A novel organ-targeted antibody conjugated to hepatocyte growth factor ameliorates colitis in a mouse model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A novel organ-targeted antibody conjugated to hepatocyte growth factor ameliorates colitis in a mouse model Nobuhisa Maeda, Shuji Kanmura, Yuko Morinaga, Satoshi Mori, Issei Kojima, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8643909/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Inflammatory bowel disease (IBD) is a chronic disease characterized by persistent mucosal inflammation and impaired epithelial repair. Hepatocyte growth factor (HGF) is a potent epithelial regeneration factor; however, its rapid clearance after systemic administration and organ non-specificity limit its clinical application. In this study, we aimed to investigate the effects of a gut-directed antibody conjugated to HGF on colitis. Mouse models of dextran sulfate sodium (DSS)-induced acute experimental colitis were intraperitoneally administered phosphate-buffered saline (PBS), free recombinant HGF, or an HGF- glycoprotein A33-specific targeting antibody complex (HGF-AB), and their body weight, disease activity index (DAI), colon length, mouse colitis histology index (MCHI), and serum HGF concentration were measured. HGF-AB treatment significantly suppressed body weight loss, reduced DAI, and maintained colon length than PBS or HGF monotherapy. The epithelial structure and inflammatory damage were significantly protected in the HGF-AB-treated group. Serum HGF concentrations were higher in the HGF-AB-treated group than in the free HGF-treated group, suggesting improved pharmacokinetic stability via antibody conjugation. HGF-AB regulated mucosal immune responses by suppressing proinflammatory cytokine transcripts and enhancing anti-inflammatory IL-10 expression. Overall, the findings established organ-targeted regenerative therapy as a promising adjunctive strategy to complement the existing anti-inflammatory treatments and promote healing in IBD. Health sciences/Diseases Health sciences/Gastroenterology Biological sciences/Immunology Health sciences/Medical research Hepatocyte growth factor Inflammatory bowel disease colitis drug delivery system organ specific targeting antibody Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Inflammatory bowel diseases (IBDs), including ulcerative colitis and Crohn’s disease, are chronic relapsing disorders characterized by persistent mucosal inflammation, disruption of the epithelial barrier, and delayed restitution [ 1 – 3 ]. With the continuous rise in the global incidence and prevalence of IBD, the disease burden has been increasing worldwide [ 4 ]. Although many biologics have been developed for IBD treatment, most of them treat by suppressing immune-related molecules, such as TNF-α agents and interleukin [ 5 , 6 ], rather than directly stimulating epithelial repair [ 2 , 3 ]. Consequently, therapeutic approaches that suppress inflammation and promote mucosal healing are urgently required. Hepatocyte growth factor (HGF) is a pleiotropic cytokine first purified from the plasma of patients with fulminant hepatitis [ 7 ]. Acting via the c-Met receptor, HGF promotes epithelial proliferation, migration, and morphogenesis, and accelerates mucosal healing in rodent models of colitis [ 8 , 9 ]. However, systemically administered HGF undergoes remarkable hepatic sequestration and off-target distribution, limiting its colonic bioavailability. Achieving therapeutic colonic concentrations might require high systemic doses, raising concerns of off-target effects. Therefore, antibody-based drug delivery platforms have been extensively investigated. The glycoprotein A33 (GPA33) antigen is selectively expressed in intestinal epithelial cells, making it an attractive target for colonic delivery [ 10 , 11 ]. Previous clinical imaging and biodistribution studies using GPA33 have demonstrated its specific tumor localization and long-term retention in colorectal cancer [ 12 – 16 ]. Recently, a fully human anti-GPA33 antibody that is cross-reactive with both human and mouse GPA33 was developed, and it showed selective accumulation in normal mouse intestinal tissues in vivo [ 17 ]. This study provided evidence that GPA33 is a viable target for intestinal-targeted therapy and might lay the foundation for translational research on HGF delivery via GPA33-specific antibodies. Based on this concept, we aimed to evaluate whether HGF-conjugated GPA33-specific transport antibodies (HGF-ABs) could improve the outcome of intestinal inflammation treatment, compared to HGF alone, in a dextran sulfate sodium (DSS)-induced colitis model. Methods Mice Specific pathogen-free male C57BL/6J mice (6–8 weeks old) were purchased from Charles River Laboratories (Yokohama, Japan). They were housed under controlled conditions (24°C, 50–60% humidity, 12-h light/dark cycle) with ad libitum access to autoclaved rodent diet (LabDiet® 5010) and water. Body weight and stool occurrence were recorded daily. On day 8, mice were deeply anesthetized with ketamine (75 mg/kg) and medetomidine (1 mg/kg). After confirmation of adequate anesthetic depth, animals were euthanized by cervical dislocation in accordance with the AVMA Guidelines for the Euthanasia of Animals: 2020 Edition. All procedures were approved by the Institutional Animal Care and Use Committee of Kagoshima University (permit no. MD23049). All animal experiments were designed and reported in accordance with the ARRIVE guidelines. ( https://arriveguidelines.org/ ). Induction of colitis and treatments Acute colitis was induced by providing drinking water containing 3% DSS (average molecular weight, 5000; FUJIFILM Wako, Tokyo, Japan) as described in the original DSS model report [ 18 ]. Mice were randomly assigned to three treatment groups (n = 5 per group), namely the phosphate-buffered saline (PBS) group that received an intraperitoneal injection of PBS (0.2 mL) once daily for 8 days, the HGF group that received an intraperitoneal injection of recombinant HGF (5 mg/kg) once daily, and the HGF-AB group that received an intraperitoneal injection of HGF GPA33-specific targeting antibody (including 5 mg/kg HGF) once daily. The GPA33-specific targeting antibody used here was a fully human antibody generated using a transchromosomic (TC) mouse platform. In this system, TC mice were immunized with organ-specific antigens, followed by PCR amplification of the VH and VL genes from lymphocytes. After constructing a single-chain variable-fragment (scFv) phage library, clones are enriched through cell or in-vivo panning and identified by next-generation sequencing [ 19 – 21 ]. The antibody generation and conjugation procedures were performed at Graduate School of Science and Engineering, Kagoshima University. Clinical assessments Disease severity was assessed daily using the disease activity index (DAI), which was calculated as the average of three sub-scores, namely percent weight loss, stool consistency, and gross rectal bleeding, each scored on a 0–4 scale according to the criteria summarized in Table 1 . Scoring was performed independently by two blinded investigators. Body weight is expressed as a percentage of the weight of each mouse on day 0 (pre-DSS). Table 1 Polymerase chain reaction primers Gene Forward Primer (5' → 3') Reverse Primer (5' → 3') IL-10 GCCAGAGCCACATGCTCCTA GATAAGGCTTGGCAACCCAAGTAA TNF-α TATGGCCCAGACCCTCACA GGAGTAGACAAGGTACAACCCATC IL-1β TCCAGGATGAGGACATGAGCAC GAACGTCACACACCAGCAGGTTA β-actin CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA Tissue collection and analyses On day 8, colon length was measured from the cecum to the rectum. Blood samples were collected for the measurement of serum HGF levels using ELISA. Distal colon sections were fixed in 10% formaldehyde neutral buffer solution, paraffin-embedded, sectioned (5 µm), and stained with hematoxylin and eosin. Histological damage was scored using the mouse colitis histology index (MCHI), as defined previously [ 22 ]. The MCHI comprises four items, namely goblet cell loss (range: 0–3), crypt density (range: 0–2), epithelial hyperplasia (range: 0–3), and submucosal infiltration (range: 0–3) combined with item-specific weights (1×, 2×, 2×, and 3×, respectively), yielding a total score ranging from 0 (no disease) to 22 (severe disease). Two independent investigators blinded to the group allocation performed the scoring. Isolation of murine colonic lamina propria mononuclear cells (LPMCs) Lamina propria mononuclear cells (LPMCs) were isolated from the colons of mice with DSS-induced colitis, according to previously reported methods with minor modifications. For LPMC analyses, mice were independently prepared and were not the ones used in the main in-vivo therapeutic experiments [ 23 ]. Briefly, the entire colon was excised, opened longitudinally, and washed thoroughly to remove any fecal content. The tissue was cut into small pieces and incubated in Ca²⁺/Mg²⁺-free Hank’s balanced salt solution (HBSS) supplemented with 0.5 mM EDTA (Invitrogen ™ UltraPure ™ 0.5 M EDTA, pH8.0; Catalog#15575020), 1 mM dithiothreitol (DTT) (Sigma-Aldrich, DL- dithiothreitol; Catalog#D5545), and sodium bicarbonate at 37°C for 30 min with shaking to remove the epithelial layer. After vigorous vortexing, the tissue suspension was passed through a 70-µm cell strainer, and the remaining tissue fragments were collected. The residual lamina propria tissue was minced and digested in D10F medium (DMEM supplemented with 10% fetal bovine serum) containing hyaluronidase, collagenase type II, and DNase I at 37°C for 30 min with agitation. The cell suspension was filtered through a 70-µm cell strainer, washed, and centrifuged at 200 × g for 5 min at room temperature. The cell pellet was resuspended in 40% Percoll and overlaid onto 80% Percoll, followed by density gradient centrifugation at 2,500 rpm for 30 min at room temperature without brake. Mononuclear cells were collected during the interphase, washed, and counted. Gene expression analysis and enzyme-linked immunosorbent assay Purified LPMCs were cultured and treated with PBS, recombinant human HGF, or HGF-AB for 24 h. After stimulation, the cells were harvested for gene expression analysis and total RNA was extracted for quantitative real-time PCR analysis. Total RNA was extracted from the LPMCs using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Real-time PCR was performed using SYBR (Applied Biosystems, Foster City, CA). After detecting the threshold cycle for each mRNA in a sample, the relative mRNA concentrations were calculated and normalized to that of β-actin. PCR conditions included an initial holding period of 95°C for 30 s, followed by a 2-step PCR program consisting of 40 cycles of 95°C for 5 s and 60°C for 34 s. All reactions were performed in duplicate. The following genes were analyzed (forward and reverse primers: Takara Bio Inc. Shiga, Japan): β-actin, TNF-α, interleukin (IL)-6, IL-10, and TGF-β1; the primers used in this experiment are listed in Table 1 . Supernatants obtained from the stimulated LPMC cultures were used for cytokine analysis. The concentrations of TNF-α, IL-6, IL-10, and TGF-β1 in the LPMC culture supernatants were measured using a Mouse Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions and analyzed in duplicate using a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA) at 450 nm. Statistical analysis Data are presented as means ± standard deviation (SD). Differences between two or three groups were appropriately analyzed using the unpaired Mann-Whitney U test and Kruskal–Wallis test, followed by Dunn’s multiple comparisons (IBM SPSS version 28). P < 0.05 indicated statistical significance. In-vitro experiments were performed independently at least twice. Results HGF-AB attenuated clinical disease activity and body weight loss in DSS-induced colitis relative to HGF alone Regarding body weight, the HGF-AB group exceeded baseline weight on day 8 (105.4 ± 4.7% of day 0), whereas the HGF group (79.1 ± 2.5%) and PBS group (77.9 ± 5.5%) were significantly below the baseline compared to the start of intraperitoneal administration. HGF-AB treatment significantly preserved body weight compared to both PBS and HGF (p < 0.05). The HGF group did not differ significantly from the PBS group (Fig. 1 a). Furthermore, the mean DAI scores on day 8 were 2.47 ± 0.30 in the PBS mice, 2.33 ± 0.47 in HGF mice, and 0.47 ± 0.56 in HGF-AB mice. The DAI score of HGF-AB group was significantly better than those of the PBS and HGF groups (p < 0.05) (Fig. 1 b). HGF-AB ameliorated macroscopic and histological colonic inflammation Each colon length is represented by an individual mouse in Fig. 2 a (n = 5). Compared to the PBS treatment, HGF alone slightly attenuated DSS-induced colon shortening, whereas HGF-AB significantly reduced colon shortening (p < 0.05). Histological evaluation of the distal colon revealed that the PBS group had the most severe histological inflammation while the HGF group showed moderate activity. In contrast, HGF-AB preserved the epithelial architecture and remarkably reduced inflammatory cell infiltration compared to those in the PBS and HGF groups (p < 0.05). The results collectively demonstrated that targeted HGF delivery results in potent tissue-protective effects that are typically associated with DSS-induced colitis (Fig. 2 b). HGF-AB maintained high concentrations of serum HGF Serum HGF concentrations at euthanasia were 11.93 ± 5.58 ng/mL in the HGF-AB group, 1.25 ± 0.82 ng/mL in the HGF group, and 0.70 ng/mL in the PBS control group (mean ± SD). Serum HGF levels were higher in the HGF-AB group than in the PBS groups (Fig. 3 ). HGF-AB altered anti-inflammatory cytokine expression in LPMCs To examine how HGF-based therapies influence mucosal immune responses, LPMCs isolated from DSS-treated mice were cultured with PBS, HGF alone, or HGF-AB, and the expression of several cytokines and the genes encoding them was evaluated. A significant increase was observed in the expression of IL-10 in the LPMCs cultured in the HGF-AB group than in the PBS group, whereas TGF-β decreased in the HGF-AB group than in the PBS group. IL-6 expression did not differ significantly across the groups. In all the gene expression analyses, no statistically significant difference between the HGF and HGF-Ab groups was seen. Although the expression of IL-10 was numerically higher in the cell culture supernatant of HGF-Ab–treated LPMCs than in the PBS-treated ones, no significant difference was observed across the three groups (Fig. 4 ). Discussion In this study, we demonstrated that the conjugation of HGF to a GPA33-targeted antibody could provide a remarkable therapeutic benefit in a DSS–induced colitis model. In particular, HGF-AB administration resulted in greater weight loss, reduced DAI, and lower histological injury scores than the administration of HGF alone. Our findings strongly supported the therapeutic value of organ-targeted regenerative therapies in IBD. Previous studies had demonstrated that HGF promotes epithelial restitution and ameliorates colitis when delivered systemically [ 8 , 9 ]. However, free HGF has potential off-target systemic effects, which limit its clinical application. In contrast, HGF-AB has the potential to achieve sustained exposure to target organs, making it suitable for clinical applications. Although HGF administration improves colitis by promoting colonic epithelial regeneration [ 8 , 9 ], it activates the HGF receptor c-MET in immune cells, such as macrophages [ 24 ]. HGF polarizes M1 macrophages into M2-like macrophages and promotes IL-10 secretion by bone marrow-derived macrophages. This phenomenon has also been observed in macrophages derived from the colonic submucosa, and IL-10 has been reported to improve DSS-induced experimental colitis [ 23 ]. These findings suggested that HGF not only promotes epithelial repair and improves colitis but also acts on immune cells in the tissue, resulting in an anti-inflammatory immunomodulatory effect, thereby improving tissue inflammation. Taken together, the studies supported a model in which sustained HGF administration in tissues could improve colitis through coordinated epithelial regeneration and the modulation of mucosal immune responses. The LPMC analysis demonstrated that HGF-AB affected immune cells in the submucosal layer. It suppressed the expression of proinflammatory cytokines and increased the expression of the anti-inflammatory cytokine IL-10. The dynamics of these cytokines are thought to lead the tissue environment toward the resolution of inflammation and repair. However, although these effects were observed at the mRNA expression level, they were not reflected in the changes in secreted cytokine concentrations. Since the analysis was limited to a small number of cases and used stimulated supernatants from LPMCs containing a variety of cell types, including macrophages and T/B cells, the effects may not have been reflected appropriately. Therefore, further investigation is warranted in this regard. Recent years have seen a paradigm shift in the therapeutic goals of IBD. Historically, clinical remission, defined as symptom resolution, has been the primary endpoint. With the advent of biologics, endoscopic mucosal healing emerged as a central therapeutic goal and has been incorporated into international consensus guidelines such as STRIDE-II [ 25 – 27 ]. More recently, accumulating evidence has suggested that histologic healing may provide an even stronger predictor of sustained remission and reduced risk of hospitalization or colectomy [ 28 , 29 ]. Patients who achieved both endoscopic and histological remissions had the most durable outcomes. However, current biologics, including anti-TNF antibodies, anti–IL-12/23 antibodies, and JAK inhibitors, act primarily by suppressing immune-driven inflammation [ 30 , 31 ]; they do not directly stimulate epithelial proliferation or restitution, leaving a gap in therapeutic strategies. HGF-AB offers a means of bridging this gap by combining anti-inflammatory treatment with an epithelial regenerative signal. The rationale is analogous to a two-axis therapeutic strategy; immune suppression to control inflammation and regenerative stimulation to restore barrier integrity. In clinical practice, the two aspects are often complementary. For example, patients who achieve deep remission typically show low inflammatory burden and evidence of epithelial healing. Therefore, HGF-AB may be used as an adjunct to standard biologics, offering synergistic benefits when used in combination with other regimens. This concept warrants further investigation, particularly in models where HGF-AB is combined with anti-inflammatory antibody therapy. GPA33 is a highly expressed cell surface antigen present on the basolateral side of intestinal epithelial cells in the normal intestine and in > 95% of primary and metastatic CRCs but not in other tissues or cancer types [ 10 , 11 ]. A key advantage of the GPA33-specific targeted antibodies used in this study was their cross-reactivity with both human and murine GPA33 [ 17 ]. Thus, the characterized antibodies are promising candidates for the development of GPA33-targeted diagnostic tools or as a basis for future therapeutic strategies for IBD. GPA33 is selectively expressed in intestinal epithelial cells and remains detectable in the inflamed mucosa, making it an attractive target for bowel-restricted antibody delivery [ 17 ]. A notable strength of the GPA33-targeted antibodies described in this study was their cross-reactivity with both human and murine GPA33, enabling reliable translational evaluation in mouse models of intestinal inflammation. The antibodies demonstrated high affinity and specificity for GPA33-expressing cells and selective accumulation in bowel tissue in vivo, supporting their potential utility in targeting the inflamed intestinal epithelium. Importantly, the fully human antibody format minimizes immunogenicity, which is a critical consideration for chronic diseases, such as IBD, that require long-term or repeated administration. From a therapeutic perspective, GPA33-targeted antibodies may serve as effective carriers for drug delivery systems, allowing the localized modulation of intestinal inflammation while reducing systemic exposure and adverse effects. In addition, selective bowel targeting may be exploited for molecular imaging to assess the disease distribution or therapeutic response. Collectively, the findings suggested that GPA33-targeted fully human antibodies provide a versatile and translationally relevant platform for advancing precision medicine approaches for IBD. A notable finding was the significantly elevated serum HGF concentration in the HGF-AB group compared to that in the free HGF group. The observation was consistent with the pharmacokinetic advantages conferred by the antibody backbone. Immunoglobulin G (IgG)–based molecules interact with the neonatal Fc receptor (FcRn), which rescues them from lysosomal degradation and recycles them back into the circulation [ 32 ]. Consequently, IgG-conjugated therapeutics generally exhibit prolonged half-life and greater systemic exposure than unconjugated proteins. This property likely contributes to the higher circulating concentrations of HGF-AB. Nevertheless, the principal therapeutic advantage stems from not only systemic exposure, but also from antibody-mediated accumulation within the intestinal epithelium via GPA33 [ 17 ]. The findings indicated that antibody conjugation prolongs HGF exposure and enhances systemic bioavailability compared to free HGF. This study had several limitations. Since GPA33-specific targeting antibodies are unlikely to have any biological effects or toxicity [ 17 ], analyses of GPA33-specific antibody groups alone were not included. Additionally, the doses of HGF bound to a GPA33-specific targeting antibody and HGF alone were examined in a preliminary experiment. Ultimately, we decided to use the same amount of HGF (5 mg/kg), as reported previously. Furthermore, although serum HGF concentrations were measured, differences in tissue HGF concentrations between the HGF-alone group and the GPA33-specific targeting antibody group were not examined. Moreover, although this study examined the effects of HGF on immune cells, it did not examine its direct effects on epithelial cells or the interactions between epithelial and immune cells. Further studies using organoids would be necessary to clarify the effects in detail [ 33 ]. In conclusion, GPA33-targeted delivery of HGF significantly improved DSS-induced colitis than free HGF, demonstrating that organ-specific targeting enhances the efficacy of reparative cytokines. The bowel-specific accumulation of GPA33-targeted antibodies supports this platform as a promising translational strategy for IBD. Clinically, HGF-AB may be particularly beneficial for patients with high-risk or steroid-dependent ulcerative colitis, in whom durable mucosal healing remains difficult to achieve using current biologics. Combining regenerative therapy with the established anti-inflammatory agents might represent a next-generation approach for achieving sustained remission. Declarations Acknowledgements We would like to thank Editage (www.editage.com) for English language editing. Author contributions NM performed the experiments, analyzed the data, and wrote the manuscript. SK designed the study, analyzed the data, and wrote the manuscript. YM, SM , IK, AT performed the experiments. YI generated and conjugated the antibody. KK supervised experiments. HM, FS, HS, and AI reviewed the manuscript. All authors have contributed to the manuscript and approved the submitted version. Data availability statement Data and materials used in this study are available from the corresponding author upon request. Competing interests statement None declared. Funding Declaration There was no Funding References Ungaro, R., Mehandru, S., Allen, P. B., Peyrin-Biroulet, L. & Colombel, J. F. Ulcerative colitis. Lancet 389 , 1756–1770 (2017). Neurath, M. F. Current and emerging therapeutic targets for IBD. Nat. Rev. Gastroenterol. Hepatol. 14 , 269–278 (2017). Ordás, I., Eckmann, L., Talamini, M., Baumgart, D. C. & Sandborn, W. J. Ulcerative colitis. Lancet 380 , 1606–1619 (2012). Hracs, L. et al. Global evolution of inflammatory bowel disease across epidemiologic stages. Nature 642 , 458–466 (2025). Hashash, J. G., Limdi, J. K., Shapiro, J. M. & Shah, S. A. Medical management of inflammatory bowel diseases. BMJ 391 , e079050 (2025). Fudman, D. I., McConnell, R. A., Ha, C. & Singh, S. Modern advanced therapies for inflammatory bowel diseases: practical considerations and positioning. Clin. Gastroenterol. Hepatol. 23 , 454-468 (2025). Gohda, E. et al. Human hepatocyte growth factor in plasma from patients with fulminant hepatic failure. Exp. Cell Res. 166 , 139–150 (1986). Tahara, Y. et al. Hepatocyte growth factor facilitates colonic mucosal repair in experimental ulcerative colitis in rats. J. Pharmacol. Exp. Ther. 307 , 146–151 (2003). Numata, M. et al. Hepatocyte growth factor facilitates the repair of large colonic ulcers in 2,4,6-trinitrobenzene sulfonic acid-induced colitis in rats. Inflamm. Bowel Dis. 11 , 551–558 (2005). Garinchesa, P. et al. Organ-specific expression of the colon cancer antigen A33, a cell surface target for antibody-based therapy. Int. J. Oncol. 9 , 465–471 (1996). Heath, J. K. et al. The human A33 antigen is a transmembrane glycoprotein and a novel member of the immunoglobulin superfamily. Proc. Natl Acad. Sci. U. S. A. 94 , 469–474 (1997). Scott, A. M. et al. A phase I trial of humanized monoclonal antibody A33 in patients with colorectal carcinoma: biodistribution, pharmacokinetics, and quantitative tumor uptake. Clin. Cancer Res. 11 , 4810–4817 (2005). Chong, G. et al. Phase I trial of 131I-huA33 in patients with advanced colorectal carcinoma. Clin. Cancer Res. 11 , 4818–4826 (2005). Carrasquillo, J. A. et al. (124)I-huA33 antibody PET of colorectal cancer. J. Nucl. Med. 52 , 1173–1180 (2011). O’Donoghue, J. A. et al. 124I-huA33 antibody uptake is driven by A33 antigen concentration in tissues from colorectal cancer patients imaged by immuno-PET. J. Nucl. Med. 52 , 1878–1885 (2011). Zanzonico, P. et al. PET-based compartmental modeling of (124)I-A33 antibody: quantitative characterization of patient-specific tumor targeting in colorectal cancer. Eur. J. Nucl. Med. Mol. Imaging 42 , 1700–1706 (2015). Hichiwa, G. et al. Targeting of bowel tissue by fully human antibodies cross-reactive with human and mouse GPA33 antigen. Biomed. Pharmacother. 189 , 118336 (2025). Cooper, H. S., Murthy, S. N., Shah, R. S. & Sedergran, D. J. Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab. Invest. 69 , 238–249 (1993). Moriwaki, T., Abe, S., Oshimura, M. & Kazuki, Y. Transchromosomic technology for genomically humanized animals. Exp. Cell Res. 390 , 111914 (2020). Satofuka, H. et al. Efficient human-like antibody repertoire and hybridoma production in trans-chromosomic mice carrying megabase-sized human immunoglobulin loci. Nat. Commun. 13 , 1841 (2022). Shimoya, K. et al. Mice carrying the full-length human immunoglobulin loci produce antigen-specific human antibodies with the lambda light chain. iScience 27 , 111258 (2024). Koelink, P. J. et al. Development of reliable, valid and responsive scoring systems for endoscopy and histology in animal models for inflammatory bowel disease. J. Crohns Colitis 12 , 794–803 (2018). Fujino, Y. et al. Hepatocyte growth factor ameliorates dextran sodium sulfate‑induced colitis in a mouse model by altering the phenotype of intestinal macrophages. Mol. Med. Rep. 27 , 70 (2023). Nishikoba, N. et al. HGF-MET signaling shifts M1 macrophages toward an M2-like phenotype through PI3K-mediated induction of Arginase-1 expression. Front. Immunol. 11 , 2135 (2020). Turner, D. et al. STRIDE-II: an update on the Selecting Therapeutic Targets in Inflammatory Bowel Disease (STRIDE) Initiative of the International Organization for the Study of IBD (IOIBD): determining Therapeutic Goals for Treat-to-Target strategies in IBD. Gastroenterology 160 , 1570–1583 (2021). Dignass, A., Rath, S., Kleindienst, T. & Stallmach, A. Review article: translating STRIDE-II into clinical reality—Opportunities and challenges. Aliment. Pharmacol. Ther. 58 , 492–502 (2023). Ricart, E. et al. Clinical approach to STRIDE-II in real-life settings: analysis and practical recommendations. Crohns Colitis 360 6 , otae055 (2024). Liang, R. F.-H., Lin, H., Chau, C. Y.-P. & Lim, W. C. Histologic healing and clinical outcomes in ulcerative colitis. Intest. Res. 23 , 182–192 (2025). Magro, F. et al. Endoscopic, histologic, and composite endpoints in patients with ulcerative colitis treated with etrasimod. Clin. Gastroenterol. Hepatol. 23 , 341–350.e6 (2025). Schreiner, P. et al. Mechanism-based treatment strategies for IBD: cytokines, cell adhesion molecules, JAK inhibitors, gut flora, and more. Inflamm. Intest. Dis. 4 , 79-96 (2019). Tian, Z., Zhao, Q. & Teng, X. Anti-IL23/12 agents and JAK inhibitors for inflammatory bowel disease. Front. Immunol. 15 , 1393463 (2024). Roopenian, D. C. & Akilesh, S. FcRn: the neonatal Fc receptor comes of age. Nat. Rev. Immunol. 7 , 715–725 (2007). Ren, J. & Huang, S. Intestinal organoids in inflammatory bowel disease: advances, applications, and future directions. Front. Cell Dev. Biol. 13 , 1517121 (2025). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8643909","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":589785690,"identity":"89169056-c2fe-4472-bbc9-c7bc0519ba41","order_by":0,"name":"Nobuhisa Maeda","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Nobuhisa","middleName":"","lastName":"Maeda","suffix":""},{"id":589785691,"identity":"542c22c1-f61b-4271-8b7e-db6158026c17","order_by":1,"name":"Shuji Kanmura","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIiWNgGAWjYBACCRjDgIEh4cAHIIONnRQtB2eAtDCToIWBmQfEIqRFsv3s0c28e+zszSUSHh62+bVNno+ZgfHDxxzcWqR58tJu8zxLTtw5IyHhcG7fbcM2ZgZmyZnbcGuRY8gxu81zgDnB4AZIS89tRqAWNmZefFr434C01NuDtVj23LYnqEVaAmzLYcYNIC0MP24nEtQiOeON2c05B44nbjjzIOFgb8Pt5DZmxma8fpE4n2N2482BanuD4znJH378uW07v7354IePeLQgAZ4EBsY2EIOxgSj1QMB+gIHhD7GKR8EoGAWjYCQBAJ8MVgHlY1uUAAAAAElFTkSuQmCC","orcid":"","institution":"Kagoshima University","correspondingAuthor":true,"prefix":"","firstName":"Shuji","middleName":"","lastName":"Kanmura","suffix":""},{"id":589785692,"identity":"e41f9b49-f950-4e38-be05-cc44c38d4f0c","order_by":2,"name":"Yuko Morinaga","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Yuko","middleName":"","lastName":"Morinaga","suffix":""},{"id":589785693,"identity":"26dca1f8-cd30-4768-915a-8a8ec534844b","order_by":3,"name":"Satoshi Mori","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Satoshi","middleName":"","lastName":"Mori","suffix":""},{"id":589785694,"identity":"906f691f-f08d-4a6b-9efe-896d84150f92","order_by":4,"name":"Issei Kojima","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Issei","middleName":"","lastName":"Kojima","suffix":""},{"id":589785695,"identity":"b1ed49fd-88ee-49f2-960c-41de245d2b37","order_by":5,"name":"Akihito Tanaka","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Akihito","middleName":"","lastName":"Tanaka","suffix":""},{"id":589785696,"identity":"d60d6cf6-9088-4745-99fb-91a073ec2bee","order_by":6,"name":"Hidehito Maeda","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Hidehito","middleName":"","lastName":"Maeda","suffix":""},{"id":589785697,"identity":"fe02317e-6f8c-45cd-9f42-d750c1c138ef","order_by":7,"name":"Kotaro Kumagai","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Kotaro","middleName":"","lastName":"Kumagai","suffix":""},{"id":589785698,"identity":"df83d33e-a1fc-4a97-bd68-04efcc23c3ad","order_by":8,"name":"Fumisato Sasaki","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Fumisato","middleName":"","lastName":"Sasaki","suffix":""},{"id":589785699,"identity":"ac679316-5aed-4786-a9b0-ce88cfb34e33","order_by":9,"name":"Shinichi Hashimoto","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Shinichi","middleName":"","lastName":"Hashimoto","suffix":""},{"id":589785700,"identity":"150ebc00-800e-4309-9da7-a14815203de0","order_by":10,"name":"Yuji Ito","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Yuji","middleName":"","lastName":"Ito","suffix":""},{"id":589785701,"identity":"d2449c3c-4eea-4c23-b901-0f8591492756","order_by":11,"name":"Akio Ido","email":"","orcid":"","institution":"Kagoshima University","correspondingAuthor":false,"prefix":"","firstName":"Akio","middleName":"","lastName":"Ido","suffix":""}],"badges":[],"createdAt":"2026-01-20 02:09:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8643909/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8643909/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102480733,"identity":"c013e871-71ff-4af3-971a-9af4928bcb4f","added_by":"auto","created_at":"2026-02-12 06:52:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":258354,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClinical parameters in DSS-induced colitis\u003c/strong\u003e\u003cbr\u003e\n(\u003cstrong\u003ea\u003c/strong\u003e) Time course of body-weight change in mice treated with PBS, free HGF, or HGF GPA33-specific transport antibodies (HGF-AB). Body weight is expressed as a percentage of baseline (day 0).\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eb\u003c/strong\u003e) Disease activity index (DAI) scores calculated from weight loss, stool consistency, and rectal bleeding.\u003c/p\u003e\n\u003cp\u003eData are shown as means ± SD (n = 5 per group). Statistical analysis was performed using the Kruskal–Wallis test, followed by Dunn’s multiple comparisons test. *P \u0026lt; 0.05, **P \u0026lt; 0.01 compared with the PBS group.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8643909/v1/6392e46dbd87a49f4cc3cdb0.png"},{"id":102480735,"identity":"e197453e-c0ec-4d69-b598-9cc982acec2d","added_by":"auto","created_at":"2026-02-12 06:52:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1242162,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistological evaluation of DSS-induced colitis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Colon length measured at sacrifice (day 8).\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eb\u003c/strong\u003e) Representative hematoxylin and eosin–stained sections of distal colon tissue from PBS-, HGF-, and HGF-AB–treated mice. Original magnification 10×, and histological injury scores assessed using the mouse colitis histology index (MCHI).\u003c/p\u003e\n\u003cp\u003eData are presented as means ± SD (n = 5 per group). Statistical analysis was performed using the Kruskal–Wallis test, followed by Dunn’s test.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8643909/v1/ae89c2d0e1c0c4f637a35e73.png"},{"id":102480736,"identity":"79727c42-1b45-4381-be8d-9b41cb3f712d","added_by":"auto","created_at":"2026-02-12 06:52:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":68429,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSerum HGF concentration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum HGF levels in PBS-, HGF-, and HGF-AB-treated mice on day 8. Data are shown as means ± SD (n = 5 per group). Statistical analysis was performed using the Kruskal–Wallis test, followed by Dunn’s multiple comparisons test. **P \u0026lt; 0.01 compared with the PBS group.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8643909/v1/f1e0e8d520bcc66771e04906.png"},{"id":102480734,"identity":"22a12635-1145-435b-a080-3e12ecf06008","added_by":"auto","created_at":"2026-02-12 06:52:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":207217,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCytokine responses in lamina propria mononuclear cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Relative mRNA expression of \u003cem\u003eTNF-α, IL-6, TGF-β\u003c/em\u003e, and \u003cem\u003eIL-10\u003c/em\u003ein lamina propria mononuclear cells (LPMCs) stimulated ex vivo with PBS, free HGF, or HGF-AB, measured by real-time PCR. Data are presented as means ±SD (n = 4 per group).\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eb\u003c/strong\u003e) Cytokine protein concentrations (IL-6, TGF-β, IL-10, and TNF-α) in culture supernatants, assessed by ELISA. IL-6, TGF-β, and IL-10 were measured in n = 4 samples per group.\u003c/p\u003e\n\u003cp\u003eGroup comparisons were conducted using the Kruskal–Wallis test, followed by Dunn’s multiple comparison test. *P \u0026lt; 0.05 compared with the PBS group.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8643909/v1/848c239fca8918276d18cfa9.png"},{"id":104200928,"identity":"5e1da0ee-541e-4a6c-ad37-5db424346b09","added_by":"auto","created_at":"2026-03-09 05:25:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2500872,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8643909/v1/210f90e9-3273-4427-9d7e-cd42ea34e9c5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A novel organ-targeted antibody conjugated to hepatocyte growth factor ameliorates colitis in a mouse model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInflammatory bowel diseases (IBDs), including ulcerative colitis and Crohn\u0026rsquo;s disease, are chronic relapsing disorders characterized by persistent mucosal inflammation, disruption of the epithelial barrier, and delayed restitution [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. With the continuous rise in the global incidence and prevalence of IBD, the disease burden has been increasing worldwide [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Although many biologics have been developed for IBD treatment, most of them treat by suppressing immune-related molecules, such as TNF-α agents and interleukin [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], rather than directly stimulating epithelial repair [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Consequently, therapeutic approaches that suppress inflammation and promote mucosal healing are urgently required.\u003c/p\u003e \u003cp\u003eHepatocyte growth factor (HGF) is a pleiotropic cytokine first purified from the plasma of patients with fulminant hepatitis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Acting via the c-Met receptor, HGF promotes epithelial proliferation, migration, and morphogenesis, and accelerates mucosal healing in rodent models of colitis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, systemically administered HGF undergoes remarkable hepatic sequestration and off-target distribution, limiting its colonic bioavailability. Achieving therapeutic colonic concentrations might require high systemic doses, raising concerns of off-target effects.\u003c/p\u003e \u003cp\u003eTherefore, antibody-based drug delivery platforms have been extensively investigated. The glycoprotein A33 (GPA33) antigen is selectively expressed in intestinal epithelial cells, making it an attractive target for colonic delivery [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Previous clinical imaging and biodistribution studies using GPA33 have demonstrated its specific tumor localization and long-term retention in colorectal cancer [\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Recently, a fully human anti-GPA33 antibody that is cross-reactive with both human and mouse GPA33 was developed, and it showed selective accumulation in normal mouse intestinal tissues in vivo [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This study provided evidence that GPA33 is a viable target for intestinal-targeted therapy and might lay the foundation for translational research on HGF delivery via GPA33-specific antibodies. Based on this concept, we aimed to evaluate whether HGF-conjugated GPA33-specific transport antibodies (HGF-ABs) could improve the outcome of intestinal inflammation treatment, compared to HGF alone, in a dextran sulfate sodium (DSS)-induced colitis model.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003eSpecific pathogen-free male C57BL/6J mice (6\u0026ndash;8 weeks old) were purchased from Charles River Laboratories (Yokohama, Japan). They were housed under controlled conditions (24\u0026deg;C, 50\u0026ndash;60% humidity, 12-h light/dark cycle) with ad libitum access to autoclaved rodent diet (LabDiet\u0026reg; 5010) and water. Body weight and stool occurrence were recorded daily. On day 8, mice were deeply anesthetized with ketamine (75 mg/kg) and medetomidine (1 mg/kg). After confirmation of adequate anesthetic depth, animals were euthanized by cervical dislocation in accordance with the AVMA Guidelines for the Euthanasia of Animals: 2020 Edition. All procedures were approved by the Institutional Animal Care and Use Committee of Kagoshima University (permit no. MD23049). All animal experiments were designed and reported in accordance with the ARRIVE guidelines. (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org/\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eInduction of colitis and treatments\u003c/h3\u003e\n\u003cp\u003eAcute colitis was induced by providing drinking water containing 3% DSS (average molecular weight, 5000; FUJIFILM Wako, Tokyo, Japan) as described in the original DSS model report [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Mice were randomly assigned to three treatment groups (n\u0026thinsp;=\u0026thinsp;5 per group), namely the phosphate-buffered saline (PBS) group that received an intraperitoneal injection of PBS (0.2 mL) once daily for 8 days, the HGF group that received an intraperitoneal injection of recombinant HGF (5 mg/kg) once daily, and the HGF-AB group that received an intraperitoneal injection of HGF GPA33-specific targeting antibody (including 5 mg/kg HGF) once daily.\u003c/p\u003e \u003cp\u003eThe GPA33-specific targeting antibody used here was a fully human antibody generated using a transchromosomic (TC) mouse platform. In this system, TC mice were immunized with organ-specific antigens, followed by PCR amplification of the VH and VL genes from lymphocytes. After constructing a single-chain variable-fragment (scFv) phage library, clones are enriched through cell or in-vivo panning and identified by next-generation sequencing [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The antibody generation and conjugation procedures were performed at Graduate School of Science and Engineering, Kagoshima University.\u003c/p\u003e\n\u003ch3\u003eClinical assessments\u003c/h3\u003e\n\u003cp\u003eDisease severity was assessed daily using the disease activity index (DAI), which was calculated as the average of three sub-scores, namely percent weight loss, stool consistency, and gross rectal bleeding, each scored on a 0\u0026ndash;4 scale according to the criteria summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Scoring was performed independently by two blinded investigators. Body weight is expressed as a percentage of the weight of each mouse on day 0 (pre-DSS).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePolymerase chain reaction primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5' \u0026rarr; 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5' \u0026rarr; 3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL-10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAGAGCCACATGCTCCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATAAGGCTTGGCAACCCAAGTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNF-α\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTATGGCCCAGACCCTCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGTAGACAAGGTACAACCCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL-1β\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCAGGATGAGGACATGAGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACGTCACACACCAGCAGGTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eβ-actin\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCCGTAAAGACCTCTATGCCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGAGCCACCGATCCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eTissue collection and analyses\u003c/h3\u003e\n\u003cp\u003eOn day 8, colon length was measured from the cecum to the rectum. Blood samples were collected for the measurement of serum HGF levels using ELISA. Distal colon sections were fixed in 10% formaldehyde neutral buffer solution, paraffin-embedded, sectioned (5 \u0026micro;m), and stained with hematoxylin and eosin. Histological damage was scored using the mouse colitis histology index (MCHI), as defined previously [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The MCHI comprises four items, namely goblet cell loss (range: 0\u0026ndash;3), crypt density (range: 0\u0026ndash;2), epithelial hyperplasia (range: 0\u0026ndash;3), and submucosal infiltration (range: 0\u0026ndash;3) combined with item-specific weights (1\u0026times;, 2\u0026times;, 2\u0026times;, and 3\u0026times;, respectively), yielding a total score ranging from 0 (no disease) to 22 (severe disease). Two independent investigators blinded to the group allocation performed the scoring.\u003c/p\u003e\n\u003ch3\u003eIsolation of murine colonic lamina propria mononuclear cells (LPMCs)\u003c/h3\u003e\n\u003cp\u003eLamina propria mononuclear cells (LPMCs) were isolated from the colons of mice with DSS-induced colitis, according to previously reported methods with minor modifications. For LPMC analyses, mice were independently prepared and were not the ones used in the main in-vivo therapeutic experiments [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Briefly, the entire colon was excised, opened longitudinally, and washed thoroughly to remove any fecal content. The tissue was cut into small pieces and incubated in Ca\u0026sup2;⁺/Mg\u0026sup2;⁺-free Hank\u0026rsquo;s balanced salt solution (HBSS) supplemented with 0.5 mM EDTA (Invitrogen\u003csup\u003e\u0026trade;\u003c/sup\u003e UltraPure\u003csup\u003e\u0026trade;\u003c/sup\u003e 0.5 M EDTA, pH8.0; Catalog#15575020), 1 mM dithiothreitol (DTT) (Sigma-Aldrich, DL- dithiothreitol; Catalog#D5545), and sodium bicarbonate at 37\u0026deg;C for 30 min with shaking to remove the epithelial layer. After vigorous vortexing, the tissue suspension was passed through a 70-\u0026micro;m cell strainer, and the remaining tissue fragments were collected. The residual lamina propria tissue was minced and digested in D10F medium (DMEM supplemented with 10% fetal bovine serum) containing hyaluronidase, collagenase type II, and DNase I at 37\u0026deg;C for 30 min with agitation. The cell suspension was filtered through a 70-\u0026micro;m cell strainer, washed, and centrifuged at 200 \u0026times; g for 5 min at room temperature. The cell pellet was resuspended in 40% Percoll and overlaid onto 80% Percoll, followed by density gradient centrifugation at 2,500 rpm for 30 min at room temperature without brake. Mononuclear cells were collected during the interphase, washed, and counted.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGene expression analysis and enzyme-linked immunosorbent assay\u003c/h2\u003e \u003cp\u003ePurified LPMCs were cultured and treated with PBS, recombinant human HGF, or HGF-AB for 24 h. After stimulation, the cells were harvested for gene expression analysis and total RNA was extracted for quantitative real-time PCR analysis. Total RNA was extracted from the LPMCs using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Real-time PCR was performed using SYBR (Applied Biosystems, Foster City, CA). After detecting the threshold cycle for each mRNA in a sample, the relative mRNA concentrations were calculated and normalized to that of β-actin. PCR conditions included an initial holding period of 95\u0026deg;C for 30 s, followed by a 2-step PCR program consisting of 40 cycles of 95\u0026deg;C for 5 s and 60\u0026deg;C for 34 s. All reactions were performed in duplicate. The following genes were analyzed (forward and reverse primers: Takara Bio Inc. Shiga, Japan): β-actin, TNF-α, interleukin (IL)-6, IL-10, and TGF-β1; the primers used in this experiment are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eSupernatants obtained from the stimulated LPMC cultures were used for cytokine analysis. The concentrations of TNF-α, IL-6, IL-10, and TGF-β1 in the LPMC culture supernatants were measured using a Mouse Quantikine ELISA Kit (R\u0026amp;D Systems, Minneapolis, MN, USA) according to the manufacturer\u0026rsquo;s instructions and analyzed in duplicate using a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA) at 450 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Differences between two or three groups were appropriately analyzed using the unpaired Mann-Whitney U test and Kruskal\u0026ndash;Wallis test, followed by Dunn\u0026rsquo;s multiple comparisons (IBM SPSS version 28). P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicated statistical significance. In-vitro experiments were performed independently at least twice.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eHGF-AB attenuated clinical disease activity and body weight loss in DSS-induced colitis relative to HGF alone\u003c/b\u003e \u003c/p\u003e \u003cp\u003eRegarding body weight, the HGF-AB group exceeded baseline weight on day 8 (105.4\u0026thinsp;\u0026plusmn;\u0026thinsp;4.7% of day 0), whereas the HGF group (79.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5%) and PBS group (77.9\u0026thinsp;\u0026plusmn;\u0026thinsp;5.5%) were significantly below the baseline compared to the start of intraperitoneal administration. HGF-AB treatment significantly preserved body weight compared to both PBS and HGF (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The HGF group did not differ significantly from the PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Furthermore, the mean DAI scores on day 8 were 2.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30 in the PBS mice, 2.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47 in HGF mice, and 0.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56 in HGF-AB mice. The DAI score of HGF-AB group was significantly better than those of the PBS and HGF groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHGF-AB ameliorated macroscopic and histological colonic inflammation\u003c/h2\u003e \u003cp\u003eEach colon length is represented by an individual mouse in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea (n\u0026thinsp;=\u0026thinsp;5). Compared to the PBS treatment, HGF alone slightly attenuated DSS-induced colon shortening, whereas HGF-AB significantly reduced colon shortening (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Histological evaluation of the distal colon revealed that the PBS group had the most severe histological inflammation while the HGF group showed moderate activity. In contrast, HGF-AB preserved the epithelial architecture and remarkably reduced inflammatory cell infiltration compared to those in the PBS and HGF groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The results collectively demonstrated that targeted HGF delivery results in potent tissue-protective effects that are typically associated with DSS-induced colitis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHGF-AB maintained high concentrations of serum HGF\u003c/h2\u003e \u003cp\u003eSerum HGF concentrations at euthanasia were 11.93\u0026thinsp;\u0026plusmn;\u0026thinsp;5.58 ng/mL in the HGF-AB group, 1.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82 ng/mL in the HGF group, and 0.70 ng/mL in the PBS control group (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). Serum HGF levels were higher in the HGF-AB group than in the PBS groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eHGF-AB altered anti-inflammatory cytokine expression in LPMCs\u003c/h2\u003e \u003cp\u003eTo examine how HGF-based therapies influence mucosal immune responses, LPMCs isolated from DSS-treated mice were cultured with PBS, HGF alone, or HGF-AB, and the expression of several cytokines and the genes encoding them was evaluated.\u003c/p\u003e \u003cp\u003eA significant increase was observed in the expression of \u003cem\u003eIL-10\u003c/em\u003e in the LPMCs cultured in the HGF-AB group than in the PBS group, whereas \u003cem\u003eTGF-β\u003c/em\u003e decreased in the HGF-AB group than in the PBS group. \u003cem\u003eIL-6\u003c/em\u003e expression did not differ significantly across the groups. In all the gene expression analyses, no statistically significant difference between the HGF and HGF-Ab groups was seen.\u003c/p\u003e \u003cp\u003eAlthough the expression of IL-10 was numerically higher in the cell culture supernatant of HGF-Ab\u0026ndash;treated LPMCs than in the PBS-treated ones, no significant difference was observed across the three groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we demonstrated that the conjugation of HGF to a GPA33-targeted antibody could provide a remarkable therapeutic benefit in a DSS\u0026ndash;induced colitis model. In particular, HGF-AB administration resulted in greater weight loss, reduced DAI, and lower histological injury scores than the administration of HGF alone.\u003c/p\u003e \u003cp\u003eOur findings strongly supported the therapeutic value of organ-targeted regenerative therapies in IBD. Previous studies had demonstrated that HGF promotes epithelial restitution and ameliorates colitis when delivered systemically [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, free HGF has potential off-target systemic effects, which limit its clinical application. In contrast, HGF-AB has the potential to achieve sustained exposure to target organs, making it suitable for clinical applications.\u003c/p\u003e \u003cp\u003eAlthough HGF administration improves colitis by promoting colonic epithelial regeneration [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], it activates the HGF receptor c-MET in immune cells, such as macrophages [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. HGF polarizes M1 macrophages into M2-like macrophages and promotes IL-10 secretion by bone marrow-derived macrophages. This phenomenon has also been observed in macrophages derived from the colonic submucosa, and IL-10 has been reported to improve DSS-induced experimental colitis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These findings suggested that HGF not only promotes epithelial repair and improves colitis but also acts on immune cells in the tissue, resulting in an anti-inflammatory immunomodulatory effect, thereby improving tissue inflammation. Taken together, the studies supported a model in which sustained HGF administration in tissues could improve colitis through coordinated epithelial regeneration and the modulation of mucosal immune responses.\u003c/p\u003e \u003cp\u003eThe LPMC analysis demonstrated that HGF-AB affected immune cells in the submucosal layer. It suppressed the expression of proinflammatory cytokines and increased the expression of the anti-inflammatory cytokine IL-10. The dynamics of these cytokines are thought to lead the tissue environment toward the resolution of inflammation and repair. However, although these effects were observed at the mRNA expression level, they were not reflected in the changes in secreted cytokine concentrations. Since the analysis was limited to a small number of cases and used stimulated supernatants from LPMCs containing a variety of cell types, including macrophages and T/B cells, the effects may not have been reflected appropriately. Therefore, further investigation is warranted in this regard.\u003c/p\u003e \u003cp\u003eRecent years have seen a paradigm shift in the therapeutic goals of IBD. Historically, clinical remission, defined as symptom resolution, has been the primary endpoint. With the advent of biologics, endoscopic mucosal healing emerged as a central therapeutic goal and has been incorporated into international consensus guidelines such as STRIDE-II [\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. More recently, accumulating evidence has suggested that histologic healing may provide an even stronger predictor of sustained remission and reduced risk of hospitalization or colectomy [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Patients who achieved both endoscopic and histological remissions had the most durable outcomes. However, current biologics, including anti-TNF antibodies, anti\u0026ndash;IL-12/23 antibodies, and JAK inhibitors, act primarily by suppressing immune-driven inflammation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]; they do not directly stimulate epithelial proliferation or restitution, leaving a gap in therapeutic strategies. HGF-AB offers a means of bridging this gap by combining anti-inflammatory treatment with an epithelial regenerative signal. The rationale is analogous to a two-axis therapeutic strategy; immune suppression to control inflammation and regenerative stimulation to restore barrier integrity. In clinical practice, the two aspects are often complementary. For example, patients who achieve deep remission typically show low inflammatory burden and evidence of epithelial healing. Therefore, HGF-AB may be used as an adjunct to standard biologics, offering synergistic benefits when used in combination with other regimens. This concept warrants further investigation, particularly in models where HGF-AB is combined with anti-inflammatory antibody therapy.\u003c/p\u003e \u003cp\u003eGPA33 is a highly expressed cell surface antigen present on the basolateral side of intestinal epithelial cells in the normal intestine and in \u0026gt;\u0026thinsp;95% of primary and metastatic CRCs but not in other tissues or cancer types [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. A key advantage of the GPA33-specific targeted antibodies used in this study was their cross-reactivity with both human and murine GPA33 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Thus, the characterized antibodies are promising candidates for the development of GPA33-targeted diagnostic tools or as a basis for future therapeutic strategies for IBD. GPA33 is selectively expressed in intestinal epithelial cells and remains detectable in the inflamed mucosa, making it an attractive target for bowel-restricted antibody delivery [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. A notable strength of the GPA33-targeted antibodies described in this study was their cross-reactivity with both human and murine GPA33, enabling reliable translational evaluation in mouse models of intestinal inflammation. The antibodies demonstrated high affinity and specificity for GPA33-expressing cells and selective accumulation in bowel tissue in vivo, supporting their potential utility in targeting the inflamed intestinal epithelium. Importantly, the fully human antibody format minimizes immunogenicity, which is a critical consideration for chronic diseases, such as IBD, that require long-term or repeated administration. From a therapeutic perspective, GPA33-targeted antibodies may serve as effective carriers for drug delivery systems, allowing the localized modulation of intestinal inflammation while reducing systemic exposure and adverse effects. In addition, selective bowel targeting may be exploited for molecular imaging to assess the disease distribution or therapeutic response. Collectively, the findings suggested that GPA33-targeted fully human antibodies provide a versatile and translationally relevant platform for advancing precision medicine approaches for IBD.\u003c/p\u003e \u003cp\u003eA notable finding was the significantly elevated serum HGF concentration in the HGF-AB group compared to that in the free HGF group. The observation was consistent with the pharmacokinetic advantages conferred by the antibody backbone. Immunoglobulin G (IgG)\u0026ndash;based molecules interact with the neonatal Fc receptor (FcRn), which rescues them from lysosomal degradation and recycles them back into the circulation [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Consequently, IgG-conjugated therapeutics generally exhibit prolonged half-life and greater systemic exposure than unconjugated proteins. This property likely contributes to the higher circulating concentrations of HGF-AB. Nevertheless, the principal therapeutic advantage stems from not only systemic exposure, but also from antibody-mediated accumulation within the intestinal epithelium via GPA33 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The findings indicated that antibody conjugation prolongs HGF exposure and enhances systemic bioavailability compared to free HGF.\u003c/p\u003e \u003cp\u003eThis study had several limitations. Since GPA33-specific targeting antibodies are unlikely to have any biological effects or toxicity [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], analyses of GPA33-specific antibody groups alone were not included. Additionally, the doses of HGF bound to a GPA33-specific targeting antibody and HGF alone were examined in a preliminary experiment. Ultimately, we decided to use the same amount of HGF (5 mg/kg), as reported previously. Furthermore, although serum HGF concentrations were measured, differences in tissue HGF concentrations between the HGF-alone group and the GPA33-specific targeting antibody group were not examined. Moreover, although this study examined the effects of HGF on immune cells, it did not examine its direct effects on epithelial cells or the interactions between epithelial and immune cells. Further studies using organoids would be necessary to clarify the effects in detail [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn conclusion, GPA33-targeted delivery of HGF significantly improved DSS-induced colitis than free HGF, demonstrating that organ-specific targeting enhances the efficacy of reparative cytokines. The bowel-specific accumulation of GPA33-targeted antibodies supports this platform as a promising translational strategy for IBD. Clinically, HGF-AB may be particularly beneficial for patients with high-risk or steroid-dependent ulcerative colitis, in whom durable mucosal healing remains difficult to achieve using current biologics. Combining regenerative therapy with the established anti-inflammatory agents might represent a next-generation approach for achieving sustained remission.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Editage (www.editage.com) for English language editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNM performed the experiments, analyzed the data, and wrote the manuscript. SK designed the study, analyzed the data, and wrote the manuscript. YM, SM\u003cu\u003e,\u0026nbsp;\u003c/u\u003eIK, AT\u0026nbsp;performed the experiments. YI\u0026nbsp;generated and conjugated the antibody.\u0026nbsp;KK supervised experiments.\u0026nbsp;HM, FS, HS, and AI reviewed the manuscript. All authors have contributed to the manuscript and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData and materials used in this study are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone declared.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was no Funding\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eUngaro, R., Mehandru, S., Allen, P. B., Peyrin-Biroulet, L. \u0026amp; Colombel, J. F. Ulcerative colitis. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e389\u003c/strong\u003e, 1756\u0026ndash;1770 (2017).\u003c/li\u003e\n\u003cli\u003eNeurath, M. F. Current and emerging therapeutic targets for IBD. \u003cem\u003eNat. Rev. Gastroenterol. Hepatol.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 269\u0026ndash;278 (2017).\u003c/li\u003e\n\u003cli\u003eOrd\u0026aacute;s, I., Eckmann, L., Talamini, M., Baumgart, D. C. \u0026amp; Sandborn, W. J. Ulcerative colitis. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e380\u003c/strong\u003e, 1606\u0026ndash;1619 (2012).\u003c/li\u003e\n\u003cli\u003eHracs, L. et al. Global evolution of inflammatory bowel disease across epidemiologic stages. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e642\u003c/strong\u003e, 458\u0026ndash;466 (2025).\u003c/li\u003e\n\u003cli\u003eHashash, J. G., Limdi, J. K., Shapiro, J. M. \u0026amp; Shah, S. A. Medical management of inflammatory bowel diseases. \u003cem\u003eBMJ\u003c/em\u003e \u003cstrong\u003e391\u003c/strong\u003e, e079050 (2025). \u003c/li\u003e\n\u003cli\u003eFudman, D. I., McConnell, R. A., Ha, C. \u0026amp; Singh, S. Modern advanced therapies for inflammatory bowel diseases: practical considerations and positioning. \u003cem\u003eClin. Gastroenterol. Hepatol.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 454-468 (2025).\u003c/li\u003e\n\u003cli\u003eGohda, E. et al. Human hepatocyte growth factor in plasma from patients with fulminant hepatic failure. \u003cem\u003eExp. Cell Res.\u003c/em\u003e \u003cstrong\u003e166\u003c/strong\u003e, 139\u0026ndash;150 (1986).\u003c/li\u003e\n\u003cli\u003eTahara, Y. et al. Hepatocyte growth factor facilitates colonic mucosal repair in experimental ulcerative colitis in rats. \u003cem\u003eJ. Pharmacol. Exp. Ther.\u003c/em\u003e \u003cstrong\u003e307\u003c/strong\u003e, 146\u0026ndash;151 (2003).\u003c/li\u003e\n\u003cli\u003eNumata, M. et al. Hepatocyte growth factor facilitates the repair of large colonic ulcers in 2,4,6-trinitrobenzene sulfonic acid-induced colitis in rats. \u003cem\u003eInflamm. Bowel Dis.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 551\u0026ndash;558 (2005).\u003c/li\u003e\n\u003cli\u003eGarinchesa, P. et al. Organ-specific expression of the colon cancer antigen A33, a cell surface target for antibody-based therapy. \u003cem\u003eInt. J. Oncol.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 465\u0026ndash;471 (1996).\u003c/li\u003e\n\u003cli\u003eHeath, J. K. et al. The human A33 antigen is a transmembrane glycoprotein and a novel member of the immunoglobulin superfamily. \u003cem\u003eProc. Natl Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e94\u003c/strong\u003e, 469\u0026ndash;474 (1997).\u003c/li\u003e\n\u003cli\u003eScott, A. M. et al. A phase I trial of humanized monoclonal antibody A33 in patients with colorectal carcinoma: biodistribution, pharmacokinetics, and quantitative tumor uptake. \u003cem\u003eClin. Cancer Res.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 4810\u0026ndash;4817 (2005).\u003c/li\u003e\n\u003cli\u003eChong, G. et al. Phase I trial of 131I-huA33 in patients with advanced colorectal carcinoma. \u003cem\u003eClin. Cancer Res.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 4818\u0026ndash;4826 (2005).\u003c/li\u003e\n\u003cli\u003eCarrasquillo, J. A. et al. (124)I-huA33 antibody PET of colorectal cancer. \u003cem\u003eJ. Nucl. Med.\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 1173\u0026ndash;1180 (2011).\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Donoghue, J. A. et al. 124I-huA33 antibody uptake is driven by A33 antigen concentration in tissues from colorectal cancer patients imaged by immuno-PET. \u003cem\u003eJ. Nucl. Med.\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 1878\u0026ndash;1885 (2011).\u003c/li\u003e\n\u003cli\u003eZanzonico, P. et al. PET-based compartmental modeling of (124)I-A33 antibody: quantitative characterization of patient-specific tumor targeting in colorectal cancer. \u003cem\u003eEur. J. Nucl. Med. Mol. Imaging\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e, 1700\u0026ndash;1706 (2015).\u003c/li\u003e\n\u003cli\u003eHichiwa, G. et al. Targeting of bowel tissue by fully human antibodies cross-reactive with human and mouse GPA33 antigen. \u003cem\u003eBiomed. Pharmacother.\u003c/em\u003e \u003cstrong\u003e189\u003c/strong\u003e, 118336 (2025).\u003c/li\u003e\n\u003cli\u003eCooper, H. S., Murthy, S. N., Shah, R. S. \u0026amp; Sedergran, D. J. Clinicopathologic study of dextran sulfate sodium experimental murine colitis. \u003cem\u003eLab. Invest.\u003c/em\u003e \u003cstrong\u003e69\u003c/strong\u003e, 238\u0026ndash;249 (1993).\u003c/li\u003e\n\u003cli\u003eMoriwaki, T., Abe, S., Oshimura, M. \u0026amp; Kazuki, Y. Transchromosomic technology for genomically humanized animals. \u003cem\u003eExp. Cell Res.\u003c/em\u003e \u003cstrong\u003e390\u003c/strong\u003e, 111914 (2020).\u003c/li\u003e\n\u003cli\u003eSatofuka, H. et al. Efficient human-like antibody repertoire and hybridoma production in trans-chromosomic mice carrying megabase-sized human immunoglobulin loci. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1841 (2022).\u003c/li\u003e\n\u003cli\u003eShimoya, K. et al. Mice carrying the full-length human immunoglobulin loci produce antigen-specific human antibodies with the lambda light chain. \u003cem\u003eiScience\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 111258 (2024).\u003c/li\u003e\n\u003cli\u003eKoelink, P. J. et al. Development of reliable, valid and responsive scoring systems for endoscopy and histology in animal models for inflammatory bowel disease. \u003cem\u003eJ. Crohns Colitis\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 794\u0026ndash;803 (2018).\u003c/li\u003e\n\u003cli\u003eFujino, Y. et al. Hepatocyte growth factor ameliorates dextran sodium sulfate‑induced colitis in a mouse model by altering the phenotype of intestinal macrophages. \u003cem\u003eMol. Med. Rep.\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 70 (2023).\u003c/li\u003e\n\u003cli\u003eNishikoba, N. et al. HGF-MET signaling shifts M1 macrophages toward an M2-like phenotype through PI3K-mediated induction of Arginase-1 expression. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 2135 (2020).\u003c/li\u003e\n\u003cli\u003eTurner, D. et al. STRIDE-II: an update on the Selecting Therapeutic Targets in Inflammatory Bowel Disease (STRIDE) Initiative of the International Organization for the Study of IBD (IOIBD): determining Therapeutic Goals for Treat-to-Target strategies in IBD. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cstrong\u003e160\u003c/strong\u003e, 1570\u0026ndash;1583 (2021).\u003c/li\u003e\n\u003cli\u003eDignass, A., Rath, S., Kleindienst, T. \u0026amp; Stallmach, A. Review article: translating STRIDE-II into clinical reality\u0026mdash;Opportunities and challenges. \u003cem\u003eAliment. Pharmacol. Ther.\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 492\u0026ndash;502 (2023).\u003c/li\u003e\n\u003cli\u003eRicart, E. et al. Clinical approach to STRIDE-II in real-life settings: analysis and practical recommendations. \u003cem\u003eCrohns Colitis 360\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, otae055 (2024).\u003c/li\u003e\n\u003cli\u003eLiang, R. F.-H., Lin, H., Chau, C. Y.-P. \u0026amp; Lim, W. C. Histologic healing and clinical outcomes in ulcerative colitis. \u003cem\u003eIntest. Res.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 182\u0026ndash;192 (2025).\u003c/li\u003e\n\u003cli\u003eMagro, F. et al. Endoscopic, histologic, and composite endpoints in patients with ulcerative colitis treated with etrasimod. \u003cem\u003eClin. Gastroenterol. Hepatol.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 341\u0026ndash;350.e6 (2025).\u003c/li\u003e\n\u003cli\u003eSchreiner, P. et al. Mechanism-based treatment strategies for IBD: cytokines, cell adhesion molecules, JAK inhibitors, gut flora, and more. \u003cem\u003eInflamm. Intest. Dis.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 79-96 (2019).\u003c/li\u003e\n\u003cli\u003eTian, Z., Zhao, Q. \u0026amp; Teng, X. Anti-IL23/12 agents and JAK inhibitors for inflammatory bowel disease. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1393463 (2024).\u003c/li\u003e\n\u003cli\u003eRoopenian, D. C. \u0026amp; Akilesh, S. FcRn: the neonatal Fc receptor comes of age. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 715\u0026ndash;725 (2007).\u003c/li\u003e\n\u003cli\u003eRen, J. \u0026amp; Huang, S. Intestinal organoids in inflammatory bowel disease: advances, applications, and future directions. \u003cem\u003eFront. Cell Dev. Biol.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1517121 (2025).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hepatocyte growth factor, Inflammatory bowel disease, colitis, drug delivery system, organ specific targeting antibody","lastPublishedDoi":"10.21203/rs.3.rs-8643909/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8643909/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInflammatory bowel disease (IBD) is a chronic disease characterized by persistent mucosal inflammation and impaired epithelial repair. Hepatocyte growth factor (HGF) is a potent epithelial regeneration factor; however, its rapid clearance after systemic administration and organ non-specificity limit its clinical application. In this study, we aimed to investigate the effects of a gut-directed antibody conjugated to HGF on colitis. Mouse models of dextran sulfate sodium (DSS)-induced acute experimental colitis were intraperitoneally administered phosphate-buffered saline (PBS), free recombinant HGF, or an HGF- glycoprotein A33-specific targeting antibody complex (HGF-AB), and their body weight, disease activity index (DAI), colon length, mouse colitis histology index (MCHI), and serum HGF concentration were measured. HGF-AB treatment significantly suppressed body weight loss, reduced DAI, and maintained colon length than PBS or HGF monotherapy. The epithelial structure and inflammatory damage were significantly protected in the HGF-AB-treated group. Serum HGF concentrations were higher in the HGF-AB-treated group than in the free HGF-treated group, suggesting improved pharmacokinetic stability via antibody conjugation. HGF-AB regulated mucosal immune responses by suppressing proinflammatory cytokine transcripts and enhancing anti-inflammatory IL-10 expression. Overall, the findings established organ-targeted regenerative therapy as a promising adjunctive strategy to complement the existing anti-inflammatory treatments and promote healing in IBD.\u003c/p\u003e","manuscriptTitle":"A novel organ-targeted antibody conjugated to hepatocyte growth factor ameliorates colitis in a mouse model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-12 06:52:44","doi":"10.21203/rs.3.rs-8643909/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8c6ec2c3-8448-42d0-8d58-f47508364ae2","owner":[],"postedDate":"February 12th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":62759574,"name":"Health sciences/Diseases"},{"id":62759575,"name":"Health sciences/Gastroenterology"},{"id":62759576,"name":"Biological sciences/Immunology"},{"id":62759577,"name":"Health sciences/Medical research"}],"tags":[],"updatedAt":"2026-03-09T05:25:24+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-12 06:52:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8643909","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8643909","identity":"rs-8643909","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.