A novel mouse model of creatine transporter deficiency

preprint OA: closed CC-BY-4.0

Abstract

Mutations in the creatine (Cr) transporter (CrT) gene lead to cerebral creatine deficiency syndrome-1 (CCDS1), an X-linked metabolic disorder characterized by cerebral Cr deficiency causing intellectual disability, seizures, movement  and behavioral disturbances, language and speech impairment ( OMIM #300352). CCDS1 is still an untreatable pathology that can be very invalidating for patients and caregivers. Only two murine models of CCDS1, one of which is an ubiquitous knockout mouse, are currently available to study the possible mechanisms underlying the pathologic phenotype of CCDS1 and to develop therapeutic strategies. Given the importance of validating phenotypes and efficacy of promising treatments in more than one mouse model we have generated a new murine model of CCDS1 obtained by ubiquitous deletion of 5-7 exons in the Slc6a8 gene. We showed a remarkable Cr depletion in the murine brain tissues and cognitive defects, thus resembling the key features of human CCDS1. These results confirm that CCDS1 can be well modeled in mice. This CrT −/y murine model will provide a new tool for increasing the relevance of preclinical studies to the human disease.
Full text 180,580 characters · extracted from preprint-html · click to expand
A novel mouse model of creatine transporter... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/3-228" }, "headline": "A novel mouse model of creatine transporter deficiency", "datePublished": "2014-09-29T14:30:27", "dateModified": "2015-01-22T16:49:20", "author": [ { "@type": "Person", "name": "Laura Baroncelli" }, { "@type": "Person", "name": "Maria Grazia Alessandrì" }, { "@type": "Person", "name": "Jonida Tola" }, { "@type": "Person", "name": "Elena Putignano" }, { "@type": "Person", "name": "Martina Migliore" }, { "@type": "Person", "name": "Elena Amendola" }, { "@type": "Person", "name": "Francesca Zonfrillo" }, { "@type": "Person", "name": "Cornelius Gross" }, { "@type": "Person", "name": "Vincenzo Leuzzi" }, { "@type": "Person", "name": "Giovanni Cioni" }, { "@type": "Person", "name": "Tommaso Pizzorusso" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Mutations in the creatine (Cr) transporter (CrT) gene lead to cerebral creatine deficiency syndrome-1 (CCDS1), an X-linked metabolic disorder characterized by cerebral Cr deficiency causing intellectual disability, seizures, movement and behavioral disturbances, language and speech impairment ( OMIM #300352).CCDS1 is still an untreatable pathology that can be very invalidating for patients and caregivers. Only two murine models of CCDS1, one of which is an ubiquitous knockout mouse, are currently available to study the possible mechanisms underlying the pathologic phenotype of CCDS1 and to develop therapeutic strategies. Given the importance of validating phenotypes and efficacy of promising treatments in more than one mouse model we have generated a new murine model of CCDS1 obtained by ubiquitous deletion of 5-7 exons in the Slc6a8 gene. We showed a remarkable Cr depletion in the murine brain tissues and cognitive defects, thus resembling the key features of human CCDS1. These results confirm that CCDS1 can be well modeled in mice. This CrT−/y murine model will provide a new tool for increasing the relevance of preclinical studies to the human disease." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/3-228", "name": "A novel mouse model of creatine transporter deficiency" } } ] } Home Browse A novel mouse model of creatine transporter deficiency ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Baroncelli L, Alessandrì MG, Tola J et al. A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.12688/f1000research.5369.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Revised A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] Laura Baroncelli 1 , Maria Grazia Alessandrì 2 , Jonida Tola 1 , [...] Elena Putignano 1 , Martina Migliore 1 , Elena Amendola 3 , Francesca Zonfrillo 3 , Cornelius Gross 3 , Vincenzo Leuzzi 4 , Giovanni Cioni 2,5 , Tommaso Pizzorusso 1,6 Laura Baroncelli 1 , Maria Grazia Alessandrì 2 , [...] Jonida Tola 1 , Elena Putignano 1 , Martina Migliore 1 , Elena Amendola 3 , Francesca Zonfrillo 3 , Cornelius Gross 3 , Vincenzo Leuzzi 4 , Giovanni Cioni 2,5 , Tommaso Pizzorusso 1,6 PUBLISHED 22 Jan 2015 Author details Author details 1 Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 2 Department of Developmental Neuroscience, IRCCS Stella Maris Scientific Institute, Calambrone (Pisa), I-56128, Italy 3 Mouse Biology Unit, European Molecular Biology Laboratory (EMBL), Monterotondo (Roma), I-00015, Italy 4 Department of Paediatrics, Child Neurology and Psychiatry, Sapienza University of Rome, Rome, I-00185, Italy 5 Department of Clinical and Experimental Medicine, University of Pisa, Pisa, I-56126, Italy 6 Department of Neuroscience, Psychology, Drug Research and Child Health NEUROFARBA, University of Florence, Florence, I-50135, Italy OPEN PEER REVIEW DETAILS REVIEWER STATUS Abstract Mutations in the creatine (Cr) transporter (CrT) gene lead to cerebral creatine deficiency syndrome-1 (CCDS1), an X-linked metabolic disorder characterized by cerebral Cr deficiency causing intellectual disability, seizures, movement and behavioral disturbances, language and speech impairment ( OMIM #300352). CCDS1 is still an untreatable pathology that can be very invalidating for patients and caregivers. Only two murine models of CCDS1, one of which is an ubiquitous knockout mouse, are currently available to study the possible mechanisms underlying the pathologic phenotype of CCDS1 and to develop therapeutic strategies. Given the importance of validating phenotypes and efficacy of promising treatments in more than one mouse model we have generated a new murine model of CCDS1 obtained by ubiquitous deletion of 5-7 exons in the Slc6a8 gene. We showed a remarkable Cr depletion in the murine brain tissues and cognitive defects, thus resembling the key features of human CCDS1. These results confirm that CCDS1 can be well modeled in mice. This CrT −/y murine model will provide a new tool for increasing the relevance of preclinical studies to the human disease. READ ALL READ LESS Keywords creatine transporter, mouse model, creatine deficiency syndrome 1 Corresponding Author(s) Laura Baroncelli ( [email protected] ) Close Corresponding author: Laura Baroncelli Competing interests: No competing interests were disclosed. Grant information: The author(s) declared that no grants were involved in supporting this work. Copyright: © 2015 Baroncelli L et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). How to cite: Baroncelli L, Alessandrì MG, Tola J et al. A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.12688/f1000research.5369.2 ) First published: 29 Sep 2014, 3 :228 ( https://doi.org/10.12688/f1000research.5369.1 ) Latest published: 22 Jan 2015, 3 :228 ( https://doi.org/10.12688/f1000research.5369.2 ) Revised Amendments from Version 1 We are glad to present a revised version of our work “A novel mouse model of creatine transporter deficiency”. We would like to bring to your attention that we extended the measurement of creatine concentration also to body fluids, more specifically serum and urine. Thus, Table 1 and its relative legend have been modified in order to show also these new data. In addition, we provided the information on GAA content in all organs and body fluids for which we measured creatine concentration. To show these data, we added a Table 2 with the relative legend. Figures have not been modified. We also revised the text according to reviewers suggestions, in particular extending the discussion about the effects of the mutant genotype on motor behavior and their relationship with animals’ cognitive performance. We are glad to present a revised version of our work “A novel mouse model of creatine transporter deficiency”. We would like to bring to your attention that we extended the measurement of creatine concentration also to body fluids, more specifically serum and urine. Thus, Table 1 and its relative legend have been modified in order to show also these new data. In addition, we provided the information on GAA content in all organs and body fluids for which we measured creatine concentration. To show these data, we added a Table 2 with the relative legend. Figures have not been modified. We also revised the text according to reviewers suggestions, in particular extending the discussion about the effects of the mutant genotype on motor behavior and their relationship with animals’ cognitive performance. See the authors' detailed response to the review by Andreas Schulze See the authors' detailed response to the review by Luis M. Valor See the authors' detailed response to the review by Benedetto Sacchetti READ REVIEWER RESPONSES Introduction The creatine (Cr) transporter (CrT, alias CRTR, MGC87396, CT1, SLC6A8, OMIM 300036) deficiency (CCDS1, OMIM #300352) is an X-linked inherited metabolic disorder characterized by cerebral Cr deficiency which results in intellectual disability, language and speech impairment, seizures and movement and behavioral disturbances, and affects about 1% of males with non-syndromic mental disability ( van de Kamp et al. , 2014 ). CrT loss of function is mostly caused by missense mutations and small deletions which are concentrated in the transmembrane domains 7 and 8 of the protein ( van de Kamp et al. , 2014 ). In physiological conditions, about half of our normal Cr requirement is satisfied by the diet. De novo endogenous synthesis of Cr takes place mainly in the kidney, liver and pancreas and involves the enzymes l-arginine: glycineamidinotransferase (AGAT) and S-adenosyl-l-methionine:N-guanidinoacetatemethyltransferase (GAMT) ( Wyss & Kaddurah-Daouk, 2000 ). Cr is a polar hydrophilic molecule unable to cross the lipidic membranes, which uses a Na + - and Cl − - dependent plasma membrane CrT to enter the cells ( Nash et al. , 1994 ). CrT is widely expressed in the brain tissue with a prominent presence in the cortical and subcortical regions involved in motor and sensory processing, learning and memory, and regulation of emotion-related behavior ( Lowe et al. , 2014 ; Mak et al. , 2009 ). Patients affected by cerebral creatine deficiency syndrome-1 (CCDS1) share depletion of brain Cr and the clinical phenotype with patients carrying the other two defects of Cr metabolism which involve mutations of genes encoding the biosynthesizing enzymes AGAT and GAMT ( Item et al. , 2001 ; Stockler et al. , 1994 ). Replenishment of the brain Cr pool is the only effective therapy for Cr deficiency diseases ( Battini et al. , 2002 ; Schulze et al. , 2001 ; Stockler et al. , 1996 ). Unfortunately, in CCDS1 patients even very high doses of Cr, alone or combined with the Cr precursors arginine and glycine to stimulate endogenous Cr synthesis, fail to restore the Cr content in brain ( Chilosi et al. , 2008 ; Valayannopoulos et al. , 2012 ). There have been attempts to normalize the levels of Cr in the brain with Cr-lipophilic analogs, but these compounds have proven ineffective when administered to patients ( Fons et al. , 2010 ). Thus, CCDS1 is still missing an effective treatment. Preclinical animal models are crucial tools to dissect disease pathogenic mechanisms and develop new therapeutic strategies. Only two murine models of CCDS1 are available so far, and they have only been analyzed at the behavioral and neurochemical level. An ubiquitous CrT knockout mouse model has been generated by deletion of 2–4 exons in the Slc6a8 gene. Learning and memory deficits, impaired motor activity and Cr depletion in brain and muscles have been reported in animals at three-four months of age ( Skelton et al. , 2011 ). Another murine model is based on the use of the CaMKII promoter to drive Cre-recombinase expression, achieving a CrT deletion only in postnatal forebrain excitatory neurons. This strategy was successful in avoiding the peripheral Cr depletion and the motor deficits shown by germline CrT knockout mouse. Behavioral analysis in mice at 12 months of age revealed learning and memory impairments that could be ameliorated by supplementation of cyclocreatine, a Cr analog ( Kurosawa et al. , 2012 ). For translational studies, the phenotype variations observed in different mouse models, carrying similar mutations and the effects of genetic backgrounds highlight the importance of validating phenotypes and therapeutic efficacy in multiple models and in different laboratories ( Katz et al. , 2012 ). Such validation will hopefully increase the relevance of preclinical studies to the human disease. To increase the number of CCDS1 models, we generated a novel murine model of CCDS1 obtained by ubiquitous deletion of 5–7 exons in the Slc6a8 gene. These mice presented a remarkable Cr depletion in the brain tissue and displayed cognitive defects resembling the key features of human CCDS1, and providing a new promising CCDS1 animal model. Materials and methods Generation of CrT knockout mice A Cre-conditional allele of Slc6a8 has been produced by introducing the loxP sites flanking exon 5–7 of the gene in embryonic stem (ES) cells via homologous recombination (vector PRPGS00081_A_A09 obtained from the NIH Knock-out Mouse Program, KOMP). The presence of lox sites has been checked by sequencing (sequencing service by MWG, Germany). The plasmid was linearized with NruI before electroporation into ES cells (129/Sv x C57BL/6N, clone A8, gift of A. Wutz, Wellcome Trust Centre for Stem Cell Research, Stem Cell Institute, University of Cambridge). G418-resistant clones were identified and screened by long-range PCR (Applied Biosystems Gene AMP PCR system 2700). Hybridization with a specific probe for the 5′ and 3′ arms was used to confirm the PCR results. Two independent positive ES cell clones were injected into C57BL/6N host embryos using a piezo-drill assisted 8-cell stage injection procedure developed at EMBL, Monterotondo Italy. Four out of five offspring (all >95% ES cell derived) provided germline transmission. Germline transmission of the allele was confirmed by long-range PCR and the neomycin selection cassette was removed by crossing with FLP recombinase expressing mice ( Farley et al. , 2000 ). Germline knockout mice were produced by crossing the constitutive allele to the HPLRT::Cre recombinase deleter mouse ( Tang et al. , 2002 ; Figure 1 ). Figure 1. Sketch of the strategy for generation of a null Slc6a8 mouse. A targeting vector was obtained from KOMP to generate mice carrying a floxed allele. Crossing these mice with a Flp deleter mouse line produced a conditional KO mouse line (cKO allele). Crossing this line with a line expressing Cre-recombinase in the germline produced the Slc6a8 null mouse used in this study (KO allele). 1F, 1R, 2F, 2R, 3F, 3F’, 3R, 4F, 4R report the sites targeted by the PCR primers to assess allele presence. Animal housing Animals were maintained at 22°C under a 12-h light–dark cycle. Food (4RF25 GLP Certificate, Mucedola) and water were available ad libitum . The chow was not added with creatine (personal communication of the manufacturer). All experiments were carried out in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC) and were approved by the Italian Ministry of Health (authorization number 147/2014-B). All necessary efforts were made to minimize both stress and the number of animals used. As CrT deficiency is an X-linked pathology and only males are consistently affected, we focused our study on male animals. Young adult males (postnatal day P40 at the beginning of testing) of each genotype (CrT –/y mutants and CrT +/y wild-type littermates) were used in behavioral experiments, while a separate group of animals (P30) was assigned to Cr level assay. Detection of Slc6a8 mutation by PCR Genomic DNA was isolated from mouse tail using a kit, and the protocol suggested by the manufacturer (DNeasy Blood & Tissue Kit, Qiagen, USA). DNA was amplified for mutant and wild-type (WT) allele using a standard PCR protocol with the following primers: F:AGGTTTCCTCAGGTTATAGAGA; R:CCCTAGGTGTATCTAACATCT; R1: TCGTGGTATCGTTATGCGCC. For PCR amplification we used 300 ng of DNA in a 25 μL reaction volume containing 0.2 mM of each dNTP, 2 μM of F primer, 1 μM of R, 1 μM of R1 primer and 0.5 U/μL Red Taq DNA polymerase (Sigma-Aldrich, Italy). The PCR conditions were as follows: 94°C for 4 min followed by 37 cycles at 94°C for 30 s, 58°C for 30 s, 72°C for 40 s and a final extension at 72°C for 7 min. Amplicons were separated using 2% agarose gel and visualized under UV light after staining with Green Gel Plus (Fisher Molecular Biology, Rome, Italy). Amplicon sizes were: WT allele = 462 bp; mutant allele = 371 bp. Biochemical analysis For Cr and GAA assay, mouse tissues, immediately frozen on dry ice and stored at -80°C until the analysis, were homogenized in 0.7 ml PBS buffer (Sigma-Aldrich, Italy) at 4°C using a ultrasonic disruptor (Microson Heat System, NY, USA) for brain or a glass manual homogenizer (VWR, Italy) for kidney, heart and muscle. After centrifugation (600 × g for 10 min at 4°C) an aliquot of the homogenate (50 µl) was assayed for protein content ( Lowry et al. , 1951 ), and the supernatant used for Cr assay as previously described ( Alessandri et al. , 2005 ). Briefly, 50 µl of saturated sodium hydrogen carbonate and 50 µl of a mixture containing 2- phenylbutyric acid (I.S.) in toluene (6.09 mmol/l; Sigma-Aldrich, Italy) were added to 200 µl of homogenate or to 100 µl of serum and urine, respectively. After adding 1 ml of toluene and 50 µl of hexafluoro-2,4-pentanedione (Sigma-Aldrich, Italy) to form bis-trifluoromethyl- pyrimidine derivatives, the mixture was stirred overnight at 80°C. The organic layer was centrifuged, dried under nitrogen and 2 µl of the residue derivatized at room temperature with 100 µl of BSTFA+TMCS (Sigma-Aldrich, Italy) injected into the Gas Chromatography/Mass Spectrometry (GC/MS) instrument. GC analyses were performed using an Agilent 6890N GC equipped with an HP5MS capillary column (0.25 mm × 30 m, film thickness 0.25 ìm) and an Agilent mass spectrometer 5973N (Agilent Technologies, Italy). The mass spectrometer was set in EI- single ion monitoring mode (SIM). The ions with m/z of 192 for I.S., 258 for Cr and 225 for guanidinoacetic acid (GAA) were used for calculation of the metabolites, using standard curves ranging 5–90 µmol/L and 0.30–6 µmol/L for Cr and GAA, respectively. Data were processed by the G1701DA MSD ChemStation software. All the aqueous solutions were prepared using ultrapure water produced by a Millipore system. Creatinine in urine was measured using an enzymatic colorimetric assay (Sentinel Diagnostics, Italy) and the UV spectrophotometer Cary50 (Agilent Technologies, Italy) set at 546 nm. Behavioral testing The testing order consisted of: open field (1 day duration), object recognition test (ORT) at 24h (3 days), Y maze (1 day), Morris water maze (MWM) with hidden platform (7 days), and locomotor activity (1 day). The mice were tested on one task at a time with the next behavioral test starting at least 2 days after the completion of the previous one. In order to reduce the circadian effects, all behavioral tests were performed during the same time interval each day (1400–1800h; light phase). All behavioral tests were conducted in blind with respect to the genotype of animals. Mice were weighed at the end of experiments (P60). Open field and object recognition test (ORT) We followed the protocol reported in Lonetti et al. , 2010 . Briefly, the apparatus consisted of a square arena (60 × 60 × 30 cm) constructed in poly(vinyl chloride) with black walls and a white floor. The mice received two sessions of 10-min duration in the empty arena on two consecutive days to habituate them to the apparatus and test room. Animal position was continuously recorded by a video tracking system (Noldus Ethovision XT). In the recording software an area corresponding to the center of the arena (a central square 30 × 30 cm), and a peripheral region (corresponding to the remaining portion of the arena) were defined. The total movement of the animal and the time spent in the center or in the periphery area were automatically computed. The mice activity during the first day of habituation was analyzed for evaluating the behavior in the open field arena. The ORT consisted of two phases: sample and testing phase. During the sample phase, two identical objects were placed in diagonally opposite corners of the arena, approximately 6 cm from the walls, and mice were allowed 10 min to explore the objects, then they were returned to their cage. The objects to be discriminated were made of plastic, metal, or glass material and were too heavy to be displaced by the mice. Arena and objects were cleaned with 10% ethanol between trials to stop the build-up of olfactory cues. The testing phase was performed 24h after the sample phase. One of the two familiar objects was replaced with a new one, while the other object was replaced by an identical copy. The objects were placed in the same locations as the previous ones. The mice were allowed to explore objects for 5 min. To avoid possible preferences for one of two objects, the choice of the new and old object and the position of the new one were randomized among animals. The amount of time spent exploring each object (nose sniffing and head orientation within <1.0 cm) was recorded and evaluated by the experimenter blind to the mouse genotype. Mice exploring the two objects for less than 10 s during the sample phase were excluded from testing. A discrimination index was computed as DI = (T new - T old )/(T new + T old ), where T new is the time spent exploring the new object, and T old is the time spent exploring the old one. Y maze Spontaneous alternation was measured using the Y-maze, as described in Begenisic et al. , 2014 . We used a Y-shaped maze with three symmetrical grey solid plastic arms at a 120-degree angle (26 cm length, 10 cm width, and 15 cm height). Mice were placed in the center of the maze and allowed to freely explore the maze for 8 minutes. The apparatus was cleaned with 10% ethanol between trials to avoid the build-up of odor traces. All sessions were video-recorded for offline blind analysis. The arm entry was defined as all four limbs within the arm. A triad was defined as a set of three arm entries, when each entry was to a different arm of the maze. The number of arm entries and the number of triads were recorded in order to calculate the alternation percentage (generated by dividing the number of triads by the number of possible alternations and then multiplying by 100). Morris water maze Mice were trained for four trials per day and for a total of 7 days in a circular water tank, made from grey polypropylene (diameter, 120 cm; height, 40 cm), filled to a depth of 25 cm with water (23°C) rendered opaque by the addition of a small amount of a non-toxic white paint. Four positions around the edge of the tank were arbitrarily designated North (N), South (S), East (E), and West (W), which provided four alternative start positions and also defined the division of the tank into four quadrants, i.e., NE, SE, SW, and NW. A square clear Perspex escape platform (11 × 11 cm) was submerged 0.5 cm below the water surface and placed at the midpoint of one of the four quadrants. The hidden platform remained in the same quadrant during training, while the start positions (N, S, E, or W) were randomized across trials. Mice were allowed up to 60 s to locate the escape platform, and their swimming paths were automatically recorded by the Noldus Ethovision system. On the last trial of the last training day, mice received a probe trial, during which the escape platform was removed from the tank and the swimming paths were recorded over 60 s while mice searched for the missing platform. The swimming paths were recorded and analyzed with the Noldus Ethovision system. Measurement of spontaneous locomotor activity OptoM3 multi-channel activity monitors (Columbus Instruments, OH, USA) were used to quantify spontaneous horizontal activity of animals. Monitors were placed in the colony area and testing was conducted in the same conditions of animal facility housing. All measurements were performed from 6:00 P.M. to 6:00 A.M. (dark phase) and to 6:00 A.M. to 6:00 P.M. (light phase), using animals maintained on a 12 hr light/dark cycle from 6:00 A.M. to 6:00 P.M. Individual mice were placed in 33 × 15 × 13-cm (length × width × height) clear plastic cages for 24h and total distance travelled was calculated from infrared beam breaks by determining activity at 1-min intervals. Horizontal activity was measured by the sequential breaking of infrared beams, 2.54 cm on center, in the horizontal plane of the x axis. Statistical analysis All statistical analyses were performed using SigmaStat Software. Differences between two groups were assessed with a two-tailed t test. The significance of factorial effects and differences among more than two groups were evaluated with ANOVA/RM ANOVA followed by Holm-Sidak test. Rank transformation was exploited for data not normally distributed. The level of significance was p < 0.05. Results CrT deletion leads to significant Cr reduction in brain and other tissues In order to determine the effectiveness of our approach for targeting CrT gene, the Cr levels were measured by GC/MS in various tissues. We observed a significant reduction of Cr in the brain (both cerebral cortex and hippocampus; Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.001), muscle (p < 0.001), heart (p < 0.001), kidney (p < 0.05) and serum (p < 0.001) of CrT −/y mice with respect to wild-type (WT) littermates (n = 4/tissue for each group; Table 1 ). In contrast, an increase of Cr levels (n = 5 for CrT −/y mice, n = 4 for WT mice; Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.05) and creatine/creatinine ratio was present in the urine of mutant (16.95 ± 1.46) with respect to WT animals (1.20 ± 0.17; t test, p < 0.001). To ensure that kidney Cr reduction was not due to impaired Cr biosynthesis, we measured kidney production of guanidinoacetic acid (GAA). No difference was observed between CrT –/y (9.76 ± 0.71 nmol/mg of protein) and CrT +/y mice (10.70 ± 0.63 nmol/mg of protein; t test, p = 0.359). Intriguingly, a moderate change in GAA levels was observed in some tissues ( Table 2 ) suggesting that Cr biosynthesis is affected by the dramatic Cr decrease caused by CrT deletion. Table 1. Depletion of Cr levels in CrT –/y mutant mice. Cr levels (mean ± SEM) in CrT –/y and CrT +/y animals (n = 4 per tissue for both groups, except n = 5 for urine measurement in CrT −/y mice). Cr levels have been measured by GC/MS. A reduction of Cr content was evident in the brain, muscle, heart, kidney and serum of mutant animals, while an increase of Cr levels was reported in urine (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method). * p < 0.05; *** p < 0.001. Tissue (nmol/mg protein) CrT -/y CrT +/y Cerebral cortex 13.61±1.06*** 76.36 ± 3.16 Hippocampus 14.14 ± 1.52*** 83.69 ± 4.37 Muscle 111.57 ± 21.27*** 310.20 ± 31.59 Heart 1.19 ± 0.27*** 89.92 ± 5.15 Kidney 1.59 ± 0.13* 9.60 ± 0.65 Serum (μmol/l) 44.53 ± 3.88*** 235.02 ± 22.48 Urine (μmol/l) 8680.42 ± 661.58* 3443.69 ± 239.97 Table 2. GAA levels in CrT –/y mutant and WT mice. GAA levels (mean ± SEM) in CrT –/y and CrT +/y animals (n = 4 per tissue for both groups, except n = 5 for urine measurement in CrT −/y mice). An increase of GAA levels was present in the brain, muscle and heart of mutant animals, while no difference was detected in kidney, serum and urine (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method). * p < 0.05; ** p < 0.01; *** p < 0.001. Tissue (nmol/mg protein) CrT -/y CrT +/y Cerebral cortex 0.114 ± 0.016*** 0.06 ± 0.003 Hippocampus 0.091 ± 0.007*** 0 Muscle 0.282 ± 0.068** 0.106 ± 0.006 Heart 0.060 ± 0.004*** 0.094 ± 0.010 Kidney 9.758 ± 0.712 NS 10.700 ± 0.627 Serum (μmol/l) 2.523 ± 0.105 NS 1.738 ± 0.119 Urine (μmol/l) 1114.298 ± 82.551 NS 841.043 ± 124.984 Reduced body weight growth in CrT –/y mice at two months of age The general appearance of CrT –/y mice was normal and no particular problems of breeding were observed. To evaluate the effects of CrT deletion on body weight, the mice with targeted disruption of CrT gene were weighed at P60, and compared with WT littermates. CrT −/y animals (n = 9) showed a significantly reduced body weight compared to CrT +/y animals (n = 9; t test, p < 0.01; Figure 2 ). Figure 2. Body weight is lower in CrT –/y animals at two months of age. At P60 the weight of CrT –/y mice was significantly reduced compared to CrT +/y animals (CrT –/y : 18.75 ± 0.78 g, CrT +/y : 22.77 ± 0.90 g; t test, p < 0.01). *, statistical significance. Error bars, s.e.m. Normal behavior of CrT –/y mice in the open field arena We first analyzed the general motor activity and anxiety-related behavior of CrT −/y (n = 9) and CrT +/y mice (n = 9) in the open field arena. Even though both groups of animals tended to avoid the center of the arena, remaining in the peripheral region for a significantly longer duration (Two Way ANOVA, post hoc Holm-Sidak method), the time spent by CrT −/y mutant mice in both the central and peripheral portion of the apparatus was not different from that recorded for WT animals (Two Way ANOVA, post hoc Holm-Sidak method, p = 0.725 and p = 0.922 respectively; Figure 3a, b, e ). No difference between CrT −/y and CrT +/y animals was present even in motion speed and total distance moved (t test, p = 0.807 and p = 0.736 respectively; Figure 3c, d ). Figure 3. Normal behavior of CrT mutant mice in the open field arena. ( a , b ) CrT –/y (n = 9) and CrT +/y mice (n = 9) spent a comparable amount of time in the center (CrT –/y : 75.16 ± 10.82 s, CrT +/y : 67.60 ± 18.11 s; a ) and in the peripheral region (CrT –/y : 524.41 ± 10.87 s, CrT +/y : 526.52 ± 18.45 s; b ) of the open field arena. A Two-Way ANOVA analysis shows no significant effect of genotype for both comparisons (p = 0.725 and p = 0.922, respectively). ( c ) Walking speed of animals during the exploration of open field arena. We found no significant difference (CrT –/y : 7.85 ± 0.43 cm/s, CrT +/y : 7.65 ± 0.71 cm/s; t test, p = 0.807). ( d ) The total distance moved in the open field arena did not differ between CrT mutants (4706.34 ± 258.75 cm) and WT animals (4535.28 ± 427.11 cm; t test, p = 0.736). ( e ) Representative examples of movement path during the open field session for a CrT –/y (left) and a CrT +/y mouse (right). Error bars, s.e.m. CrT –/y mice display declarative memory deficits in the object recognition test We assessed declarative memory abilities in the object recognition test (ORT) evaluating animal ability to discriminate a new versus a familiar object. During the sample phase ( Figure 4a ), all experimental groups equally explored the objects, with total exploration time of mutant mice (n = 8) very close to that recorded for the control group (n = 6; t test, p = 0.358). After a delay of 24h, the testing phase revealed that while CrT +/y mice displayed a clear preference toward the novel object spending a significantly longer time exploring it, an impaired performance was found in CrT –/y animals, which exhibited a significantly lower discrimination index than control animals (t test, p < 0.05, Figure 4b ). Figure 4. CrT deletion leads to cognitive deficits in object recognition memory. ( a ) On the left, a schematic representation of the sample condition in object recognition task. Histograms depict the performance of CrT –/y and CrT +y during the sample phase: no difference in the total exploration time of objects was detected between the experimental groups (CrT –/y : n = 8, exploration time = 56.91 ± 5.40 s; CrT +/y : n = 6, exploration time = 67.20 ± 10.23 s; t test, p = 0.358). ( b ) On the left, a schematic diagram of the test condition. Histograms display object discrimination indexes of CrT –/y and CrT +y during the testing phase: a significantly lower discrimination index was found in CrT –/y mice (0.261 ± 0.053) compared to CrT +y animals (0.448 ± 0.059; t test, p < 0.05). *, statistical significance. Error bars, s.e.m. Impaired spatial working memory in CrT –/y mice To evaluate whether CrT deletion may affect spatial working memory, we used the analysis of spontaneous alternation in the Y maze ( Figure 5a ). Animals of both groups equally explored all the three arms of the maze. Indeed, no effect of genotype was detected for either the number of entries in the single arms of the maze (designated A, B, C) or the total number of arm entries, indicating that the exploratory disposition of mutant animals (n = 9) was not altered compared to WT littermates (n = 9; Two-Way ANOVA, post hoc Holm-Sidak method, p = 0.640, p = 0.966, p = 0.252, p = 0.523 respectively, Figure 5b ). In contrast, CrT −/y mice showed a significantly smaller rate of spontaneous alternation with respect to WT controls (t test, p < 0.05, Figure 5c ). Figure 5. Impairment of Y-maze spontaneous alternation rate in CrT –/y mice. ( a ) Schematic diagram of the Y maze apparatus. ( b ) Histograms depict the mean number of entries in the single arms of the maze (A, B, C) and the total number of arm entries for the different experimental groups: animals of both groups equally explored all the three arms of the maze and general exploratory behavior of CrT –/y animals (n = 9; A: 15.22 ± 1.12, B: 14.22 ± 1.08, C: 12.22 ± 1.05, TOT: 41.67 ± 2.41) was totally comparable to that exhibited by WT littermates (n = 9; A: 14.00 ± 1.26, B: 14.11 ± 1.29, C: 15.22 ± 1.27, TOT: 43.33 ± 3.58; Two-Way ANOVA, post hoc Holm-Sidak method, p = 0.640, p = 0.966, p = 0.252, p = 0.523 respectively). ( c ) Alternation rate in the Y maze was significantly lower in CrT –/y mice (49.24 ± 3.20%) compared to that recorded for CrT +/y littermates (58.91 ± 2.99%; t test, p < 0.05). *, statistical significance. Error bars, s.e.m. CrT deletion impairs spatial learning and memory in mutant mice We further assessed spatial memory abilities in the Morris water maze (MWM) task, a cognitive paradigm which allows testing both spatial learning and memory. Since a main effect of genotype was found on mean swimming speed recorded all along the training phase (t test, p < 0.05; Figure 6a ), we analyzed path length, which is a quantity independent of swimming velocity. We found that the mean distance covered to locate the submerged platform on the last three days of training was longer in CrT –/y mice (n = 9) compared to CrT +/y littermates (n = 5; t test, p < 0.05; Figure 6b, c ). To measure the strength of spatial learning and to discriminate between spatial and non-spatial memory strategies we performed a probe trial in which the hidden platform was removed and the amount of time spent in the former region of the platform was measured. The probe test confirmed the spatial memory impairment of CrT –/y mice: CrT +/y animals spent significantly longer time in the quadrant where the platform was located during the previous learning days (NE*; Two-Way RM ANOVA, post hoc Holm-Sidak method, p < 0.05 for all comparisons); in contrast, CrT –/y mice showed no preference for the target quadrant, indicating that they did not remember the location of the hidden platform (Two-Way RM ANOVA, post hoc Holm-Sidak method; Figure 6d ). A statistically significant effect of genotype was detected in the time spent exploring the target quadrant (Two-Way RM ANOVA, post hoc Holm-Sidak method, p < 0.05; Figure 6d ). Figure 6. CrT deletion impairs spatial learning and memory in mutant mice. ( a ) Mean swimming speed measured all along the training phase for CrT –/y and CrT +/y animals: mutant mice (14.00 ± 0.53 cm/s) resulted to be slower swimmers with respect to control littermates (16.44 ± 0.60 cm/s; t test, p < 0.05). ( b , c ) Learning curves for CrT –/y (n = 9; blue) and CrT +/y mice (n = 5; grey) during the training phase. The histogram shows the mean swimming path covered to locate the submerged platform on the last three day of training for the two groups. A t-test analysis showed a statistical difference between CrT –/y (285.24 ± 37.53 cm) and CrT +/y animals (171.58 ± 23.80 cm; p < 0.05). ( d ) Probe trial. A Two-Way RM ANOVA followed by Holm-Sidak multiple comparison revealed that while CrT +/y spent significantly more time in the NE quadrant than in the other ones, CrT –/y did not show any preference for the target quadrant. In addition, the percentage of time spent in the target quadrant was shorter in CrT –/y mice (30.31 ± 5.33%) than in the other group (45.73 ± 7.35%). ( e ) Representative examples of swimming path during the probe session for a CrT –/y (left) and a CrT +/y mouse (right). *, statistical significance. Error bars, s.e.m. Cr depletion reduces spontaneous locomotor activity in CrT −/y mice To investigate the presence of movement impairments in CrT −/y mice in a non-aversive environment, we investigated home-cage-locomotor activity. We found that CrT –/y mice (n = 9) are significantly less active than the CrT +/y group (n = 8, Two-Way ANOVA, post hoc Holm-Sidak method, p < 0.001). More specifically, CrT −/y mice showed decreased horizontal activity during the night period (Two-Way ANOVA, post hoc Holm-Sidak method, p < 0.001), while no effect of genotype was observed for exploration during daytime (p = 0.535; Figure 7a, b ). Figure 7. Locomotor activity in CrT –/y mutant mice and the wild-type parental strain. ( a ) Total horizontal distance travelled throughout 24h (left), and over the dark (middle) or light phase (right). CrT –/y mice had a significant decrease in motor activity in comparison to control animals during the whole period of testing (CrT –/y : 43,594.22 ± 2,639.39 beam crossings, CrT +/y : 65,587.63 ± 5,831.19 beam crossings) and the night phase (CrT –/y : 29,109.67 ± 1,695.35 beam crossings, CrT +/y : 48,094.13 ± 4,843.56 beam crossings; Two-Way ANOVA, post hoc Holm-Sidak method, p < 0.001 for both comparisons), while the motor behavior of the two groups was similar in the day-time (CrT –/y : 14,484.56 ± 1,458.08 beam crossings, CrT +/y : 17,493.50 ± 2,957.57 beam crossings; p = 0.535). ( b ) Time course of horizontal activity of CrT –/y (blue) and CrT +/y (grey) animals during 24h. Data are plotted as total number of beam crossings ± SEM in each time block of 60 min. Dark and light phases are indicated. *, statistical significance. Error bars, s.e.m. Dataset 1. Complete data for neurochemical and behavioral assessment in a mouse model of creatine transporter deficiency. Detailed descriptions of each dataset can be found in the text file provided. Discussion We have generated a new murine model of human CrT deficiency carrying a loss of function deletion of 5–7 exons in the murine orthologous of Slc68a gene. Given that most disease-underlying mutations in human CCDS1 lead to loss of CrT function ( van de Kamp et al. , 2014 ), our model has a good degree of construct validity. Beyond the genetic deletion, neurochemical abnormalities found in CrT −/y mice, reproducing the reduced levels of Cr that characterize the brain of CCDS1 patients ( van de Kamp et al. , 2012 ), are also helpful to confirm the successful disruption of CrT gene and the construct robustness of this model. Importantly, Cr deficiency is apparent in both the cerebral cortex and hippocampus, i.e., two brain regions crucially involved in the patient cognitive defects. These results seem to support the hypothesis that, despite AGAT and GAMT expression ( Carducci et al. , 2012 ; Schmidt et al. , 2004 ; Tachikawa et al. , 2004 ), in CrT deficiency conditions endogenous synthesis does not compensate for the loss of Cr uptake in the mouse ( Skelton et al. , 2011 ) as well as in the human brain ( Cecil et al. , 2001 ). In contrast to the preservation of Cr levels in skeletal muscle of CCDS1 patients ( deGrauw et al. , 2003 ), we observed that mutant mice exhibit Cr reductions in muscle and other peripheral tissues and body fluids. This observation, which is in agreement with data from a different CrT knockout mouse ( Russell et al. , 2014 ; Skelton et al. , 2011 ), further confirmed that the recombination resulted in a ubiquitous disruption of the CrT gene. In particular, the reduction of serum Cr level may be explained by defective gut absorption from the diet ( Garcia-Miranda et al. , 2009 ; Skelton et al. , 2011 ). The only body fluid in which Cr levels resulted to be increased is urine; it is likely that the lack of a functional transporter impairs the creatine salvage normally operated by the kidney ( van de Kamp et al. , 2014 ). Consistently, we found an elevated creatine/creatinine (Cr/Crn) ratio in the urine of mutant mice, probably due to a combination of reduced renal reabsorption of creatine and decreased creatinine excretion. Our behavioral investigation highlighted that CrT −/y mice carrying a different deletion than previously reported ( Skelton et al. , 2011 ) exhibit a broad spectrum of phenotypes establishing the validity of this model and corroborating its utility in translational studies. Mutant mice, indeed, show cognitive impairments in a battery of learning and memory tests aimed at assessing both explicit and implicit memories such as object-recognition task, Y maze and Morris water maze. The memory deficiency assessed across a variety of behavioral tasks indicates that CrT −/y animals have a general cognitive impairment, which is a key clinical feature in CCDS1 patients. While the motor development is only mildly delayed in CCDS1 patients ( van de Kamp et al. , 2013 ) and myopathic symptoms have been rarely described ( Anselm et al. , 2006 ; van de Kamp et al. , 2013 ), mostly as late onset deficits ( deGrauw et al. , 2002 ; Hahn et al. , 2002 ; Kleefstra et al. , 2005 ), we found that reduced muscle levels of Cr measured in mutant animals were accompanied by alterations of motor behavior. CrT −/y mice, indeed, showed significantly decreased home-cage-locomotor activity (particularly evident during the night period) and they were slower swimmers than CrT +/y mice. In contrast, we found that vulnerability to stress and anxiety responses are not sensitive to CrT deletion. The lack of a genotype effect for the motor behavior in the open field test may be due to the aversive nature of the arena, which may affect the explorative aptitude of both wild-type and mutant mice, thus masking the difference in motor activity between the two groups. It is worth noting that our data allow to exclude the possibility that an impaired motor activity can interfere with the animals’ cognitive performance. Indeed, in the ORT sample phase and the Y maze test the total exploration of objects and/or arena was equal for mutant and control mice, while for the Morris water maze we analyzed the path length covered to locate the submerged platform avoiding the confounding effects of the reduced swimming speed of mutant mice. Future studies using conditional mouse models with a disruption of CrT allele only in the brain tissue will be useful to dissect the role of peripheral Cr in the development of cognitive deficits. It has been reported that a CrT deletion exclusively restricted to forebrain excitatory neurons during late postnatal development induces selective learning and memory deficits without affecting motor behavior ( Kurosawa et al. , 2012 ). Because of the importance of Cr in normal retinal function and development ( Acosta et al. , 2005 ), it has been suggested that an alteration of visual capabilities might play a role in the cognitive deficits displayed by CrT −/y animals. We reported that during the ORT sample phase all experimental groups equally explored and observed the objects, with the total exploration time of mutant mice very close to that recorded for the control group, suggesting that no major impairment is present in the visual system of CrT –/y animals. In addition, to avoid possible confounding effects due to reduced visual acuity, the tank used in the Morris water maze task was surrounded by a set of extra-maze cues in a visual discrimination range detectable even by partially-sighted animals. In conclusion, this CrT −/y murine model will provide a new tool for improving preclinical evaluation of potential CCDS1 intervention treatments. The results confirm previous data suggesting that CCDS1 can be well modeled in mice ( Kurosawa et al. , 2012 ; Skelton et al. , 2011 ). Null mice display an impairment of motor behavior rarely present in human patients; however, the use of conditional mice will avoid this problem. Since CCDS1 is still an untreatable pathology, there is a compelling need for developing effective therapeutic strategies. The availability of murine models that reliably reproduce the human condition will fuel and support the research in this field. To assess the reproducibility and the predictive validity of promising treatments for CCDS1 as well as for other disorders, the validation of findings in more than one animal model is strongly desirable prior to launching later-stage translational or clinical projects ( Katz et al. , 2012 ). Since another invalidating hallmark of CCDS1 is the frequent occurrence of seizures, additional studies in CrT −/y mice analyzing the behavioral response to kainic-acid injection will be required to provide useful information about seizure susceptibility in this model. Data availability F1000Research : Dataset 1. Complete data for neurochemical and behavioral assessment in a mouse model of creatine transporter deficiency., 10.5256/f1000research.5369.d42180 ( Baroncelli et al. , 2015 ). Author contributions GC, VL and TP conceived the study. TP and LB designed the experiments. LB, MGA, JT, EP and MM carried out the research. EA, FZ and CG produced and provided the mouse model. LB and TP wrote the manuscript. All authors were involved in the revision of the draft manuscript and have agreed to the final content. Competing interests No competing interests were disclosed. Grant information Work was supported by the International Foundation for CDKL5 Research (E.A.), and EMBL (E.A., F.Z., C.G.). Production and housing of transgenic mice was supported by the EMBL Transgenic Services and Mouse Facilities under the guidance of Pedro Moreira and Maria Kamber, respectively. Faculty Opinions recommended References Acosta ML, Kalloniatis M, Christie DL: Creatine transporter localization in developing and adult retina: importance of creatine to retinal function. Am J Physiol Cell Physiol. 2005; 289 (4): C1015–1023. PubMed Abstract | Publisher Full Text Alessandri MG, Celati L, Battini R, et al. : Gas chromatography/mass spectrometry assay for arginine: glycine-amidinotransferase deficiency. Anal Biochem. 2005; 343 (2): 356–358. PubMed Abstract | Publisher Full Text Anselm IA, Alkuraya FS, Salomons GS, et al. : X-linked creatine transporter defect: a report on two unrelated boys with a severe clinical phenotype. J Inherit Metab Dis. 2006; 29 (1): 214–219. PubMed Abstract | Publisher Full Text | Free Full Text Baroncelli L, Alessandrì MG, Tola J, et al. : Dataset 1. Complete data for neurochemical and behavioral assessment in a mouse model of creatine transporter deficiency. F1000Research. 2015. Data Source Battini R, Leuzzi V, Carducci C, et al. : Creatine depletion in a new case with AGAT deficiency: clinical and genetic study in a large pedigree. Mol Genet Metab. 2002; 77 (4): 326–331. PubMed Abstract | Publisher Full Text Begenisic T, Baroncelli L, Sansevero G, et al. : Fluoxetine in adulthood normalizes GABA release and rescues hippocampal synaptic plasticity and spatial memory in a mouse model of Down syndrome. Neurobiol Dis. 2014; 63 : 12–19. PubMed Abstract | Publisher Full Text Carducci C, Carducci C, Santagata S, et al. : In vitro study of uptake and synthesis of creatine and its precursors by cerebellar granule cells and astrocytes suggests some hypotheses on the physiopathology of the inherited disorders of creatine metabolism. BMC Neurosci. 2012; 13 : 41. PubMed Abstract | Publisher Full Text | Free Full Text Cecil KM, Salomons GS, Ball WS Jr, et al. : Irreversible brain creatine deficiency with elevated serum and urine creatine: a creatine transporter defect? Ann Neurol. 2001; 49 (3): 401–404. PubMed Abstract | Publisher Full Text Chilosi A, Leuzzi V, Battini R, et al. : Treatment with L-arginine improves neuropsychological disorders in a child with creatine transporter defect. Neurocase. 2008; 14 (2): 151–161. PubMed Abstract | Publisher Full Text deGrauw TJ, Cecil KM, Byars AW, et al. : The clinical syndrome of creatine transporter deficiency. Mol Cell Biochem. 2003; 244 (1–2): 45–48. PubMed Abstract | Publisher Full Text deGrauw TJ, Salomons GS, Cecil KM, et al. : Congenital creatine transporter deficiency. Neuropediatrics. 2002; 33 (5): 232–238. PubMed Abstract | Publisher Full Text Farley FW, Soriano P, Steffen LS, et al. : Widespread recombinase expression using FLPeR (flipper) mice. Genesis. 2000; 28 (3–4): 106–110. PubMed Abstract | <a target="xrefwindow" id="d2295152e1955" href="https://doi.org/10.1002/1526-968X(200011/12)28:3/4 Publisher Full Text Fons C, Arias A, Sempere A, et al. : Response to creatine analogs in fibroblasts and patients with creatine transporter deficiency. Mol Genet Metab. 2010; 99 (3): 296–299. PubMed Abstract | Publisher Full Text Garcia-Miranda P, Garcia-Delgado M, Peral MJ, et al. : Ontogeny regulates creatine metabolism in rat small and large intestine. J Physiol Pharmacol. 2009; 60 (3): 127–33. PubMed Abstract Hahn KA, Salomons GS, Tackels-Horne D, et al. : X-linked mental retardation with seizures and carrier manifestations is caused by a mutation in the creatine-transporter gene ( SLC6A8 ) located in Xq28. Am J Hum Genet. 2002; 70 (5): 1349–1356. PubMed Abstract | Publisher Full Text | Free Full Text Item CB, Stockler-Ipsiroglu S, Stromberger C, et al. : Arginine:glycine amidinotransferase deficiency: the third inborn error of creatine metabolism in humans. Am J Hum Genet. 2001; 69 (5): 1127–1133. PubMed Abstract | Publisher Full Text | Free Full Text Katz DM, Berger-Sweeney JE, Eubanks JH, et al. : Preclinical research in Rett syndrome: setting the foundation for translational success. Dis Model Mech. 2012; 5 (6): 733–745. PubMed Abstract | Publisher Full Text | Free Full Text Kleefstra T, Rosenberg EH, Salomons GS, et al. : Progressive intestinal, neurological and psychiatric problems in two adult males with cerebral creatine deficiency caused by an SLC6A8 mutation. Clin Genet. 2005; 68 (4): 379–381. PubMed Abstract | Publisher Full Text Kurosawa Y, Degrauw TJ, Lindquist DM, et al. : Cyclocreatine treatment improves cognition in mice with creatine transporter deficiency. J Clin Invest. 2012; 122 (8): 2837–2846. PubMed Abstract | Publisher Full Text | Free Full Text Lonetti G, Angelucci A, Morando L, et al. : Early environmental enrichment moderates the behavioral and synaptic phenotype of MeCP2 null mice. Biol Psychiatry. 2010; 67 (7): 657–665. PubMed Abstract | Publisher Full Text Lowe MT, Faull RL, Christie DL, et al. : Distribution of the creatine transporter throughout the human brain reveals a spectrum of creatine transporter immunoreactivity. J Comp Neurol. 2014. PubMed Abstract | Publisher Full Text Lowry OH, Rosebrough NJ, Farr AL, et al. : Protein measurement with the Folin phenol reagent. J Biol Chem. 1951; 193 (1): 265–275. PubMed Abstract Mak CS, Waldvogel HJ, Dodd JR, et al. : Immunohistochemical localisation of the creatine transporter in the rat brain. Neuroscience. 2009; 163 (2): 571–585. PubMed Abstract | Publisher Full Text Nash SR, Giros B, Kingsmore SF, et al. : Cloning, pharmacological characterization, and genomic localization of the human creatine transporter. Receptors Channels. 1994; 2 (2): 165–174. PubMed Abstract Russell AP, Ghobrial L, Wright CR, et al. : Creatine transporter (SLC6A8) knockout mice display an increased capacity for in vitro creatine biosynthesis in skeletal muscle. Front Physiol. 2014; 5 : 314. PubMed Abstract | Publisher Full Text | Free Full Text Schmidt A, Marescau B, Boehm EA, et al. : Severely altered guanidino compound levels, disturbed body weight homeostasis and impaired fertility in a mouse model of guanidinoacetate N-methyltransferase (GAMT) deficiency. Hum Mol Genet. 2004; 13 (9): 905–921. PubMed Abstract | Publisher Full Text Schulze A, Ebinger F, Rating D, et al. : Improving treatment of guanidinoacetate methyltransferase deficiency: reduction of guanidinoacetic acid in body fluids by arginine restriction and ornithine supplementation. Mol Genet Metab. 2001; 74 (4): 413–419. PubMed Abstract | Publisher Full Text Skelton MR, Schaefer TL, Graham DL, et al. : Creatine transporter (CrT; Slc6a8) knockout mice as a model of human CrT deficiency. PLoS One. 2011; 6 (1): e16187. PubMed Abstract | Publisher Full Text | Free Full Text Stockler S, Hanefeld F, Frahm J: Creatine replacement therapy in guanidinoacetate methyltransferase deficiency, a novel inborn error of metabolism. Lancet. 1996; 348 (9030): 789–790. PubMed Abstract | Publisher Full Text Stockler S, Holzbach U, Hanefeld F, et al. : Creatine deficiency in the brain: a new treatable inborn error of metabolism. Pediatr Res. 1994; 36 (3): 409–413. PubMed Abstract | Publisher Full Text Tachikawa M, Fukaya M, Terasaki T, et al. : Distinct cellular expressions of creatine synthetic enzyme GAMT and creatine kinases uCK-Mi and CK-B suggest a novel neuron-glial relationship for brain energy homeostasis. Eur J Neurosci. 2004; 20 (1): 144–160. PubMed Abstract | Publisher Full Text Tang SH, Silva FJ, Tsark WM, et al. : A Cre/loxP-deleter transgenic line in mouse strain 129S1/SvImJ. Genesis. 2002; 32 (3): 199–202. PubMed Abstract | Publisher Full Text Valayannopoulos V, Boddaert N, Chabli A, et al. : Treatment by oral creatine, L-arginine and L-glycine in six severely affected patients with creatine transporter defect. J Inherit Metab Dis. 2012; 35 (1): 151–157. PubMed Abstract | Publisher Full Text van de Kamp JM, Mancini GM, Salomons GS: X-linked creatine transporter deficiency: clinical aspects and pathophysiology. J Inherit Metab Dis. 2014; 37 (5): 715–733. PubMed Abstract | Publisher Full Text van de Kamp JM, Pouwels PJ, Aarsen FK, et al. : Long-term follow-up and treatment in nine boys with X-linked creatine transporter defect. J Inherit Metab Dis. 2012; 35 (1): 141–149. PubMed Abstract | Publisher Full Text | Free Full Text van de Kamp JM, Betsalel OT, Mercimek-Mahmutoglu S, et al. : Phenotype and genotype in 101 males with X-linked creatine transporter deficiency. J Med Genet. 2013; 50 (7): 463–472. PubMed Abstract | Publisher Full Text Wyss M, Kaddurah-Daouk R: Creatine and creatinine metabolism. Physiol Rev. 2000; 80 (3): 1107–1213. PubMed Abstract Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 29 Sep 2014 ADD YOUR COMMENT Comment Author details Author details 1 Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 2 Department of Developmental Neuroscience, IRCCS Stella Maris Scientific Institute, Calambrone (Pisa), I-56128, Italy 3 Mouse Biology Unit, European Molecular Biology Laboratory (EMBL), Monterotondo (Roma), I-00015, Italy 4 Department of Paediatrics, Child Neurology and Psychiatry, Sapienza University of Rome, Rome, I-00185, Italy 5 Department of Clinical and Experimental Medicine, University of Pisa, Pisa, I-56126, Italy 6 Department of Neuroscience, Psychology, Drug Research and Child Health NEUROFARBA, University of Florence, Florence, I-50135, Italy Competing interests No competing interests were disclosed. Grant information The author(s) declared that no grants were involved in supporting this work. Article Versions (2) version 2 Revised Published: 22 Jan 2015, 3:228 https://doi.org/10.12688/f1000research.5369.2 version 1 Published: 29 Sep 2014, 3:228 https://doi.org/10.12688/f1000research.5369.1 Copyright © 2015 Baroncelli L et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Baroncelli L, Alessandrì MG, Tola J et al. A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.12688/f1000research.5369.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 22 Jan 2015 Revised Views 0 Cite How to cite this report: Valor LM. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7423 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7423 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 04 Feb 2015 Luis M. Valor , Instituto de Neurociencias de Alicante (Universidad Miguel Hernández - Consejo Superior de Investigaciones Científicas), Alicante, Spain Approved VIEWS 0 https://doi.org/10.5256/f1000research.6455.r7423 I do not ... Continue reading READ ALL I do not have additional comments. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Valor LM. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7423 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7423 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Sacchetti B. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7422 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7422 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 03 Feb 2015 Benedetto Sacchetti , Department of Neuroscience, University of Turin, Turin, Italy Approved VIEWS 0 https://doi.org/10.5256/f1000research.6455.r7422 The authors have ... Continue reading READ ALL The authors have addressed all my concerns. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Sacchetti B. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7422 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7422 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Schulze A. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7421 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7421 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 26 Jan 2015 Andreas Schulze , Division of Clinical and Metabolic Genetics, Department of Pediatrics, University of Toronto, Toronto, ON, Canada Approved VIEWS 0 https://doi.org/10.5256/f1000research.6455.r7421 The authors have addressed all of my concerns to my full satisfaction. I apologize ... Continue reading READ ALL The authors have addressed all of my concerns to my full satisfaction. I apologize for misinterpreting the results of the novel object recognition test in the Skeleton paper. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Schulze A. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7421 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7421 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 29 Sep 2014 Views 0 Cite How to cite this report: Schulze A. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6559 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6559 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 11 Nov 2014 Andreas Schulze , Division of Clinical and Metabolic Genetics, Department of Pediatrics, University of Toronto, Toronto, ON, Canada Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.5732.r6559 The research group generated a new ubiquitous CrT knockout as mouse model for creatine transporter deficiency with a large 3 exon deletion in the Slc6a8 gene. Biochemical phenotyping revealed creatine deficiency in brain, muscle, heart, and kidneys and behavioral testing ... Continue reading READ ALL The research group generated a new ubiquitous CrT knockout as mouse model for creatine transporter deficiency with a large 3 exon deletion in the Slc6a8 gene. Biochemical phenotyping revealed creatine deficiency in brain, muscle, heart, and kidneys and behavioral testing revealed a phenotypic similarities with CrT patients. Therefore the new mouse model appears to be a valid tool to study creatine transporter deficiency. What needs some more elaboration is the discrepancy in findings compared to the mouse model described by Skelton et al. ( 2011) . Considering the similarities of the knock-outs, both have a large deletion of three exons, on would expect similar findings. But in the knock-out presented here there is more cognitive impairment, i.e. novel object recognition was abnormal while it was normal in the Skelton paper, and this is despite of the fact that the brain creatine deficiency reported here appears to be less pronounced than in the mouse model of Skelton et al . Before indexing the authors should provide information on whether the mouse chow contained creatine (some mouse chow contains fish meal and the latter contains creatine). Also it would be important to know the creatine concentration in plasma. The creatine concentration in mutants is expected to be higher than in wild types. I wonder whether blood contamination has contributed to unexpected high brain creatine concentration in mutants. Why did the group not consider whole-body perfusion prior to organ removal? Did the authors measure creatine/creatinine ratios in urine? And why not providing the information on guanidinoacetate in organs and body fluids as well? Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Schulze A. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6559 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6559 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Reader Comment 16 Dec 2014 Skelton Lab 16 Dec 2014 Reader Comment Dr. Schulze, I would like to respectfully clarify an error in your review. Our ubiquitous CrT mice did indeed show deficits in object recognition memory, as shown in figure 6 of ... Continue reading Dr. Schulze, I would like to respectfully clarify an error in your review. Our ubiquitous CrT mice did indeed show deficits in object recognition memory, as shown in figure 6 of our PLOS One paper . In fact, the object recognition deficit was similar to the deficit presented in this paper. Best Regards, Matthew R. Skelton, Ph.D. Cincinnati Children's Research Foundation [email protected] Dr. Schulze, I would like to respectfully clarify an error in your review. Our ubiquitous CrT mice did indeed show deficits in object recognition memory, as shown in figure 6 of our PLOS One paper . In fact, the object recognition deficit was similar to the deficit presented in this paper. Best Regards, Matthew R. Skelton, Ph.D. Cincinnati Children's Research Foundation [email protected] Competing Interests: We developed the first CrT KO mice. Close Report a concern Author Response 22 Jan 2015 Laura Baroncelli , Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 22 Jan 2015 Author Response As already clarified by Dr. Skelton, our behavioral findings are not at odds with those reported in his PLOS ONE paper: indeed, their knockout mice show a deficit in object ... Continue reading As already clarified by Dr. Skelton, our behavioral findings are not at odds with those reported in his PLOS ONE paper: indeed, their knockout mice show a deficit in object recognition memory very similar to that measured in our model. The difference in the extent of creatine deficiency is explained by the different methods employed to measure this metabolite: in our study creatine was analyzed using gas chromatography/mass spectrometry, a widely accepted specific and sensitive technique, whereas Skelton et al. (2011) used a less sensitive colorimetric method. As regards the mouse chow, the manufacturer told us that the pellet purchased for our animal facility is not added with creatine. We made this point clearer, adding a sentence in the Materials and methods section (Animal housing subsection). We followed your suggestion and measured creatine concentration also in body fluids, and more specifically in serum and urine. We observed a significant reduction of Cr in the serum of CrT −/y mice with respect to wild-type (WT) littermates (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.001). In contrast, an increase of Cr levels (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.05) and creatine/ creatinine ratio was present in the urine of mutant with respect to WT animals (t test, p < 0.001). We added these data in the Result section and in Table 1. We also modified the discussion adding the following sentences: “In contrast to the preservation of Cr levels in skeletal muscle of CCDS1 patients ( deGrauw et al., 2003 ), we observed that mutant mice exhibit Cr reductions in muscle and other peripheral tissues and body fluids. This observation, which is in agreement with data from a different CrT knockout mouse ( Russell et al. , 2014 ; Skelton et al ., 2011), further confirmed that the recombination resulted in a ubiquitous disruption of the CrT gene. In particular, the reduction of serum Cr level may be explained by defective gut absorption from the diet ( Garcia-Miranda et al. , 2009 ; Skelton et al. , 2011). The only body fluid in which Cr levels resulted to be increased is urine; it is likely that the lack of a functional transporter impairs the creatine salvage normally operated by the kidney ( van de Kamp et al. , 2014 ). Consistently, we found an elevated creatine/creatinine (Cr/Crn) ratio in the urine of mutant mice, probably due to a combination of reduced renal reabsorption of creatine and decreased creatinine excretion.” Since we found a strong reduction of creatine concentration, we don’t think that blood contamination could be responsible for higher brain Cr levels in these mice. Finally, we provided the information on GAA content in organs and body fluids, adding a Table 2 to the manuscript. As already clarified by Dr. Skelton, our behavioral findings are not at odds with those reported in his PLOS ONE paper: indeed, their knockout mice show a deficit in object recognition memory very similar to that measured in our model. The difference in the extent of creatine deficiency is explained by the different methods employed to measure this metabolite: in our study creatine was analyzed using gas chromatography/mass spectrometry, a widely accepted specific and sensitive technique, whereas Skelton et al. (2011) used a less sensitive colorimetric method. As regards the mouse chow, the manufacturer told us that the pellet purchased for our animal facility is not added with creatine. We made this point clearer, adding a sentence in the Materials and methods section (Animal housing subsection). We followed your suggestion and measured creatine concentration also in body fluids, and more specifically in serum and urine. We observed a significant reduction of Cr in the serum of CrT −/y mice with respect to wild-type (WT) littermates (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.001). In contrast, an increase of Cr levels (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.05) and creatine/ creatinine ratio was present in the urine of mutant with respect to WT animals (t test, p < 0.001). We added these data in the Result section and in Table 1. We also modified the discussion adding the following sentences: “In contrast to the preservation of Cr levels in skeletal muscle of CCDS1 patients ( deGrauw et al., 2003 ), we observed that mutant mice exhibit Cr reductions in muscle and other peripheral tissues and body fluids. This observation, which is in agreement with data from a different CrT knockout mouse ( Russell et al. , 2014 ; Skelton et al ., 2011), further confirmed that the recombination resulted in a ubiquitous disruption of the CrT gene. In particular, the reduction of serum Cr level may be explained by defective gut absorption from the diet ( Garcia-Miranda et al. , 2009 ; Skelton et al. , 2011). The only body fluid in which Cr levels resulted to be increased is urine; it is likely that the lack of a functional transporter impairs the creatine salvage normally operated by the kidney ( van de Kamp et al. , 2014 ). Consistently, we found an elevated creatine/creatinine (Cr/Crn) ratio in the urine of mutant mice, probably due to a combination of reduced renal reabsorption of creatine and decreased creatinine excretion.” Since we found a strong reduction of creatine concentration, we don’t think that blood contamination could be responsible for higher brain Cr levels in these mice. Finally, we provided the information on GAA content in organs and body fluids, adding a Table 2 to the manuscript. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Reader Comment 16 Dec 2014 Skelton Lab 16 Dec 2014 Reader Comment Dr. Schulze, I would like to respectfully clarify an error in your review. Our ubiquitous CrT mice did indeed show deficits in object recognition memory, as shown in figure 6 of ... Continue reading Dr. Schulze, I would like to respectfully clarify an error in your review. Our ubiquitous CrT mice did indeed show deficits in object recognition memory, as shown in figure 6 of our PLOS One paper . In fact, the object recognition deficit was similar to the deficit presented in this paper. Best Regards, Matthew R. Skelton, Ph.D. Cincinnati Children's Research Foundation [email protected] Dr. Schulze, I would like to respectfully clarify an error in your review. Our ubiquitous CrT mice did indeed show deficits in object recognition memory, as shown in figure 6 of our PLOS One paper . In fact, the object recognition deficit was similar to the deficit presented in this paper. Best Regards, Matthew R. Skelton, Ph.D. Cincinnati Children's Research Foundation [email protected] Competing Interests: We developed the first CrT KO mice. Close Report a concern Author Response 22 Jan 2015 Laura Baroncelli , Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 22 Jan 2015 Author Response As already clarified by Dr. Skelton, our behavioral findings are not at odds with those reported in his PLOS ONE paper: indeed, their knockout mice show a deficit in object ... Continue reading As already clarified by Dr. Skelton, our behavioral findings are not at odds with those reported in his PLOS ONE paper: indeed, their knockout mice show a deficit in object recognition memory very similar to that measured in our model. The difference in the extent of creatine deficiency is explained by the different methods employed to measure this metabolite: in our study creatine was analyzed using gas chromatography/mass spectrometry, a widely accepted specific and sensitive technique, whereas Skelton et al. (2011) used a less sensitive colorimetric method. As regards the mouse chow, the manufacturer told us that the pellet purchased for our animal facility is not added with creatine. We made this point clearer, adding a sentence in the Materials and methods section (Animal housing subsection). We followed your suggestion and measured creatine concentration also in body fluids, and more specifically in serum and urine. We observed a significant reduction of Cr in the serum of CrT −/y mice with respect to wild-type (WT) littermates (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.001). In contrast, an increase of Cr levels (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.05) and creatine/ creatinine ratio was present in the urine of mutant with respect to WT animals (t test, p < 0.001). We added these data in the Result section and in Table 1. We also modified the discussion adding the following sentences: “In contrast to the preservation of Cr levels in skeletal muscle of CCDS1 patients ( deGrauw et al., 2003 ), we observed that mutant mice exhibit Cr reductions in muscle and other peripheral tissues and body fluids. This observation, which is in agreement with data from a different CrT knockout mouse ( Russell et al. , 2014 ; Skelton et al ., 2011), further confirmed that the recombination resulted in a ubiquitous disruption of the CrT gene. In particular, the reduction of serum Cr level may be explained by defective gut absorption from the diet ( Garcia-Miranda et al. , 2009 ; Skelton et al. , 2011). The only body fluid in which Cr levels resulted to be increased is urine; it is likely that the lack of a functional transporter impairs the creatine salvage normally operated by the kidney ( van de Kamp et al. , 2014 ). Consistently, we found an elevated creatine/creatinine (Cr/Crn) ratio in the urine of mutant mice, probably due to a combination of reduced renal reabsorption of creatine and decreased creatinine excretion.” Since we found a strong reduction of creatine concentration, we don’t think that blood contamination could be responsible for higher brain Cr levels in these mice. Finally, we provided the information on GAA content in organs and body fluids, adding a Table 2 to the manuscript. As already clarified by Dr. Skelton, our behavioral findings are not at odds with those reported in his PLOS ONE paper: indeed, their knockout mice show a deficit in object recognition memory very similar to that measured in our model. The difference in the extent of creatine deficiency is explained by the different methods employed to measure this metabolite: in our study creatine was analyzed using gas chromatography/mass spectrometry, a widely accepted specific and sensitive technique, whereas Skelton et al. (2011) used a less sensitive colorimetric method. As regards the mouse chow, the manufacturer told us that the pellet purchased for our animal facility is not added with creatine. We made this point clearer, adding a sentence in the Materials and methods section (Animal housing subsection). We followed your suggestion and measured creatine concentration also in body fluids, and more specifically in serum and urine. We observed a significant reduction of Cr in the serum of CrT −/y mice with respect to wild-type (WT) littermates (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.001). In contrast, an increase of Cr levels (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.05) and creatine/ creatinine ratio was present in the urine of mutant with respect to WT animals (t test, p < 0.001). We added these data in the Result section and in Table 1. We also modified the discussion adding the following sentences: “In contrast to the preservation of Cr levels in skeletal muscle of CCDS1 patients ( deGrauw et al., 2003 ), we observed that mutant mice exhibit Cr reductions in muscle and other peripheral tissues and body fluids. This observation, which is in agreement with data from a different CrT knockout mouse ( Russell et al. , 2014 ; Skelton et al ., 2011), further confirmed that the recombination resulted in a ubiquitous disruption of the CrT gene. In particular, the reduction of serum Cr level may be explained by defective gut absorption from the diet ( Garcia-Miranda et al. , 2009 ; Skelton et al. , 2011). The only body fluid in which Cr levels resulted to be increased is urine; it is likely that the lack of a functional transporter impairs the creatine salvage normally operated by the kidney ( van de Kamp et al. , 2014 ). Consistently, we found an elevated creatine/creatinine (Cr/Crn) ratio in the urine of mutant mice, probably due to a combination of reduced renal reabsorption of creatine and decreased creatinine excretion.” Since we found a strong reduction of creatine concentration, we don’t think that blood contamination could be responsible for higher brain Cr levels in these mice. Finally, we provided the information on GAA content in organs and body fluids, adding a Table 2 to the manuscript. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Valor LM. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6560 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6560 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 05 Nov 2014 Luis M. Valor , Instituto de Neurociencias de Alicante (Universidad Miguel Hernández - Consejo Superior de Investigaciones Científicas), Alicante, Spain Approved VIEWS 0 https://doi.org/10.5256/f1000research.5732.r6560 In “A novel mouse of creatine transporter deficiency” the authors describe the phenotype of a new knockout mouse for Slc6a8 gene which is associated with a depletion in the levels of creatine in diverse organs. This phenotype is reminiscent of ... Continue reading READ ALL In “A novel mouse of creatine transporter deficiency” the authors describe the phenotype of a new knockout mouse for Slc6a8 gene which is associated with a depletion in the levels of creatine in diverse organs. This phenotype is reminiscent of the CCDS1 symptomatology, therefore the main output of the present report is an increase in the number of available murine models for this disorder as claimed in the article. The paper is well written and the work is well presented, with no major concerns regarding the data as shown. Nonetheless, I miss a more complete behavioural analysis. In some cases this is not crucial because assessment of particular tasks is expected to support current findings (absence of anxiety in the open field or impaired spatial working memory in the Y-maze) although with the strength of using more dedicated paradigms (elevated plus maze or T-maze based on a rewarding system, respectively). However, it is more relevant in the case of motor and neuromuscular deficits to enhance the conclusions obtained from spontaneous activity measurements, and other approaches (accelerating rotarod, grip strength, vertical pole, etc. to put some examples) may be more informative. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Valor LM. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6560 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6560 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 22 Jan 2015 Laura Baroncelli , Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 22 Jan 2015 Author Response We agree that a more detailed behavioral analysis (in particular dedicated to the understanding of motor and neuromuscolar deficits) would be informative for the characterization of CCDS1 murine models. We ... Continue reading We agree that a more detailed behavioral analysis (in particular dedicated to the understanding of motor and neuromuscolar deficits) would be informative for the characterization of CCDS1 murine models. We plan to do this in our next paper. We agree that a more detailed behavioral analysis (in particular dedicated to the understanding of motor and neuromuscolar deficits) would be informative for the characterization of CCDS1 murine models. We plan to do this in our next paper. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 22 Jan 2015 Laura Baroncelli , Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 22 Jan 2015 Author Response We agree that a more detailed behavioral analysis (in particular dedicated to the understanding of motor and neuromuscolar deficits) would be informative for the characterization of CCDS1 murine models. We ... Continue reading We agree that a more detailed behavioral analysis (in particular dedicated to the understanding of motor and neuromuscolar deficits) would be informative for the characterization of CCDS1 murine models. We plan to do this in our next paper. We agree that a more detailed behavioral analysis (in particular dedicated to the understanding of motor and neuromuscolar deficits) would be informative for the characterization of CCDS1 murine models. We plan to do this in our next paper. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Sacchetti B. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6247 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6247 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 02 Oct 2014 Benedetto Sacchetti , Department of Neuroscience, University of Turin, Turin, Italy Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.5732.r6247 In the present paper the authors describe a new murine model of CCDS1 obtained by ubiquitous deletion of 5-7 exons in the Slc6a8 gene. The experiments in general are well controlled and the results could be of interest for a ... Continue reading READ ALL In the present paper the authors describe a new murine model of CCDS1 obtained by ubiquitous deletion of 5-7 exons in the Slc6a8 gene. The experiments in general are well controlled and the results could be of interest for a general audience. However, I think there are two related points that should be added or clarified before the paper can be considered for publication. The authors reported that Cr depletion altered spontaneous locomotor behavior (Fig 7) and reduced muscle levels. How can this data fit with the normal behavior (namely, the motion speed and the total distance moved) displayed by mutant animals in the open field test? On the other hands, can the authors exclude that the aforementioned reduced motor activity may have interfere with learning and memory trials? The authors should at least discuss this possibility. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Sacchetti B. Reviewer Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6247 ) The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6247 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 06 Nov 2014 Laura Baroncelli , Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 06 Nov 2014 Author Response We agree that the difference between the altered spontaneous locomotor behavior of mutant animals in the home cage and the normal exploratory disposition in the open field arena can be ... Continue reading We agree that the difference between the altered spontaneous locomotor behavior of mutant animals in the home cage and the normal exploratory disposition in the open field arena can be a little bit surprising. However, we feel that the lack of a genotype effect for the latter measure may be due to the aversive nature of the open field arena, which may affect the explorative behavior of both wild-type and mutant mice, thus masking the difference in motor activity between the two groups. We think that our data allow to exclude the possibility that an impaired motor activity can interfere with the presented results of learning and memory test. We found that, during the ORT sample phase, the total exploration time of objects was equal for mutant and control mice (Figure 4a), and animals of both groups equally explored the Y maze in terms of both the number of entries in the single arms of the maze and the total number of arm entries (Figure 5b). These results strongly suggest that animals’ level of activity does not affect their cognitive performance. As for the Morris water maze during the training phase we analyzed the path length covered to locate the submerged platform just to avoid the confounding effects of the reduced swimming speed observed in mutant mice that should not affect instead the performance in the probe trial. We agree that the difference between the altered spontaneous locomotor behavior of mutant animals in the home cage and the normal exploratory disposition in the open field arena can be a little bit surprising. However, we feel that the lack of a genotype effect for the latter measure may be due to the aversive nature of the open field arena, which may affect the explorative behavior of both wild-type and mutant mice, thus masking the difference in motor activity between the two groups. We think that our data allow to exclude the possibility that an impaired motor activity can interfere with the presented results of learning and memory test. We found that, during the ORT sample phase, the total exploration time of objects was equal for mutant and control mice (Figure 4a), and animals of both groups equally explored the Y maze in terms of both the number of entries in the single arms of the maze and the total number of arm entries (Figure 5b). These results strongly suggest that animals’ level of activity does not affect their cognitive performance. As for the Morris water maze during the training phase we analyzed the path length covered to locate the submerged platform just to avoid the confounding effects of the reduced swimming speed observed in mutant mice that should not affect instead the performance in the probe trial. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 06 Nov 2014 Laura Baroncelli , Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy 06 Nov 2014 Author Response We agree that the difference between the altered spontaneous locomotor behavior of mutant animals in the home cage and the normal exploratory disposition in the open field arena can be ... Continue reading We agree that the difference between the altered spontaneous locomotor behavior of mutant animals in the home cage and the normal exploratory disposition in the open field arena can be a little bit surprising. However, we feel that the lack of a genotype effect for the latter measure may be due to the aversive nature of the open field arena, which may affect the explorative behavior of both wild-type and mutant mice, thus masking the difference in motor activity between the two groups. We think that our data allow to exclude the possibility that an impaired motor activity can interfere with the presented results of learning and memory test. We found that, during the ORT sample phase, the total exploration time of objects was equal for mutant and control mice (Figure 4a), and animals of both groups equally explored the Y maze in terms of both the number of entries in the single arms of the maze and the total number of arm entries (Figure 5b). These results strongly suggest that animals’ level of activity does not affect their cognitive performance. As for the Morris water maze during the training phase we analyzed the path length covered to locate the submerged platform just to avoid the confounding effects of the reduced swimming speed observed in mutant mice that should not affect instead the performance in the probe trial. We agree that the difference between the altered spontaneous locomotor behavior of mutant animals in the home cage and the normal exploratory disposition in the open field arena can be a little bit surprising. However, we feel that the lack of a genotype effect for the latter measure may be due to the aversive nature of the open field arena, which may affect the explorative behavior of both wild-type and mutant mice, thus masking the difference in motor activity between the two groups. We think that our data allow to exclude the possibility that an impaired motor activity can interfere with the presented results of learning and memory test. We found that, during the ORT sample phase, the total exploration time of objects was equal for mutant and control mice (Figure 4a), and animals of both groups equally explored the Y maze in terms of both the number of entries in the single arms of the maze and the total number of arm entries (Figure 5b). These results strongly suggest that animals’ level of activity does not affect their cognitive performance. As for the Morris water maze during the training phase we analyzed the path length covered to locate the submerged platform just to avoid the confounding effects of the reduced swimming speed observed in mutant mice that should not affect instead the performance in the probe trial. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 29 Sep 2014 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 22 Jan 15 read read read Version 1 29 Sep 14 read read read Benedetto Sacchetti , University of Turin, Turin, Italy Luis M. Valor , Instituto de Neurociencias de Alicante (Universidad Miguel Hernández - Consejo Superior de Investigaciones Científicas), Alicante, Spain Andreas Schulze , University of Toronto, Toronto, Canada Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2015 Valor L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 04 Feb 2015 | for Version 2 Luis M. Valor , Instituto de Neurociencias de Alicante (Universidad Miguel Hernández - Consejo Superior de Investigaciones Científicas), Alicante, Spain 0 Views copyright © 2015 Valor L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions I do not have additional comments. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Valor LM. Peer Review Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7423) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7423 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2015 Sacchetti B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 03 Feb 2015 | for Version 2 Benedetto Sacchetti , Department of Neuroscience, University of Turin, Turin, Italy 0 Views copyright © 2015 Sacchetti B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors have addressed all my concerns. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Sacchetti B. Peer Review Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7422) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7422 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2015 Schulze A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 26 Jan 2015 | for Version 2 Andreas Schulze , Division of Clinical and Metabolic Genetics, Department of Pediatrics, University of Toronto, Toronto, ON, Canada 0 Views copyright © 2015 Schulze A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors have addressed all of my concerns to my full satisfaction. I apologize for misinterpreting the results of the novel object recognition test in the Skeleton paper. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Schulze A. Peer Review Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.6455.r7421) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-228/v2#referee-response-7421 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2014 Schulze A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 11 Nov 2014 | for Version 1 Andreas Schulze , Division of Clinical and Metabolic Genetics, Department of Pediatrics, University of Toronto, Toronto, ON, Canada 0 Views copyright © 2014 Schulze A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (2) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The research group generated a new ubiquitous CrT knockout as mouse model for creatine transporter deficiency with a large 3 exon deletion in the Slc6a8 gene. Biochemical phenotyping revealed creatine deficiency in brain, muscle, heart, and kidneys and behavioral testing revealed a phenotypic similarities with CrT patients. Therefore the new mouse model appears to be a valid tool to study creatine transporter deficiency. What needs some more elaboration is the discrepancy in findings compared to the mouse model described by Skelton et al. ( 2011) . Considering the similarities of the knock-outs, both have a large deletion of three exons, on would expect similar findings. But in the knock-out presented here there is more cognitive impairment, i.e. novel object recognition was abnormal while it was normal in the Skelton paper, and this is despite of the fact that the brain creatine deficiency reported here appears to be less pronounced than in the mouse model of Skelton et al . Before indexing the authors should provide information on whether the mouse chow contained creatine (some mouse chow contains fish meal and the latter contains creatine). Also it would be important to know the creatine concentration in plasma. The creatine concentration in mutants is expected to be higher than in wild types. I wonder whether blood contamination has contributed to unexpected high brain creatine concentration in mutants. Why did the group not consider whole-body perfusion prior to organ removal? Did the authors measure creatine/creatinine ratios in urine? And why not providing the information on guanidinoacetate in organs and body fluids as well? Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (2) Reader Comment 16 Dec 2014 Skelton Lab Dr. Schulze, I would like to respectfully clarify an error in your review. Our ubiquitous CrT mice did indeed show deficits in object recognition memory, as shown in figure 6 of our PLOS One paper . In fact, the object recognition deficit was similar to the deficit presented in this paper. Best Regards, Matthew R. Skelton, Ph.D. Cincinnati Children's Research Foundation [email protected] View more View less Competing Interests We developed the first CrT KO mice. reply Respond Report a concern Author Response 22 Jan 2015 Laura Baroncelli, Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy As already clarified by Dr. Skelton, our behavioral findings are not at odds with those reported in his PLOS ONE paper: indeed, their knockout mice show a deficit in object recognition memory very similar to that measured in our model. The difference in the extent of creatine deficiency is explained by the different methods employed to measure this metabolite: in our study creatine was analyzed using gas chromatography/mass spectrometry, a widely accepted specific and sensitive technique, whereas Skelton et al. (2011) used a less sensitive colorimetric method. As regards the mouse chow, the manufacturer told us that the pellet purchased for our animal facility is not added with creatine. We made this point clearer, adding a sentence in the Materials and methods section (Animal housing subsection). We followed your suggestion and measured creatine concentration also in body fluids, and more specifically in serum and urine. We observed a significant reduction of Cr in the serum of CrT −/y mice with respect to wild-type (WT) littermates (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.001). In contrast, an increase of Cr levels (Two Way ANOVA on rank transformed data, post hoc Holm-Sidak method, p < 0.05) and creatine/ creatinine ratio was present in the urine of mutant with respect to WT animals (t test, p < 0.001). We added these data in the Result section and in Table 1. We also modified the discussion adding the following sentences: “In contrast to the preservation of Cr levels in skeletal muscle of CCDS1 patients ( deGrauw et al., 2003 ), we observed that mutant mice exhibit Cr reductions in muscle and other peripheral tissues and body fluids. This observation, which is in agreement with data from a different CrT knockout mouse ( Russell et al. , 2014 ; Skelton et al ., 2011), further confirmed that the recombination resulted in a ubiquitous disruption of the CrT gene. In particular, the reduction of serum Cr level may be explained by defective gut absorption from the diet ( Garcia-Miranda et al. , 2009 ; Skelton et al. , 2011). The only body fluid in which Cr levels resulted to be increased is urine; it is likely that the lack of a functional transporter impairs the creatine salvage normally operated by the kidney ( van de Kamp et al. , 2014 ). Consistently, we found an elevated creatine/creatinine (Cr/Crn) ratio in the urine of mutant mice, probably due to a combination of reduced renal reabsorption of creatine and decreased creatinine excretion.” Since we found a strong reduction of creatine concentration, we don’t think that blood contamination could be responsible for higher brain Cr levels in these mice. Finally, we provided the information on GAA content in organs and body fluids, adding a Table 2 to the manuscript. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Schulze A. Peer Review Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6559) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6559 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2014 Valor L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 05 Nov 2014 | for Version 1 Luis M. Valor , Instituto de Neurociencias de Alicante (Universidad Miguel Hernández - Consejo Superior de Investigaciones Científicas), Alicante, Spain 0 Views copyright © 2014 Valor L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions In “A novel mouse of creatine transporter deficiency” the authors describe the phenotype of a new knockout mouse for Slc6a8 gene which is associated with a depletion in the levels of creatine in diverse organs. This phenotype is reminiscent of the CCDS1 symptomatology, therefore the main output of the present report is an increase in the number of available murine models for this disorder as claimed in the article. The paper is well written and the work is well presented, with no major concerns regarding the data as shown. Nonetheless, I miss a more complete behavioural analysis. In some cases this is not crucial because assessment of particular tasks is expected to support current findings (absence of anxiety in the open field or impaired spatial working memory in the Y-maze) although with the strength of using more dedicated paradigms (elevated plus maze or T-maze based on a rewarding system, respectively). However, it is more relevant in the case of motor and neuromuscular deficits to enhance the conclusions obtained from spontaneous activity measurements, and other approaches (accelerating rotarod, grip strength, vertical pole, etc. to put some examples) may be more informative. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (1) Author Response 22 Jan 2015 Laura Baroncelli, Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy We agree that a more detailed behavioral analysis (in particular dedicated to the understanding of motor and neuromuscolar deficits) would be informative for the characterization of CCDS1 murine models. We plan to do this in our next paper. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Valor LM. Peer Review Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6560) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6560 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2014 Sacchetti B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 02 Oct 2014 | for Version 1 Benedetto Sacchetti , Department of Neuroscience, University of Turin, Turin, Italy 0 Views copyright © 2014 Sacchetti B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions In the present paper the authors describe a new murine model of CCDS1 obtained by ubiquitous deletion of 5-7 exons in the Slc6a8 gene. The experiments in general are well controlled and the results could be of interest for a general audience. However, I think there are two related points that should be added or clarified before the paper can be considered for publication. The authors reported that Cr depletion altered spontaneous locomotor behavior (Fig 7) and reduced muscle levels. How can this data fit with the normal behavior (namely, the motion speed and the total distance moved) displayed by mutant animals in the open field test? On the other hands, can the authors exclude that the aforementioned reduced motor activity may have interfere with learning and memory trials? The authors should at least discuss this possibility. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 06 Nov 2014 Laura Baroncelli, Institute of Neuroscience, National Research Council (CNR), Pisa, I-56124, Italy We agree that the difference between the altered spontaneous locomotor behavior of mutant animals in the home cage and the normal exploratory disposition in the open field arena can be a little bit surprising. However, we feel that the lack of a genotype effect for the latter measure may be due to the aversive nature of the open field arena, which may affect the explorative behavior of both wild-type and mutant mice, thus masking the difference in motor activity between the two groups. We think that our data allow to exclude the possibility that an impaired motor activity can interfere with the presented results of learning and memory test. We found that, during the ORT sample phase, the total exploration time of objects was equal for mutant and control mice (Figure 4a), and animals of both groups equally explored the Y maze in terms of both the number of entries in the single arms of the maze and the total number of arm entries (Figure 5b). These results strongly suggest that animals’ level of activity does not affect their cognitive performance. As for the Morris water maze during the training phase we analyzed the path length covered to locate the submerged platform just to avoid the confounding effects of the reduced swimming speed observed in mutant mice that should not affect instead the performance in the probe trial. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Sacchetti B. Peer Review Report For: A novel mouse model of creatine transporter deficiency [version 2; peer review: 3 approved] . F1000Research 2015, 3 :228 ( https://doi.org/10.5256/f1000research.5732.r6247) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-228/v1#referee-response-6247 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Click here to access the data. The problem Spreadsheet data files may not format correctly if your computer is using different default delimiters (symbols used to separate values into separate cells) - a spreadsheet created in one region is sometimes misinterpreted by computers in other regions. You can change the regional settings on your computer so that the spreadsheet can be interpreted correctly. How to fix it Save downloaded CSV file Open spreadsheet program (e.g. Excel) Click the ‘Data’ tab at the top Click the ‘From text’ icon (top left) Browse for downloaded CSV file, click ‘Import’ Ensure ‘Delimited’ radio button is selected, click ‘Next’ Check one of the appropriate delimiter checkboxes (you can visualize the formatting by looking at the data preview below these options) Click ‘Finish’ Downloaded data do not display as expected? Download the data Dataset citation: Baroncelli L, Alessandrì MG, Tola J et al. . Dataset 1 in: A novel mouse model of creatine transporter deficiency. F1000Research 2015, 3 :228 (https://doi.org/10.5256/f1000research.5369.d42180) Close Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "A novel mouse model of creatine transporter...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/3-228/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/3-228/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/3-228/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Baroncelli L et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/3-228/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/3-228", templates : { twitter : "A novel mouse model of creatine transporter deficiency. Baroncelli L et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/3-228/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/5369/6455") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "6455"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "6560": 40, "6244": 0, "6245": 0, "6246": 0, "6247": 73, "6248": 0, "6249": 0, "7421": 22, "7422": 20, "6558": 0, "7423": 18, "6559": 61, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "4d99a2ed-5e70-48a8-bdcd-ed460536d3b0"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-29T02:00:03.542394+00:00
License: CC-BY-4.0