026micro;M) and diluted to working concentrations. Quantitative real-time PCR was performed using 2\u0026times; SYBR Green master mix (Nepenthe, T\u0026uuml;rkiye) on a Bio-Rad CFX96 system (California, USA) in 0.1 mL PCR tubes. Reactions (20 \u0026micro;L) were run in triplicate under the following conditions: initial denaturation at 94\u0026deg;C for 10 min, followed by 40 cycles of 95\u0026deg;C for 15 s and 55\u0026deg;C for 30 s. GAPDH was used as the housekeeping gene for normalization. Ct values were recorded for each sample, and relative gene expression was calculated using the 2^\u0026minus;ΔΔCt method for subsequent statistical analyses.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimary sequences, product size and accession numbers of genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimary sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eproduct size\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eaccession number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eGAPDH (HouseKeeping)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGTGCCAGCCTCGTCTCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e248 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_017008.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GATGGTGATGGGTTTCCCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eSIRT1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTAGTTCCTCGGTGTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e152 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001414959.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:ACCCAATAACAATGAGGAGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003ePGC-1α\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTCAGGAGCTGGATGGCTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e104 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_031347.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGATCTGGGCAAAGAGGCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eNRF2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCCTTCCTCTGCTGCCATTAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e126 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001399173.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:TCATTGAACTCCACCGTGCCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eBAX\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CACGTCTGCGGGGAGTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e419 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_017059.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TAGAAAAGGGCAACCACCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eBCL2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CATCTCATGCCAAGGGGGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e284 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_016993.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TATCCCACTCGTAGCCCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eF: Forward, R: Reverse, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, SIRT1: Sirtuin 1, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha, NRF2: Nuclear factor erythroid 2-related factor 2, BCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein.\u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eFor statistical analysis, histopathological, immunohistochemical and genetic scores were compared between the groups. Initially, the Shapiro-Wilk method was employed to assess the normality of the data distribution. ANOVA was employed as a means of comparing the groups since the data showed a normal distribution (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). For this purpose, the One-way ANOVA with Tukey\u0026rsquo;s multiple comparison tests was used by the GraphPad Prism version 10.1 (GraphPad Software, USA) package program. The level of significance was considered at (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological Findings\u003c/h2\u003e \u003cp\u003eIn the control and VOR groups, a normal periodontal structure was observed. In the MXT group, degenerative changes were detected in the epithelial cells of the gingival tissues, along with thinning of the epithelial layer and dense bacterial accumulations on the epithelial surface. Both intraepithelial and submucosal inflammatory cell infiltrations, predominantly composed of neutrophils and lymphocytes, were observed. Additionally, subepithelial edema was prominent in this group, and microhemorrhages were noted in some rats. Treatment with VOR resulted in a marked improvement in all pathological findings (Fig.\u0026nbsp;2).\u003cb\u003eFig.\u0026nbsp;2: Histopathological appearance of the interdental papilla of rats between the groups.\u003c/b\u003e (A) Normal gingival epithelium (arrow) in the control group. (B) Marked hyperemia (thin arrow head) in the submucosa, bacteria clusters (thick arrow head) and necrosis in MTX group. (C) Decreased hyperemia (thin arrow head) and slight erosion in gingival tissue (thin arrow) in MTX\u0026thinsp;+\u0026thinsp;VOR group. (D) Normal gingival appearance in VOR group, HE, scale bars\u0026thinsp;=\u0026thinsp;50\u0026micro;m.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn the control group rats, the tongue mucosa, submucosa and muscle layer appeared normal. In the MTX group, there were degenerative modifications in the epithelial cells of the tongue mucosa and distinct bacterial clusters on the epithelial surface. Additionally, a marked accumulation of mast cells was noted in the muscle layer of the tongue in the MTX group. Treatment with VOR significantly reduced all pathological findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSemi-quantitative scoring showed significantly elevated hyperemia and mast cell infiltration scores in the MTX group compared to control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). In the MTX\u0026thinsp;+\u0026thinsp;VOR group, these scores were significantly reduced for both parameters (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and the VOR group showed no significant deviation from the control. Even though oedema, hemorrhage, and neutrophilic infiltration scores were slightly increased in the MTX and MTX\u0026thinsp;+\u0026thinsp;VOR groups, there was no statistically significant difference between the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;8 per group). Dot plots displays the individual scores of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey\u0026rsquo;s multiple comparison test. * p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. MTX: Methotrexate, VOR: Vortioxetine.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eImmunohistochemical findings\u003c/h3\u003e\n\u003cp\u003eImmunohistochemical analysis of gingival tissue, especially periodontal ligament, showed elevated CAS-3 and TNF-α expression levels in the MTX group. Treatment with VOR effectively normalized these expressions. The expression was particularly prominent in osteoblastic cells, with osteoclasts and mesenchymal cells also showing higher levels compared to epithelial cells. Additionally, increased expression was observed in inflammatory cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) Minimal to no expression in the control group. (B) Marked increase in expression (arrows) in the MTX group. (C) Reduced expression in the MTX\u0026thinsp;+\u0026thinsp;VOR treatment group. (D) Negative to minimal expression in the VOR group. Streptavidin-biotin peroxidase method, Scale bars\u0026thinsp;=\u0026thinsp;50 \u0026micro;m.\u003c/p\u003e \u003cp\u003eImmunohistochemical examination of the tongue mucosa revealed that while slight to negative CAS-3 and TNF-α expressions observed in the control group, marked increased expressions were observed in the epithelial layer in the MTX group. In addition, some mesenchymal and muscle cells were also showed positive immunoexpressions in this group. VOR treatment decreased the expressions in the MTX\u0026thinsp;+\u0026thinsp;VOR group. VOR group had negative expressions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A) Negative to slight expression in the control group. (B) Marked increase in expression (arrows) in the MTX group. (C) Reduced expression in the MTX\u0026thinsp;+\u0026thinsp;VOR treatment group. (D) Negative to slight expression in the VOR group. Streptavidin-biotin peroxidase method, Scale bars\u0026thinsp;=\u0026thinsp;50 \u0026micro;m.\u003c/p\u003e \u003cp\u003eImmunohistochemical staining of the control group showed no or very little CAS-3 and TNF-α expression. CAS-3 and TNF-α expression increased significantly in the MTX group compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for both). After MTX-VOR treatment, TNF-α and CAS-3 expression also decreased significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for both). The VOR group showed similar TNF-α expression patterns but significantly lower CAS-3 expressions compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The results of the statistical analysis of immunohistochemical expression are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey\u0026rsquo;s multiple comparison test. ** p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. MTX: Methotrexate, VOR: Vortioxetine, CAS-3: Caspase 3, TNF-α: Tumor necrosis factor alpha.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eOxidative Stress Pathway\u003c/h2\u003e \u003cp\u003eMTX exposure led to a significant suppression of antioxidant defence genes in oral tissues. Specifically, SIRT1 and NRF2 mRNA levels were dramatically reduced in the MTX group compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for both). Co-administration of VOR significantly reversed these changes (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for both vs. MTX). The VOR group displayed normal or slightly increased expression of these genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey\u0026rsquo;s multiple comparison test. *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. MTX: Methotrexate, VOR: Vortioxetine, SIRT1: Sirtuin 1, NRF2: Nuclear factor erythroid 2-related factor 2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMitochondrial Biogenesis and Apoptotic Pathway\u003c/h2\u003e \u003cp\u003eMTX exposure significantly disrupted the mitochondrial and apoptotic gene balance in oral tissues. BAX expression increased approximately threefold, while BCL2 levels decreased significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for both). Concomitant treatment with VOR effectively rebalanced this ratio by suppressing BAX transcription and increasing BCL2 expression (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for both vs. MTX) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBar graphs illustrate the comparisons between groups, and data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;8 per group). Dot plots display the individual values of each sample. Statistical analysis was performed by one-way ANOVA followed by Tukey\u0026rsquo;s multiple comparison test. *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. MTX: Methotrexate, VOR: Vortioxetine, BCL2: B-cell lymphoma 2, BAX: BCL2-associated X protein, PGC-1α: Peroxisome proliferator-activated receptor-gamma coactivator-1 alpha.\u003c/p\u003e \u003cp\u003eFurthermore, rats treated with MTX displayed a significant downregulation of PGC1α compared to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). VOR application recovered PGC-1α expression when compared to the MTX group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMTX is frequently used in autoimmune and neoplastic diseases. Unfortunately, its toxic effect on rapidly dividing cells causes undesirable side effects such as oral mucositis and epithelial degeneration (Rampon, Henkin et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Koźmiński, Halik et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, MTX treatment caused significant epithelial thinning, hyperemia, inflammatory cell infiltration, and mast cell accumulation in gingival and lingual tissues. These data are coherent with prior reports indicating that MTX disrupts mucosal integrity through direct cytotoxicity and excessive ROS production (Sonis \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Hu, Escalera-Joy et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The significant upregulation of TNF-α and CAS-3 immunoreactivity strongly emphasized the simultaneous activation of inflammatory and apoptotic cascades, a typical example of chemotherapy-induced mucosal damage (Huang, Yang et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Bayramoglu, Mokhtare et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Treatment with VOR significantly reversed these histopathological lesions. In animals receiving MTX\u0026thinsp;+\u0026thinsp;VOR, epithelial morphology was preserved, hyperemia was reduced, and inflammatory and mast cell infiltration was markedly decreased. As evidenced by the reduction in TNF-α and CAS-3 expression, a decrease in inflammatory response and apoptosis at both the structural and molecular levels accompanied these histological changes. This is in agreement with preliminary studies indicating that VOR possesses antioxidant and anti-inflammatory properties as well as central serotonergic effects (Sanchez, Asin and Artigas \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Talmon, Rossi et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAt the molecular level, the current qRT-PCR results demonstrate that MTX exposure strongly upregulates BAX and CAS-3, accompanied by a significant downregulation of BCL2, which is interpreted as activating the intrinsic mitochondrial apoptosis pathway. These findings are consistent with previous reports (Kolli, Abraham et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2009\u003c/span\u003e, Asci, Ozmen et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This anti-apoptotic change supports the notion that VOR stabilizes mitochondrial membranes and preserves the cell survival signal. Thus, the findings of these studies explain the reversal of inflammatory effects in the periodontal ligament and tongue epithelium with the additional application of VOR.\u003c/p\u003e \u003cp\u003eIn our study, it was observed that VOR not only inhibits apoptosis but also significantly increases PGC-1α, the primary transcription coactivator that directs mitochondrial replication and oxidative phosphorylation, therefore improving mitochondrial biogenesis and energy metabolism. The recovery of PGC1α expression observed in the MTX\u0026thinsp;+\u0026thinsp;VOR group suggests that VOR is not only a substance that limits damage, but also a substance that triggers damage, enabling mitochondrial regeneration and adaptive remodeling. This finding can be correlated with the literature showing that serotonergic modulation improves mitochondrial function and redox homeostasis. (Bhargava and Schnellmann \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Ľupt\u0026aacute;k, Fišar and Hroudov\u0026aacute; \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). (Talmon, Rossi et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) showed that serotonin receptor agonists can activate SIRT1\u0026ndash;PGC-1α signaling and restore mitochondrial integrity under oxidative stress, which is like the results of our study.\u003c/p\u003e \u003cp\u003eMTX exposure has led to a marked suppression of SIRT1 and NRF2, two central regulators of redox balance and cellular defense. SIRT1 deacetylates NRF2, promoting its nuclear translocation and the transcription of antioxidant enzymes such as heme oxygenase-1 (HO-1) and glutathione peroxidase 4 (GPX4) (Ma \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The downregulation of these genes observed in cases of MTX toxicity indicates that oxidative stress is one of the primary causes of tissue damage. On the other hand, VOR application significantly upregulated both SIRT1 and NRF2 expressions, thus restoring the antioxidant defense system. This result is consistent with the extensive evidence that VOR can recover mitochondrial respiration and reduce oxidative stress. (Talmon, Rossi et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Ľupt\u0026aacute;k, Fišar and Hroudov\u0026aacute; \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn our study, the normalization of TNF-α levels in the MTX\u0026thinsp;+\u0026thinsp;VOR group demonstrates that VOR breaks the vicious cycle between oxidative stress and cytokine-induced apoptosis by interfering with this inflammatory pathway.\u003c/p\u003e \u003cp\u003eThe accumulation of mast cells, especially in the tongue muscle in the MTX group, also reveals the role of neuroimmune interaction in mucosal inflammation. Serotonin and mast cells share mutually regulatory pathways; serotonin can suppress mast cell degranulation, while mast cell mediators influence the serotonin cycle (Kushnir-Sukhov, Gilfillan et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Therefore, the decrease in mast cell density in tissues treated with VOR may stem directly from serotonergic stabilization of mucosal immune balance. This represents an innovative dimension of VOR's therapeutic effect and extends its efficacy from neuronal systems to epithelial systems.\u003c/p\u003e \u003cp\u003eThe concurrent activation of the SIRT1/NRF2/PGC-1α pathways and suppression of the TNF-α/BAX/CAS-3 apoptotic cascade collectively contributes to the restoration of mitochondrial homeostasis and redox balance. In the MTX\u0026thinsp;+\u0026thinsp;VOR group, this coordinated molecular modulation underlies the observed histopathological improvement. Consequently, the epithelial architecture remains largely preserved, while hyperemia and inflammatory cell infiltration are markedly reduced compared to MTX alone.\u003c/p\u003e \u003cp\u003eVortioxetine is an FDA-approved antidepressant with a well-established safety profile, which supports its potential repositioning as an adjunctive agent for protecting the oral mucosa. This may be particularly relevant for patients receiving chronic MTX therapy, as both depression and MTX-induced oral toxicity have been shown to negatively affect quality of life and treatment adherence (Valer, Curra et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The present findings suggest that VOR may confer benefits beyond its psychotropic effects, exhibiting additional anti-inflammatory and anti-apoptotic actions within oral tissues, thereby offering a dual therapeutic advantage.\u003c/p\u003e \u003cp\u003eThis study has several limitations. First, the research was conducted in an experimental rat model, and although this model effectively simulates MTX-induced oral mucositis, it may not fully reflect the complex pathophysiological processes seen in humans. Secondly, the study utilized only a single dose of methotrexate and a fixed VOR regimen; consequently, the dose-response relationship and long-term effects could not be evaluated. Additionally, the study focused primarily on oxidative stress, inflammation, and mitochondrial apoptotic pathways; other possible mechanisms such as angiogenesis, autophagy, or changes in oral microbiota were not investigated. Moreover, the assessments were conducted at a single point in time; thereby, the dynamic changes in the development and healing process of mucositis could not be demonstrated. In future studies, the inclusion of different time points, varying drug doses, and complementary mechanical analyses with clinical validation are essential to confirm and expand upon these findings.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eFinally, this study supports the concept that targeting mitochondrial signal transduction and antioxidant transcription factors offers a viable strategy for preventing drug-induced oral mucositis. Future research should expand on these findings by evaluating downstream antioxidants, mitochondrial ultrastructure by electron microscopy, and long-term effects on epithelial regeneration. However, our integrated analysis including histology, immunohistochemistry and gene expression convincingly demonstrates that VOR provides comprehensive protection against MTX-induced oral toxicity by restoring cellular homeostasis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eMTX Methotrexate\u003c/p\u003e \u003cp\u003eVOR Vortioxetine\u003c/p\u003e \u003cp\u003eCAS-3 Caspase-3\u003c/p\u003e \u003cp\u003eTNF-α Tumor necrosis factor\u003c/p\u003e \u003cp\u003eSIRT1 Sirtuin 1\u003c/p\u003e \u003cp\u003eNRF2 Nuclear factor erythroid 2-related factor 2\u003c/p\u003e \u003cp\u003ePGC1α Peroxisome proliferator-activated receptor gamma coactivator 1-alpha\u003c/p\u003e \u003cp\u003eBCL2 B-cell lymphoma 2\u003c/p\u003e \u003cp\u003eBAX BCL2-associated X protein\u003c/p\u003e \u003cp\u003eH\u0026amp;E Hematoxylin and eosin\u003c/p\u003e \u003cp\u003ePMNLs Polymorphonuclear leukocytes\u003c/p\u003e \u003cp\u003eF Forward\u003c/p\u003e \u003cp\u003eR Reverse\u003c/p\u003e \u003cp\u003eGAPDH Glyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the SDU Animal Experiments Local Ethics Committee (approval no: HADYEK 6/559, date: 12.06.2025).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData related to the study results are accessible through the corresponding author on request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe corresponding author and co-authors declare no financial or ethical conflicts of interest related to this study\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was funded by the Suleyman Demirel University [grant number: TSG-2024-9556].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Generative AI Use:\u003c/strong\u003e During the preparation of this work, the authors used ChatGPT-5.1 to improve language and readability. After using this tool/service, the authors reviewed and edited the content as needed and took full responsibility for the content of the publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003eConceptualization, M.K., B.B., A.I., and H.A.; methodology, M.K., B.B., E.S., H.A., and O.O.; validation, M.K., H.A., and O.O.; formal analysis, O.O. and E.S.; investigation, M.K., B.B., A.I.; resources, M.K., H.A., data curation, M.K., B.B., A.I., and E.S.; writing—original draft preparation, M.K., A.I., E.S., H.A., and O.O.; writing—review and editing, M.K., A.I., E.S., H.A., and O.O.; visualization, A.I., H.A., and O.O.; supervision, O.O. and H.A.; project administration, M.K., B.B., and H.A. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAsci H, Ozmen O, Ellidag HY, Aydin B, Bas E, Yilmaz N. The impact of gallic acid on methotrexate-induced kidney damage in rats. J Food Drug Anal. 2017;25(4):890\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldwin DS, Chrones L, Florea I, Nielsen R, Nomikos GG, Palo W, et al. The safety and tolerability of vortioxetine: analysis of data from randomized placebo-controlled trials and open-label extension studies. J Psychopharmacol. 2016;30(3):242\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBayramoglu Z, Mokhtare B, Mendil AS, Coban TA, Mammadov R, Bulut S, et al. Effect of taxifolin on methotrexate-induced oxidative and inflammatory oral mucositis in rats: biochemical and histopathological evaluation. J Appl Oral Sci. 2022;30:e20220115.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhargava P, Schnellmann RG. Mitochondrial energetics in the kidney. Nat Rev Nephrol. 2017;13(10):629\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCronstein BN, Aune TM. Methotrexate and its mechanisms of action in inflammatory arthritis. Nat Rev Rheumatol. 2020;16(3):145\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDahab MM, Morsy SM. Evaluation of the prophylactic effect of pomegranate peel extract and pumpkin seed oil on the periodontium of rats receiving methotrexate: histologic and immunohistochemical study. Egypt Dent J. 2024;70(3):2281\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEbrahimnezhad N, Nayebifar S, Soltani Z, Khoramipour K. High-intensity interval training reduced oxidative stress and apoptosis in the hippocampus of male rats with type 2 diabetes: the role of the PGC1α-Keap1-Nrf2 signaling pathway. Iran J Basic Med Sci. 2023;26(11):1313.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeorgiou M, Patapatiou G, Domoxoudis S, Pistevou-Gompaki K, Papanikolaou A. Oral mucositis: understanding the pathology and management. Hippokratia. 2012;16(3):215.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Z, Escalera-Joy AM, Ashcraft E, Acharya R, Jeha S, Cheng C, et al. Clinical risk factors for high-dose methotrexate-induced oral mucositis following individualized dosing. Cancer Med. 2024;13(21):e70351.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang JS, Yang CM, Wang JS, Liou HH, Hsieh IC, Li GC, et al. Caspase-3 expression in tumorigenesis and prognosis of buccal mucosa squamous cell carcinoma. Oncotarget. 2017;8(48):84237\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKolli VK, Abraham P, Isaac B, Selvakumar D. Neutrophil infiltration and oxidative stress may play a critical role in methotrexate-induced renal damage. Chemotherapy. 2009;55(2):83\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoźmiński P, Halik PK, Chesori R, Gniazdowska E. Overview of dual-acting drug methotrexate in different neurological diseases, autoimmune pathologies and cancers. Int J Mol Sci. 2020;21(10):3483.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKushnir-Sukhov NM, Gilfillan AM, Coleman JW, Brown JM, Bruening S, Toth M, et al. 5-hydroxytryptamine induces mast cell adhesion and migration. J Immunol. 2006;177(9):6422\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eĽupt\u0026aacute;k M, Fišar Z, Hroudov\u0026aacute; J. Agomelatine, ketamine and vortioxetine attenuate energy cell metabolism-In vitro study. Int J Mol Sci. 2022;23(22):13824.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Q. Role of Nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 2013;53:401\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartu MA, Maftei GA, Luchian I, Stefanescu OM, Scutariu MM, Solomon SM. The effect of acknowledged and novel anti-rheumatic therapies on periodontal tissues: a narrative review. Pharmaceuticals. 2021;14(12):1209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiture SK, Jaiswal AK. Nrf2 protein up-regulates antiapoptotic protein Bcl-2 and prevents cellular apoptosis. J Biol Chem. 2012;287(13):9873\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePedrazas CHS, Azevedo MNL, Torres SR. Oral events related to low-dose methotrexate in rheumatoid arthritis patients. Brazilian Oral Res. 2010;24:368\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRampon G, Henkin C, Jorge VM, Almeida HL Jr. Methotrexate-induced mucositis with extra-mucosal involvement after accidental overdose. An Bras Dermatol. 2018;93:155\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanchez C, Asin KE, Artigas F. Vortioxetine, a novel antidepressant with multimodal activity: review of preclinical and clinical data. Pharmacol Ther. 2015;145:43\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeymour R, Thomason J, Ellis J. The pathogenesis of drug-induced gingival overgrowth. J Clin Periodontol. 1996;23(3):165\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSonis ST. The pathobiology of mucositis. Nat Rev Cancer. 2004;4(4):277\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTalmon M, Rossi S, Pastore A, Cattaneo CI, Brunelleschi S, Fresu LG. Vortioxetine exerts anti-inflammatory and immunomodulatory effects on human monocytes/macrophages. Br J Pharmacol. 2018;175(1):113\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValer JB, Curra M, Gabriel AF, Schmidt TR, Ferreira MBC, Roesler R, et al. Oral mucositis in childhood cancer patients receiving high-dose methotrexate: prevalence, relationship with other toxicities and methotrexate elimination. Int J Pediatr Dent. 2021;31(2):238\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshinari N, Kameyama Y, Aoyama Y, Nishiyama H, Noguchi T. Effect of long-term methotrexate-induced neutropenia on experimental periodontal lesion in rats. J Periodontal Res. 1994;29(6):393\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Wang S, Li Y, Yu S, Zhao Y. SIRT1/PGC-1α signaling promotes mitochondrial functional recovery and reduces apoptosis after intracerebral hemorrhage in rats. Frontier Mol Neurosci. 2017;10:443.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Methotrexate, Vortioxetine, Oral mucositis, Oxidative stress, Apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-8273479/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8273479/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMethotrexate (MTX) commonly causes oral mucositis by inducing epithelial cytotoxicity and inflammation, leading to functional impairment and treatment limitations. Therefore, agents that can protect oral tissues without reducing MTX efficacy are needed. Vortioxetine (VOR), with its reported anti-inflammatory and antioxidant actions, may offer such therapeutic potential.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThirty-two adults female Wistar rats were divided into four groups: Control, MTX, VOR and MTX\u0026thinsp;+\u0026thinsp;VOR (n\u0026thinsp;=\u0026thinsp;8 each). VOR (10 mg/kg/day, intraperitoneally [i.p.]) was administered continuously for five days and a single dose of MTX (20 mg/kg, i.p.) was injected 30 minutes after the first VOR dose on day 1. Maxillary gingiva and tongue tissues were harvested on day 5 for histopathological, immunohistochemical (caspase-3 [CAS-3], tumor necrosis factor [TNF-α]) and molecular (sirtuin 1 [SIRT1], nuclear factor erythroid 2-related factor 2 [NRF2], peroxisome proliferator-activated receptor gamma coactivator 1-alpha [PGC1α], B-cell lymphoma 2 [BCL2], and BCL2-associated X protein [BAX]) analyses.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eMTX treatment caused increased TNF-α and CAS-3 immunoexpressing, leading to severe epithelial degeneration, hyperemia and inflammatory cell infiltration in the oral mucosa. Gene expression analysis supported that there was a significant upregulation of proapoptotic (BAX, CAS-3) and inflammatory markers (TNF-α) whereas a downregulation of mitochondrial regulators (SIRT1, NRF2, PGC1α, BCL2). Co-treatment with VOR markedly reversed these changes.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eVOR significantly ameliorated the damage caused by MTX to the oral mucosa by interfering with the SIRT1/NRF2/PGC1α antioxidant axis and suppressing the BAX/BCL2/CAS-3 apoptotic pathway. These results indicate that VOR can be used as a valuable therapeutic agent that can be combined with chemotherapy to alleviate side effects in the oral mucosa by restoring redox homeostasis, mitochondrial integrity and cellular survival signals.\u003c/p\u003e","manuscriptTitle":"Vortioxetine mitigates methotrexate-induced oral mucosa injury via sirtuin 1 pathway and intrinsic apoptosis signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-30 10:23:11","doi":"10.21203/rs.3.rs-8273479/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-17T13:43:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-10T05:02:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-31T10:21:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"105812856887324742556016865328462309070","date":"2026-01-30T15:48:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"252373433307587831348825508053255518936","date":"2026-01-28T23:38:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"54230422903273420583250534341568219796","date":"2026-01-28T13:08:30+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-28T12:22:23+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-01-28T09:49:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-09T08:05:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-09T07:59:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Oral Health","date":"2025-12-03T19:57:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"824a390c-09f4-45f1-8deb-42661be038e5","owner":[],"postedDate":"January 30th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-30T16:29:07+00:00","versionOfRecord":{"articleIdentity":"rs-8273479","link":"https://doi.org/10.1186/s12903-026-08149-1","journal":{"identity":"bmc-oral-health","isVorOnly":false,"title":"BMC Oral Health"},"publishedOn":"2026-03-27 16:10:50","publishedOnDateReadable":"March 27th, 2026"},"versionCreatedAt":"2026-01-30 10:23:11","video":"","vorDoi":"10.1186/s12903-026-08149-1","vorDoiUrl":"https://doi.org/10.1186/s12903-026-08149-1","workflowStages":[]},"version":"v1","identity":"rs-8273479","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8273479","identity":"rs-8273479","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.