Leishmania infantum chagasi detection in blood donors living in an endemic area

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-16

This study detected Leishmania infantum chagasi in 2.16% of blood donors in an endemic area using IFAT and PCR-RFLP, supporting the risk of transfusion-transmitted infection.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-16 · read from full text

This preprint studied the prevalence of asymptomatic Leishmania infantum chagasi infection in 324 blood donors from the Adamantina microregion in Brazil, using indirect immunofluorescence (IFAT) for Leishmania antibodies and PCR-RFLP for parasite DNA identification. After excluding donors with other transfusion-relevant infections (HIV, hepatitis B/C, syphilis, HTLV I/II, and Chagas disease), seven samples were IFAT-positive (2.16%), and six of these were PCR-positive for a 953 bp chitinase gene fragment, with RFLP identifying L. infantum chagasi. The authors note that IFAT can yield cross-reactions and that low parasitemia may explain cases where serology is positive but PCR is negative. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Human Visceral Leishmaniasis (HVL) is a neglected disease that occurs in 98 countries on five continents, and it is endemic in tropical and subtropical regions. In South America, the etiological agent of HVL is Leishmania infantum chagasi , mainly transmitted through the bite of an infected sandfly female from the genus Lutzomyia . In American HVL endemic areas, is common the occurrence of asymptomatic infection, which contribute with the possibility of L. infantum chagasi transmission during a blood transfusion. To know the prevalence of L. infantum chagasi asymptomatic infection in blood donors from the microregion of Adamantina, we investigated 324 peripheral blood samples from donors through Immunofluorescence (IFAT) and PCR-RFLP techniques. Seven blood samples (2.16%) tested positive for Leishmania by IFAT, and from that six presented positive results by PCR (85.71%), which were later identified as L. infantum chagasi by RFLP. The presence of L. infantum chagasi in the peripheral blood of blood donors supported the hypothesis of transmission by blood transfusion and points to the need to include tests for visceral leishmaniasis in blood bank screening tests and pre-storage measures, especially in endemic areas to prevent the exponential increase of HVL by blood transfusion.
Full text 48,970 characters · extracted from preprint-html · click to expand
Leishmania infantum chagasi detection in blood donors living in an endemic area | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Leishmania infantum chagasi detection in blood donors living in an endemic area Elizandra Aparecida de Oliveira Lopes, Patrícia Florencio-Henschel, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2260576/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Dec, 2022 Read the published version in Parasitology Research → Version 1 posted 8 You are reading this latest preprint version Abstract Human Visceral Leishmaniasis (HVL) is a neglected disease that occurs in 98 countries on five continents, and it is endemic in tropical and subtropical regions. In South America, the etiological agent of HVL is Leishmania infantum chagasi , mainly transmitted through the bite of an infected sandfly female from the genus Lutzomyia . In American HVL endemic areas, is common the occurrence of asymptomatic infection, which contribute with the possibility of L. infantum chagasi transmission during a blood transfusion. To know the prevalence of L. infantum chagasi asymptomatic infection in blood donors from the microregion of Adamantina, we investigated 324 peripheral blood samples from donors through Immunofluorescence (IFAT) and PCR-RFLP techniques. Seven blood samples (2.16%) tested positive for Leishmania by IFAT, and from that six presented positive results by PCR (85.71%), which were later identified as L. infantum chagasi by RFLP. The presence of L. infantum chagasi in the peripheral blood of blood donors supported the hypothesis of transmission by blood transfusion and points to the need to include tests for visceral leishmaniasis in blood bank screening tests and pre-storage measures, especially in endemic areas to prevent the exponential increase of HVL by blood transfusion. Visceral leishmaniasis Blood bank Blood transfusion Polymerase chain reaction Indirect immunofluorescence Figures Figure 1 Introduction Leishmaniasis is a group of neglected diseases caused by protozoa of the genus Leishmania , which has been transmitted between humans, domestic dogs, and wild animals by vector insects of the genera Phlebotomus in the Old World and Lutzomyia in the New World. Clinically, human leishmaniasis is divided into tegumentary and visceral leishmaniasis, which depend on the infecting Leishmania species, but the clinical manifestation is the result of the complex interaction between the parasite and the host (Pace 2014 ). Human visceral leishmaniasis (HVL) is the most severe form of the disease, being lethal in 90% of untreated cases (BRASIL 2009 ). Endemic in tropical, subtropical, and Mediterranean areas, it is present in more than 98 countries, affecting about 12 million people worldwide, with 1.5 million new cases each year being characterized as an emerging disease due to high morbidity and mortality (Bezerra et al. 2018 ). Currently, in the American continent, HVL is endemic in 13 countries, and from 2001 to 2020, there were 67,922 notifications with an average of 3,400 cases per year, of which 97% were diagnosed in Brazil (OPAS 2021 ). In this period, Brazil registered the highest number of cases in 2017, however, a gradual decrease has been observed and in 2020 there was a reduction of 55% (OPAS 2021 ). Climatic factors such as rain, vector density, and collective immunity may have influenced this reduction (Jeronimo et al. 2000 ). Nevertheless, HVL is found in all five Brazilian regions, and the Southeast is the third region with the highest number of confirmed cases (Rancan et al. 2020 ), where the microregion of Adamantina is included among the municipalities of Brazil that present the highest incidence of cases per 100,000 inhabitants (OPAS 2021 ). Although man is not considered a reservoir of Leishmania infantum chagasi ( L. infantum chagasi ), and cannot maintain the vector transmission cycle of the disease, other forms of human transmission may occur as congenital, organ transplantation, needle sharing, and blood transfusion(Singh 2006 ). In this context, transmission by blood transfusion should be considered in endemic areas (Pedrosa 2016 ) since asymptomatic carriers have a low number of parasitic forms in the bloodstream and these can survive blood storage and infect blood recipients (le Fichoux et al. 1999 ; Singh 2006 ). Thus, this research aimed to evaluate the presence of L. infantum chagasi in blood donors living in endemic areas. Material And Methods This research was conducted in blood donors from the Adamantina microregion from 05/01/2018 to 10/31/2018 and approved by the Research Ethics Committee- CEP-Famema, under the CAAE: 85265618.9.0000.5413.The blood bank of the Santa Casa of Adamantina municipality is located in the Midwest region of São Paulo State, southeast of Brazil (21° 41' 07'' and 51° 04' 21'' W). This blood bank is a reference for donors from the Adamantina microregion, with a population density of 43.4 inhabitants per km 2 (IBGE 2010 ). Blood samples from donors considered suitable according to sanitary governmental license (Resolução da Diretoria Colegiada -RDC, nº 153 of 2017/26/04) were collected, refrigerated, and sent within 24 hours to the Parasitology Department of Marília Medical School (Famema). The samples screened by serological techniques and considered positive for HIV, Hepatitis B and C, Syphilis, HTLV I and II, and Chagas disease were excluded. The sample size was performed using the software G*Power, version 3.1.9.2 (Franz Faul, Universität Kiel, Germany). The association between qualitative variables was performed by Fisher’s exact test. The sample size considering a type I error margin (α) of 5%, a study power of 80%, 1 (one) degree of free demand a large effect size (0.50), was 32 sample elements. The Leishmania Indirect Immunofluorescence test (IFAT) was performed according to the kit IFI Leishmaniasis Human Bio-Manguinhos (L 176LA001C), in the Parasitology Department of Centro de Laboratório Regional IV de Marília – Instituto Adolfo Lutz. Serum from patients infected with L. infantum chagasi diagnosed at the Famema Parasitology Laboratory through bone marrow aspirate was used as a positive control. For DNA extraction and quantification, 200 uL of peripheral blood samples were extracted using the column method, employing DNeasy® Blood&tissue Kit (QIAGEN®, Valencia, CA, USA), according to the supplier’s instructions. The quantification and determination of the DNA quality were verified after 1% agarose gel electrophoresis, stained with ethidium bromide, and DNA was determined by comparing band intensity with the intensity of the Low Mass Ladder pattern (Invitrogen/Thermo Fischer Scientific, Waltham, Massachusetts, USA). Molecular diagnosis was performed with 50-100ng of genomic DNA extracted from peripheral blood. It was submitted to molecular diagnosis for the genus Leishmania spp by amplification of a 953 base pair fragment referring to the gene encoding the enzyme chitinase, using the primer pairs Lquit224F (5' - GTTCMACTACGAGGCCTTCTTCAA − 3') and Lquit1182R (5' - CAGATCATTATCCCAGACAAGTT − 3') described by Jordão et al. ( 2021 ). PCR reaction was performed with the enzyme Gotaq®hot Start Polymerase (Promega™, Madison, WI, USA), according to the conditions provided by the manufacturer. As a positive control of the PCR reaction, we used DNA extracted from L. infantum chagasi from samples isolated by culture available in the Famema Parasitology laboratory. After molecular diagnosis by PCR, the 953 bp amplified fragment was submitted to RFLP with PstI endonuclease (New Englandbiolabs Inc., Ipswich, MA, USA) according to the manufacturer’s instructions. The fragment sizes obtained after digestion were 390 bp, 258 bp, 192 bp, and 113 bp, which corresponds to the specific restriction pattern of the species L. infantum chagasi , according to the method described by Jordão et al. ( 2021 ). Results And Discussion Sample calculation analysis indicated the inclusion of a minimum of 300 individuals. Thus, were included 324 blood donors agreed to participate in this research, being 86 (26,54%) females and 238 (73,46%) males. Of these, two (28,57%) females and five (71,43%) males were positive for IFTA, without statistical significance between gender and the presence of antibodies to Leishmania spp by Fisher’s exact test (p ≥ 0.05). The predominance of males among asymptomatic individuals observed in this study is because men prevail among blood donors (Urias et al. 2009 ). The possibility of HVL transmission by blood transfusion was recognized by World Health Organization (2010), but there is little scientific evidence concerning parasitemia in these individuals, as well as its importance regarding transmission through blood transfusion (le Fichoux et al. 1999 ). Although IFAT is considered the gold standard among serological tests for the diagnosis of HVL due to its high sensitivity, there is the possibility of cross-reactions with other diseases such as Chagas disease, cutaneous leishmaniasis, malaria, tuberculosis, schistosomiasis, and typhoid fever(Sundar and Rai 2002 ; Urias et al. 2009 ). Probably cross-reaction to other infectious agents, recent contact with the parasite (Michel et al. 2011 ), and probably a low parasitemia, ranging from 0.0001 parasite/mL to 1 parasite/mL (le Fichoux et al. 1999 ), could explain the PCR negative result obtained in Leishmania spp 953 bp chitinase in one IFAT positive serum. In six samples (85,71%), nonetheless, the presence of a fragment of 953 bp corresponding to chitinase encoding gene of Leishmania spp and L. infantum chagasi by RFLP were observed respectively in Figs. 1A and 1B. (FIGURE 1) To minimize the risk of transfusion of Leishmania-infected blood, different pre-storage measures would be used in blood banks, such as leukodepletion and pathogen-reducing technologies, such as ultraviolet light which could decrease the discarding of collected bags considering the current scarcity of blood donation (Monteiro et al, 2016 ; Jimenez-Marco et al. 2018 ). In this way, we believe that these measures would prevent the exponential increase of HVL through blood transfusion mainly in endemic areas Conclusion The presence of L. infantum chagasi in the peripheral blood of asymptomatic individuals as blood donors indicates an important public health issue and supports the hypothesis of transmission by blood transfusion. Declarations Acknowledgment Instituto Adolfo Lutz for the help in carrying out the immunofluorescence technique Biomanguinhos for the donation of the immunofluorescence kit Funding: This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001. Authors' contributions: Elizandra Aparecida de Oliveira Lopes, Luciamare Perinetti Alves Martins and Rodrigo Buzinaro Suzuki contributed to the conception and design of the study, prepared the material, collected and analyzed the data. Patrícia Florencio-Henschel, Felipe Trovalim Jordão and Márcia Aparecida Sperança contributed to the preparation of the material and data analysis. The first draft of the manuscript was written by Elizandra Aparecida de Oliveira Lopes and all the authors commented on the previous versions of the manuscript. All authors read and approved the final manuscript. Ethics approval: This work was approved by the Research Ethics Committee of the Faculdade de Medicina de Marília – CAAE: 85265618.9.0000.5413. Conflict of interests: The authors declare that they have no conflict of interest. Consent to participate: Informed consent was obtained from all individual participants included in the study. Consent for publication: The participants have consented to the submission of the case report to the journal. Availability of data and material: Not applicable. References Bezerra JMT, de Araújo VEM, Barbosa DS, Martins-Melo FR, Werneck GL, Carneiro M (2018) Burden of leishmaniasis in Brazil and federated units, 1990-2016: Findings from Global Burden of Disease Study 2016. PLoS neglected tropical diseases 12(9):e0006697.https://doi.org/10.1371/journal.pntd.0006697 Boelaert M, et al. (2007) Evaluation of rapid diagnostic tests: visceral leishmaniasis. Nature Reviews Microbiology 5(11):S31-S39.https://doi.org/10.1038/nrmicro1766 BRASIL (2009) Ministério da Saúde. Guia da Vigilância Epidemiológica, vol 7. Departamento de Vigilância Epidemiológica, Brasilia (DF). https://bvsms.saude.gov.br/bvs/publicacoes/guia_vigilancia_epidemiologica_7ed.pdf. Accessed02 Jun 2022 IBGE (2010) Censo demográfico brasileiro de 2010. Instituto Brasileiro de Geografia e Estatística, Rio de Janeiro-RJ. https://cidades.ibge.gov.br/brasil/sp/adamantina/panorama. Accessed 18 May 2022 Jeronimo SMB, Teixeira MJ, Sousa AdQ, Thielking P, Pearson RD, Evans TG (2000) Natural History of Leishmania (Leishmania) chagasi infection in Northeastern Brazil: Long-Term Follow-Up. J Clinical Infectious Diseases 30(3):608-609.https://doi.org/10.1086/313697 Jimenez-Marco T, et al. (2018) Strategies for reducing the risk of transfusion-transmitted leishmaniasis in an area endemic for Leishmania infantum : a patient- and donor-targeted approach. Blood Transfus 16(2):130-136. https://doi.org/10.2450/2017.0201-16 Jordão FT, et al. (2021) Evolutive History of Leishmania Genus and Differential Diagnosis of Clinical Important Species Based on a Unique Kinetoplastida Chitinase. 2(3):54-61.https://doi.org/10.34172/ijmpes.2021.16 le Fichoux Y, et al. (1999) Occurrence of Leishmania infantum parasitemia in asymptomatic blood donors living in an area of endemicity in southern France. Journal of clinical microbiology 37(6):1953-1957.https://doi.org/10.1128/JCM.37.6.1953-1957.1999 Michel G, Pomares C, Ferrua B, Marty P (2011) Importance of worldwide asymptomatic carriers of Leishmania infantum (L. chagasi) in human. Acta Trop 119(2-3):69-75.https://doi.org/10.1016/j.actatropica.2011.05.012 Monteiro DC, et al. (2016) Leishmania infantum Infection in Blood Donors, Northeastern Brazil. Emerging infectious diseases 22(4):739-40. https://doi.org/10.3201/eid2204.150065 OPAS (2021) Organização Pan-Americana da Saúde. Leishmanioses: Informe Epidemiológico das Américas [Internet]. Dezembro 2021, vol 10, 10 edn. OPAS/OMS, Washington, DC: OPS; 2021. https://iris.paho.org/handle/10665.2/55386. Accessed 02 May 2022 Otero AC, et al. (2000) Short report: occurrence of Leishmania donovani DNA in donated blood from seroreactive Brazilian blood donors. The American journal of tropical medicine and hygiene 62(1):128-31.https://doi.org/10.4269/ajtmh.2000.62.128 Pace D. (2014) Leishmaniasis. J Infect 69:S10-8. https://doi.org/10.1016/j.jinf.2014.07.016 Pedrosa ÉKFdS (2016) Investigação da infecção por leishmania em doadores de sangue [Dissertação]. In: UERN (ed). Programa de Pós-Graduação em Saúde e Sociedade edn. Universidade do Estado do Rio Grande do Norte/BC, MOSSORÓ-RN, p 79 Prina E, Roux E, Mattei D, Milon G (2007) Leishmania DNA is rapidly degraded following parasite death: an analysis by microscopy and real-time PCR. Microbes and infection 9(11):1307-15.https://doi.org/10.1016/j.micinf.2007.06.005 Rancan EA, Chagas EFB, Sperança MA, Carvalho VCdL, Martins LPA, Suzuki RB (2020) Spatio-temporal distribution of human American visceral leishmaniasis in the Western region of Sao Paulo State, from 2004 to 2018. J Revista do Instituto de Medicina Tropical de São Paulo 62. https://doi.org/10.1590/S1678-9946202062080 Singh S (2006) New developments in diagnosis of leishmaniasis. The Indian journal of medical research 123(3):311-30 Sundar S, Rai M (2002) Laboratory diagnosis of visceral leishmaniasis. Clinical and diagnostic laboratory immunology 9(5):951-8. https://doi.org/10.1128/cdli.9.5.951-958.2002 Urias EVR, et al. (2009) Prevalência de adultos infectados por Leishmania leishmania chagasi entre doadores de sangue do Hemocentro Regional de Montes Claros, Minas Gerais, Brasil. J Revista Brasileira de Hematologia e Hemoterapia 31:348-354. https://doi.org/10.1590/S1516-84842009005000073 WHO (2010) Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the Control of Leishmaniases. In: 949 (ed). World Health Organization, Geneva, p 186. https://apps.who.int/iris/handle/10665/44412. Accessed 18 May 2022 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 26 Dec, 2022 Read the published version in Parasitology Research → Version 1 posted Editorial decision: Major revision 06 Dec, 2022 Reviews received at journal 05 Dec, 2022 Reviewers agreed at journal 30 Nov, 2022 Reviewers agreed at journal 30 Nov, 2022 Reviewers invited by journal 25 Nov, 2022 Editor assigned by journal 24 Nov, 2022 Submission checks completed at journal 23 Nov, 2022 First submitted to journal 10 Nov, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2260576","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":154659578,"identity":"c62d9c5e-89f0-489d-8163-e5761a362f8f","order_by":0,"name":"Elizandra Aparecida de Oliveira Lopes","email":"","orcid":"","institution":"Marília Medical School","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Elizandra","middleName":"Aparecida de Oliveira","lastName":"Lopes","suffix":""},{"id":154659579,"identity":"fc62607a-6331-495d-9c0c-f6a0a3d63240","order_by":1,"name":"Patrícia Florencio-Henschel","email":"","orcid":"","institution":"Instituto Adolfo Lutz","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Patrícia","middleName":"","lastName":"Florencio-Henschel","suffix":""},{"id":154659580,"identity":"c00b3ed7-adf7-4a47-bc35-5ca82654c668","order_by":2,"name":"Felipe Trovalim Jordão","email":"","orcid":"","institution":"Federal University of ABC","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Felipe","middleName":"Trovalim","lastName":"Jordão","suffix":""},{"id":154659581,"identity":"e143a086-25fa-4a4f-8c38-30363f721ebf","order_by":3,"name":"Márcia Aparecida Sperança","email":"","orcid":"","institution":"Federal University of ABC","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Márcia","middleName":"Aparecida","lastName":"Sperança","suffix":""},{"id":154659582,"identity":"c1ba5035-ec92-45f0-90cf-9833bd7fdd63","order_by":4,"name":"Luciamare Perinetti Alves Martins","email":"","orcid":"","institution":"Marília Medical School","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Luciamare","middleName":"Perinetti Alves","lastName":"Martins","suffix":""},{"id":154659583,"identity":"083abd3c-0ca8-4852-9ec5-6c5ae04359e8","order_by":5,"name":"Rodrigo Buzinaro Suzuki","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYDACCTCZwMMPpgpI0SLZAKIMSNDCYHAARBOjxXx2+zPJn21pMsbnVyd+eGDAIM8vdgC/Fpk7Z8wkJNtyeMxuvN0sAXSY4czZCQTcJZHDJmHYVgHUcnYDSEuCwW2CWtKfSSQCtRjPOLv5B5FaEswkDgIdZsDfu41IW2TOGFs2nEvjkbjBu80iwUCCCL9Itz+8+aMs2Z6//+zmmz8qbOT5pQloQdIMVilBrHIQ4D9AiupRMApGwSgYSQAAxjw/LrRb2mgAAAAASUVORK5CYII=","orcid":"","institution":"University of Marília","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Rodrigo","middleName":"Buzinaro","lastName":"Suzuki","suffix":""}],"badges":[],"createdAt":"2022-11-10 19:14:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2260576/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2260576/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00436-022-07770-7","type":"published","date":"2022-12-26T18:07:47+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":29666541,"identity":"992ce446-5ebb-487b-bf46-6507dd8a48b9","added_by":"auto","created_at":"2022-11-29 16:41:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1380632,"visible":true,"origin":"","legend":"\u003cp\u003eLeishmania chitinase encoding gene fragment detection and identification of L. infantum chagasi species by PCR-RFLP.\u003c/p\u003e\n\u003cp\u003eNote: A- Detection of the genus Leishmania spp by PCR. Amplification of the 953 bp fragment from Leishmania spp chitinase encoding gene. 1-100 bp DNA Ladder (Invitrogen, Thermo Fisher Scientific, US); 2- Positive control of L. infantum chagasi DNA from samples isolated by culture; 3 to 8- DNA from IFAT positive samples of Leishmania spp; 9- Negative control. B- Identification L. infantum chagasi species by RFLP. 1-50 bp DNA Ladder (Invitrogen, Thermo Fisher Scientific, US); 2 to 7- 953 bp PCR fragment from positive Leishmania spp samples by IFAT digested with PstI; (Fragments sizes correspond to L. infantum chagasi chitinase) and 8- Negative control.Thus, in HVL endemic areas is important to use diagnostic methods for the detection of Leishmania species in human peripheral blood (Boelaert et al. 2007). Then, the monitoring of blood receptors should be performed for at least one year, since individuals who received contaminated blood may manifest symptoms between 6 and 11 months after transfusion (Otero et al. 2000).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-2260576/v1/83e3c6365b40c6b19d690d4c.png"},{"id":44715127,"identity":"3e363cc8-541d-4988-8d14-88199f0accbd","added_by":"auto","created_at":"2023-10-16 18:13:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":530897,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2260576/v1/263fa2a3-f45e-445f-bff9-9e2031696f69.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Leishmania infantum chagasi detection in blood donors living in an endemic area","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLeishmaniasis is a group of neglected diseases caused by protozoa of the genus \u003cem\u003eLeishmania\u003c/em\u003e, which has been transmitted between humans, domestic dogs, and wild animals by vector insects of the genera \u003cem\u003ePhlebotomus\u003c/em\u003e in the Old World and \u003cem\u003eLutzomyia\u003c/em\u003e in the New World. Clinically, human leishmaniasis is divided into tegumentary and visceral leishmaniasis, which depend on the infecting \u003cem\u003eLeishmania\u003c/em\u003e species, but the clinical manifestation is the result of the complex interaction between the parasite and the host (Pace \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHuman visceral leishmaniasis (HVL) is the most severe form of the disease, being lethal in 90% of untreated cases (BRASIL \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Endemic in tropical, subtropical, and Mediterranean areas, it is present in more than 98 countries, affecting about 12\u0026nbsp;million people worldwide, with 1.5\u0026nbsp;million new cases each year being characterized as an emerging disease due to high morbidity and mortality (Bezerra et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Currently, in the American continent, HVL is endemic in 13 countries, and from 2001 to 2020, there were 67,922 notifications with an average of 3,400 cases per year, of which 97% were diagnosed in Brazil (OPAS \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this period, Brazil registered the highest number of cases in 2017, however, a gradual decrease has been observed and in 2020 there was a reduction of 55% (OPAS \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Climatic factors such as rain, vector density, and collective immunity may have influenced this reduction (Jeronimo et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2000\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNevertheless, HVL is found in all five Brazilian regions, and the Southeast is the third region with the highest number of confirmed cases (Rancan et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), where the microregion of Adamantina is included among the municipalities of Brazil that present the highest incidence of cases per 100,000 inhabitants (OPAS \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAlthough man is not considered a reservoir of \u003cem\u003eLeishmania infantum chagasi\u003c/em\u003e (\u003cem\u003eL. infantum chagasi\u003c/em\u003e), and cannot maintain the vector transmission cycle of the disease, other forms of human transmission may occur as congenital, organ transplantation, needle sharing, and blood transfusion(Singh \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In this context, transmission by blood transfusion should be considered in endemic areas (Pedrosa \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) since asymptomatic carriers have a low number of parasitic forms in the bloodstream and these can survive blood storage and infect blood recipients (le Fichoux et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Singh \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Thus, this research aimed to evaluate the presence of \u003cem\u003eL. infantum chagasi\u003c/em\u003e in blood donors living in endemic areas.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cp\u003e This research was conducted in blood donors from the Adamantina microregion from 05/01/2018 to 10/31/2018 and approved by the Research Ethics Committee- CEP-Famema, under the CAAE: 85265618.9.0000.5413.The blood bank of the Santa Casa of Adamantina municipality is located in the Midwest region of S\u0026atilde;o Paulo State, southeast of Brazil (21\u0026deg; 41' 07'' and 51\u0026deg; 04' 21'' W). This blood bank is a reference for donors from the Adamantina microregion, with a population density of 43.4 inhabitants per km\u003csup\u003e2\u003c/sup\u003e(IBGE \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Blood samples from donors considered suitable according to sanitary governmental license (Resolu\u0026ccedil;\u0026atilde;o da Diretoria Colegiada -RDC, n\u0026ordm; 153 of 2017/26/04) were collected, refrigerated, and sent within 24 hours to the Parasitology Department of Mar\u0026iacute;lia Medical School (Famema). The samples screened by serological techniques and considered positive for HIV, Hepatitis B and C, Syphilis, HTLV I and II, and Chagas disease were excluded. The sample size was performed using the software G*Power, version 3.1.9.2 (Franz Faul, Universit\u0026auml;t Kiel, Germany). The association between qualitative variables was performed by Fisher\u0026rsquo;s exact test. The sample size considering a type I error margin (α) of 5%, a study power of 80%, 1 (one) degree of free demand a large effect size (0.50), was 32 sample elements.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eLeishmania\u003c/em\u003e Indirect Immunofluorescence test (IFAT) was performed according to the kit IFI Leishmaniasis Human Bio-Manguinhos (L 176LA001C), in the Parasitology Department of Centro de Laborat\u0026oacute;rio Regional IV de Mar\u0026iacute;lia \u0026ndash; Instituto Adolfo Lutz. Serum from patients infected with \u003cem\u003eL. infantum chagasi\u003c/em\u003e diagnosed at the Famema Parasitology Laboratory through bone marrow aspirate was used as a positive control.\u003c/p\u003e \u003cp\u003eFor DNA extraction and quantification, 200 uL of peripheral blood samples were extracted using the column method, employing DNeasy\u0026reg; Blood\u0026amp;tissue Kit (QIAGEN\u0026reg;, Valencia, CA, USA), according to the supplier\u0026rsquo;s instructions. The quantification and determination of the DNA quality were verified after 1% agarose gel electrophoresis, stained with ethidium bromide, and DNA was determined by comparing band intensity with the intensity of the Low Mass Ladder pattern (Invitrogen/Thermo Fischer Scientific, Waltham, Massachusetts, USA).\u003c/p\u003e \u003cp\u003eMolecular diagnosis was performed with 50-100ng of genomic DNA extracted from peripheral blood. It was submitted to molecular diagnosis for the genus \u003cem\u003eLeishmania\u003c/em\u003e spp by amplification of a 953 base pair fragment referring to the gene encoding the enzyme chitinase, using the primer pairs Lquit224F (5' - GTTCMACTACGAGGCCTTCTTCAA \u0026minus;\u0026thinsp;3') and Lquit1182R (5' - CAGATCATTATCCCAGACAAGTT \u0026minus;\u0026thinsp;3') described by Jord\u0026atilde;o et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). PCR reaction was performed with the enzyme Gotaq\u0026reg;hot Start Polymerase (Promega\u0026trade;, Madison, WI, USA), according to the conditions provided by the manufacturer. As a positive control of the PCR reaction, we used DNA extracted from \u003cem\u003eL. infantum chagasi\u003c/em\u003e from samples isolated by culture available in the Famema Parasitology laboratory.\u003c/p\u003e \u003cp\u003eAfter molecular diagnosis by PCR, the 953 bp amplified fragment was submitted to RFLP with PstI endonuclease (New Englandbiolabs Inc., Ipswich, MA, USA) according to the manufacturer\u0026rsquo;s instructions. The fragment sizes obtained after digestion were 390 bp, 258 bp, 192 bp, and 113 bp, which corresponds to the specific restriction pattern of the species \u003cem\u003eL. infantum chagasi\u003c/em\u003e, according to the method described by Jord\u0026atilde;o et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e"},{"header":"Results And Discussion","content":"\u003cp\u003eSample calculation analysis indicated the inclusion of a minimum of 300 individuals. Thus, were included 324 blood donors agreed to participate in this research, being 86 (26,54%) females and 238 (73,46%) males. Of these, two (28,57%) females and five (71,43%) males were positive for IFTA, without statistical significance between gender and the presence of antibodies to \u003cem\u003eLeishmania\u003c/em\u003e spp by Fisher\u0026rsquo;s exact test (p\u0026thinsp;\u0026ge;\u0026thinsp;0.05). The predominance of males among asymptomatic individuals observed in this study is because men prevail among blood donors (Urias et al. \u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe possibility of HVL transmission by blood transfusion was recognized by World Health Organization (2010), but there is little scientific evidence concerning parasitemia in these individuals, as well as its importance regarding transmission through blood transfusion (le Fichoux et al. \u003cspan class=\"CitationRef\"\u003e1999\u003c/span\u003e). Although IFAT is considered the gold standard among serological tests for the diagnosis of HVL due to its high sensitivity, there is the possibility of cross-reactions with other diseases such as Chagas disease, cutaneous leishmaniasis, malaria, tuberculosis, schistosomiasis, and typhoid fever(Sundar and Rai \u003cspan class=\"CitationRef\"\u003e2002\u003c/span\u003e; Urias et al. \u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e). Probably cross-reaction to other infectious agents, recent contact with the parasite (Michel et al. \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e), and probably a low parasitemia, ranging from 0.0001 parasite/mL to 1 parasite/mL (le Fichoux et al. \u003cspan class=\"CitationRef\"\u003e1999\u003c/span\u003e), could explain the PCR negative result obtained in \u003cem\u003eLeishmania\u003c/em\u003e spp 953 bp chitinase in one IFAT positive serum.\u003c/p\u003e\n\u003cp\u003eIn six samples (85,71%), nonetheless, the presence of a fragment of 953 bp corresponding to chitinase encoding gene of \u003cem\u003eLeishmania\u003c/em\u003e spp and \u003cem\u003eL. infantum chagasi\u003c/em\u003e by RFLP were observed respectively in Figs. 1A and 1B.\u003c/p\u003e\n\u003cp\u003e(FIGURE 1)\u003c/p\u003e\n\u003cp\u003eTo minimize the risk of transfusion of Leishmania-infected blood, different pre-storage measures would be used in blood banks, such as leukodepletion and pathogen-reducing technologies, such as ultraviolet light which could decrease the discarding of collected bags considering the current scarcity of blood donation (Monteiro et al, \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e; Jimenez-Marco et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). In this way, we believe that these measures would prevent the exponential increase of HVL through blood transfusion mainly in endemic areas\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe presence of \u003cem\u003eL. infantum chagasi\u003c/em\u003e in the peripheral blood of asymptomatic individuals as blood donors indicates an important public health issue and supports the hypothesis of transmission by blood transfusion.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInstituto Adolfo Lutz for the help in carrying out the immunofluorescence technique Biomanguinhos for the donation of the immunofluorescence kit\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis study was financed in part by the Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior - Brasil (CAPES) - Finance Code 001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions:\u0026nbsp;\u003c/strong\u003eElizandra Aparecida de Oliveira Lopes, Luciamare Perinetti Alves Martins and Rodrigo Buzinaro Suzuki contributed to the conception and design of the study, prepared the material, collected and analyzed the data. Patr\u0026iacute;cia Florencio-Henschel, Felipe Trovalim Jord\u0026atilde;o and M\u0026aacute;rcia Aparecida Speran\u0026ccedil;a contributed to the preparation of the material and data analysis. The first draft of the manuscript was written by Elizandra Aparecida de Oliveira Lopes and all the authors commented on the previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval:\u0026nbsp;\u003c/strong\u003eThis work was approved by the Research Ethics Committee of the Faculdade de Medicina de Mar\u0026iacute;lia \u0026ndash; CAAE: 85265618.9.0000.5413.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests:\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate:\u0026nbsp;\u003c/strong\u003eInformed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eThe participants have consented to the submission of the case report to the journal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material:\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBezerra JMT, de Ara\u0026uacute;jo VEM, Barbosa DS, Martins-Melo FR, Werneck GL, Carneiro M (2018) Burden of leishmaniasis in Brazil and federated units, 1990-2016: Findings from Global Burden of Disease Study 2016. PLoS neglected tropical diseases 12(9):e0006697.https://doi.org/10.1371/journal.pntd.0006697\u003c/li\u003e\n \u003cli\u003eBoelaert M, et al. (2007) Evaluation of rapid diagnostic tests: visceral leishmaniasis. Nature Reviews Microbiology 5(11):S31-S39.https://doi.org/10.1038/nrmicro1766\u003c/li\u003e\n \u003cli\u003eBRASIL (2009) Minist\u0026eacute;rio da Sa\u0026uacute;de. Guia da Vigil\u0026acirc;ncia Epidemiol\u0026oacute;gica, vol 7. Departamento de Vigil\u0026acirc;ncia Epidemiol\u0026oacute;gica, Brasilia (DF). https://bvsms.saude.gov.br/bvs/publicacoes/guia_vigilancia_epidemiologica_7ed.pdf. Accessed02 Jun 2022\u003c/li\u003e\n \u003cli\u003eIBGE (2010) Censo demogr\u0026aacute;fico brasileiro de 2010. Instituto Brasileiro de Geografia e Estat\u0026iacute;stica, Rio de Janeiro-RJ. https://cidades.ibge.gov.br/brasil/sp/adamantina/panorama. Accessed 18 May 2022\u003c/li\u003e\n \u003cli\u003eJeronimo SMB, Teixeira MJ, Sousa AdQ, Thielking P, Pearson RD, Evans TG (2000) Natural History of \u003cem\u003eLeishmania (Leishmania) chagasi\u003c/em\u003e infection in Northeastern Brazil: Long-Term Follow-Up. J Clinical Infectious Diseases 30(3):608-609.https://doi.org/10.1086/313697\u003c/li\u003e\n \u003cli\u003eJimenez-Marco T, et al. (2018) Strategies for reducing the risk of transfusion-transmitted leishmaniasis in an area endemic for \u003cem\u003eLeishmania infantum\u003c/em\u003e: a patient- and donor-targeted approach. Blood Transfus 16(2):130-136. https://doi.org/10.2450/2017.0201-16\u003c/li\u003e\n \u003cli\u003eJord\u0026atilde;o FT, et al. (2021) Evolutive History of \u003cem\u003eLeishmania\u003c/em\u003e Genus and Differential Diagnosis of Clinical Important Species Based on a Unique Kinetoplastida Chitinase. 2(3):54-61.https://doi.org/10.34172/ijmpes.2021.16\u003c/li\u003e\n \u003cli\u003ele Fichoux Y, et al. (1999) Occurrence of \u003cem\u003eLeishmania infantum\u003c/em\u003e parasitemia in asymptomatic blood donors living in an area of endemicity in southern France. Journal of clinical microbiology 37(6):1953-1957.https://doi.org/10.1128/JCM.37.6.1953-1957.1999\u003c/li\u003e\n \u003cli\u003eMichel G, Pomares C, Ferrua B, Marty P (2011) Importance of worldwide asymptomatic carriers of \u003cem\u003eLeishmania infantum\u003c/em\u003e (L. chagasi) in human. Acta Trop 119(2-3):69-75.https://doi.org/10.1016/j.actatropica.2011.05.012\u003c/li\u003e\n \u003cli\u003eMonteiro DC, et al. (2016) \u003cem\u003eLeishmania infantum\u003c/em\u003e Infection in Blood Donors, Northeastern Brazil. Emerging infectious diseases 22(4):739-40. https://doi.org/10.3201/eid2204.150065\u003c/li\u003e\n \u003cli\u003eOPAS (2021) Organiza\u0026ccedil;\u0026atilde;o Pan-Americana da Sa\u0026uacute;de. Leishmanioses: Informe Epidemiol\u0026oacute;gico das Am\u0026eacute;ricas [Internet]. Dezembro 2021, vol 10, 10 edn. OPAS/OMS, Washington, DC: OPS; 2021. https://iris.paho.org/handle/10665.2/55386. Accessed 02 May 2022\u003c/li\u003e\n \u003cli\u003eOtero AC, et al. (2000) Short report: occurrence of \u003cem\u003eLeishmania donovani\u003c/em\u003e DNA in donated blood from seroreactive Brazilian blood donors. The American journal of tropical medicine and hygiene 62(1):128-31.https://doi.org/10.4269/ajtmh.2000.62.128\u003c/li\u003e\n \u003cli\u003ePace D. (2014) Leishmaniasis. J Infect 69:S10-8. https://doi.org/10.1016/j.jinf.2014.07.016\u003c/li\u003e\n \u003cli\u003ePedrosa \u0026Eacute;KFdS (2016) Investiga\u0026ccedil;\u0026atilde;o da infec\u0026ccedil;\u0026atilde;o por leishmania em doadores de sangue [Disserta\u0026ccedil;\u0026atilde;o]. In: UERN (ed). Programa de P\u0026oacute;s-Gradua\u0026ccedil;\u0026atilde;o em Sa\u0026uacute;de e Sociedade edn. Universidade do Estado do Rio Grande do Norte/BC, MOSSOR\u0026Oacute;-RN, p 79\u003c/li\u003e\n \u003cli\u003ePrina E, Roux E, Mattei D, Milon G (2007) Leishmania DNA is rapidly degraded following parasite death: an analysis by microscopy and real-time PCR. Microbes and infection 9(11):1307-15.https://doi.org/10.1016/j.micinf.2007.06.005\u003c/li\u003e\n \u003cli\u003eRancan EA, Chagas EFB, Speran\u0026ccedil;a MA, Carvalho VCdL, Martins LPA, Suzuki RB (2020) Spatio-temporal distribution of human American visceral leishmaniasis in the Western region of Sao Paulo State, from 2004 to 2018. J Revista do Instituto de Medicina Tropical de S\u0026atilde;o Paulo 62. https://doi.org/10.1590/S1678-9946202062080\u003c/li\u003e\n \u003cli\u003eSingh S (2006) New developments in diagnosis of leishmaniasis. The Indian journal of medical research 123(3):311-30\u003c/li\u003e\n \u003cli\u003eSundar S, Rai M (2002) Laboratory diagnosis of visceral leishmaniasis. Clinical and diagnostic laboratory immunology 9(5):951-8. https://doi.org/10.1128/cdli.9.5.951-958.2002\u003c/li\u003e\n \u003cli\u003eUrias EVR, et al. (2009) Preval\u0026ecirc;ncia de adultos infectados por \u003cem\u003eLeishmania leishmania chagasi\u003c/em\u003e entre doadores de sangue do Hemocentro Regional de Montes Claros, Minas Gerais, Brasil. J Revista Brasileira de Hematologia e Hemoterapia 31:348-354. https://doi.org/10.1590/S1516-84842009005000073\u003c/li\u003e\n \u003cli\u003eWHO (2010) Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the Control of Leishmaniases. In: 949 (ed). World Health Organization, Geneva, p 186. https://apps.who.int/iris/handle/10665/44412. Accessed 18 May 2022\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasitology-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pare","sideBox":"Learn more about [Parasitology Research](http://link.springer.com/journal/436)","snPcode":"436","submissionUrl":"https://submission.nature.com/new-submission/436/3","title":"Parasitology Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Visceral leishmaniasis, Blood bank, Blood transfusion, Polymerase chain reaction, Indirect immunofluorescence","lastPublishedDoi":"10.21203/rs.3.rs-2260576/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2260576/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHuman Visceral Leishmaniasis (HVL) is a neglected disease that occurs in 98 countries on five continents, and it is endemic in tropical and subtropical regions. In South America, the etiological agent of HVL is \u003cem\u003eLeishmania infantum chagasi\u003c/em\u003e, mainly transmitted through the bite of an infected sandfly female from the genus \u003cem\u003eLutzomyia\u003c/em\u003e. In American HVL endemic areas, is common the occurrence of asymptomatic infection, which contribute with the possibility of \u003cem\u003eL. infantum chagasi\u003c/em\u003e transmission during a blood transfusion. To know the prevalence of \u003cem\u003eL. infantum chagasi\u003c/em\u003e asymptomatic infection in blood donors from the microregion of Adamantina, we investigated 324 peripheral blood samples from donors through Immunofluorescence (IFAT) and PCR-RFLP techniques. Seven blood samples (2.16%) tested positive for \u003cem\u003eLeishmania\u003c/em\u003e by IFAT, and from that six presented positive results by PCR (85.71%), which were later identified as \u003cem\u003eL. infantum chagasi\u003c/em\u003e by RFLP. The presence of \u003cem\u003eL. infantum chagasi\u003c/em\u003e in the peripheral blood of blood donors supported the hypothesis of transmission by blood transfusion and points to the need to include tests for visceral leishmaniasis in blood bank screening tests and pre-storage measures, especially in endemic areas to prevent the exponential increase of HVL by blood transfusion.\u003c/p\u003e","manuscriptTitle":"Leishmania infantum chagasi detection in blood donors living in an endemic area","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-11-29 16:41:21","doi":"10.21203/rs.3.rs-2260576/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-12-07T04:31:17+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-12-05T14:14:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"9391a6e8-dc65-4db0-bb32-b24c54c16d3e","date":"2022-11-30T15:49:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8edf8f4b-a534-4454-9749-10592c84a43f","date":"2022-11-30T10:43:35+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-11-26T04:28:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-11-24T07:40:13+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-11-24T02:37:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasitology Research","date":"2022-11-10T19:06:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasitology-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pare","sideBox":"Learn more about [Parasitology Research](http://link.springer.com/journal/436)","snPcode":"436","submissionUrl":"https://submission.nature.com/new-submission/436/3","title":"Parasitology Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"63f05021-8640-4e9e-80b3-09e036b6fb93","owner":[],"postedDate":"November 29th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T18:10:15+00:00","versionOfRecord":{"articleIdentity":"rs-2260576","link":"https://doi.org/10.1007/s00436-022-07770-7","journal":{"identity":"parasitology-research","isVorOnly":false,"title":"Parasitology Research"},"publishedOn":"2022-12-26 18:07:47","publishedOnDateReadable":"December 26th, 2022"},"versionCreatedAt":"2022-11-29 16:41:21","video":"","vorDoi":"10.1007/s00436-022-07770-7","vorDoiUrl":"https://doi.org/10.1007/s00436-022-07770-7","workflowStages":[]},"version":"v1","identity":"rs-2260576","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2260576","identity":"rs-2260576","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-29T02:00:03.542394+00:00
License: CC-BY-4.0