Taurine enhances antioxidant enzyme activity and immune response in Seriola rivoliana juveniles after lipopolysaccharide injection

Taurine enhances antioxidant enzyme activity and immune response in Seriola rivoliana juveniles after lipopolysaccharide injection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Taurine enhances antioxidant enzyme activity and immune response in Seriola rivoliana juveniles after lipopolysaccharide injection Andressa Teles, Laura Guzmán-Villanueva, Marco A. Hernández-de Dios, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4926904/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The use of additives in fish feeds is a practice used worldwide to provide better productive results and improve the fish's health and immune capacity to face disease outbreaks. This study aimed to analyze the effects of the different doses of taurine in fish feed and its impact on the immune-related parameters and antioxidant enzyme activity after LPS (lipopolysaccharide) injection. For this, immune-related gene expression was evaluated as well as lysozyme activity and antioxidant enzyme activity. The results showed that using taurine at 2% (TAU 2%) improved the expression of il1-β, tnf-α, and tlr-3 compared to the other treatments at 24 hours post LPS injection. Lysozyme activity and antioxidant activity such as superoxide dismutase (SOD) and catalase were higher in the treatment with both taurine 1% (TAU 1%) and TAU 2% when compared with the negative control (C-) and the positive control (C+) treatments after 72 hours post LPS injection. These results suggest that using 2% of exogenous taurine added to a commercial fish feed for juveniles of Seriola rivoliana can improve their immunocompetency and counteract the oxidative stress caused by exposure to LPS. Seriola rivoliana LPS Taurine immune response Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The aquaculture industry faces the challenge of disease outbreaks that hinder production worldwide, hence, prioritizing health maintenance is crucial in contemporary fish farming. It is vital to develop strategies for enhancing fish's immune system and well-being (Ramos-Pinto et al. 2021 ; Kumar et al. 2022 ). In this sense, the development and assessment of feed additives come to face these common issues. These additives are commonly employed as immunostimulants to enhance the overall health condition of aquatic animals, thereby preventing or controlling disease outbreaks (Hernández-Contreras et al. 2023), and are generally added in a basal diet to produce functional diets. Functional diets are defined as those that go beyond meeting the fundamental nutritional needs of farmed fish, playing a role in improving growth, survival, and overall health, by incorporating particular additives that possess nutritional or health-boosting qualities (Ramos-Pinto et al. 2021 ). An additive gaining attention in fish feed formulations is taurine. Taurine is a β-sulphonic amino acid that has been identified as an essential amino acid in several fish species, notably in juvenile and larval stages (Salze and Davis, 2015 ; Sampath et al. 2020 ), especially concerning marine carnivorous fish (Aragao et al. 2022). It has been shown to have several beneficial effects such as reducing oxidative damage and inflammation in the organism exposed to toxic substances and stressors (Yan et al. 2019 ; Gunathilaka et al. 2019 ; Han et al. 2020 ; Ramos-Pinto et al. 2021 ; Holen et al. 2022 ; Ma et al. 2022 ; Shi et al. 2022 ). Recent evidence from animal models indicates that lipopolysaccharides (LPS) can induce inflammation and oxidative stress (Zhang et al. 2019 ). LPS, which is also referred to as endotoxin, is located in the outer membrane of Gram-negative bacteria. It is well known that in mammals and higher vertebrates, the LPS is extremely toxic even in low doses, however, in fish the LPS does not have the same toxicity but is capable of triggering the activation of the immune system and being evaluated such as a bacterial infection (Guzmán-Villanueva et al. 2014 ; Alves et al. 2020; Zhu et al. 2020 ; Biller et al. 2021 ; Saravia et al. 2022 ). Recently, the use of functional additives and immunomodulators have been evaluated on the immune system of S. rivoliana juveniles (Mazón-Suastegui et al. 2019, Hernández-Contreras et al. 2021 , Asencio-Alcudia et al. 2023 ). The longfin yellowtail (Carangidae) is a fast-growing tropical marine species with high-quality meat, making it a promising candidate for diversifying global aquaculture production (Teles et al. 2017 ; 2018; 2022 ). This study aims to determine whether the inclusion of taurine in the marine fish commercial diet of juveniles of S. rivoliana can modulate their immune and antioxidant response to a challenge with LPS. For this purpose, innate and adaptive immune-related genes ( il1-β , il-10, tnf-α, myd-88, tlr-3, c3, and marco ) and enzyme (lysozyme), and antioxidant enzymes (superoxide dismutase, catalase) were evaluated. To our understanding, this is the first study aimed to explore the effect of taurine supplementation on the antioxidant and immune capacity of juveniles of S. rivoliana after the LPS challenge. Material and Methods Ethics statement This study adhered to the guidelines established by the European Union Council (2010/63/EU) and the Mexican Government (NOM-062—ZOO-1999) about the production, care, and use of experimental animals. Additionally, the research protocols and procedures were meticulously reviewed and approved by an internal committee at CIBNOR, in accordance with the ARRIVE guidelines. Nutritional trial Previous to the LPS challenge, a nutritional trial was performed by Hernández-de Dios et al. ( 2024 ) in which juveniles of Seriola rivoliana were fed with two different diets (Taurine 1% - TAU1%; Taurine 2% - TAU2%) plus the control treatment (0% Taurine – C) for 60 days. Initial and final body weight and furcal length at the nutritional trial are provided by Hernández-de Dios et al. ( 2024 ). LPS-challenge For LPS exposure, we followed the protocol performed by Guzmán-Villanueva et al. ( 2014 ) with some modifications. Briefly, after 60 days of nutritional trial, being fed with different taurine concentrations (0, 1%, and 2%) juveniles of S. rivoliana were assigned to be challenged with LPS ( Salmonella typhimurium (Sigma L – 6511) – 1 mg Kg − 1 in 1 mL Saline solution). Experimental and control groups [LPS injected = Taurine 1%, Taurine 2% and Control (+); Saline solution injected = Control (-)] were kept in 3000 L tanks (9 fish per tank) during 72h after intraperitoneal injection. Dissolved oxygen was kept at 7.4 ± 1.1 mg L − 1 , water exchange 100% day − 1 and temperature 24 ± 1.0°C. Sampling For biochemical analysis, fish were sampled ( n = 3) for skin mucus (72h post-injection), and molecular analysis for head kidney ( n = 3 ) at 0, 24 hours, and 72 hours post-injection. Fish were first anesthetized with clove oil (eugenol), and skin mucus was collected and preserved in PBS at -80°C until analysis. For molecular analysis, after being anesthetized, fish were euthanized by a quick and humane medullary cut using sharp scissors. Following euthanasia, samples of the head kidney were obtained and preserved in RNAlater® (Thermo-Fisher Scientific, Carlsbad, CA, USA) at -80°C for further analysis. Molecular analysis RNA extraction Total RNA was extracted from the head kidney. The samples were homogenized using a fast prep system (Thermo-Fisher Scientific, Carlsbad, CA, USA) with silica pearls at 5 seconds per minute for 30 seconds in 1000 µL of Trizol Reagent (Invitrogen, Carlsbad, CA, USA). After homogenization, the procedure for RNA isolation was performed following the manufacturer´s instructions. The amount and quality of the total RNA were determined using a Nanodrop spectrophotometer (Thermo-Fisher Scientific, Carlsbad, CA, USA) and by agarose electrophoresis (1.5%) with Sybr Safe DNA Gel Stain (Invitrogen, Paisley, United Kingdom). DNAse treatment To guarantee the elimination of genomic DNA, a DNAse treatment was performed. For each 1 µg of RNA, a mix of 1 µL of buffer 10X, 1 µL of Dnase, and DEPC water is made to obtain a total of 10 µL, then incubated at 37° C for 30 minutes followed by adding 1 µL DNAse Stop Solution and incubated at 65°C for 10 minutes. cDNA synthesis To generate complementary DNA by the reverse transcriptase, 1 µL of oligo-dT was mixed with 2 µg of total RNA then incubated at 70°C for 10 minutes. A mix of 1 µL dNTP (10mM), 2.4 µL 25mM MgCl 2 , 4µL 5X Reaction buffer (ImProm-II™), 2 µl Ribonuclease inhibitor (RNasin®) 1µL Reverse transcriptase (Improm-II™) and 5.6 µL Nuclease free-water. The protocol for reverse transcription was the following: 25°C for 5 minutes, 42°C for 60 minutes, and 70°C for 15 minutes, the cDNA was stored at -20°C until further qPCR analyses. RT-qPCR Quantification of relative gene expression was conducted through RT-qPCR analysis, utilizing a CFX96 Touch™ Real-Time Thermal Cycler CFX96 (Bio-Rad) with a 10 µL total volume reaction per sample. Each reaction consisted of 5 µL of SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad), 2.0 µL cDNA, and 0.1 µL of primers as indicated in Table 1 . The experimental procedures included an initial cycle of 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 15 s, concluding with a melting curve analysis following the standard 60-cycle program to validate the amplification of a singular product in each reaction. The primers utilized in this investigation were designed based on the transcriptome of S. rivoliana . (BioSample accessions SAMN20923996, SAMN20923997, SAMN20923998, SAMN20923999, SAMN20924000, SAMN20924001, SAMN20924002, SAMN20924003. The expression of the target genes was calculated using the 2 −ΔΔCT method as described by (Livak and Schmittgen, 2001 ), normalized with the reference gene 18S , and the negative control group (C-) whose expression was set at 1. Table 1 Oligonucleotide primers were used for the qPCR analysis of target genes of Seriola rivoliana juveniles. Gene Function Primer sequences (5’- 3’) Amplicon size (bp) marco Scavenger receptor Fw: GACTCAGTGGACAACGTGG Rv: GTCTCCTTTGTCTCCTTTG 220 il-10 Anti-inflammatory cytokine Fw: ACAGTGGTATCAGGGATCCTCA Rv: CCGACTGTGTAGGGTATGACTG 155 il-1β Proinflammatory cytokine Fw: AGCCAGCAGAGACACTTAG Rv: TGGGTAAAGGTGGCAAGTAG3 124 tnf-α Proinflammatory cytokine Fw: TTCATGCCTCTTAGCCACAGG Rv: CTCCGTCCGTCTCTGTAACTG 131 myd-88 Signaling molecule stimulator Fw: ATGAAGCGACGAAAAACCCC Rv: AAGACTGAAGATCCTCCACAATGTC 135 tlr3 Pattern recognition receptor Fw: CAAATGTTACCAGATTGCCAAACC Rv: TTACCATCAGCATCGGGACAAC 168 18s 18s ribosomal RNA (reference gene) Fw: CTGAACTGGGGCCATGATTAAGAG Rv: GGTATCTGATCGTCGTCGAACCTC 165 Biochemical analyses SOD activity SOD activity was assayed according to Guzmán-Villanueva et al. ( 2014 ), briefly, a cocktail containing phosphate buffer (50 mM pH 7.8), cytochrome C 0.012 mM, xanthine (0.1 mM) and EDTA (0.1 mM), where SOD competes with cytochrome c for superoxide ions generated by a reaction between xanthine and xanthine oxidase (0.025 IU mL − 1 SIGMA). SOD activity was determined by the level of inhibition percentage of reduction of cytochrome c at 550 nm. Catalase activity The catalase (CAT) activity was measured by mixing the head kidney homogenate extract (20 µL) with 100 µL of phosphate buffer (100 mM, pH 7.0), 30 µL of absolute methanol and 20 µL of H 2 O 2 (30%). The mixture was incubated in a shaker (120 rpm) for 20 min at room temperature. After incubation, 30 µL of KOH (10 M) and 30 µL of diluted 4-Amino-3-hydrazino-5-mercapto-1,2,4,-triazole (Alfa Aesar, Ward Hill, MA, USA) (46 mM in 0.5 M HCl solution) reagent were added, and incubated for 10 minutes in a shaker. Finally, 10µL of KIO 4 was added and the plate was incubated for 5 minutes in a shaker at room temperature. Absorbance was read at 540 nm. The formation of formaldehyde in each sample was calculated using a formaldehyde standard curve. CAT activity was calculated using the following equation: $$\:\varvec{C}\varvec{A}\varvec{T}\:\varvec{a}\varvec{c}\varvec{t}\varvec{i}\varvec{v}\varvec{i}\varvec{t}\varvec{y}=\frac{\mu\:M\:formaldehyde}{20\:min}*sample\:dilution=nmol/min/mL$$ Lysozyme activity Based on the method by Lange et al. ( 2001 ) with modifications, on a flat-bottomed 96-well microtitre plate, 100 µL of 0.4 mg mL − 1 suspension of Micrococcus lysodeikticus (Sigma-Aldrich, St. Louis, USA) in 0.05 mol L-1 phosphate buffer (pH 5.2) were added to 100 µL of homogenate (1:10 dilution) and the measurements were made at 450 nm every 2 min during 60 min using a microplate reader Varioskan Flash, (Thermo Fisher Scientific, USA). A unit of lysozyme activity was defined as the amount of homogenate causing a decrease in absorbance of 0.001 units per minute. For the positive control, the homogenate was replaced by 2µg mL-1 Hen Egg White lysozyme (Sigma L-7001). Homogenate was replaced by phosphate buffer for the negative control. Protein determination To determine specific activity, protein content was measured in the homogenates as described by Bradford (1976) using Bio-Rad Protein assay dye reagent (BioRad 500 − 0205) and bovine serum albumin (BSA, A7906; Sigma-Aldrich, Madrid, Spain) as the standard. Samples were assayed in triplicates in 96-well and read at 595 nm. Statistical analysis Molecular and biochemical analyses were performed in triplicate for each sample and are shown as Mean ± Standard deviation (SD). One-way and two-way analysis of variance (ANOVA) with treatment and time as independent variables were performed. Shapiro-Wilk test for normality and Levene´s test for homoscedasticity was previously performed (logarithmic transformation was performed when data did not fit normality), then a Tukey’s post hoc test was carried out when significant differences between treatments were detected (p < 0.05). The statistical analysis and plot were performed using the software SPSS Version 29 (Armonk, NY, USA). Results Experimental fish did not show mortality after LPS administration nor at the final of the experiment. Enzyme activity Data presented in Fig. 1 A shows the high activity of SOD in TAU 1% and TAU 2% treatments when compared with C + and C-, no statistical differences were observed between TAU 1% and TAU 2%. When compared with C-, the C + treatment shows higher activity of SOD in mucus at 72 hours post-injection. Figure 1 B shows the highest activity of catalase in the TAU 2%, followed by the TAU 1% treatment. No differences between C- and C+, related to catalase activity, were detected. Regarding lysozyme activity, TAU 1% and TAU 2% presented higher values which were statistically different from C + and C-. No differences in lysozyme activity were observed between C + and C- (Fig. 2 ). Immune system gene expression Significant overexpression of all immune-related genes evaluated in this study was observed at 24 h post-LPS injection when compared with 0h and 72h post-injection (p < 0.05). Regarding the il-1β gene, at the beginning of the trial, the fish fed with a control diet showed higher expression of this gene compared to TAU 1% and TAU 2% group; at 24h a significant overexpression was observed at TAU 2% treatment when compared to C+ (p < 0.05) and TAU 1% (p < 0.05) at the same period (Fig. 3 A). The tnf-α gene was overexpressed at the beginning of the trial in the control group when compared with TAU 1% and TAU 2%, however, at 24 h post-injection, presented a significant difference between the TAU 2% and C+, where the former treatment, this gene was overexpressed (Fig. 3 B). For the tlr-3 gene, overexpression was observed in control group previous to the LPS-injection when compared with TAU 1% and TAU 2% group, whereas, at 24h post-injection, an overexpression was observed in TAU 2% when compared to C + and TAU 1% (Fig. 4 A). Regarding the marco gene, at 0h TAU 2% showed overexpression compared to the other groups at the same period. At 72 h post-injection, overexpression was observed in the C + group when compared to the different treatments. No differences were observed for this gene at 24h (Fig. 4 B). Overexpression of il-10 was observed at the beginning of the trial in the control group compared to the other groups. At 72 h post-injection, C + presented overexpression compared to the TAU 1% group. No differences were observed between the treatments at 24 h post-injection (Fig. 5A). No differences between the treatments in each period were observed for the myd-88 gene (p > 0.05) (Fig. 5B). During the trial, the expression from all the measured genes in the different treatments showed the same pattern, at 0h low gene expression was observed, then a peak of expression was observed followed by a drop at 72h, which in some cases, presented the same expression of the 0h. Discussion Due to the environment in which they are kept, aquaculture fish are highly susceptible to bacterial infections, which makes producers increasingly seek solutions to these problems through the use of immunostimulants. In this sense, there is evidence that the use of taurine can provide an immunomodulatory and antioxidant effect, capable of improving animal health and welfare (Bañuelos et al. 2014; Dehghani et al. 2020 ). In the present study, S. rivoliana juveniles were fed with different amounts of exogenous taurine (0, 1, and 2%) for 8 weeks and then exposed to an LPS challenge for 72h. We observed that juveniles of S. rivoliana fed with TAU 1% and TAU 2% led to a significant enhancement in SOD and CAT activities after the challenge. Similar to our research, Shi et al. ( 2022 ) found that Monopterus albus fed with different taurine doses during 8 weeks of feeding trial when challenged with H 2 O 2 showed higher SOD and CAT when compared with the control-fed group. In other fish species, under different challenges such as ammonia-challenged hybrid snakehead Channa maculatus ♀ × Channa argus ♂ (Tan et al. 2018 ); low temperature stressed Takifugu obscurus (Cheng et al. 2018 ) taurine showed its antioxidant effect improving antioxidant enzyme activity. In studies performed by Cheong et al. ( 2017 ) and Kim et al. ( 2017 ) using Taurine-Rich Paroctopus dofleini and mussel water extracts, the authors found a reduction of ROS in embryos and larvae of zebrafish Danio rerio exposed to an LPS challenge when compared to the control group (No extract). In terrestrial animals, taurine administration effects are similar to our findings; rats and broiler chickens fed diet taurine when challenged with LPS, presented improvement in their antioxidant capacity increasing the SOD and CAT activity (Liu et al. 2017 ; Han et al. 2020 ). During and after a challenge, the organism passes through stress that imbalances its homeostasis and might generate oxidative stress by improving the production of reactive oxygen species (ROS), which plays a crucial role in cellular signaling pathways and the immune system response, however, excessive production and accumulation of ROS can harm the organism when the cell fails to detoxify or repair properly the damage caused by these molecules. As part of the defense mechanism after a challenge, the immune response is activated which may produce ROS as a defense mechanism against the pathogen, in response, the activity of antioxidant enzymes might increase to neutralize the excess of ROS and prevent oxidative damage to the host´s cells and tissues. Two important antioxidant enzymes involved in this process are: 1) superoxide dismutase (SOD) which plays a critical role in eliminating harmful ROS (superoxide anion) and; 2) catalase (CAT), which catalyzes excess ROS (hydrogen peroxide) to produce a disproportionation reaction and reduce hydrogen peroxide to water as part of the antioxidant defense to maintain cellular homeostasis (Zhu et al. 2020 ; Reyes-Becerril et al. 2021 ). These antioxidant enzymes are complementary to prevent the excessive accumulation of ROS. The antioxidant properties of taurine in fish have been confirmed by several studies (Bañuelos et al. 2014; Dehghani et al. 2020 ; Shi et al. 2021 , 2022 ), although taurine itself is not able to scavenge ROS, it exerts its antioxidant action by inhibiting the production of ROS by increasing activities of antioxidant enzymes (Liu et al. 2017 ; Han et al. 2020 ). LPS possesses pro‑oxidative action via the induction of excessive production of reactive oxygen species (ROS) (Liu et al. 2017 ), in the present study it can be shown that taurine can alleviate this process by increasing antioxidant activities after the LPS challenge when compared to the C + group. It is worth mentioning that, because of its biochemical composition, LPS mimics a gram-negative bacterial infection, so the host immune-related system is capable of detecting it and then initiating a cascade of responses. The detection of pathogens by pattern recognition receptors (PPR) is essential for triggering innate immune responses and subsequent host immunity through various signaling cascades, this includes enhanced lysozyme production, which aids in the elimination of the pathogen by hydrolyzing the ß-linked glycosidic bonds in the bacterial cell wall peptidoglycans (Biller et al. 2021 ). In this sense, it is important to notice the efficacy of the higher doses of taurine in the present study as an immunostimulant that promoted increased mucus lysozyme activity after the juveniles were challenged with LPS when compared to the C + and C- groups. Similar to our findings, Dehghani et al. ( 2020 ) reported an increase in mucosal lysozyme when Acanthopagrus latus was fed with a taurine-rich diet (≥ 1.25%). The same was observed in Pelteobagrus fulvidraco fed with higher levels of taurine (1.6, 2.13, and 2.55%), with values of lysozyme activity increasing with increasing dietary taurine levels (Li et al. 2016 ). Regarding a closer species from the same family, the golden pompano Trachinotus ovatus showed a similar pattern when fed higher levels of taurine in the diet, which increased lysozyme activity (Liu et al. 2015). There seems to be a positive correlation between diet taurine level and lysozyme activity, however, further research on this topic must be performed to standardize the amounts, way of administration, or delivery of taurine. When it comes to an LPS challenge, this correlation seems to be the opposite. Some studies have demonstrated that when the organisms are exposed to different doses of LPS, the lysozyme activity decreases when compared to the control group (no LPS injection) (Alves et al. 2020; Giri et al. 2020 ; Li et al. 2020 ; Zhu et al. 2020 ; Biller et al. 2021 ) which could indicate an immune depression status of the organism, however, it seems to depend on the dose, and tissue evaluated and species-specific, in our study, no differences in mucus lysozyme activity were found between C- and C+, which may indicate that even the LPS promoted a host immune response, the dose of LPS were not sufficiently higher to trigger a decrease in the lysozyme activity. The immune response in fish is predominantly influenced by humoral factors, including lysozyme, a critical constituent of the innate immune system found widely in bodily fluids, which is a protein that serves as a dependable marker that mirrors the health condition of a fish (Zhu et al., 2020 ). Lysozyme plays a key role in the innate immune response by acting against microbial invasion, activating the complement system, and facilitating the destruction and removal of foreign particles (Reyes-Becerril 2017; Giri et al. 2020 ). In addition to its primary role in combating Gram-positive bacteria, lysozyme, which is present in the mucus, lymphoid tissue, plasma, and other bodily fluids of most fish species, can also lyse Gram-negative bacterial cells, in addition, act as an opsonin, enhancing the phagocytic activity of immune cells, and it also activates the complement system, which is a key component of the innate immune response (Magnadottir, 2006). The improvement of lysozyme activity associated with other immune parameters suggests that taurine can positively influence the fish's immune response, which could, potentially, enhance their ability to combat bacterial challenges. In this sense, immune-related genes such as tlr-3, il1-β, and tnf-α evaluated in this study showed significant mRNA overexpression after 24 hours after injection. Toll-like receptor ( tlr-3) can act as an amplifier of the immune response, promoting the release of proinflammatory cytokines and the activation of other components of the immune system. In this study, overexpression may indicate an attempt by the organism to restore a proper balance in its immune system. It is worth mentioning that TLR-3 was mainly associated with a virus or poly I: C challenges (Rodriguez et al., 2005 ; Herrero, 2010 ; Wang et al., 2018 ; Chen et al. 2021 ), however, in some fish, evidence shows that TLR-3 had a response after bacterial challenges. Similar to our research, Wang et al. ( 2018 ) found the overexpression of tlr-3 in Lateolabrax japonicus after bacterial challenge with Vibrio harveyi and Streptococcus agalactiae . Another study conducted by Zhang et al. ( 2017 ) showed overexpression of tlr-3 in the head kidney of yellow catfish Pelteobagrus fulvidraco after being challenged with Aeromonas hydrophila , a gram-negative bacteria. The authors evaluated the nine tlr s genes including tlr-3 , at different times of exposition (0, 6, 12, 24, 28, and 72 h), and interestingly similar as found in our study, high fold-change was observed at 6, 12, and 24 hours and decreased drastically afterward. In the present study, we found overexpression at 24 h, with a prominent decrease at 72h, which led us to infer that this gene participates actively in the recognition of bacteria as well as LPS as a PAMP and might induce inflammatory responses in fish. When TLRs on immune cells detect PAMPs, they trigger signaling pathways that lead to the production of proinflammatory cytokines like IL-1β and TNF-α. IL1β and TNF-α play pivotal roles as essential molecules within the innate immune response against bacterial intrusion, while also serving to induce the secretion of fundamental cytokines that activate the effector functions of macrophages and lymphocytes (Reyes-Becerril et al. 2017). The overexpression of both cytokines il1-β and tnf-α was observed in this study at 24 h after LPS injection with significant differences between TAU 2% when compared to the other treatments, demonstrating its potential immunostimulant effect. This enhanced immune response is a key feature of trained immunity, where the innate immune cells exhibit a memory-like response to subsequent challenges with pathogens or PAMPs (Angulo, 2020). Regarding the effect of taurine on mRNA expression after an LPS challenge, Holen et al ( 2022 ) found that before a stress period of transition from fresh to seawater, using a diet amino acid-rich (DL-Methionine, L-Lysine, L-Threonine, and Taurine) seemed benefits for leukocyte immune responses induced by LPS which increased the gene expression of il-1β . The authors suggest that a diet containing those amino acids could increase the defense of the fish against bacterial and viral infection in this vulnerable transition period. Interestingly, contrary to our findings Shi et al. ( 2022 ) found that taurine could inhibit the overexpression of il1-β and tlr-3 when Monopterus albus juveniles were challenged with H 2 O 2 , however, an overexpression of il-10 was observed in taurine treatment. In our study, the mechanism of defense after 24 h LPS injection, triggered a pro-inflammatory response with no difference between treatments in the anti-inflammatory il-10 response that could indicate a balance among pro-inflammatory and anti-inflammatory response, which in pathological conditions, the anti-inflammatory response may be inadequate to mitigate the inflammatory activity, or alternatively, become disproportionately pronounced, thereby suppressing the immune system and rendering the host susceptible to infection (de Pablo-Sánchez et al. 2005). Inflammation can help to regulate the immune response, ensuring that it is properly activated to fight the infection or injury and deactivated once the problem is resolved. In the present study, it could be observed at 72 h, when the inflammatory mRNA expression decreased to the basal level with similar values as found at 0h post-injection, so this pro-inflammatory overexpression of tlr-3 , il1-b , and tnf-a in TAU 2% could indicate a better-trained immunity in TAU 2% group. In this sense, a study performed with goats LPS challenged, showed that the use of β-glucan as the immunostimulant, increased the expression of il 1-β and tnf-α when compared to the control group, the authors suggest that the increased production of IL-1β and TNF-α reflects the activation of immune signaling pathways and the priming of the immune system to respond effectively to the challenge posed by the pathogen (Angulo et al. 2018 ; 2020 ). In conclusion, our findings suggest that supplementation with taurine has the potential to improve the immunological capabilities of juvenile S. rivoliana , thereby enabling them to initiate an efficient immune response against an immune challenge. The assessment of antioxidant enzymes and lysozyme activity, along with other immune parameters, helped us to understand how taurine influenced the immune function and contributed to avoiding oxidative stress of the S. rivoliana juveniles and their ability to respond to challenges such as lipopolysaccharide exposure. Future research is suggested to optimize the level of taurine for this species, as well as the use of other immunostimulants against LPS or bacterial challenge, to elucidate the mechanisms of defense of the juveniles of S. rivoliana against infection and how to improve its immunodefense responses. Declarations Interest conflict The authors declare no conflict of interest. Author Contribution All authors contributed significantly to this study. Conceptualization, methodology, software, formal analysis, investigation, data curation, writing—original draft preparation, visualization, review and editing: A.T.; Conceptualization, methodology, supervision, formal analysis, investigation, data curation, writing—original draft preparation, visualization, resources, funding acquisition, review and editing: D.T.-R.; methodology, software, formal analysis, investigation, data curation, writing—original draft preparation, visualization, review and editing: L.T.G-V; methodology, formal analysis, investigation, data curation, writing—original draft preparation, visualization, review and editing: M.A.H.-D.; visualization, writing, methodology, experimentation: A. B.; methodology, review and editing: M.M.-G. Acknowledgement The authors thank Kampachi Farms for providing juveniles; Pablo Monsalvo Spencer for technical support. Partial funding was provided by Consejo Nacional de Ciencia y Tecnología (grant CONACYT-PRONACES 321279 FOP07) and Kampachi Farms México Project n° 20464. Data Availability Statement Data is contained within the article. References Alves APDC, Paulino RR, Pereira RT, Costa DV, Rosa PV (2021) Nile tilapia fed insect meal: Growth and innate immune response in different times under lipopolysaccharide challenge. Aquaculture Research 52(2): 529-540. https://doi.org/10.1111/are.14911 Angulo M, Reyes-Becerril M, Cepeda-Palacios R, Angulo C (2020) Oral administration of Debaryomyces hansenii CBS8339-β-glucan induces trained immunity in newborn goats. Developmental & Comparative Immunology 105: 103597. https://doi.org/10.1016/j.dci.2019.103597 Angulo M, Reyes-Becerril M, Tovar-Ramírez D, Ascencio F, Angulo C (2018) Debaryomyces hansenii CBS 8339 β-glucan enhances immune responses and downstream gene signaling pathways in goat peripheral blood leukocytes. Developmental & Comparative Immunology 88:173-182. https://doi.org/10.1016/j.dci.2018.07.017 Aragão C, Gonçalves AT, Costas B, Azeredo R, Xavier MJ, Engrola S (2022) Alternative Proteins for Fish Diets: Implications beyond Growth. Animals 12:1211. https://doi.org/10.3390/ani12091211 Asencio-Alcudia GG, Sepúlveda-Quiroz CA, Pérez-Urbiola JC, Rodríguez-Jaramillo MDC, Teles A, Salas-Leiva JS, Martínez-García R, Jiménez-Martínez LD, Galaviz M, Tovar-Ramírez D, Alvarez-González CA (2023) Stress-Protective Role of Dietary α-Tocopherol Supplementation in Longfin Yellowtail ( Seriola rivoliana ) Juveniles. Fishes 8(10):526. https://doi.org/10.3390/fishes8100526 Bañuelos-Vargas I, López LM, Pérez-Jiménez A, Peres H (2014) Effect of fishmeal replacement by soy protein concentrate with taurine supplementation on hepatic intermediary metabolism and antioxidant status of totoaba juveniles ( Totoaba macdonaldi ). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 170:18-25. https://doi.org/10.1016/j.cbpb.2014.01.003 Biller JD, Polycarpo GDV, Moromizato BS, Sidekerskis APD, Silva TDD, Reis ICD, Fierro-Castro C (2021) Lysozyme activity as an indicator of innate immunity of tilapia ( Oreochromis niloticus ) when challenged with LPS and Streptococcus agalactiae. Revista Brasileira de Zootecnia 50:e20210053. https://doi.org/10.37496/rbz5020210053 Chen Y, Lin J, Zhao Y, Ma X, Yi H (2021) Toll-like receptor 3 (TLR3) regulation mechanisms and roles in antiviral innate immune responses. Journal of Zhejiang University-SCIENCE B 22(8):609-632. https://doi.org/10.1631/jzus.B2000808 Cheng CH, Guo ZX, Wan, AL (2018) The protective effects of taurine on oxidative stress, cytoplasmic free-Ca2+, and apoptosis of pufferfish ( Takifugu obscurus ) under low-temperature stress. Fish & Shellfish Immunolog , 77 :457 -464. https://doi.org/10.1016/j.fsi.2018.04.022 Cheong SH, Lee SH, Jeon YJ, Lee DS (2017) Mussel ( Mytilus coruscus ) Water Extract ContainingTaurine Prevents LPS-Induced Inflammatory Responses in Zebrafish Model. In Lee DH, Schaffer SW, Park E, Kim HW (Eds), Taurine 10 ( Vol. 975, pp. 931-942). Springer Netherlands. https://doi.org/10.1007/978-94-024-1079-2_74 De Pablo Sánchez R, Monserrat Sanz J, Prieto Martín A, Reyes Martín E, Álvarez De Mon Soto M, Sánchez García M (2005) Balance entre citocinas pro y antiinflamatorias en estados sépticos. Medicina Intensiva 29(3): 151-158. https://doi.org/10.1016/S0210-5691(05)74222-4 Dehghani R, Oujifard A, Mozanzadeh MT, Morshedi V, Bagheri D (2020) Effects of dietary taurine on growth performance, antioxidant status, digestive enzymes activities, and skin mucosal immune responses in yellowfin seabream, Acanthopagrus latus . Aquaculture 517:734795. https://doi.org/10.1016/j.aquaculture.2019.734795 Directive 2010/63. Directive (EU) 2010/63 of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific purposes. https://eur-lex.europa.eu/eli/dir/2010/63/oj. Giri SS, Kim HJ, Kim SG, Kim SW, Kwon J, Lee SB, Sukumaran V, Chang Park S (2020) Effectiveness of the guava leaf extracts against lipopolysaccharide-induced oxidative stress and immune responses in Cyprinus carpio . Fish & Shellfish Immunology 105 :164 -176. https://doi.org/10.1016/j.fsi.2020.06.004 Gunathilaka GLBE, Kim MG, Lee C, Shin J, Lee BJ, Lee KJ (2019) Effects of taurine supplementation in low fish meal diets for red seabream ( Pagrus major ) in low water temperature season. Fish Aquatic Sci 22, 23. https://doi.org/10.1186/s41240-019-0138-z Guzmán-Villanueva LT, Ascencio-Valle F, Macías-Rodríguez ME, Tovar-Ramírez D (2014) Effects of dietary β-1,3/1,6-glucan on the antioxidant and digestive enzyme activities of Pacific red snapper ( Lutjanus peru ) after exposure to lipopolysaccharides. Fish Physiology and Biochemistry 40 ( 3):827-837. https://doi.org/10.1007/s10695-013-9889-0 Han H, Zhang J, Chen Y, Shen M, Yan E, Wei C, Yu C, Zhang L, Wang T (2020) Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age. J Anim Sci.1;98(10):skaa311. https://doi: 10.1093/jas/skaa311 Han H, Zhang J, Chen Y, Shen M, Yan E, Wei C, Yu C, Zhang L, Wang T (2020). Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age. Journal of Animal Science 98 (10 ), skaa311. https://doi.org/10.1093/jas/skaa311 Hernández-Contreras A, Tovar-Ramírez D, Reyes-Becerril M (2021) Modulatory effect of Debaryomyces hansenii and oregano essential oil on the humoral immunity of skin mucus in Longfin yellowtail Seriola rivoliana . Aquaculture Research 52(2):749-762. https://doi.org/10.1111/are.14931Hernández-Contreras Á, Teles A, Salas-Leiva JS, Chaves-Pozo E, Tovar-Ramírez D (2023) Feed Additives in Aquaculture. In Arsenos G, Giannenas I (Eds.), Sustainable Use of Feed Additives in Livestock (pp. 811-846). Springer International Publishing. https://doi.org/10.1007/978-3-031-42855-5_28 Hernández-de Dios MA, Tovar-Ramírez D, Maldonado-García D, Galaviz- Espinoza MA, Barreto-Curiel F, Spanopoulos-Zarco M, Maldonado-García M (2024) Taurine improves juvenile Seriola rivoliana growth performance and biochemical profiles in blood serum and skeletal muscle. Latin American Journal of Aquatic Research 52(3): 443-458. https://doi.org/10.3856/vol52-issue3-fulltext-3204 Herrero MJ (2010) ABC de los «Toll-like receptors»: Relación con el desarrollo y progresión de enfermedades autoinmunes. Seminarios de la Fundación Española de Reumatología 11(4):135-143. https://doi.org/10.1016/j.semreu.2010.04.005 Holen E, Chen M, Fjelldal PG, Skjærven K, Sissener NH, Remø S, Prabhu AJ, Hamre K, Vikeså V, Subramanian S, Espe M (2022) Tailoring freshwater diets towards boosted immunity and pancreas disease infection robustness in Atlantic salmon post smolts. Fish & Shellfish Immunology 120:377-391. https://doi.org/10.1016/j.fsi.2021.11.019 Kim YS, Kim EK, Jeon NJ, Ryu BI, Hwang JW, Choi EJ, Moon SH, Jeon BT, Park PJ (2017) Antioxidant Effect of Taurine-Rich Paroctopus dofleini Extracts Through Inhibiting ROS Production Against LPS-Induced Oxidative Stress In Vitro and In Vivo Model. In Lee DH, Schaffer SW, Park E, Kim HW (Eds.), Taurine 10 (Vol. 975, pp. 1165-1177). Springer Netherlands. https://doi.org/10.1007/978-94-024-1079-2_93 Kumar S, Choubey AK, Srivastava PK (2022) The effects of dietary immunostimulants on the innate immune response of Indian major carp: A review, Fish & Shellfish Immunology 123:36-49. https://doi.org/10.1016/j.fsi.2022.02.039. Lange S, Guđmundsdottir BK, Magnadottir B (2001) Humoral immune parameters of cultured Atlantic halibut ( Hippoglossus hippoglossus L.). Fish & Shellfish Immunology 11(6):523-535. https://doi.org/10.1006/fsim.2000.0333 Li M, Lai H, Li Q, Gong S, Wang R (2016) Effects of dietary taurine on growth, immunity and hyperammonemia in juvenile yellow catfish Pelteobagrus fulvidraco fed all-plant protein diets. Aquaculture 450 :3 49-355. https://doi.org/10.1016/j.aquaculture.2015.08.013 Li, MY, Guo WQ, Guo GL, Zhu XM, Niu XT, Shan XF, Tian JX, Wang GQ, Zhang DM (2020) Effects of dietary astaxanthin on lipopolysaccharide-induced oxidative stress, immune responses and glucocorticoid receptor (GR)-related gene expression in Channa argus. Aquaculture 517:734816. https://doi.org/10.1016/j.aquaculture.2019.734816 Liu JX, Guo HY, Zhu KC, Liu BS, Zhang N, Zhang DC (2022) Effects of exogenous taurine supplementation on the growth, antioxidant capacity, intestine immunity, and resistance against Streptococcus agalactiae in juvenile golden pompano (Trachinotus ovatus) fed with a low-fishmeal diet. Frontiers in Immunology 13 : 1036821. https://doi.org/10.3389/fimmu.2022.1036821 Liu Y, Li F, Zhang L, Wu J, Wang Y, Yu H (2017) Taurine alleviates lipopolysaccharide-induced liver injury by anti-inflammation and antioxidants in rats. Molecular Medicine Reports 16 (5): 6512-6517. https://doi.org/10.3892/mmr.2017.7414 Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25(4):402-408. https://doi.org/10.1006/meth.2001.1262 Ma Y, Zhang Y, Li R, Deng S, Qin Q, Ran C, Hao Y, Zhang J, Zhu L (2022) Mechanism of taurine reducing inflammation and organ injury in sepsis mice. Cellular Immunology 375:104503. https://doi.org/10.1016/j.cellimm.2022.104503 Magnadóttir B (2006) Innate immunity of fish (overview). Fish & Shellfish Immunology 20(2):137-151. https://doi.org/10.1016/j.fsi.2004.09.006 Mazón-Suástegui J, Salas-Leiva J, Teles A, Tovar-Ramírez D (2019) Immune and Antioxidant Enzyme Response of Longfin Yellowtail ( Seriola rivoliana ) Juveniles to Ultra-diluted Substances Derived from Phosphorus, Silica and Pathogenic Vibrio. Homeopathy 108(01):043-053. https://doi.org/10.1055/s-0038-1672197 Ramos-Pinto L, Machado M, Calduch-Giner J, Pérez-Sánchez J, Dias J, Conceição LEC, Silva TS, Costas B (2021) Dietary Histidine,Threonine, or Taurine Supplementation Affects Gilthead Seabream ( Sparus aurata ) Immune Status. Animals 11:1193. https://doi.org/10.3390/ani11051193 Reyes-Becerril M, Gijón D, Angulo M, Vázquez-Martínez J, López MG, Junco E, Armenta J, Guerra K, Angulo C (2021) Composition, antioxidant capacity, intestinal, and immunobiological effects of oregano ( Lippia palmeri Watts) in goats: Preliminary in vitro and in vivo studies. Tropical Animal Health and Production 53(1): 101. https://doi.org/10.1007/s11250-020-02450-z Rodriguez MF, Wiens GD, Purcell MK, Palti Y (2005) Characterization of Toll-like receptor 3 gene in rainbow trout ( Oncorhynchus mykiss ). Immunogenetics, 57(7):510-519. https://doi.org/10.1007/s00251-005-0013-1 Salze GP, Davis DA (2015) Taurine: A critical nutrient for future fish feeds. Aquaculture 437:215-229. https://doi.org/10.1016/j.aquaculture.2014.12.006 Sampath, WWHA, Rathnayake RMDS, Yang M, Zhang W, Mai K (2020) Roles of dietary taurine in fish nutrition. Mar Life Sci Technol 2:360–375. https://doi.org/10.1007/s42995-020-00051-1 Saravia J, Paschke K, Pontigo JP, Nualart D, Navarro JM, Vargas-Chacoff L (2022) Effects of temperature on the innate immune response on Antarctic and sub-Antarctic fish Harpagifer antarcticus and Harpagifer bispinis challenged with two immunostimulants, LPS and Poly I:C: In vivo and in vitro approach. Fish & Shellfish Immunology 130:391-408. https://doi.org/10.1016/j.fsi.2022.09.025 Secretaria de Agricultura (2001) Norma Oficial Mexicana NOM-062-ZOO-1999, Especificaciones Técnicas Para La Producción, Cuidado y Uso de los Animales de Laboratorio. Ciudad de México: SA. Shi Y, Hu Y, Wang Z, Zhou J, Zhang J, Zhong H, Fu G, Zhong L (2021) The Protective Effect of Taurine on Oxidized Fish-Oil-Induced Liver Oxidative Stress and Intestinal Barrier-Function Impairment in Juvenile Ictalurus punctatus . Antioxidants 10(11):1690. https://doi.org/10.3390/antiox10111690 Shi Y, Zhong L, Fan Y, Zhang J, Dai J, Zhong H, Fu G, Hu Y (2022) Taurine inhibits hydrogen peroxide-induced oxidative stress, inflammatory response and apoptosis in liver of Monopterus albus . Fish & Shellfish Immunology 128:536-546. https://doi.org/10.1016/j.fsi.2022.08.029 Tan X, Sun Z, Zhu X, Ye C (2018) Dietary supplementation with taurine improves ability to resist ammonia stress in hybrid snakehead ( Channa maculatus ♀ × Channa argus ♂). Aquaculture Research 49 (10 ):3400-3410. https://doi.org/10.1111/are.13804 Teles A, Alvarez-González CA, Llera-Herrera R, Gisbert E, Salas-Leiva J, Del Carmen Rodríguez-Jaramillo M, Tovar-Ramírez D (2022) Debaryomyces hansenii CBS 8339 promotes larval development in Seriola rivoliana . Aquaculture 560:738587. https://doi.org/10.1016/j.aquaculture.2022.738587 Teles A, Salas-Leiva J, Alvarez-González CA, Tovar-Ramírez D (2019) Changes in digestive enzyme activities during early ontogeny of Seriola rivoliana . Fish Physiology and Biochemistry 45(2):733-742. https://doi.org/10.1007/s10695-018-0598-6 Teles A, Salas-Leiva J, Alvarez-González CA, Gisbert E, Ibarra-Castro L, Urbiola JCP, Tovar-Ramírez D (2017) Histological study of the gastrointestinal tract in longfin yellowtail ( Seriola rivoliana ) larvae. Fish Physiology and Biochemistry 43(6):1613-1628. https://doi.org/10.1007/s10695-017-0397-5 Wang P, Zhao C, Wang C, Fan S, Yan L, Qiu L (2018) TLR3 gene in Japanese sea perch ( Lateolabrax japonicus ): Molecular cloning, characterization and expression analysis after bacterial infection. Fish & Shellfish Immunology 76:347-354. https://doi.org/10.1016/j.fsi.2018.01.013 Yan LC, Feng L, Jiang WD, Wu P, Liu Y, Jiang J, Tang L, Tang WN, Zhang YA, Yang J, Zhou XQ, Kuang SY (2019) Dietary taurine supplementation to a plant protein source-based diet improved the growth and intestinal immune function of young grass carp ( Ctenopharyngodon idella ) Aquaculture Nutrition 25:873–896. https://doi.org/10.1111/anu.12907 Zhang J, Xu X, Zhu H, Wang Y, Hou Y, Liu Y (2019) Dietary fish oil supplementation alters liver gene expressions to protect against LPS-induced liver injury in weanling piglets. Innate Immunity 25(1):60-72. https://doi.org/10.1177/1753425918821420 Zhang XT, Zhang GR, Shi ZC, Yuan YJ, Zheng H, Lin L, Wei KJ, Ji W (2017) Expression analysis of nine Toll-like receptors in yellow catfish ( Pelteobagrus fulvidraco ) responding to Aeromonas hydrophila challenge. Fish & Shellfish Immunology 63:384-393. https://doi.org/10.1016/j.fsi.2017.02.021 Zhu X, Li M, Liu X, Xia C, Niu X, Wang G, Zhang D (2020) Effects of dietary astaxanthin on growth, blood biochemistry, antioxidant, immune and inflammatory response in lipopolysaccharide‐challenged Channa argus . Aquaculture Research 51 (5 ):1980-1991. https://doi.org/10.1111/are.14550 Zhu X, Li M, Liu X, Xia C, Niu X, Wang G, Zhang D (2020) Effects of dietary astaxanthin on growth, blood biochemistry, antioxidant, immune and inflammatory response in lipopolysaccharide‐challenged Channa argus . Aquaculture Research 51(5):1980-1991. https://doi.org/10.1111/are.14550 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4926904","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":359308291,"identity":"d5cb2ffb-4c06-4dfb-8794-a70333a047a0","order_by":0,"name":"Andressa Teles","email":"","orcid":"","institution":"Centro de Investigaciones Biológicas del Noroeste SC","correspondingAuthor":false,"prefix":"","firstName":"Andressa","middleName":"","lastName":"Teles","suffix":""},{"id":359308292,"identity":"cbfecff0-6ab2-4a9d-8a99-69b675ecd214","order_by":1,"name":"Laura Guzmán-Villanueva","email":"","orcid":"","institution":"CONACYT - Centro de Investigaciones Biológicas del Noroeste (CIBNOR)","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"","lastName":"Guzmán-Villanueva","suffix":""},{"id":359308293,"identity":"092d1e60-b210-4289-92a9-b3c242bbb844","order_by":2,"name":"Marco A. Hernández-de Dios","email":"","orcid":"","institution":"Centro de Investigaciones Biológicas del Noroeste SC","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"A. Hernández-de","lastName":"Dios","suffix":""},{"id":359308294,"identity":"24a6830f-2fac-4534-a302-a8832d68db1c","order_by":3,"name":"Minerva Maldonado-García","email":"","orcid":"","institution":"Centro de Investigaciones Biológicas del Noroeste SC","correspondingAuthor":false,"prefix":"","firstName":"Minerva","middleName":"","lastName":"Maldonado-García","suffix":""},{"id":359308295,"identity":"c21e4f51-138e-4777-a38e-49f49ad75410","order_by":4,"name":"Dariel Tovar-Ramírez","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYDCCA2BSgpmfgbGNSC3HwKQNu2QDiVrS+A0OMLARp4PvfvMxiZ97DksbHz/c9rig4h6D7owE/Fokj7GlSfY8O2xsdiax3XjGmWIGszMH8GsxOMZjbMBz4HCy2Q3GNmnetgQGs+MNhLUY/jlwuH7zDJiWwwT8AtRi+JjnQBqzgQSxtkgeS0t8LHPAhlkC5BeeMwk8BP3Cd/jwgYNvDgCjsv34s8c8FQlyZjcSCLgMHfCQqH4UjIJRMApGATYAANoyQ8ARM6pCAAAAAElFTkSuQmCC","orcid":"","institution":"Centro de Investigaciones Biológicas del Noroeste SC","correspondingAuthor":true,"prefix":"","firstName":"Dariel","middleName":"","lastName":"Tovar-Ramírez","suffix":""}],"badges":[],"createdAt":"2024-08-16 19:53:56","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4926904/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4926904/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65434448,"identity":"fb6388a2-6866-4147-8e69-928997987daf","added_by":"auto","created_at":"2024-09-27 12:10:39","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":24959,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA)\u003c/strong\u003e Superoxide dismutase (SOD) and \u003cstrong\u003eB) \u003c/strong\u003ecatalase activities of \u003cem\u003eSeriola rivoliana\u003c/em\u003e juveniles fed with different exogenous taurine amounts (0, 1 and 2%) after 72h LPS injection. Data are shown as mean±SD. Significant differences between treatments are indicated by letters (p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4926904/v1/abd9065afd3812b08cd0dc6b.png"},{"id":65434405,"identity":"404277fe-7c94-4101-b505-3b8c509b542b","added_by":"auto","created_at":"2024-09-27 12:10:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":18100,"visible":true,"origin":"","legend":"\u003cp\u003eLysozyme activity of \u003cem\u003eSeriola rivoliana\u003c/em\u003e juveniles fed with different exogenous taurine amounts (0, 1 and 2%) after 72h LPS injection. Data are shown as mean±SD. Significant differences between treatments are indicated by letters (p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4926904/v1/5c726415abf993bcbbed5f8d.png"},{"id":65434452,"identity":"7ac7364e-f0ea-49fa-81a6-29af8822d9a3","added_by":"auto","created_at":"2024-09-27 12:10:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":57780,"visible":true,"origin":"","legend":"\u003cp\u003eRelative gene expression of \u003cstrong\u003eA)\u003c/strong\u003e \u003cem\u003eil-1β\u003c/em\u003e and \u003cstrong\u003eB)\u003c/strong\u003e \u003cem\u003etnf-α\u003c/em\u003eof \u003cem\u003eSeriola rivoliana\u003c/em\u003e juveniles fed with different exogenous taurine amounts (0, 1 and 2%) at 0, 24 and 72 hours post LPS injection. Data are shown as mean±SD. Significant differences between treatments are indicated by letters (p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4926904/v1/0dff313be67d74a44b998550.png"},{"id":65434409,"identity":"37728d2d-9f7b-40fd-aec3-e34fb23bbb41","added_by":"auto","created_at":"2024-09-27 12:10:38","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":58533,"visible":true,"origin":"","legend":"\u003cp\u003eRelative gene expression of \u003cstrong\u003eA)\u003c/strong\u003e \u003cem\u003etlr-3\u003c/em\u003e and \u003cstrong\u003eB)\u003c/strong\u003e \u003cem\u003emarco\u003c/em\u003eof \u003cem\u003eSeriola rivoliana\u003c/em\u003e juveniles fed with different exogenous taurine amounts (0, 1 and 2%) at 0, 24 and 72 hours post LPS injection. Data are shown as mean±SD. Significant differences between treatments are indicated by letters (p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4926904/v1/9533f1bbb0e33a3d15051f76.png"},{"id":65434303,"identity":"f8be5553-d0ba-4303-a411-73450211fd26","added_by":"auto","created_at":"2024-09-27 12:10:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":59135,"visible":true,"origin":"","legend":"\u003cp\u003eRelative gene expression of \u003cstrong\u003eA)\u003c/strong\u003e \u003cem\u003eil-10\u003c/em\u003e and \u003cstrong\u003eB)\u003c/strong\u003e \u003cem\u003emyd-88\u003c/em\u003eof \u003cem\u003eSeriola rivoliana\u003c/em\u003e juveniles fed with different exogenous taurine amounts (0, 1 and 2%) at 0, 24 and 72 hours post LPS injection. Data are shown as mean±SD. Significant differences between treatments are indicated by letters (p\u0026lt;0.05).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4926904/v1/e675c86827de40ef1741fa6d.png"},{"id":73648262,"identity":"3eb87c09-6696-43d3-8368-99757099bdbe","added_by":"auto","created_at":"2025-01-13 09:10:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":952420,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4926904/v1/f312c4ab-f28a-40d6-a6f4-7bdc121dc648.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Taurine enhances antioxidant enzyme activity and immune response in Seriola rivoliana juveniles after lipopolysaccharide injection","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe aquaculture industry faces the challenge of disease outbreaks that hinder production worldwide, hence, prioritizing health maintenance is crucial in contemporary fish farming. It is vital to develop strategies for enhancing fish's immune system and well-being (Ramos-Pinto et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Kumar et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this sense, the development and assessment of feed additives come to face these common issues. These additives are commonly employed as immunostimulants to enhance the overall health condition of aquatic animals, thereby preventing or controlling disease outbreaks (Hern\u0026aacute;ndez-Contreras et al. 2023), and are generally added in a basal diet to produce functional diets. Functional diets are defined as those that go beyond meeting the fundamental nutritional needs of farmed fish, playing a role in improving growth, survival, and overall health, by incorporating particular additives that possess nutritional or health-boosting qualities (Ramos-Pinto et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAn additive gaining attention in fish feed formulations is taurine. Taurine is a β-sulphonic amino acid that has been identified as an essential amino acid in several fish species, notably in juvenile and larval stages (Salze and Davis, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Sampath et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), especially concerning marine carnivorous fish (Aragao et al. 2022). It has been shown to have several beneficial effects such as reducing oxidative damage and inflammation in the organism exposed to toxic substances and stressors (Yan et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Gunathilaka et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Ramos-Pinto et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Holen et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Shi et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecent evidence from animal models indicates that lipopolysaccharides (LPS) can induce inflammation and oxidative stress (Zhang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). LPS, which is also referred to as endotoxin, is located in the outer membrane of Gram-negative bacteria. It is well known that in mammals and higher vertebrates, the LPS is extremely toxic even in low doses, however, in fish the LPS does not have the same toxicity but is capable of triggering the activation of the immune system and being evaluated such as a bacterial infection (Guzm\u0026aacute;n-Villanueva et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Alves et al. 2020; Zhu et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Biller et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Saravia et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecently, the use of functional additives and immunomodulators have been evaluated on the immune system of \u003cem\u003eS. rivoliana\u003c/em\u003e juveniles (Maz\u0026oacute;n-Suastegui et al. 2019, Hern\u0026aacute;ndez-Contreras et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Asencio-Alcudia et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The longfin yellowtail (Carangidae) is a fast-growing tropical marine species with high-quality meat, making it a promising candidate for diversifying global aquaculture production (Teles et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; 2018; \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThis study aims to determine whether the inclusion of taurine in the marine fish commercial diet of juveniles of \u003cem\u003eS. rivoliana\u003c/em\u003e can modulate their immune and antioxidant response to a challenge with LPS. For this purpose, innate and adaptive immune-related genes (\u003cem\u003eil1-β\u003c/em\u003e, \u003cem\u003eil-10, tnf-α, myd-88, tlr-3, c3, and marco\u003c/em\u003e) and enzyme (lysozyme), and antioxidant enzymes (superoxide dismutase, catalase) were evaluated. To our understanding, this is the first study aimed to explore the effect of taurine supplementation on the antioxidant and immune capacity of juveniles of \u003cem\u003eS. rivoliana\u003c/em\u003e after the LPS challenge.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003eEthics statement\u003c/p\u003e \u003cp\u003e This study adhered to the guidelines established by the European Union Council (2010/63/EU) and the Mexican Government (NOM-062\u0026mdash;ZOO-1999) about the production, care, and use of experimental animals. Additionally, the research protocols and procedures were meticulously reviewed and approved by an internal committee at CIBNOR, in accordance with the ARRIVE guidelines.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eNutritional trial\u003c/h2\u003e \u003cp\u003ePrevious to the LPS challenge, a nutritional trial was performed by Hern\u0026aacute;ndez-de Dios et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) in which juveniles of \u003cem\u003eSeriola rivoliana\u003c/em\u003e were fed with two different diets (Taurine 1% - TAU1%; Taurine 2% - TAU2%) plus the control treatment (0% Taurine \u0026ndash; C) for 60 days. Initial and final body weight and furcal length at the nutritional trial are provided by Hern\u0026aacute;ndez-de Dios et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLPS-challenge\u003c/h3\u003e\n\u003cp\u003eFor LPS exposure, we followed the protocol performed by Guzm\u0026aacute;n-Villanueva et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) with some modifications. Briefly, after 60 days of nutritional trial, being fed with different taurine concentrations (0, 1%, and 2%) juveniles of \u003cem\u003eS. rivoliana\u003c/em\u003e were assigned to be challenged with LPS (\u003cem\u003eSalmonella typhimurium\u003c/em\u003e (Sigma L \u0026ndash; 6511) \u0026ndash; 1 mg Kg \u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in 1 mL Saline solution). Experimental and control groups [LPS injected\u0026thinsp;=\u0026thinsp;Taurine 1%, Taurine 2% and Control (+); Saline solution injected\u0026thinsp;=\u0026thinsp;Control (-)] were kept in 3000 L tanks (9 fish per tank) during 72h after intraperitoneal injection. Dissolved oxygen was kept at 7.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, water exchange 100% day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and temperature 24\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0\u0026deg;C.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSampling\u003c/h2\u003e \u003cp\u003eFor biochemical analysis, fish were sampled (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3) for skin mucus (72h post-injection), and molecular analysis for head kidney (\u003cem\u003en\u0026thinsp;=\u0026thinsp;3\u003c/em\u003e) at 0, 24 hours, and 72 hours post-injection. Fish were first anesthetized with clove oil (eugenol), and skin mucus was collected and preserved in PBS at -80\u0026deg;C until analysis. For molecular analysis, after being anesthetized, fish were euthanized by a quick and humane medullary cut using sharp scissors. Following euthanasia, samples of the head kidney were obtained and preserved in RNAlater\u0026reg; (Thermo-Fisher Scientific, Carlsbad, CA, USA) at -80\u0026deg;C for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMolecular analysis\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003eRNA extraction\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from the head kidney. The samples were homogenized using a fast prep system (Thermo-Fisher Scientific, Carlsbad, CA, USA) with silica pearls at 5 seconds per minute for 30 seconds in 1000 \u0026micro;L of Trizol Reagent (Invitrogen, Carlsbad, CA, USA). After homogenization, the procedure for RNA isolation was performed following the manufacturer\u0026acute;s instructions.\u003c/p\u003e \u003cp\u003eThe amount and quality of the total RNA were determined using a Nanodrop spectrophotometer (Thermo-Fisher Scientific, Carlsbad, CA, USA) and by agarose electrophoresis (1.5%) with Sybr Safe DNA Gel Stain (Invitrogen, Paisley, United Kingdom).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDNAse treatment\u003c/h2\u003e \u003cp\u003eTo guarantee the elimination of genomic DNA, a DNAse treatment was performed. For each 1 \u0026micro;g of RNA, a mix of 1 \u0026micro;L of buffer 10X, 1 \u0026micro;L of Dnase, and DEPC water is made to obtain a total of 10 \u0026micro;L, then incubated at 37\u0026deg; C for 30 minutes followed by adding 1 \u0026micro;L DNAse Stop Solution and incubated at 65\u0026deg;C for 10 minutes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ecDNA synthesis\u003c/h2\u003e \u003cp\u003eTo generate complementary DNA by the reverse transcriptase, 1 \u0026micro;L of oligo-dT was mixed with 2 \u0026micro;g of total RNA then incubated at 70\u0026deg;C for 10 minutes. A mix of 1 \u0026micro;L dNTP (10mM), 2.4 \u0026micro;L 25mM MgCl\u003csub\u003e2\u003c/sub\u003e, 4\u0026micro;L 5X Reaction buffer (ImProm-II\u0026trade;), 2 \u0026micro;l Ribonuclease inhibitor (RNasin\u0026reg;) 1\u0026micro;L Reverse transcriptase (Improm-II\u0026trade;) and 5.6 \u0026micro;L Nuclease free-water. The protocol for reverse transcription was the following: 25\u0026deg;C for 5 minutes, 42\u0026deg;C for 60 minutes, and 70\u0026deg;C for 15 minutes, the cDNA was stored at -20\u0026deg;C until further qPCR analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eQuantification of relative gene expression was conducted through RT-qPCR analysis, utilizing a CFX96 Touch\u0026trade; Real-Time Thermal Cycler CFX96 (Bio-Rad) with a 10 \u0026micro;L total volume reaction per sample. Each reaction consisted of 5 \u0026micro;L of SsoAdvanced\u0026trade; Universal SYBR\u0026reg; Green Supermix (Bio-Rad), 2.0 \u0026micro;L cDNA, and 0.1 \u0026micro;L of primers as indicated in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The experimental procedures included an initial cycle of 95\u0026deg;C for 30 s, followed by 40 cycles of 95\u0026deg;C for 5 s and 60\u0026deg;C for 15 s, concluding with a melting curve analysis following the standard 60-cycle program to validate the amplification of a singular product in each reaction. The primers utilized in this investigation were designed based on the transcriptome of \u003cem\u003eS. rivoliana\u003c/em\u003e. (BioSample accessions SAMN20923996, SAMN20923997, SAMN20923998, SAMN20923999, SAMN20924000, SAMN20924001, SAMN20924002, SAMN20924003. The expression of the target genes was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method as described by (Livak and Schmittgen, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), normalized with the reference gene \u003cem\u003e18S\u003c/em\u003e, and the negative control group (C-) whose expression was set at 1.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOligonucleotide primers were used for the qPCR analysis of target genes of \u003cem\u003eSeriola rivoliana\u003c/em\u003e juveniles.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFunction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequences (5\u0026rsquo;- 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmplicon size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003emarco\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eScavenger receptor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFw: GACTCAGTGGACAACGTGG\u003c/p\u003e \u003cp\u003eRv: GTCTCCTTTGTCTCCTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e220\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eil-10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAnti-inflammatory cytokine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFw: ACAGTGGTATCAGGGATCCTCA\u003c/p\u003e \u003cp\u003eRv: CCGACTGTGTAGGGTATGACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e155\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eil-1β\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProinflammatory cytokine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFw: AGCCAGCAGAGACACTTAG\u003c/p\u003e \u003cp\u003eRv: TGGGTAAAGGTGGCAAGTAG3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e124\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003etnf-α\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProinflammatory cytokine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFw: TTCATGCCTCTTAGCCACAGG\u003c/p\u003e \u003cp\u003eRv: CTCCGTCCGTCTCTGTAACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e131\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003emyd-88\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSignaling molecule stimulator\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFw: ATGAAGCGACGAAAAACCCC\u003c/p\u003e \u003cp\u003eRv: AAGACTGAAGATCCTCCACAATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e135\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003etlr3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePattern recognition receptor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFw: CAAATGTTACCAGATTGCCAAACC\u003c/p\u003e \u003cp\u003eRv: TTACCATCAGCATCGGGACAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e168\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e18s\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18s ribosomal RNA (reference gene)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFw: CTGAACTGGGGCCATGATTAAGAG\u003c/p\u003e \u003cp\u003eRv: GGTATCTGATCGTCGTCGAACCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e165\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBiochemical analyses\u003c/h2\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003eSOD activity\u003c/h2\u003e \u003cp\u003eSOD activity was assayed according to Guzm\u0026aacute;n-Villanueva et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), briefly, a cocktail containing phosphate buffer (50 mM pH 7.8), cytochrome C 0.012 mM, xanthine (0.1 mM) and EDTA (0.1 mM), where SOD competes with cytochrome c for superoxide ions generated by a reaction between xanthine and xanthine oxidase (0.025 IU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e SIGMA). SOD activity was determined by the level of inhibition percentage of reduction of cytochrome c at 550 nm.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCatalase activity\u003c/h2\u003e \u003cp\u003eThe catalase (CAT) activity was measured by mixing the head kidney homogenate extract (20 \u0026micro;L) with 100 \u0026micro;L of phosphate buffer (100 mM, pH 7.0), 30 \u0026micro;L of absolute methanol and 20 \u0026micro;L of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (30%). The mixture was incubated in a shaker (120 rpm) for 20 min at room temperature. After incubation, 30 \u0026micro;L of KOH (10 M) and 30 \u0026micro;L of diluted 4-Amino-3-hydrazino-5-mercapto-1,2,4,-triazole (Alfa Aesar, Ward Hill, MA, USA) (46 mM in 0.5 M HCl solution) reagent were added, and incubated for 10 minutes in a shaker. Finally, 10\u0026micro;L of KIO\u003csub\u003e4\u003c/sub\u003e was added and the plate was incubated for 5 minutes in a shaker at room temperature. Absorbance was read at 540 nm. The formation of formaldehyde in each sample was calculated using a formaldehyde standard curve. CAT activity was calculated using the following equation:\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:\\varvec{C}\\varvec{A}\\varvec{T}\\:\\varvec{a}\\varvec{c}\\varvec{t}\\varvec{i}\\varvec{v}\\varvec{i}\\varvec{t}\\varvec{y}=\\frac{\\mu\\:M\\:formaldehyde}{20\\:min}*sample\\:dilution=nmol/min/mL$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eLysozyme activity\u003c/h2\u003e \u003cp\u003eBased on the method by Lange et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) with modifications, on a flat-bottomed 96-well microtitre plate, 100 \u0026micro;L of 0.4 mg mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e suspension of \u003cem\u003eMicrococcus lysodeikticus\u003c/em\u003e (Sigma-Aldrich, St. Louis, USA) in 0.05 mol L-1 phosphate buffer (pH 5.2) were added to 100 \u0026micro;L of homogenate (1:10 dilution) and the measurements were made at 450 nm every 2 min during 60 min using a microplate reader Varioskan Flash, (Thermo Fisher Scientific, USA). A unit of lysozyme activity was defined as the amount of homogenate causing a decrease in absorbance of 0.001 units per minute. For the positive control, the homogenate was replaced by 2\u0026micro;g mL-1 Hen Egg White lysozyme (Sigma L-7001). Homogenate was replaced by phosphate buffer for the negative control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eProtein determination\u003c/h2\u003e \u003cp\u003eTo determine specific activity, protein content was measured in the homogenates as described by Bradford (1976) using Bio-Rad Protein assay dye reagent (BioRad 500\u0026thinsp;\u0026minus;\u0026thinsp;0205) and bovine serum albumin (BSA, A7906; Sigma-Aldrich, Madrid, Spain) as the standard. Samples were assayed in triplicates in 96-well and read at 595 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eMolecular and biochemical analyses were performed in triplicate for each sample and are shown as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;Standard deviation (SD). One-way and two-way analysis of variance (ANOVA) with treatment and time as independent variables were performed. Shapiro-Wilk test for normality and Levene\u0026acute;s test for homoscedasticity was previously performed (logarithmic transformation was performed when data did not fit normality), then a Tukey\u0026rsquo;s \u003cem\u003epost hoc\u003c/em\u003e test was carried out when significant differences between treatments were detected (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The statistical analysis and plot were performed using the software SPSS Version 29 (Armonk, NY, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eExperimental fish did not show mortality after LPS administration nor at the final of the experiment.\u003c/p\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme activity\u003c/h2\u003e \u003cp\u003eData presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA shows the high activity of SOD in TAU 1% and TAU 2% treatments when compared with C\u0026thinsp;+\u0026thinsp;and C-, no statistical differences were observed between TAU 1% and TAU 2%. When compared with C-, the C\u0026thinsp;+\u0026thinsp;treatment shows higher activity of SOD in mucus at 72 hours post-injection. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB shows the highest activity of catalase in the TAU 2%, followed by the TAU 1% treatment. No differences between C- and C+, related to catalase activity, were detected.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eRegarding lysozyme activity, TAU 1% and TAU 2% presented higher values which were statistically different from C\u0026thinsp;+\u0026thinsp;and C-. No differences in lysozyme activity were observed between C\u0026thinsp;+\u0026thinsp;and C- (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eImmune system gene expression\u003c/h2\u003e \u003cp\u003eSignificant overexpression of all immune-related genes evaluated in this study was observed at 24 h post-LPS injection when compared with 0h and 72h post-injection (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Regarding the \u003cem\u003eil-1β\u003c/em\u003e gene, at the beginning of the trial, the fish fed with a control diet showed higher expression of this gene compared to TAU 1% and TAU 2% group; at 24h a significant overexpression was observed at TAU 2% treatment when compared to C+ (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and TAU 1% (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) at the same period (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The \u003cem\u003etnf-α\u003c/em\u003e gene was overexpressed at the beginning of the trial in the control group when compared with TAU 1% and TAU 2%, however, at 24 h post-injection, presented a significant difference between the TAU 2% and C+, where the former treatment, this gene was overexpressed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). For the \u003cem\u003etlr-3\u003c/em\u003e gene, overexpression was observed in control group previous to the LPS-injection when compared with TAU 1% and TAU 2% group, whereas, at 24h post-injection, an overexpression was observed in TAU 2% when compared to C\u0026thinsp;+\u0026thinsp;and TAU 1% (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eRegarding the \u003cem\u003emarco\u003c/em\u003e gene, at 0h TAU 2% showed overexpression compared to the other groups at the same period. At 72 h post-injection, overexpression was observed in the C\u0026thinsp;+\u0026thinsp;group when compared to the different treatments. No differences were observed for this gene at 24h (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eOverexpression of \u003cem\u003eil-10\u003c/em\u003e was observed at the beginning of the trial in the control group compared to the other groups. At 72 h post-injection, C\u0026thinsp;+\u0026thinsp;presented overexpression compared to the TAU 1% group. No differences were observed between the treatments at 24 h post-injection (Fig.\u0026nbsp;5A).\u003c/p\u003e \u003cp\u003eNo differences between the treatments in each period were observed for the \u003cem\u003emyd-88\u003c/em\u003e gene (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;5B).\u003c/p\u003e \u003cp\u003eDuring the trial, the expression from all the measured genes in the different treatments showed the same pattern, at 0h low gene expression was observed, then a peak of expression was observed followed by a drop at 72h, which in some cases, presented the same expression of the 0h.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDue to the environment in which they are kept, aquaculture fish are highly susceptible to bacterial infections, which makes producers increasingly seek solutions to these problems through the use of immunostimulants. In this sense, there is evidence that the use of taurine can provide an immunomodulatory and antioxidant effect, capable of improving animal health and welfare (Ba\u0026ntilde;uelos et al. 2014; Dehghani et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the present study, S. \u003cem\u003erivoliana\u003c/em\u003e juveniles were fed with different amounts of exogenous taurine (0, 1, and 2%) for 8 weeks and then exposed to an LPS challenge for 72h. We observed that juveniles of \u003cem\u003eS. rivoliana\u003c/em\u003e fed with TAU 1% and TAU 2% led to a significant enhancement in SOD and CAT activities after the challenge. Similar to our research, Shi et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) found that \u003cem\u003eMonopterus albus\u003c/em\u003e fed with different taurine doses during 8 weeks of feeding trial when challenged with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e showed higher SOD and CAT when compared with the control-fed group. In other fish species, under different challenges such as ammonia-challenged hybrid snakehead \u003cem\u003eChanna maculatus\u003c/em\u003e♀ \u0026times; \u003cem\u003eChanna argus\u003c/em\u003e♂ (Tan et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e); low temperature stressed \u003cem\u003eTakifugu obscurus\u003c/em\u003e (Cheng et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) taurine showed its antioxidant effect improving antioxidant enzyme activity.\u003c/p\u003e \u003cp\u003eIn studies performed by Cheong et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and Kim et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) using Taurine-Rich \u003cem\u003eParoctopus dofleini\u003c/em\u003e and mussel water extracts, the authors found a reduction of ROS in embryos and larvae of zebrafish \u003cem\u003eDanio rerio\u003c/em\u003e exposed to an LPS challenge when compared to the control group (No extract). In terrestrial animals, taurine administration effects are similar to our findings; rats and broiler chickens fed diet taurine when challenged with LPS, presented improvement in their antioxidant capacity increasing the SOD and CAT activity (Liu et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDuring and after a challenge, the organism passes through stress that imbalances its homeostasis and might generate oxidative stress by improving the production of reactive oxygen species (ROS), which plays a crucial role in cellular signaling pathways and the immune system response, however, excessive production and accumulation of ROS can harm the organism when the cell fails to detoxify or repair properly the damage caused by these molecules. As part of the defense mechanism after a challenge, the immune response is activated which may produce ROS as a defense mechanism against the pathogen, in response, the activity of antioxidant enzymes might increase to neutralize the excess of ROS and prevent oxidative damage to the host\u0026acute;s cells and tissues. Two important antioxidant enzymes involved in this process are: 1) superoxide dismutase (SOD) which plays a critical role in eliminating harmful ROS (superoxide anion) and; 2) catalase (CAT), which catalyzes excess ROS (hydrogen peroxide) to produce a disproportionation reaction and reduce hydrogen peroxide to water as part of the antioxidant defense to maintain cellular homeostasis (Zhu et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Reyes-Becerril et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). These antioxidant enzymes are complementary to prevent the excessive accumulation of ROS.\u003c/p\u003e \u003cp\u003eThe antioxidant properties of taurine in fish have been confirmed by several studies (Ba\u0026ntilde;uelos et al. 2014; Dehghani et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Shi et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), although taurine itself is not able to scavenge ROS, it exerts its antioxidant action by inhibiting the production of ROS by increasing activities of antioxidant enzymes (Liu et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). LPS possesses pro‑oxidative action via the induction of excessive production of reactive oxygen species (ROS) (Liu et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), in the present study it can be shown that taurine can alleviate this process by increasing antioxidant activities after the LPS challenge when compared to the C\u0026thinsp;+\u0026thinsp;group. It is worth mentioning that, because of its biochemical composition, LPS mimics a gram-negative bacterial infection, so the host immune-related system is capable of detecting it and then initiating a cascade of responses.\u003c/p\u003e \u003cp\u003eThe detection of pathogens by pattern recognition receptors (PPR) is essential for triggering innate immune responses and subsequent host immunity through various signaling cascades, this includes enhanced lysozyme production, which aids in the elimination of the pathogen by hydrolyzing the \u0026szlig;-linked glycosidic bonds in the bacterial cell wall peptidoglycans (Biller et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this sense, it is important to notice the efficacy of the higher doses of taurine in the present study as an immunostimulant that promoted increased mucus lysozyme activity after the juveniles were challenged with LPS when compared to the C\u0026thinsp;+\u0026thinsp;and C- groups. Similar to our findings, Dehghani et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) reported an increase in mucosal lysozyme when \u003cem\u003eAcanthopagrus latus\u003c/em\u003e was fed with a taurine-rich diet (\u0026ge;\u0026thinsp;1.25%). The same was observed in \u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e fed with higher levels of taurine (1.6, 2.13, and 2.55%), with values of lysozyme activity increasing with increasing dietary taurine levels (Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Regarding a closer species from the same family, the golden pompano \u003cem\u003eTrachinotus ovatus\u003c/em\u003e showed a similar pattern when fed higher levels of taurine in the diet, which increased lysozyme activity (Liu et al. 2015). There seems to be a positive correlation between diet taurine level and lysozyme activity, however, further research on this topic must be performed to standardize the amounts, way of administration, or delivery of taurine. When it comes to an LPS challenge, this correlation seems to be the opposite. Some studies have demonstrated that when the organisms are exposed to different doses of LPS, the lysozyme activity decreases when compared to the control group (no LPS injection) (Alves et al. 2020; Giri et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhu et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Biller et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) which could indicate an immune depression status of the organism, however, it seems to depend on the dose, and tissue evaluated and species-specific, in our study, no differences in mucus lysozyme activity were found between C- and C+, which may indicate that even the LPS promoted a host immune response, the dose of LPS were not sufficiently higher to trigger a decrease in the lysozyme activity. The immune response in fish is predominantly influenced by humoral factors, including lysozyme, a critical constituent of the innate immune system found widely in bodily fluids, which is a protein that serves as a dependable marker that mirrors the health condition of a fish (Zhu et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLysozyme plays a key role in the innate immune response by acting against microbial invasion, activating the complement system, and facilitating the destruction and removal of foreign particles (Reyes-Becerril 2017; Giri et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In addition to its primary role in combating Gram-positive bacteria, lysozyme, which is present in the mucus, lymphoid tissue, plasma, and other bodily fluids of most fish species, can also lyse Gram-negative bacterial cells, in addition, act as an opsonin, enhancing the phagocytic activity of immune cells, and it also activates the complement system, which is a key component of the innate immune response (Magnadottir, 2006). The improvement of lysozyme activity associated with other immune parameters suggests that taurine can positively influence the fish's immune response, which could, potentially, enhance their ability to combat bacterial challenges. In this sense, immune-related genes such as \u003cem\u003etlr-3, il1-β, and tnf-α\u003c/em\u003e evaluated in this study showed significant mRNA overexpression after 24 hours after injection.\u003c/p\u003e \u003cp\u003eToll-like receptor (\u003cem\u003etlr-3)\u003c/em\u003e can act as an amplifier of the immune response, promoting the release of proinflammatory cytokines and the activation of other components of the immune system. In this study, overexpression may indicate an attempt by the organism to restore a proper balance in its immune system. It is worth mentioning that TLR-3 was mainly associated with a virus or poly I: C challenges (Rodriguez et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Herrero, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), however, in some fish, evidence shows that TLR-3 had a response after bacterial challenges. Similar to our research, Wang et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) found the overexpression of \u003cem\u003etlr-3\u003c/em\u003e in \u003cem\u003eLateolabrax japonicus\u003c/em\u003e after bacterial challenge with \u003cem\u003eVibrio harveyi\u003c/em\u003e and \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e. Another study conducted by Zhang et al. (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) showed overexpression of \u003cem\u003etlr-3\u003c/em\u003e in the head kidney of yellow catfish \u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e after being challenged with \u003cem\u003eAeromonas hydrophila\u003c/em\u003e, a gram-negative bacteria. The authors evaluated the nine \u003cem\u003etlr\u003c/em\u003es genes including \u003cem\u003etlr-3\u003c/em\u003e, at different times of exposition (0, 6, 12, 24, 28, and 72 h), and interestingly similar as found in our study, high fold-change was observed at 6, 12, and 24 hours and decreased drastically afterward. In the present study, we found overexpression at 24 h, with a prominent decrease at 72h, which led us to infer that this gene participates actively in the recognition of bacteria as well as LPS as a PAMP and might induce inflammatory responses in fish. When TLRs on immune cells detect PAMPs, they trigger signaling pathways that lead to the production of proinflammatory cytokines like IL-1β and TNF-α.\u003c/p\u003e \u003cp\u003eIL1β and TNF-α play pivotal roles as essential molecules within the innate immune response against bacterial intrusion, while also serving to induce the secretion of fundamental cytokines that activate the effector functions of macrophages and lymphocytes (Reyes-Becerril et al. 2017). The overexpression of both cytokines \u003cem\u003eil1-β\u003c/em\u003e and \u003cem\u003etnf-α\u003c/em\u003e was observed in this study at 24 h after LPS injection with significant differences between TAU 2% when compared to the other treatments, demonstrating its potential immunostimulant effect. This enhanced immune response is a key feature of trained immunity, where the innate immune cells exhibit a memory-like response to subsequent challenges with pathogens or PAMPs (Angulo, 2020). Regarding the effect of taurine on mRNA expression after an LPS challenge, Holen et al (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) found that before a stress period of transition from fresh to seawater, using a diet amino acid-rich (DL-Methionine, L-Lysine, L-Threonine, and Taurine) seemed benefits for leukocyte immune responses induced by LPS which increased the gene expression of \u003cem\u003eil-1β\u003c/em\u003e. The authors suggest that a diet containing those amino acids could increase the defense of the fish against bacterial and viral infection in this vulnerable transition period. Interestingly, contrary to our findings Shi et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) found that taurine could inhibit the overexpression of \u003cem\u003eil1-β\u003c/em\u003e and \u003cem\u003etlr-3\u003c/em\u003e when \u003cem\u003eMonopterus albus\u003c/em\u003e juveniles were challenged with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, however, an overexpression of \u003cem\u003eil-10\u003c/em\u003e was observed in taurine treatment. In our study, the mechanism of defense after 24 h LPS injection, triggered a pro-inflammatory response with no difference between treatments in the anti-inflammatory \u003cem\u003eil-10\u003c/em\u003e response that could indicate a balance among pro-inflammatory and anti-inflammatory response, which in pathological conditions, the anti-inflammatory response may be inadequate to mitigate the inflammatory activity, or alternatively, become disproportionately pronounced, thereby suppressing the immune system and rendering the host susceptible to infection (de Pablo-S\u0026aacute;nchez et al. 2005).\u003c/p\u003e \u003cp\u003eInflammation can help to regulate the immune response, ensuring that it is properly activated to fight the infection or injury and deactivated once the problem is resolved. In the present study, it could be observed at 72 h, when the inflammatory mRNA expression decreased to the basal level with similar values as found at 0h post-injection, so this pro-inflammatory overexpression of \u003cem\u003etlr-3\u003c/em\u003e, \u003cem\u003eil1-b\u003c/em\u003e, and \u003cem\u003etnf-a\u003c/em\u003e in TAU 2% could indicate a better-trained immunity in TAU 2% group. In this sense, a study performed with goats LPS challenged, showed that the use of β-glucan as the immunostimulant, increased the expression of il\u003cem\u003e1-β\u003c/em\u003e and \u003cem\u003etnf-α\u003c/em\u003e when compared to the control group, the authors suggest that the increased production of IL-1β and TNF-α reflects the activation of immune signaling pathways and the priming of the immune system to respond effectively to the challenge posed by the pathogen (Angulo et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn conclusion, our findings suggest that supplementation with taurine has the potential to improve the immunological capabilities of juvenile \u003cem\u003eS. rivoliana\u003c/em\u003e, thereby enabling them to initiate an efficient immune response against an immune challenge. The assessment of antioxidant enzymes and lysozyme activity, along with other immune parameters, helped us to understand how taurine influenced the immune function and contributed to avoiding oxidative stress of the \u003cem\u003eS. rivoliana\u003c/em\u003e juveniles and their ability to respond to challenges such as lipopolysaccharide exposure.\u003c/p\u003e \u003cp\u003eFuture research is suggested to optimize the level of taurine for this species, as well as the use of other immunostimulants against LPS or bacterial challenge, to elucidate the mechanisms of defense of the juveniles of \u003cem\u003eS. rivoliana\u003c/em\u003e against infection and how to improve its immunodefense responses.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eInterest conflict\u003c/h2\u003e \u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll authors contributed significantly to this study. Conceptualization, methodology, software, formal analysis, investigation, data curation, writing\u0026mdash;original draft preparation, visualization, review and editing: A.T.; Conceptualization, methodology, supervision, formal analysis, investigation, data curation, writing\u0026mdash;original draft preparation, visualization, resources, funding acquisition, review and editing: D.T.-R.; methodology, software, formal analysis, investigation, data curation, writing\u0026mdash;original draft preparation, visualization, review and editing: L.T.G-V; methodology, formal analysis, investigation, data curation, writing\u0026mdash;original draft preparation, visualization, review and editing: M.A.H.-D.; visualization, writing, methodology, experimentation: A. B.; methodology, review and editing: M.M.-G.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors thank Kampachi Farms for providing juveniles; Pablo Monsalvo Spencer for technical support. Partial funding was provided by Consejo Nacional de Ciencia y Tecnolog\u0026iacute;a (grant CONACYT-PRONACES 321279 FOP07) and Kampachi Farms M\u0026eacute;xico Project n\u0026deg; 20464.\u003c/p\u003e\u003ch2\u003eData Availability Statement\u003c/h2\u003e \u003cp\u003eData is contained within the article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlves APDC, Paulino RR, Pereira RT, Costa DV, Rosa PV (2021) Nile tilapia fed insect meal: Growth and innate immune response in different times under lipopolysaccharide challenge. Aquaculture Research 52(2): 529-540. https://doi.org/10.1111/are.14911\u003c/li\u003e\n\u003cli\u003eAngulo M, Reyes-Becerril M, Cepeda-Palacios R, Angulo C (2020) Oral administration of \u003cem\u003eDebaryomyces hansenii\u003c/em\u003e CBS8339-\u0026beta;-glucan induces trained immunity in newborn goats. Developmental \u0026amp; Comparative Immunology 105: 103597. https://doi.org/10.1016/j.dci.2019.103597\u003c/li\u003e\n\u003cli\u003eAngulo M, Reyes-Becerril M, Tovar-Ram\u0026iacute;rez D, Ascencio F, Angulo C (2018) \u003cem\u003eDebaryomyces hansenii\u003c/em\u003e CBS 8339 \u0026beta;-glucan enhances immune responses and downstream gene signaling pathways in goat peripheral blood leukocytes. Developmental \u0026amp; Comparative Immunology 88:173-182. https://doi.org/10.1016/j.dci.2018.07.017\u003c/li\u003e\n\u003cli\u003eArag\u0026atilde;o C, Gon\u0026ccedil;alves AT, Costas B, Azeredo R, Xavier MJ, Engrola S (2022) Alternative Proteins for Fish Diets: Implications beyond Growth. Animals 12:1211. https://doi.org/10.3390/ani12091211\u003c/li\u003e\n\u003cli\u003eAsencio-Alcudia GG, Sep\u0026uacute;lveda-Quiroz CA, P\u0026eacute;rez-Urbiola JC, Rodr\u0026iacute;guez-Jaramillo MDC, Teles A, Salas-Leiva JS, Mart\u0026iacute;nez-Garc\u0026iacute;a R, Jim\u0026eacute;nez-Mart\u0026iacute;nez LD, Galaviz M, Tovar-Ram\u0026iacute;rez D, Alvarez-Gonz\u0026aacute;lez CA (2023) Stress-Protective Role of Dietary \u0026alpha;-Tocopherol Supplementation in Longfin Yellowtail (\u003cem\u003eSeriola rivoliana\u003c/em\u003e) Juveniles. Fishes 8(10):526. https://doi.org/10.3390/fishes8100526\u003c/li\u003e\n\u003cli\u003eBa\u0026ntilde;uelos-Vargas I, L\u0026oacute;pez LM, P\u0026eacute;rez-Jim\u0026eacute;nez A, Peres H (2014) Effect of fishmeal replacement by soy protein concentrate with taurine supplementation on hepatic intermediary metabolism and antioxidant status of totoaba juveniles (\u003cem\u003eTotoaba macdonaldi\u003c/em\u003e). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 170:18-25. https://doi.org/10.1016/j.cbpb.2014.01.003\u003c/li\u003e\n\u003cli\u003eBiller JD, Polycarpo GDV, Moromizato BS, Sidekerskis APD, Silva TDD, Reis ICD, Fierro-Castro C (2021) Lysozyme activity as an indicator of innate immunity of tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) when challenged with LPS and Streptococcus agalactiae. Revista Brasileira de Zootecnia 50:e20210053. https://doi.org/10.37496/rbz5020210053\u003c/li\u003e\n\u003cli\u003eChen Y, Lin J, Zhao Y, Ma X, Yi H (2021) Toll-like receptor 3 (TLR3) regulation mechanisms and roles in antiviral innate immune responses. Journal of Zhejiang University-SCIENCE B 22(8):609-632. https://doi.org/10.1631/jzus.B2000808\u003c/li\u003e\n\u003cli\u003eCheng CH, Guo ZX, Wan, AL (2018) The protective effects of taurine on oxidative stress, cytoplasmic free-Ca2+, and apoptosis of pufferfish (\u003cem\u003eTakifugu obscurus\u003c/em\u003e) under low-temperature stress. \u003cem\u003eFish \u0026amp; Shellfish Immunolog\u003c/em\u003e\u003cem\u003e, \u003cem\u003e77\u003c/em\u003e:457\u003c/em\u003e-464. https://doi.org/10.1016/j.fsi.2018.04.022\u003c/li\u003e\n\u003cli\u003eCheong SH, Lee SH, Jeon YJ, Lee DS (2017) Mussel (\u003cem\u003eMytilus coruscus\u003c/em\u003e) Water Extract ContainingTaurine Prevents LPS-Induced Inflammatory Responses in Zebrafish Model. In Lee DH, Schaffer SW, Park E, Kim HW (Eds), \u003cem\u003eTaurine 10\u003c/em\u003e\u003cem\u003e (\u003c/em\u003eVol. 975, pp. 931-942). Springer Netherlands. https://doi.org/10.1007/978-94-024-1079-2_74\u003c/li\u003e\n\u003cli\u003eDe Pablo S\u0026aacute;nchez R, Monserrat Sanz J, Prieto Mart\u0026iacute;n A, Reyes Mart\u0026iacute;n E, \u0026Aacute;lvarez De Mon Soto M, S\u0026aacute;nchez Garc\u0026iacute;a M (2005) Balance entre citocinas pro y antiinflamatorias en estados s\u0026eacute;pticos. Medicina Intensiva 29(3): 151-158. https://doi.org/10.1016/S0210-5691(05)74222-4\u003c/li\u003e\n\u003cli\u003eDehghani R, Oujifard A, Mozanzadeh MT, Morshedi V, Bagheri D (2020) Effects of dietary taurine on growth performance, antioxidant status, digestive enzymes activities, and skin mucosal immune responses in yellowfin seabream, \u003cem\u003eAcanthopagrus latus\u003c/em\u003e. Aquaculture 517:734795. https://doi.org/10.1016/j.aquaculture.2019.734795\u003c/li\u003e\n\u003cli\u003eDirective 2010/63. Directive (EU) 2010/63 of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific purposes. https://eur-lex.europa.eu/eli/dir/2010/63/oj.\u003c/li\u003e\n\u003cli\u003eGiri SS, Kim HJ, Kim SG, Kim SW, Kwon J, Lee SB, Sukumaran V, Chang Park S (2020) Effectiveness of the guava leaf extracts against lipopolysaccharide-induced oxidative stress and immune responses in \u003cem\u003eCyprinus carpio\u003c/em\u003e. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e\u003cem\u003e \u003cem\u003e105\u003c/em\u003e:164\u003c/em\u003e-176. https://doi.org/10.1016/j.fsi.2020.06.004\u003c/li\u003e\n\u003cli\u003eGunathilaka GLBE, Kim MG, Lee C, Shin J, Lee BJ, Lee KJ (2019) Effects of taurine supplementation in low fish meal diets for red seabream (\u003cem\u003ePagrus major\u003c/em\u003e) in low water temperature season. Fish Aquatic Sci 22, 23. https://doi.org/10.1186/s41240-019-0138-z\u003c/li\u003e\n\u003cli\u003eGuzm\u0026aacute;n-Villanueva LT, Ascencio-Valle F, Mac\u0026iacute;as-Rodr\u0026iacute;guez ME, Tovar-Ram\u0026iacute;rez D (2014) Effects of dietary \u0026beta;-1,3/1,6-glucan on the antioxidant and digestive enzyme activities of Pacific red snapper (\u003cem\u003eLutjanus peru\u003c/em\u003e) after exposure to lipopolysaccharides. \u003cem\u003eFish Physiology and Biochemistry\u003c/em\u003e\u003cem\u003e \u003cem\u003e40\u003c/em\u003e(\u003c/em\u003e3):827-837. https://doi.org/10.1007/s10695-013-9889-0\u003c/li\u003e\n\u003cli\u003eHan H, Zhang J, Chen Y, Shen M, Yan E, Wei C, Yu C, Zhang L, Wang T (2020) Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age. J Anim Sci.1;98(10):skaa311. https://doi: 10.1093/jas/skaa311\u003c/li\u003e\n\u003cli\u003eHan H, Zhang J, Chen Y, Shen M, Yan E, Wei C, Yu C, Zhang L, Wang T (2020). Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age. \u003cem\u003eJournal of Animal Science\u003c/em\u003e\u003cem\u003e \u003cem\u003e98\u003c/em\u003e(10\u003c/em\u003e), skaa311. https://doi.org/10.1093/jas/skaa311\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ndez-Contreras A, Tovar-Ram\u0026iacute;rez D, Reyes-Becerril M (2021) Modulatory effect of \u003cem\u003eDebaryomyces hansenii\u003c/em\u003e and oregano essential oil on the humoral immunity of skin mucus in Longfin yellowtail \u003cem\u003eSeriola rivoliana\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e Aquaculture Research 52(2):749-762. https://doi.org/10.1111/are.14931Hern\u0026aacute;ndez-Contreras \u0026Aacute;, Teles A, Salas-Leiva JS, Chaves-Pozo E, Tovar-Ram\u0026iacute;rez D (2023) Feed Additives in Aquaculture. In Arsenos G, Giannenas I (Eds.), Sustainable Use of Feed Additives in Livestock (pp. 811-846). Springer International Publishing. https://doi.org/10.1007/978-3-031-42855-5_28\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ndez-de Dios MA, Tovar-Ram\u0026iacute;rez D, Maldonado-Garc\u0026iacute;a D, Galaviz- Espinoza MA, Barreto-Curiel F, Spanopoulos-Zarco M, Maldonado-Garc\u0026iacute;a M (2024) Taurine improves juvenile \u003cem\u003eSeriola rivoliana \u003c/em\u003egrowth performance and biochemical profiles in blood serum and skeletal muscle. Latin American Journal of Aquatic Research 52(3): 443-458. https://doi.org/10.3856/vol52-issue3-fulltext-3204\u003c/li\u003e\n\u003cli\u003eHerrero MJ (2010) ABC de los \u0026laquo;Toll-like receptors\u0026raquo;: Relaci\u0026oacute;n con el desarrollo y progresi\u0026oacute;n de enfermedades autoinmunes. Seminarios de la Fundaci\u0026oacute;n Espa\u0026ntilde;ola de Reumatolog\u0026iacute;a 11(4):135-143. https://doi.org/10.1016/j.semreu.2010.04.005\u003c/li\u003e\n\u003cli\u003eHolen E, Chen M, Fjelldal PG, Skj\u0026aelig;rven K, Sissener NH, Rem\u0026oslash; S, Prabhu AJ, Hamre K, Vikes\u0026aring; V, Subramanian S, Espe M (2022) Tailoring freshwater diets towards boosted immunity and pancreas disease infection robustness in Atlantic salmon post smolts. Fish \u0026amp; Shellfish Immunology 120:377-391. https://doi.org/10.1016/j.fsi.2021.11.019\u003c/li\u003e\n\u003cli\u003eKim YS, Kim EK, Jeon NJ, Ryu BI, Hwang JW, Choi EJ, Moon SH, Jeon BT, Park PJ (2017) Antioxidant Effect of Taurine-Rich \u003cem\u003eParoctopus dofleini\u003c/em\u003e Extracts Through Inhibiting ROS Production Against LPS-Induced Oxidative Stress In Vitro and In Vivo Model. In Lee DH, Schaffer SW, Park E, Kim HW (Eds.), \u003cem\u003eTaurine 10\u003c/em\u003e (Vol. 975, pp. 1165-1177). Springer Netherlands. https://doi.org/10.1007/978-94-024-1079-2_93\u003c/li\u003e\n\u003cli\u003eKumar S, Choubey AK, Srivastava PK (2022) The effects of dietary immunostimulants on the innate immune response of Indian major carp: A review, Fish \u0026amp; Shellfish Immunology 123:36-49. https://doi.org/10.1016/j.fsi.2022.02.039.\u003c/li\u003e\n\u003cli\u003eLange S, Guđmundsdottir BK, Magnadottir B (2001) Humoral immune parameters of cultured Atlantic halibut (\u003cem\u003eHippoglossus hippoglossus\u003c/em\u003e L.). Fish \u0026amp; Shellfish Immunology 11(6):523-535. https://doi.org/10.1006/fsim.2000.0333\u003c/li\u003e\n\u003cli\u003eLi M, Lai H, Li Q, Gong S, Wang R (2016) Effects of dietary taurine on growth, immunity and hyperammonemia in juvenile yellow catfish \u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e fed all-plant protein diets. \u003cem\u003eAquaculture\u003c/em\u003e\u003cem\u003e \u003cem\u003e450\u003c/em\u003e:3\u003c/em\u003e49-355. https://doi.org/10.1016/j.aquaculture.2015.08.013\u003c/li\u003e\n\u003cli\u003eLi, MY, Guo WQ, Guo GL, Zhu XM, Niu XT, Shan XF, Tian JX, Wang GQ, Zhang DM (2020) Effects of dietary astaxanthin on lipopolysaccharide-induced oxidative stress, immune responses and glucocorticoid receptor (GR)-related gene expression in Channa argus. Aquaculture 517:734816. https://doi.org/10.1016/j.aquaculture.2019.734816\u003c/li\u003e\n\u003cli\u003eLiu JX, Guo HY, Zhu KC, Liu BS, Zhang N, Zhang DC (2022) Effects of exogenous taurine supplementation on the growth, antioxidant capacity, intestine immunity, and resistance against \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e in juvenile golden pompano (Trachinotus ovatus) fed with a low-fishmeal diet. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e\u003cem\u003e \u003cem\u003e13\u003c/em\u003e:\u003c/em\u003e1036821. https://doi.org/10.3389/fimmu.2022.1036821\u003c/li\u003e\n\u003cli\u003eLiu Y, Li F, Zhang L, Wu J, Wang Y, Yu H (2017) Taurine alleviates lipopolysaccharide-induced liver injury by anti-inflammation and antioxidants in rats. \u003cem\u003eMolecular Medicine Reports\u003c/em\u003e\u003cem\u003e \u003cem\u003e16\u003c/em\u003e(5):\u003c/em\u003e6512-6517. https://doi.org/10.3892/mmr.2017.7414\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026minus;\u0026Delta;\u0026Delta;CT Method. Methods 25(4):402-408. https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eMa Y, Zhang Y, Li R, Deng S, Qin Q, Ran C, Hao Y, Zhang J, Zhu L (2022) Mechanism of taurine reducing inflammation and organ injury in sepsis mice. Cellular Immunology 375:104503. https://doi.org/10.1016/j.cellimm.2022.104503\u003c/li\u003e\n\u003cli\u003eMagnad\u0026oacute;ttir B (2006) Innate immunity of fish (overview). Fish \u0026amp; Shellfish Immunology 20(2):137-151. https://doi.org/10.1016/j.fsi.2004.09.006\u003c/li\u003e\n\u003cli\u003eMaz\u0026oacute;n-Su\u0026aacute;stegui J, Salas-Leiva J, Teles A, Tovar-Ram\u0026iacute;rez D (2019) Immune and Antioxidant Enzyme Response of Longfin Yellowtail (\u003cem\u003eSeriola rivoliana\u003c/em\u003e) Juveniles to Ultra-diluted Substances Derived from Phosphorus, Silica and Pathogenic Vibrio. Homeopathy 108(01):043-053. https://doi.org/10.1055/s-0038-1672197\u003c/li\u003e\n\u003cli\u003eRamos-Pinto L, Machado M, Calduch-Giner J, P\u0026eacute;rez-S\u0026aacute;nchez J, Dias J, Concei\u0026ccedil;\u0026atilde;o LEC, Silva TS, Costas B (2021) Dietary Histidine,Threonine, or Taurine Supplementation Affects Gilthead Seabream (\u003cem\u003eSparus aurata\u003c/em\u003e) Immune Status. Animals 11:1193. https://doi.org/10.3390/ani11051193\u003c/li\u003e\n\u003cli\u003eReyes-Becerril M, Gij\u0026oacute;n D, Angulo M, V\u0026aacute;zquez-Mart\u0026iacute;nez J, L\u0026oacute;pez MG, Junco E, Armenta J, Guerra K, Angulo C (2021) Composition, antioxidant capacity, intestinal, and immunobiological effects of oregano (\u003cem\u003eLippia palmeri \u003c/em\u003eWatts) in goats: Preliminary in vitro and in vivo studies. Tropical Animal Health and Production 53(1): 101. https://doi.org/10.1007/s11250-020-02450-z\u003c/li\u003e\n\u003cli\u003eRodriguez MF, Wiens GD, Purcell MK, Palti Y (2005) Characterization of Toll-like receptor 3 gene in rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). Immunogenetics, 57(7):510-519. https://doi.org/10.1007/s00251-005-0013-1\u003c/li\u003e\n\u003cli\u003eSalze GP, Davis DA (2015) Taurine: A critical nutrient for future fish feeds. Aquaculture 437:215-229. https://doi.org/10.1016/j.aquaculture.2014.12.006\u003c/li\u003e\n\u003cli\u003eSampath, WWHA, Rathnayake RMDS, Yang M, Zhang W, Mai K (2020) Roles of dietary taurine in fish nutrition. Mar Life Sci Technol 2:360\u0026ndash;375. https://doi.org/10.1007/s42995-020-00051-1\u003c/li\u003e\n\u003cli\u003eSaravia J, Paschke K, Pontigo JP, Nualart D, Navarro JM, Vargas-Chacoff L (2022) Effects of temperature on the innate immune response on Antarctic and sub-Antarctic fish \u003cem\u003eHarpagifer antarcticus\u003c/em\u003e and \u003cem\u003eHarpagifer bispinis\u003c/em\u003e challenged with two immunostimulants, LPS and Poly I:C: In vivo and in vitro approach. Fish \u0026amp; Shellfish Immunology 130:391-408. https://doi.org/10.1016/j.fsi.2022.09.025\u003c/li\u003e\n\u003cli\u003eSecretaria de Agricultura (2001) Norma Oficial Mexicana NOM-062-ZOO-1999, Especificaciones T\u0026eacute;cnicas Para La Producci\u0026oacute;n, Cuidado y Uso de los Animales de Laboratorio. Ciudad de M\u0026eacute;xico: SA.\u003c/li\u003e\n\u003cli\u003eShi Y, Hu Y, Wang Z, Zhou J, Zhang J, Zhong H, Fu G, Zhong L (2021) The Protective Effect of Taurine on Oxidized Fish-Oil-Induced Liver Oxidative Stress and Intestinal Barrier-Function Impairment in Juvenile \u003cem\u003eIctalurus punctatus\u003c/em\u003e. Antioxidants 10(11):1690. https://doi.org/10.3390/antiox10111690\u003c/li\u003e\n\u003cli\u003eShi Y, Zhong L, Fan Y, Zhang J, Dai J, Zhong H, Fu G, Hu Y (2022) Taurine inhibits hydrogen peroxide-induced oxidative stress, inflammatory response and apoptosis in liver of \u003cem\u003eMonopterus albus\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology 128:536-546. https://doi.org/10.1016/j.fsi.2022.08.029\u003c/li\u003e\n\u003cli\u003eTan X, Sun Z, Zhu X, Ye C (2018) Dietary supplementation with taurine improves ability to resist ammonia stress in hybrid snakehead (\u003cem\u003eChanna maculatus\u003c/em\u003e ♀ \u0026times; \u003cem\u003eChanna argus\u003c/em\u003e ♂). \u003cem\u003eAquaculture Research\u003c/em\u003e\u003cem\u003e \u003cem\u003e49\u003c/em\u003e(10\u003c/em\u003e):3400-3410. https://doi.org/10.1111/are.13804\u003c/li\u003e\n\u003cli\u003eTeles A, Alvarez-Gonz\u0026aacute;lez CA, Llera-Herrera R, Gisbert E, Salas-Leiva J, Del Carmen Rodr\u0026iacute;guez-Jaramillo M, Tovar-Ram\u0026iacute;rez D (2022) \u003cem\u003eDebaryomyces hansenii\u003c/em\u003e CBS 8339 promotes larval development in \u003cem\u003eSeriola rivoliana\u003c/em\u003e. Aquaculture 560:738587. https://doi.org/10.1016/j.aquaculture.2022.738587\u003c/li\u003e\n\u003cli\u003eTeles A, Salas-Leiva J, Alvarez-Gonz\u0026aacute;lez CA, Tovar-Ram\u0026iacute;rez D (2019) Changes in digestive enzyme activities during early ontogeny of \u003cem\u003eSeriola rivoliana\u003c/em\u003e. Fish Physiology and Biochemistry 45(2):733-742. https://doi.org/10.1007/s10695-018-0598-6\u003c/li\u003e\n\u003cli\u003eTeles A, Salas-Leiva J, Alvarez-Gonz\u0026aacute;lez CA, Gisbert E, Ibarra-Castro L, Urbiola JCP, Tovar-Ram\u0026iacute;rez D (2017) Histological study of the gastrointestinal tract in longfin yellowtail (\u003cem\u003eSeriola rivoliana\u003c/em\u003e) larvae. Fish Physiology and Biochemistry 43(6):1613-1628. https://doi.org/10.1007/s10695-017-0397-5\u003c/li\u003e\n\u003cli\u003eWang P, Zhao C, Wang C, Fan S, Yan L, Qiu L (2018) TLR3 gene in Japanese sea perch (\u003cem\u003eLateolabrax japonicus\u003c/em\u003e): Molecular cloning, characterization and expression analysis after bacterial infection. Fish \u0026amp; Shellfish Immunology 76:347-354. https://doi.org/10.1016/j.fsi.2018.01.013\u003c/li\u003e\n\u003cli\u003eYan LC, Feng L, Jiang WD, Wu P, Liu Y, Jiang J, Tang L, Tang WN, Zhang YA, Yang J, Zhou XQ, Kuang SY (2019) Dietary taurine supplementation to a plant protein source-based diet improved the growth and intestinal immune function of young grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e) Aquaculture Nutrition 25:873\u0026ndash;896. https://doi.org/10.1111/anu.12907\u003c/li\u003e\n\u003cli\u003eZhang J, Xu X, Zhu H, Wang Y, Hou Y, Liu Y (2019) Dietary fish oil supplementation alters liver gene expressions to protect against LPS-induced liver injury in weanling piglets. Innate Immunity 25(1):60-72. https://doi.org/10.1177/1753425918821420\u003c/li\u003e\n\u003cli\u003eZhang XT, Zhang GR, Shi ZC, Yuan YJ, Zheng H, Lin L, Wei KJ, Ji W (2017) Expression analysis of nine Toll-like receptors in yellow catfish (\u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e) responding to \u003cem\u003eAeromonas hydrophila\u003c/em\u003e challenge. Fish \u0026amp; Shellfish Immunology 63:384-393. https://doi.org/10.1016/j.fsi.2017.02.021\u003c/li\u003e\n\u003cli\u003eZhu X, Li M, Liu X, Xia C, Niu X, Wang G, Zhang D (2020) Effects of dietary astaxanthin on growth, blood biochemistry, antioxidant, immune and inflammatory response in lipopolysaccharide‐challenged \u003cem\u003eChanna argus\u003c/em\u003e. \u003cem\u003eAquaculture Research\u003c/em\u003e\u003cem\u003e \u003cem\u003e51\u003c/em\u003e(5\u003c/em\u003e):1980-1991. https://doi.org/10.1111/are.14550\u003c/li\u003e\n\u003cli\u003eZhu X, Li M, Liu X, Xia C, Niu X, Wang G, Zhang D (2020) Effects of dietary astaxanthin on growth, blood biochemistry, antioxidant, immune and inflammatory response in lipopolysaccharide‐challenged \u003cem\u003eChanna argus\u003c/em\u003e. Aquaculture Research 51(5):1980-1991. https://doi.org/10.1111/are.14550\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Seriola rivoliana, LPS, Taurine, immune response","lastPublishedDoi":"10.21203/rs.3.rs-4926904/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4926904/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe use of additives in fish feeds is a practice used worldwide to provide better productive results and improve the fish's health and immune capacity to face disease outbreaks. This study aimed to analyze the effects of the different doses of taurine in fish feed and its impact on the immune-related parameters and antioxidant enzyme activity after LPS (lipopolysaccharide) injection. For this, immune-related gene expression was evaluated as well as lysozyme activity and antioxidant enzyme activity. The results showed that using taurine at 2% (TAU 2%) improved the expression of \u003cem\u003eil1-β, tnf-α, and tlr-3\u003c/em\u003e compared to the other treatments at 24 hours post LPS injection. Lysozyme activity and antioxidant activity such as superoxide dismutase (SOD) and catalase were higher in the treatment with both taurine 1% (TAU 1%) and TAU 2% when compared with the negative control (C-) and the positive control (C+) treatments after 72 hours post LPS injection. These results suggest that using 2% of exogenous taurine added to a commercial fish feed for juveniles of \u003cem\u003eSeriola rivoliana\u003c/em\u003e can improve their immunocompetency and counteract the oxidative stress caused by exposure to LPS.\u003c/p\u003e","manuscriptTitle":"Taurine enhances antioxidant enzyme activity and immune response in Seriola rivoliana juveniles after lipopolysaccharide injection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-27 11:04:19","doi":"10.21203/rs.3.rs-4926904/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"aaef8f71-2e41-4b18-8da7-cd3001637b57","owner":[],"postedDate":"September 27th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-13T09:09:23+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-27 11:04:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4926904","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4926904","identity":"rs-4926904","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}