Development of a Recombinase-Aided Amplification Assay for Rapid Detection of Human Norovirus GII.4

Development of a Recombinase-Aided Amplification Assay for Rapid Detection of Human Norovirus GII.4 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Development of a Recombinase-Aided Amplification Assay for Rapid Detection of Human Norovirus GII.4 Zhiwei Qin, Liang Xue, Weicheng Cai, Junshan Gao, Yueting Jiang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-132273/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Mar, 2021 Read the published version in BMC Infectious Diseases → Version 1 posted 10 You are reading this latest preprint version Abstract Background: Human noroviruses are one of the main causes of foodborne illnesses and represent a serious public health concern. Rapid and sensitive assays for human norovirus detection are undoubtedly necessary for clinical diagnosis, especially in regions without more sophisticated equipment. Method: The recombinase-aided amplification (RT-RAA) is a fast, robust and isothermal nucleic acid detection method based on enzyme reaction. This method can complete the sample detection at 39°C in 30 minutes. In this study, we successfully established a rapid reverse transcription recombinase-aided amplification (RT-RAA) assay for the detection of human norovirus GII.4 and applied this assay to clinical samples, as well as comparison with commercial RT-qPCR. Results: An analytical sensitivity detection of the RT-RAA at a 95% probability of 3.425 log10 genomic copies (LGC)/reaction. Moreover, no cross-reaction was observed with other norovirus genogroups and other common foodborne viruses. Stool samples were examined by RT-RAA and reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). Compared with RT-qPCR, kappa values for human norovirus detection with RT-RAA were 0.894 (p < 0.001), indicating that both assays were in agreement. Conclusion: This RT-RAA assay provides a rapid, specific, and sensitive assay for human norovirus detection and is suitable for clinical testing. Infectious Diseases Norovirus Detection Rapid diagnostic technique Recombinase-aided amplification Figures Figure 1 Figure 2 Figure 3 1 Introduction Noroviruses (NoV) are positive-sense single-stranded RNA viruses and are regarded as one of the main causes of acute gastroenteritis worldwide. Globally, it is estimated that the incidence of NoV has reached approximately 10% and results in over $ 60 billion in social costs per year (Bartsch and Lopman et al., 2016 ). Infection with NoV generally results in abdominal pain, diarrhea, and vomiting (Moore and Goulter et al., 2015 ). It has been reported that NoV infects people of all ages, but is more severe in children and the elderly, especially in low-income countries, leading to over 200,000 deaths every year (Krisztián Bányai, 2018). Traditional detection methods for NoV, such as immunoassays and electron microscopy, are not suitable for rapid diagnosis because most of them are generally time-consuming and laborious. Common nucleic molecular diagnostic assays for NoV detection with high specificity and sensitivity, such as fluorescence-based real-time PCR and nested PCR, have been used in disease diagnosis (Yan and Yagyu et al., 2003 ; Yoo and Lee et al., 2017 ). However, expensive equipment and the need for trained technicians make these traditional detection methods restrictive and impractical for rapid and convenient detection in low-income regions. The recombinase-aided amplification (RAA) assay is a new isothermal nucleic acid amplification technology in recent years for pathogen detection. The reaction is typically completed in approximately 30 min at 37–42 °C. RAA has been successfully applied in the detection of pathogens (Bai and Ma et al., 2020 ; Li and Yu et al., 2020 ; Wang and Cui et al., 2020 ; Xue and Li et al., 2020 ; Xue and Li et al., 2020 ) and single nucleotide polymorphisms (SNPs) (Duan and Li et al., 2018 ). Owing to its speed, low-cost, and high sensitivity, RAA is highly suitable for clinical applications, and is a potential assay for the point-of-care testing (POCT) for foodborne pathogens. In the past two decades, NoV GII.4 has been reported to be the predominant genotype worldwide, and more than half of the outbreaks and sporadic infections are caused by this genotype (Siebenga and Vennema et al., 2009 ). For decades, the most popular method for specific detection of NoV GII.4 has been sequencing and phylogenetic analysis (Silva and Rodrigues et al., 2013 ; Nenonen and Hannoun et al., 2014 ; Allen and Trainor et al., 2016 ). Currently, there is no rapid detection method for NoV GII.4. Therefore, it is important to establish an efficient and rapid detection method in response to outbreaks of NoV GII.4. In this work, we describe a novel, isothermal, reverse transcription recombinase-aided amplification (RT-RAA) method for the detection of NoV GII.4. 2 Material And Methods 2.1 Virus stock and clinical samples Positive stool samples of norovirus, enterovirus, astrovirus, adenovirus, sapovirus, and rotavirus used in this study were those detected in our previous studies (Xue and Dong et al., 2016 ). All samples were diluted to 20% (w/v) in phosphate-buffered saline (PBS, pH 7.2), divided into 50 µL per tube, and stored at − 80 °C until use. 2.2 Nucleic acid extraction Total RNA was extracted from 50 µL of each stool sample using the High Pure viral RNA kit (Magen, Guangzhou, China) according to the manufacturer’s protocol. The RNA was eluted in 50 µL RNase-free water and stored at − 80 °C until use. 2.3 Design of primers and probes Complete genome sequences of human norovirus GII.4 strains were retrieved from GenBank and used for comparative analyses using MEGA version 7.0 (Kumar et al., 2018). As the specific site of NoV GII.4 exhibited substantial divergence from other prevalent NoVs (GII.2, GII.3, GII.6, GII.8, and GII.17) and other common foodborne viruses (enterovirus, astrovirus, adenovirus, sapovirus, and rotavirus), it was used as the nucleic target for the RT-RAA of NoV GII.4. The forward and reverse primers and probe were designed according to the manufacturer’s guidelines (Qitian, JiangSu, China) (Table 1 ). All primers and probes were synthesized by Shanghai GENEray (Shanghai, China). 2.4 Preparation of viral standards The primers F3 and G2SKR were as described in previous studies (Kojima and Kageyama et al., 2002 ; Luo, 2012 ). A 413-bp (net 4977–5389, GenBank accession no. JX989074) fragment of the ORF1-ORF2 genes of NoV GII.4 was cloned into the pEASY-T1 vector (Transgen Biotech, Beijing, China) for DNA copy number quantification. Then, the recombinant plasmid was amplified using the Premix Ex Taq version 2.0 Kit (Takara, Dalian, China) and 2 µL template. The nucleotide amplicon was gel purified using the Hipure Gel Pure DNA Mini Kit (Magen) and subjected to in vitro transcription and recovery of RNA using the mMESSAGE mMACHINE™ T7 Transcription Kit (Thermo Fisher, Shanghai, China) according to the manufacturer’s instructions. The cRNA was quantified using an EPOCH2 Microplate Spectrophotometer (BioTek, Winooski, VT) and the cRNA copy number was calculated using the following formula: cRNA copy number (copy number/µL) = [6.02 × 10 23 × cRNA concentration (ng/µL) × 10 − 9 ]/[cRNA length in nucleotides × 340]. The cRNA was aliquoted into centrifuge tubes every 5 µL/tube, and stored at − 20 °C until further use. 2.5 RT-qPCR assay RT-qPCR reactions were carried out using the One Step PrimeScript™ RT-PCR kit (Perfect Real Time, Takara). Each 20-µL reaction mixture contained 0.4 pmol of forward and reverse primers, 0.8 pmol of probe, 10 µL of 2 × One Step RT-PCR buffer, 2 µL of template, 0.4 µL of TaKaRa Ex Taq HS, 0.4 µL of PrimeScript RT Enzyme Mix II, and RNase Free dH 2 O added to make the volume 20 µL. The primer pairs were COG2R and QNIF2d (Loisy and Atmar et al., 2005 ). The size of the amplification product was 89 bp. The following amplification conditions were used: 42 °C for 300 s, 95 °C for 10 s, followed by 45 cycles of 95 °C for 5 s, and 60 °C for 20 s. 2.6 RT-RAA assay RT-RAA reactions were carried out using the modified RAA kit (Qitian). Each 50-µL reaction mixture contained 2.1 pmol of forward and reverse primers, 0.6 pmol of probe, 25 µL of buffer VI, 2.5 µL of template, 1 µL of RNase inhibitor (20 U), 1 µL of RTase (50 U) and nuclease-free water added to make the volume 47.5 µL. The reaction mixture was added to RT-RAA lyophilized enzyme pellets, and 2.5 µL of magnesium acetate was added to the tops of the reaction tube lids. The magnesium acetate droplets were then spun down using a mini centrifuge, and the reactions were quickly transferred to a Lightcycler@96 (Roche, Basel, Switzerland) set to 39 °C with cycle reads every 30 s. Nuclease-free water was used as a negative control in every test. 2.7 Evaluation of specificity and sensitivity Enterovirus, astrovirus, adenovirus, sapovirus, and rotavirus were used to evaluate specificity. NoV GII.2, NoV GII.3, NoV GII.6, NoV GII.8, and NoV GII.17 were used to evaluate the specificity of NoV genotypes. The sensitivity of the RT-RAA assay for detection of human NoV GII.4 was determined using 10-fold dilutions of cRNA (10 7 to 10 0 copies per reaction, n = 8). Negative control reactions were performed in parallel for each run. 2.8 Evaluation of the RT-RAA assay using clinical samples To evaluate clinical performance of RT-RAA, a total of 38 clinical samples previously confirmed as NoV GII.4-positive by sequencing assay were used for nucleic acid extraction, and detection in the RT-RAA and RT-qPCR assays. 2.9 Statistical analysis To determine the detection limit of RT-RAA, a probit analysis was performed at a probability level of 95%, and the p and kappa values of RT-RAA and RT-qPCR were calculated. All statistics and analysis were performed by using SPSS 24.0 (IBM Corp, Armonk, NY) 3 Results 3.1 Development and screening of RT-RAA primer and probe sets A total of 1,942 complete genome sequences of NoVs GII were retrieved from GenBank. Based on bioinformatic analysis, including length, genotype, regional distribution, and prevalence, the non-human NoV strains, repeated sequence strains, obvious long fragment insertion strains, deletion mutations, and long genetic distance strains were removed to obtain 216 reference strains that contained 55 GII.4, 5 GII.1, 20 GII.2, 20 GII.3, 7 GII.5 20 GII.6, 8 GII.7, 1 GII.8, 2 GII.10, 20 GII.12, 6 GII.13, 5 GII.14, 1 GII.16, 20 GII.17, 1 GII.20, 2 GII.21, 3 GII.22, 15 GII.24, and 5 GII.25. Then, the 55 NoVs GII.4 were used as reference strains for comparative analyses to design primers and probes. Twenty-two combinations of candidate primers (2 forward and 11 reverse) were produced and screened for reactivity to purified GII.4 RNA. Of these, five primer sets were identified as capable of amplifying target RNA, and a probe (ROP) was designed to accommodate all sets (Table 1 ). All RT-RAA primers were screened by fluorescence RAA and electrophoresis with PCR and RAA. Because of resource constraints, one set of primers (RF1 and RR4 with probe ROP) was chosen for subsequent evaluation. Fifty-five GII.4 sequences were used for alignment with primers RF1, RR4, and probe ROP, and sequence alignment showed that RF1RR4 with ROP was highly conserved for GII.4 (Fig. 1 ). Table 1 The matching of primers and probes Primer Name Sequence (5′→3′) Nucleotide Length Matching of primer and probe 0–2 bp 3–4 bp ≥ 5 bp RF1 ATTTTTACGTGCCCAGACAAGAGCCAATGTTCAG 4986–5019/ 34 bp 96.4%(53/55) 0(0/55) 3.6%(2/55) RF2 CAAGAGCCAATGTTCAGATGGATGAGATTCTCAG 5003–5036/ 34 bp 96.4%(53/55) 0(0/55) 3.6%(2/55) RR1 TCAGATGGGTTGGCGTCACTCGACGCCATCTTC 5087–5119/ 33 bp 96.4%(53/55) 3.6%(2/55) 0(0/55) RR2 GACCCATCAGATGGGTTGGCGTCACTCGACGCC 5093–5125/ 33 bp 92.7%(51/55) 7.3%(4/55) 0(0/55) RR3 TTGGCTGTGGACCCATCAGATGGGTTGGCGTC 5103–5134/ 32 bp 96.4%(53/55) 3.6%(2/55) 0(0/55) RR4 ACGAGGTTGGCTGTGGACCCATCAGATGGGTTGGC 5106–5140/ 35 bp 96.4%(53/55) 3.6%(2/55) 0(0/55) RR5 ACCAGGGGCTTGTACAAAATTGTTTCTAATCCAG 5234–5267/ 34 bp 94.5%(52/55) 5.5%(3/55) 0(0/55) RR6 TTCTAGGGGATACTGTAAACTCTCCACCAG 5263–5292/ 30 bp 100%(55/55) 0(0/55) 0(0/55) RR7 TGTTTCTAATCCAGGGGTCAATTACATTTTGT 5216–5247/ 32 bp 98.2%(54/55) 1.8%(1/55) 0(0/55) RR8 AGCCATAACCTCATTGTTGACCTCTGGGACGAG 5136–5168/ 33 bp 98.2%(54/55) 1.8%(1/55) 0(0/55) RR9 TGGCCAAATGGGAAAGGTAGGGGTTCAGATCAG 5332–5364/ 33 bp 49.1%(27/55) 45.4%(25/55) 5.5%(3/55) RR10 ATTCTGGCCAAATGAGAAAGGTAGGGATTCAG 5337–5368/ 32 bp 47.3%(26/55) 47.3%(26/55) 5.5%(3/55) RR11 TATTTCACCTGGAGCGTTTCTAGGGGATACTG 5278–5309/ 32 bp 96.4%(53/55) 3.6%(2/55) 0(0/55) ROP* TCAGACCTGAGCACGTGGGAGGGCGATCGCAAFHQGGCTCCCAGTTTTGT 5033–5082/ 50 bp 96.4%(53/55) 3.6%(2/55) 0(0/55) *For probe modifications: 3 = dT-FAM; H = THF; Q = dT-BHQ1. The probe has a 3 C3-spacer for blocking extension. 3.2 Specificity of RT-RAA The RT-RAA assay was positive for NoV GII.4 and negative for NoV GI, rotavirus, sapovirus, astrovirus, enterovirus, adenovirus, and the negative control (Fig. 2A). The RT-RAA assay was positive for NoV GII.4, and negative for NoV GII.2, GII.3, GII.6, GII.8, GII.17, and the negative control (Fig. 2B). No cross-reactivity of RNA from any control virus was observed. Therefore, RT-RAA for the detection of NoV GII.4 demonstrates a high specificity for the target. Figure 2 Specificity of RT-RAA for NoV GII.4 (A)The RT-RAA assay was positive for NoV GII.4 and negative for NoV GI, rotavirus, sapovirus, astrovirus, enterovirus, adenovirus, and the negative control. (B) The RT-RAA assay was positive for NoV GII.4, and negative for NoV GII.2, GII.3, GII.6, GII.8, GII.17, and the negative control. 3.2 Sensitivity of RT-RAA After serial dilution from 2.67 × 10 7 to 2.67 × 10 0 copies/µL, the cRNA of NoV GII.4 was tested using RT-RAA The results showed that the detection limit of the RT-RAA was 3.425 LGC (95% Cl: 2.906 LGC–4.471 LGC)/reaction, and the 95% detection limit of the qRT-PCR was 2.110 LGC (95% Cl: 1.586 LGC–3.113 LGC)/reaction (Fig. 3 ; Table 2 ). Table 2 Detection limits of human NoVs GII.4 in RT-qPCR and RT-RPA assays Copies/reaction Times of positive sample tested by two different assays for NoV (n = 8) RT-qPCR RT-RAA 2.67 × 10 7 8 8 2.67 × 10 6 8 8 2.67 × 10 5 8 8 2.67 × 10 4 8 8 2.67 × 10 3 8 7 2.67 × 10 2 8 6 2.67 × 10 1 6 1 2.67 × 10 0 2 0 3.4 Comparison of the RT-RAA and RT-qPCR assays with clinical samples A total of 38 clinical samples were used to evaluate the RT-RAA assay and RT-qPCR. The RT-qPCR showed positive results for 18 out of 38 samples with a positive rate of 47.4%, and RT-RAA showed positive results for 16 out of 38 samples with a positive rate of 42.1%. Compared with RT-qPCR, the kappa value of the RT-RAA assay for NoV GII.4 detection was 0.894 (p < 0.001), suggesting that both assays were consistent. A detailed comparison of both assays is shown in Table 3 . Table 3 Clinical performance of RT-RAA for detection of NoV GII.4 RT-qPCR RT-RAA Total Agreement Kappa p-value of kappa Positive Negative Positive 16 2 18 88.9% 0.894 < 0.001 Negative 0 20 20 Total 16 22 38 4 Discussion In recent years, norovirus outbreaks have gradually increased worldwide. For example, it is estimated that there are 56,000–71,000 hospitalizations and 570–800 deaths due to NoV infection every year in the United States (Vinjé, 2015 ). The development of diagnostic technology for this virus is of far-reaching practical significance to improve the quality of public health safety. In this study, we established a rapid, sensitive, and specific RT-RAA assay for the detection of human NoV GII.4. Established methods for detecting norovirus, such as conventional RT-PCR (Osazuwa and Grobler et al., 2020 ), droplet digital PCR (Persson and Eriksson et al., 2018 ), TaqMan-based real-time RT-PCR (Gao and Wang et al., 2019 ), recombinase polymerase amplification (RPA) assays (Moore and Jaykus, 2017 ), and loop-mediated isothermal amplification (LAMP) assays (Yaren and Bradley et al., 2016 ), have multiple limitations. Conventional PCR has limitation of relatively low sensitivity, and requires agarose gel electrophoresis as the final interpretation of the results. TaqMan-based real-time RT-PCR requires expensive thermal cycler devices and trained technicians. The assays based on RPA are more expensive than other detection methods, costing approximately $ 15 per reaction. LAMP assays are more sophisticated because at least two pairs of primers need to be designed. Therefore, the development of a fast, cheap, and effective assay to detect norovirus is desirable. The sensitivity of the newly established RT-RAA assay reached 3.245 LGC per reaction. The kappa values of RT-RAA and RT-qPCR indicated that both assays were highly consistent. The few inconsistencies observed might stem from different principles for the two methods and the complexity of clinical samples. Notably, the RT-RAA assay was so rapid that produced positive signal approximately 5 min, and the entire detection protocol could be completed within 30 min. In contrast, the RT-qPCR and RT-LAMP assays normally require 1.5 h for completion (Jeon and Seo et al., 2017 ; Zaid Haddadin, 2020 ). Finally, due to thermal cycler limitations, PCR-based detection assays were difficult to integrate in small-scale portable devices amenable for POCT. Compared with LAMP, RT-RAA also effectively avoids the problem of aerosol pollution because the entire assay is completed in the reaction unit without additional opening of the lid. Thus, RT-RAA might be a potential method for POCT of norovirus. Although the RT-RAA assay has many advantages for detecting foodborne viruses, it also has some limitations. Firstly, it is more difficult to achieve multiplex detection of pathogens using RT-RAA than assays based on PCR because the long primers and probes form dimers more easily (Yan and Li et al., 2018 ). Furthermore, compared with digital PCR, the RT-RAA assay cannot achieve quantitative detection of nucleic acids temporarily. In the future, we will combine the RT-RAA assay with microfluidic digital chip technology for quantitative detection without the need for a thermal cycler or extensive technical expertise, which is expected to become one of the most powerful tools for the rapid and accurate diagnosis of pathogens. In conclusion, we successfully established a valuable and alternative RT-RAA analysis for NoV GII.4 detection with low cost, high sensitivity and short time consumption. This new assay can be a suitable method for the diagnosis of NoV infection in poorly developed areas under limited conditions. Abbreviations RT-RAA: Reverse transcription recombinase-aided amplification; NoV: Norovirus; LGC: log10 genomic copies; SNPs: Single nucleotide polymorphisms; POCT: Point-of-care testing; RPA: Recombinase polymerase amplification; LAMP: loop-mediated isothermal amplification; Declarations Acknowledgments We would like to thank Editage (www.editage.cn) for English language editing. Authors’ contributions YH, ZQ, QW and LX conceived and designed the experiment. ZQ, WC, LX and JG performed the experiments. ZQ WC and LX data statistic analyses. ZQ and LX drafted the manuscript. ZQ, YJ, LX YL, LW, YH and QW reviewed the final manuscript. All authors read and approved the final manuscript. Funding This work was supported by the National Key Research and Development Program of China (2018YFC1602500), the National Natural Science Foundation of China (31872912), the Natural Science Foundations of Guangdong Province for Distinguished Young Scholars (2019B151502065), the Key Research and Development Program of Guangdong Province (2019B020209001), and GDAS’Project of Science and Technology Development (2020GDASYL-20200104008). Availability of data and materials All data generated or analysed during this study are included in this published article. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Allen, D. J. and E. Trainor, et al. (2016). "Early Detection of Epidemic GII-4 Norovirus Strains in UK and Malawi: Role of Surveillance of Sporadic Acute Gastroenteritis in Anticipating Global Epidemics." PLOS ONE 11 (4): e0146972. https://doi.org/10.1371/journal.pone.0146972. Bai, X. and X. Ma, et al. (2020). "Field applicable detection of hepatitis B virus using internal controlled duplex recombinase-aided amplification assay and lateral flow dipstick assay." Journal of Medical Virology. https://doi.org/10.1002/jmv.25778. Bartsch, S. M. and B. A. Lopman, et al. (2016). "Global Economic Burden of Norovirus Gastroenteritis." PLOS ONE 11 (4): e0151219. https://doi.org/10.1371/journal.pone.0151219. Duan, S. and G. Li, et al. (2018). "A probe directed recombinase amplification assay for detection of MTHFR A1298C polymorphism associated with congenital heart disease." BioTechniques 64 (5): 211. https://doi.org/10.2144/btn-2018-2010. Gao, X. and Z. Wang, et al. (2019). "Surveillance of norovirus contamination in commercial fresh/frozen berries from Heilongjiang Province, China, using a TaqMan real-time RT-PCR assay." Food Microbiology 82: 119-126. https://doi.org/10.1016/j.fm.2019.01.017. Jeon, S. B. and D. J. Seo, et al. (2017). "Development of one-step reverse transcription loop-mediated isothermal amplification for norovirus detection in oysters." Food Control 73: 1002-1009. https://doi.org/10.1016/j.foodcont.2016.10.005. Kojima, S. and T. Kageyama, et al. (2002). "Genogroup-specific PCR primers for detection of Norwalk-like viruses." Journal of virological methods 100 (1-2): 107-114. https://doi.org/10.1016/S0166-0934(01)00404-9. Krisztián Bányai and Mary KEstes , et al. (2018). "Viral gastroenteritis." lancet 392: 175–86. http://dx.doi.org/10.1016/S0140-6736(18)31128-0. Li, Y. and Z. Yu, et al. (2020). "Development of a recombinase-aided amplification assay for rapid and sensitive detection of porcine circovirus 3." Journal of Virological Methods 282: 113904. Loisy, F. and R. L. Atmar, et al. (2005). "Real-time RT-PCR for norovirus screening in shellfish." Journal of Virological Methods 123 (1): 1-7. https://doi.org/10.1016/j.jviromet.2020.113904. Luo, J. W. X. X. (2012). "Colorimetric detection of norovirus genotype GII by reverse transcription loop-mediated isothermal amplification." Chinese journal of virology 28 (2): 165-71. Moore, M. D. and L. Jaykus (2017). "Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses." Scientific Reports 7 (1). https://doi.org/10.1038/srep40244. Moore, M. D. and R. M. Goulter, et al. (2015). "Human Norovirus as a Foodborne Pathogen: Challenges and Developments." Annual review of food science and technology 6 (1): 411-433. https://doi.org/10.1146/annurev-food-022814-015643. Nenonen, N. P. and C. Hannoun, et al. (2014). "Norovirus GII.4 Detection in Environmental Samples from Patient Rooms during Nosocomial Outbreaks." Journal of Clinical Microbiology 52 (7): 2352-2358. https://doi.org/10.1128/JCM.00266-14. Osazuwa, F. and H. S. Grobler, et al. (2020). "Phylogenetic lineage of GII.17 norovirus identified among children in South-South, Nigeria." BMC Research Notes 13 (1). https://doi.org/10.1186/s13104-020-05185-0. Persson, S. and R. Eriksson, et al. (2018). "Comparison between RT droplet digital PCR and RT real-time PCR for quantification of noroviruses in oysters." International Journal of Food Microbiology 284: 73-83. https://doi.org/10.1016/j.ijfoodmicro.2018.06.022. Siebenga, J. J. and H. Vennema, et al. (2009). "Norovirus Illness Is a Global Problem: Emergence and Spread of Norovirus GII.4 Variants, 2001–2007." The Journal of Infectious Diseases 200 (5): 802-812. https://doi.org/10.1086/605127. Silva, L. D. D. and E. L. Rodrigues, et al. (2013). "Detection of the pandemic norovirus variant GII.4 Sydney 2012 in Rio Branco, state of Acre, northern Brazil." Memórias do Instituto Oswaldo Cruz 108 (8): 1068-1070. https://doi.org/0.1590/0074-0276130293. Vinjé, J. (2015). "Advances in Laboratory Methods for Detection and Typing of Norovirus." Journal of Clinical Microbiology 53 (2): 373-381. https://doi.org/10.1128/JCM.01535-14. Wang, Y. and Y. Cui, et al. (2020). "Development of a recombinase-aided amplification assay for detection of orf virus." Journal of Virological Methods 280: 113861. https://doi.org/10.1016/j.jviromet.2020.113861. Xue, G. and S. Li, et al. (2020). "Reverse-Transcription Recombinase-Aided Amplification Assay for Rapid Detection of the 2019 Novel Coronavirus (SARS-CoV-2)." Analytical Chemistry 92 (14): 9699-9705. https://doi.org/0.1021/acs.analchem.0c01032. Xue, G. and S. Li, et al. (2020). "Use of a rapid recombinase-aided amplification assay for Mycoplasma pneumoniae detection." BMC Infectious Diseases 20 (1). https://doi.org/10.1186/s12879-019-4750-4. Xue, L. and R. Dong, et al. (2016). "Molecular epidemiology of noroviruses associated with sporadic gastroenteritis in Guangzhou, China, 2013-2015." Archives of Virology 161 (5): 1377-1384. https://doi.org/10.1007/s00705-016-2784-0. Yan, H. and F. Yagyu, et al. (2003). "Detection of norovirus (GI, GII), Sapovirus and astrovirus in fecal samples using reverse transcription single-round multiplex PCR." Journal of Virological Methods 114 (1): 37-44. https://doi.org/10.1016/j.jviromet.2003.08.009. Yan, T. and X. Li, et al. (2018). "Development of a reverse transcription recombinase-aided amplification assay for the detection of coxsackievirus A10 and coxsackievirus A6 RNA." Archives of Virology 163 (6): 1455-1461. https://doi.org/10.1007/s00705-018-3734-9. Yaren, O. and K. M. Bradley, et al. (2016). "A norovirus detection architecture based on isothermal amplification and expanded genetic systems." Journal of Virological Methods 237: 64-71. https://doi.org/10.1016/j.jviromet.2016.08.012. Yoo, J. E. and C. Lee, et al. (2017). "Evaluation of Various Real-Time Reverse Transcription Quantitative PCR Assays for Norovirus Detection." Journal of Microbiology and Biotechnology 27 (4): 816-824. https://doi.org/10.4014/jmb.1612.12026. Zaid Haddadin, M. D. E. B. (2020). "Characteristics of GII.4 Norovirus versus other Genotypes in Sporadic Pediatric Infections in Davidson County, Tennessee, USA." Clinical infectious diseases. https://doi.org/10.1093/cid/ciaa1001. Cite Share Download PDF Status: Published Journal Publication published 09 Mar, 2021 Read the published version in BMC Infectious Diseases → Version 1 posted Editorial decision: Minor revision 09 Feb, 2021 Review # 2 received at journal 06 Feb, 2021 Review # 1 received at journal 31 Jan, 2021 Reviewer # 2 agreed at journal 30 Jan, 2021 Reviewers invited by journal 16 Jan, 2021 Reviewer # 1 agreed at journal 16 Jan, 2021 Editor assigned by journal 13 Jan, 2021 Submission checks completed at journal 19 Dec, 2020 Editor invited by journal 17 Dec, 2020 First submitted to journal 20 Oct, 2020 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-132273","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":6783052,"identity":"96031dcd-afef-4847-ae0f-66f7f7005d5b","order_by":0,"name":"Zhiwei Qin","email":"","orcid":"","institution":"Kunming University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhiwei","middleName":"","lastName":"Qin","suffix":""},{"id":6783053,"identity":"c0620875-0c04-4e0f-8a5b-7773072dda2d","order_by":1,"name":"Liang Xue","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYHACxgMJQJKfgcHgANF6wFokG0jSAiKA6g2IU25wI/nAgQc1d+w2n1+88dANBrs8glokZ6QlHEg49ix5241nBYdzGJKLCWrhl8gxOJDAdjjZ7MYZA6CWA4kNhLSwSeR/OJDw73Cy8QxitQBtASprO2xnwN9DpBbJnmcGBxL7DidI3GAD+sUgmbAWg+PJDx/++HbYnr//8ObPORV2hLXAQGKDRALIBGLVA4E9A/8BEpSPglEwCkbBiAIAAXdJQPh8HjYAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-2106-4690","institution":"Guangdong Institute of Microbiology","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Liang","middleName":"","lastName":"Xue","suffix":""},{"id":6783054,"identity":"9a7e2e02-5df8-4cf7-bf0e-015dd435626b","order_by":2,"name":"Weicheng Cai","email":"","orcid":"","institution":"Guangdong Institute of Microbiology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weicheng","middleName":"","lastName":"Cai","suffix":""},{"id":6783055,"identity":"a1a52d37-60f2-40fd-b944-503b29a3fd38","order_by":3,"name":"Junshan Gao","email":"","orcid":"","institution":"Guangdong Institute of Microbiology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Junshan","middleName":"","lastName":"Gao","suffix":""},{"id":6783056,"identity":"0cb0610c-821b-4941-bb00-4c18b29c8e12","order_by":4,"name":"Yueting Jiang","email":"","orcid":"","institution":"First Affiliated Hospital of Guangzhou Medical university","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yueting","middleName":"","lastName":"Jiang","suffix":""},{"id":6783057,"identity":"ff40a4f8-1df2-4ad4-9630-e96fef080dd1","order_by":5,"name":"Jiale Yang","email":"","orcid":"","institution":"Guangdong Institute of Microbiology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiale","middleName":"","lastName":"Yang","suffix":""},{"id":6783058,"identity":"e6eccc60-10c4-4e50-a796-958522c884f9","order_by":6,"name":"Yanhui Liang","email":"","orcid":"","institution":"Guangdong Institute of Microbiology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yanhui","middleName":"","lastName":"Liang","suffix":""},{"id":6783059,"identity":"3ae6633d-5896-462d-a310-0f541688ea04","order_by":7,"name":"Linping Wang","email":"","orcid":"","institution":"Guangdong Institute of Microbiology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Linping","middleName":"","lastName":"Wang","suffix":""},{"id":6783060,"identity":"e4d96bc7-a200-4aec-bc9a-bb1102554640","order_by":8,"name":"Jumei Zhang","email":"","orcid":"","institution":"Guangdong Institute of Microbiology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jumei","middleName":"","lastName":"Zhang","suffix":""},{"id":6783061,"identity":"47e1e9e8-dcbb-4bcc-b6ab-220802bee7e2","order_by":9,"name":"Yongdan Hu","email":"","orcid":"","institution":"Kunming University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yongdan","middleName":"","lastName":"Hu","suffix":""},{"id":6783062,"identity":"fcb456c8-59e6-4f16-82ea-651b26caa532","order_by":10,"name":"Qingping Wu","email":"","orcid":"","institution":"Guangdong Institute of Microbiology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qingping","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2020-12-19 14:01:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-132273/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-132273/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12879-021-05942-x","type":"published","date":"2021-03-09T15:00:27+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":4451129,"identity":"00b68e95-704e-452a-8a4e-2a0bdae9ad3c","added_by":"auto","created_at":"2020-12-22 19:37:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":949431,"visible":true,"origin":"","legend":"Multiple sequence alignment of primers and probe sets with GII.4 strain sequences ","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-132273/v1/b54df903c62bfe4e8d867fe0.png"},{"id":4450978,"identity":"e3aad16a-53d4-4d5c-b03a-8ba8734de461","added_by":"auto","created_at":"2020-12-22 19:34:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":193354,"visible":true,"origin":"","legend":"Specificity of RT-RAA for NoV GII.4 (A)The RT-RAA assay was positive for NoV GII.4 and negative for NoV GI, rotavirus, sapovirus, astrovirus, enterovirus, adenovirus, and the negative control. (B) The RT-RAA assay was positive for NoV GII.4, and negative for NoV GII.2, GII.3, GII.6, GII.8, GII.17, and the negative control.","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-132273/v1/32f8b660ae6500c162d8f6cb.png"},{"id":4450980,"identity":"9649ca40-8882-4e38-b4ee-ed6f1d0ba83f","added_by":"auto","created_at":"2020-12-22 19:34:57","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":693217,"visible":true,"origin":"","legend":"Sensitivity of RT-RAA for GII NoV","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-132273/v1/eeaaadb81babc73842b19cdb.jpg"},{"id":13639006,"identity":"af20d5ef-3aac-4986-8920-703c8ce00c42","added_by":"auto","created_at":"2021-09-17 08:53:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1348578,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-132273/v1/79480600-b231-4e93-bd30-10acd2866f74.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eDevelopment of a Recombinase-Aided Amplification Assay for Rapid Detection of Human Norovirus GII.4\u003c/p\u003e","fulltext":[{"header":"1 Introduction","content":" \u003cp\u003eNoroviruses (NoV) are positive-sense single-stranded RNA viruses and are regarded as one of the main causes of acute gastroenteritis worldwide. Globally, it is estimated that the incidence of NoV has reached approximately 10% and results in over \u003cspan\u003e$\u003c/span\u003e60\u0026nbsp;billion in social costs per year (Bartsch and Lopman et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Infection with NoV generally results in abdominal pain, diarrhea, and vomiting (Moore and Goulter et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). It has been reported that NoV infects people of all ages, but is more severe in children and the elderly, especially in low-income countries, leading to over 200,000 deaths every year (Kriszti\u0026aacute;n B\u0026aacute;nyai, 2018).\u003c/p\u003e \u003cp\u003eTraditional detection methods for NoV, such as immunoassays and electron microscopy, are not suitable for rapid diagnosis because most of them are generally time-consuming and laborious. Common nucleic molecular diagnostic assays for NoV detection with high specificity and sensitivity, such as fluorescence-based real-time PCR and nested PCR, have been used in disease diagnosis (Yan and Yagyu et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Yoo and Lee et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). However, expensive equipment and the need for trained technicians make these traditional detection methods restrictive and impractical for rapid and convenient detection in low-income regions.\u003c/p\u003e \u003cp\u003eThe recombinase-aided amplification (RAA) assay is a new isothermal nucleic acid amplification technology in recent years for pathogen detection. The reaction is typically completed in approximately 30\u0026nbsp;min at 37\u0026ndash;42\u0026nbsp;\u0026deg;C. RAA has been successfully applied in the detection of pathogens (Bai and Ma et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Li and Yu et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang and Cui et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xue and Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xue and Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and single nucleotide polymorphisms (SNPs) (Duan and Li et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Owing to its speed, low-cost, and high sensitivity, RAA is highly suitable for clinical applications, and is a potential assay for the point-of-care testing (POCT) for foodborne pathogens.\u003c/p\u003e \u003cp\u003eIn the past two decades, NoV GII.4 has been reported to be the predominant genotype worldwide, and more than half of the outbreaks and sporadic infections are caused by this genotype (Siebenga and Vennema et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). For decades, the most popular method for specific detection of NoV GII.4 has been sequencing and phylogenetic analysis (Silva and Rodrigues et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Nenonen and Hannoun et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Allen and Trainor et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Currently, there is no rapid detection method for NoV GII.4. Therefore, it is important to establish an efficient and rapid detection method in response to outbreaks of NoV GII.4. In this work, we describe a novel, isothermal, reverse transcription recombinase-aided amplification (RT-RAA) method for the detection of NoV GII.4.\u003c/p\u003e "},{"header":"2 Material And Methods","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Virus stock and clinical samples\u003c/h2\u003e \u003cp\u003ePositive stool samples of norovirus, enterovirus, astrovirus, adenovirus, sapovirus, and rotavirus used in this study were those detected in our previous studies (Xue and Dong et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). All samples were diluted to 20% (w/v) in phosphate-buffered saline (PBS, pH 7.2), divided into 50 \u0026micro;L per tube, and stored at \u0026minus;\u0026thinsp;80\u0026nbsp;\u0026deg;C until use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Nucleic acid extraction\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from 50 \u0026micro;L of each stool sample using the High Pure viral RNA kit (Magen, Guangzhou, China) according to the manufacturer\u0026rsquo;s protocol. The RNA was eluted in 50 \u0026micro;L RNase-free water and stored at \u0026minus;\u0026thinsp;80\u0026nbsp;\u0026deg;C until use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Design of primers and probes\u003c/h2\u003e \u003cp\u003eComplete genome sequences of human norovirus GII.4 strains were retrieved from GenBank and used for comparative analyses using MEGA version 7.0 (Kumar et al., 2018). As the specific site of NoV GII.4 exhibited substantial divergence from other prevalent NoVs (GII.2, GII.3, GII.6, GII.8, and GII.17) and other common foodborne viruses (enterovirus, astrovirus, adenovirus, sapovirus, and rotavirus), it was used as the nucleic target for the RT-RAA of NoV GII.4. The forward and reverse primers and probe were designed according to the manufacturer\u0026rsquo;s guidelines (Qitian, JiangSu, China) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). All primers and probes were synthesized by Shanghai GENEray (Shanghai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Preparation of viral standards\u003c/h2\u003e \u003cp\u003eThe primers F3 and G2SKR were as described in previous studies (Kojima and Kageyama et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Luo, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). A 413-bp (net 4977\u0026ndash;5389, GenBank accession no. JX989074) fragment of the ORF1-ORF2 genes of NoV GII.4 was cloned into the pEASY-T1 vector (Transgen Biotech, Beijing, China) for DNA copy number quantification. Then, the recombinant plasmid was amplified using the Premix Ex Taq version 2.0 Kit (Takara, Dalian, China) and 2 \u0026micro;L template. The nucleotide amplicon was gel purified using the Hipure Gel Pure DNA Mini Kit (Magen) and subjected to in vitro transcription and recovery of RNA using the mMESSAGE mMACHINE\u0026trade; T7 Transcription Kit (Thermo Fisher, Shanghai, China) according to the manufacturer\u0026rsquo;s instructions. The cRNA was quantified using an EPOCH2 Microplate Spectrophotometer (BioTek, Winooski, VT) and the cRNA copy number was calculated using the following formula: cRNA copy number (copy number/\u0026micro;L) = [6.02\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e23\u003c/sup\u003e \u0026times; cRNA concentration (ng/\u0026micro;L)\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e]/[cRNA length in nucleotides\u0026thinsp;\u0026times;\u0026thinsp;340]. The cRNA was aliquoted into centrifuge tubes every 5 \u0026micro;L/tube, and stored at \u0026minus;\u0026thinsp;20\u0026nbsp;\u0026deg;C until further use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 RT-qPCR assay\u003c/h2\u003e \u003cp\u003eRT-qPCR reactions were carried out using the One Step PrimeScript\u0026trade; RT-PCR kit (Perfect Real Time, Takara). Each 20-\u0026micro;L reaction mixture contained 0.4\u0026nbsp;pmol of forward and reverse primers, 0.8\u0026nbsp;pmol of probe, 10 \u0026micro;L of 2\u0026thinsp;\u0026times;\u0026thinsp;One Step RT-PCR buffer, 2 \u0026micro;L of template, 0.4 \u0026micro;L of TaKaRa Ex Taq HS, 0.4 \u0026micro;L of PrimeScript RT Enzyme Mix II, and RNase Free dH\u003csub\u003e2\u003c/sub\u003eO added to make the volume 20 \u0026micro;L. The primer pairs were COG2R and QNIF2d (Loisy and Atmar et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The size of the amplification product was 89\u0026nbsp;bp. The following amplification conditions were used: 42\u0026nbsp;\u0026deg;C for 300\u0026nbsp;s, 95\u0026nbsp;\u0026deg;C for 10\u0026nbsp;s, followed by 45 cycles of 95\u0026nbsp;\u0026deg;C for 5\u0026nbsp;s, and 60\u0026nbsp;\u0026deg;C for 20\u0026nbsp;s.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 RT-RAA assay\u003c/h2\u003e \u003cp\u003eRT-RAA reactions were carried out using the modified RAA kit (Qitian). Each 50-\u0026micro;L reaction mixture contained 2.1\u0026nbsp;pmol of forward and reverse primers, 0.6\u0026nbsp;pmol of probe, 25 \u0026micro;L of buffer VI, 2.5 \u0026micro;L of template, 1 \u0026micro;L of RNase inhibitor (20 U), 1 \u0026micro;L of RTase (50 U) and nuclease-free water added to make the volume 47.5 \u0026micro;L. The reaction mixture was added to RT-RAA lyophilized enzyme pellets, and 2.5 \u0026micro;L of magnesium acetate was added to the tops of the reaction tube lids. The magnesium acetate droplets were then spun down using a mini centrifuge, and the reactions were quickly transferred to a Lightcycler@96 (Roche, Basel, Switzerland) set to 39\u0026nbsp;\u0026deg;C with cycle reads every 30\u0026nbsp;s. Nuclease-free water was used as a negative control in every test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Evaluation of specificity and sensitivity\u003c/h2\u003e \u003cp\u003eEnterovirus, astrovirus, adenovirus, sapovirus, and rotavirus were used to evaluate specificity. NoV GII.2, NoV GII.3, NoV GII.6, NoV GII.8, and NoV GII.17 were used to evaluate the specificity of NoV genotypes. The sensitivity of the RT-RAA assay for detection of human NoV GII.4 was determined using 10-fold dilutions of cRNA (10\u003csup\u003e7\u003c/sup\u003e to 10\u003csup\u003e0\u003c/sup\u003e copies per reaction, n\u0026thinsp;=\u0026thinsp;8). Negative control reactions were performed in parallel for each run.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Evaluation of the RT-RAA assay using clinical samples\u003c/h2\u003e \u003cp\u003eTo evaluate clinical performance of RT-RAA, a total of 38 clinical samples previously confirmed as NoV GII.4-positive by sequencing assay were used for nucleic acid extraction, and detection in the RT-RAA and RT-qPCR assays.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Statistical analysis\u003c/h2\u003e \u003cp\u003eTo determine the detection limit of RT-RAA, a probit analysis was performed at a probability level of 95%, and the \u003cem\u003ep\u003c/em\u003e and kappa values of RT-RAA and RT-qPCR were calculated. All statistics and analysis were performed by using SPSS 24.0 (IBM Corp, Armonk, NY)\u003c/p\u003e \u003c/div\u003e "},{"header":"3 Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003e3.1 Development and screening of RT-RAA primer and probe sets\u003c/h2\u003e\n\u003cp\u003eA total of 1,942 complete genome sequences of NoVs GII were retrieved from GenBank. Based on bioinformatic analysis, including length, genotype, regional distribution, and prevalence, the non-human NoV strains, repeated sequence strains, obvious long fragment insertion strains, deletion mutations, and long genetic distance strains were removed to obtain 216 reference strains that contained 55 GII.4, 5 GII.1, 20 GII.2, 20 GII.3, 7 GII.5 20 GII.6, 8 GII.7, 1 GII.8, 2 GII.10, 20 GII.12, 6 GII.13, 5 GII.14, 1 GII.16, 20 GII.17, 1 GII.20, 2 GII.21, 3 GII.22, 15 GII.24, and 5 GII.25. Then, the 55 NoVs GII.4 were used as reference strains for comparative analyses to design primers and probes. Twenty-two combinations of candidate primers (2 forward and 11 reverse) were produced and screened for reactivity to purified GII.4 RNA. Of these, five primer sets were identified as capable of amplifying target RNA, and a probe (ROP) was designed to accommodate all sets (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). All RT-RAA primers were screened by fluorescence RAA and electrophoresis with PCR and RAA. Because of resource constraints, one set of primers (RF1 and RR4 with probe ROP) was chosen for subsequent evaluation. Fifty-five GII.4 sequences were used for alignment with primers RF1, RR4, and probe ROP, and sequence alignment showed that RF1RR4 with ROP was highly conserved for GII.4 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eThe matching of primers and probes\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003ePrimer Name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eSequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eNucleotide\u003c/p\u003e\n\u003c/th\u003e\n\u003cth rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eLength\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eMatching of primer and probe\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0\u0026ndash;2\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3\u0026ndash;4\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026ge;\u0026thinsp;5\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRF1\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eATTTTTACGTGCCCAGACAAGAGCCAATGTTCAG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e4986\u0026ndash;5019/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e34\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e96.4%(53/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3.6%(2/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRF2\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eCAAGAGCCAATGTTCAGATGGATGAGATTCTCAG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5003\u0026ndash;5036/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e34\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e96.4%(53/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3.6%(2/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR1\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eTCAGATGGGTTGGCGTCACTCGACGCCATCTTC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5087\u0026ndash;5119/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e33\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e96.4%(53/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3.6%(2/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR2\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eGACCCATCAGATGGGTTGGCGTCACTCGACGCC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5093\u0026ndash;5125/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e33\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e92.7%(51/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e7.3%(4/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR3\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eTTGGCTGTGGACCCATCAGATGGGTTGGCGTC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5103\u0026ndash;5134/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e32\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e96.4%(53/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3.6%(2/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR4\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eACGAGGTTGGCTGTGGACCCATCAGATGGGTTGGC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5106\u0026ndash;5140/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e35\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e96.4%(53/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3.6%(2/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR5\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eACCAGGGGCTTGTACAAAATTGTTTCTAATCCAG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5234\u0026ndash;5267/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e34\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e94.5%(52/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5.5%(3/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR6\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eTTCTAGGGGATACTGTAAACTCTCCACCAG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5263\u0026ndash;5292/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e30\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e100%(55/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR7\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eTGTTTCTAATCCAGGGGTCAATTACATTTTGT\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5216\u0026ndash;5247/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e32\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e98.2%(54/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e1.8%(1/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR8\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eAGCCATAACCTCATTGTTGACCTCTGGGACGAG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5136\u0026ndash;5168/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e33\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e98.2%(54/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e1.8%(1/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR9\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eTGGCCAAATGGGAAAGGTAGGGGTTCAGATCAG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5332\u0026ndash;5364/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e33\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e49.1%(27/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e45.4%(25/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5.5%(3/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR10\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eATTCTGGCCAAATGAGAAAGGTAGGGATTCAG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5337\u0026ndash;5368/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e32\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e47.3%(26/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e47.3%(26/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5.5%(3/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eRR11\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eTATTTCACCTGGAGCGTTTCTAGGGGATACTG\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5278\u0026ndash;5309/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e32\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e96.4%(53/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3.6%(2/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eROP*\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eTCAGACCTGAGCACGTGGGAGGGCGATCGCAAFHQGGCTCCCAGTTTTGT\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e5033\u0026ndash;5082/\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e50\u0026nbsp;bp\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e96.4%(53/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e3.6%(2/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e0(0/55)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"7\"\u003e*For probe modifications: 3\u0026thinsp;=\u0026thinsp;dT-FAM; H\u0026thinsp;=\u0026thinsp;THF; Q\u0026thinsp;=\u0026thinsp;dT-BHQ1. The probe has a 3 C3-spacer for blocking extension.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003e3.2 Specificity of RT-RAA\u003c/h2\u003e\n\u003cp\u003eThe RT-RAA assay was positive for NoV GII.4 and negative for NoV GI, rotavirus, sapovirus, astrovirus, enterovirus, adenovirus, and the negative control (Fig.\u0026nbsp;2A). The RT-RAA assay was positive for NoV GII.4, and negative for NoV GII.2, GII.3, GII.6, GII.8, GII.17, and the negative control (Fig.\u0026nbsp;2B). No cross-reactivity of RNA from any control virus was observed. Therefore, RT-RAA for the detection of NoV GII.4 demonstrates a high specificity for the target.\u003c/p\u003e\n\u003cp\u003eFigure 2 Specificity of RT-RAA for NoV GII.4 (A)The RT-RAA assay was positive for NoV GII.4 and negative for NoV GI, rotavirus, sapovirus, astrovirus, enterovirus, adenovirus, and the negative control. (B) The RT-RAA assay was positive for NoV GII.4, and negative for NoV GII.2, GII.3, GII.6, GII.8, GII.17, and the negative control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003e3.2 Sensitivity of RT-RAA\u003c/h2\u003e\n\u003cp\u003eAfter serial dilution from 2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e7\u003c/sup\u003e to 2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e0\u003c/sup\u003e copies/\u0026micro;L, the cRNA of NoV GII.4 was tested using RT-RAA The results showed that the detection limit of the RT-RAA was 3.425 LGC (95% Cl: 2.906 LGC\u0026ndash;4.471 LGC)/reaction, and the 95% detection limit of the qRT-PCR was 2.110 LGC (95% Cl: 1.586 LGC\u0026ndash;3.113 LGC)/reaction (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e; Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eDetection limits of human NoVs GII.4 in RT-qPCR and RT-RPA assays\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eCopies/reaction\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eTimes of positive sample tested by two different assays for NoV (n\u0026thinsp;=\u0026thinsp;8)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eRT-qPCR\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eRT-RAA\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e7\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e6\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e0\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003e3.4 Comparison of the RT-RAA and RT-qPCR assays with clinical samples\u003c/h2\u003e\n\u003cp\u003eA total of 38 clinical samples were used to evaluate the RT-RAA assay and RT-qPCR. The RT-qPCR showed positive results for 18 out of 38 samples with a positive rate of 47.4%, and RT-RAA showed positive results for 16 out of 38 samples with a positive rate of 42.1%. Compared with RT-qPCR, the kappa value of the RT-RAA assay for NoV GII.4 detection was 0.894 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), suggesting that both assays were consistent. A detailed comparison of both assays is shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eClinical performance of RT-RAA for detection of NoV GII.4\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eRT-qPCR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eRT-RAA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eTotal\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eAgreement\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eKappa\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003ep-value of kappa\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePositive\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNegative\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePositive\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e18\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"3\" align=\"left\"\u003e\n\u003cp\u003e88.9%\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"3\" align=\"left\"\u003e\n\u003cp\u003e0.894\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"3\" align=\"left\"\u003e\n\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNegative\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e20\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e20\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTotal\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e22\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e38\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":" \u003cp\u003eIn recent years, norovirus outbreaks have gradually increased worldwide. For example, it is estimated that there are 56,000\u0026ndash;71,000 hospitalizations and 570\u0026ndash;800 deaths due to NoV infection every year in the United States (Vinj\u0026eacute;, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The development of diagnostic technology for this virus is of far-reaching practical significance to improve the quality of public health safety. In this study, we established a rapid, sensitive, and specific RT-RAA assay for the detection of human NoV GII.4.\u003c/p\u003e \u003cp\u003eEstablished methods for detecting norovirus, such as conventional RT-PCR (Osazuwa and Grobler et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), droplet digital PCR (Persson and Eriksson et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), TaqMan-based real-time RT-PCR (Gao and Wang et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), recombinase polymerase amplification (RPA) assays (Moore and Jaykus, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and loop-mediated isothermal amplification (LAMP) assays (Yaren and Bradley et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), have multiple limitations. Conventional PCR has limitation of relatively low sensitivity, and requires agarose gel electrophoresis as the final interpretation of the results. TaqMan-based real-time RT-PCR requires expensive thermal cycler devices and trained technicians. The assays based on RPA are more expensive than other detection methods, costing approximately \u003cspan\u003e$\u003c/span\u003e15 per reaction. LAMP assays are more sophisticated because at least two pairs of primers need to be designed. Therefore, the development of a fast, cheap, and effective assay to detect norovirus is desirable.\u003c/p\u003e \u003cp\u003eThe sensitivity of the newly established RT-RAA assay reached 3.245 LGC per reaction. The kappa values of RT-RAA and RT-qPCR indicated that both assays were highly consistent. The few inconsistencies observed might stem from different principles for the two methods and the complexity of clinical samples. Notably, the RT-RAA assay was so rapid that produced positive signal approximately 5\u0026nbsp;min, and the entire detection protocol could be completed within 30\u0026nbsp;min. In contrast, the RT-qPCR and RT-LAMP assays normally require 1.5\u0026nbsp;h for completion (Jeon and Seo et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Zaid Haddadin, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Finally, due to thermal cycler limitations, PCR-based detection assays were difficult to integrate in small-scale portable devices amenable for POCT. Compared with LAMP, RT-RAA also effectively avoids the problem of aerosol pollution because the entire assay is completed in the reaction unit without additional opening of the lid. Thus, RT-RAA might be a potential method for POCT of norovirus.\u003c/p\u003e \u003cp\u003eAlthough the RT-RAA assay has many advantages for detecting foodborne viruses, it also has some limitations. Firstly, it is more difficult to achieve multiplex detection of pathogens using RT-RAA than assays based on PCR because the long primers and probes form dimers more easily (Yan and Li et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Furthermore, compared with digital PCR, the RT-RAA assay cannot achieve quantitative detection of nucleic acids temporarily. In the future, we will combine the RT-RAA assay with microfluidic digital chip technology for quantitative detection without the need for a thermal cycler or extensive technical expertise, which is expected to become one of the most powerful tools for the rapid and accurate diagnosis of pathogens.\u003c/p\u003e \u003cp\u003eIn conclusion, we successfully established a valuable and alternative RT-RAA analysis for NoV GII.4 detection with low cost, high sensitivity and short time consumption. This new assay can be a suitable method for the diagnosis of NoV infection in poorly developed areas under limited conditions.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003eRT-RAA: Reverse transcription recombinase-aided amplification; NoV: Norovirus; LGC: log10 genomic copies; SNPs: Single nucleotide polymorphisms; POCT: Point-of-care testing; RPA: Recombinase polymerase amplification; LAMP: loop-mediated isothermal amplification;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Editage (www.editage.cn) for English language editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYH, ZQ, QW and LX conceived and designed the experiment. ZQ, WC, LX and JG performed the experiments. ZQ WC and LX data statistic analyses. ZQ and LX drafted the manuscript. ZQ, YJ, LX YL, LW, YH and QW reviewed the final manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Key Research and Development Program of China (2018YFC1602500), the National Natural Science Foundation of China (31872912), the Natural Science Foundations of Guangdong Province for Distinguished Young Scholars (2019B151502065), the Key Research and Development Program of Guangdong Province (2019B020209001), and GDAS\u0026rsquo;Project of Science and Technology Development (2020GDASYL-20200104008).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003eAllen, D. J. and E. Trainor, et al. (2016). \"Early Detection of Epidemic GII-4 Norovirus Strains in UK and Malawi: Role of Surveillance of Sporadic Acute Gastroenteritis in Anticipating Global Epidemics.\" PLOS ONE 11 (4): e0146972. https://doi.org/10.1371/journal.pone.0146972.\u003c/p\u003e\n\u003cp\u003eBai, X. and X. Ma, et al. (2020). \"Field applicable detection of hepatitis B virus using internal controlled duplex recombinase-aided amplification assay and lateral flow dipstick assay.\" Journal of Medical Virology. https://doi.org/10.1002/jmv.25778.\u003c/p\u003e\n\u003cp\u003eBartsch, S. M. and B. A. Lopman, et al. (2016). \"Global Economic Burden of Norovirus Gastroenteritis.\" PLOS ONE 11 (4): e0151219. https://doi.org/10.1371/journal.pone.0151219.\u003c/p\u003e\n\u003cp\u003eDuan, S. and G. Li, et al. (2018). \"A probe directed recombinase amplification assay for detection of MTHFR A1298C polymorphism associated with congenital heart disease.\" BioTechniques 64 (5): 211. https://doi.org/10.2144/btn-2018-2010.\u003c/p\u003e\n\u003cp\u003eGao, X. and Z. Wang, et al. (2019). \"Surveillance of norovirus contamination in commercial fresh/frozen berries from Heilongjiang Province, China, using a TaqMan real-time RT-PCR assay.\" Food Microbiology 82: 119-126. https://doi.org/10.1016/j.fm.2019.01.017.\u003c/p\u003e\n\u003cp\u003eJeon, S. B. and D. J. Seo, et al. (2017). \"Development of one-step reverse transcription loop-mediated isothermal amplification for norovirus detection in oysters.\" Food Control 73: 1002-1009. https://doi.org/10.1016/j.foodcont.2016.10.005.\u003c/p\u003e\n\u003cp\u003eKojima, S. and T. Kageyama, et al. (2002). \"Genogroup-specific PCR primers for detection of Norwalk-like viruses.\" Journal of virological methods 100 (1-2): 107-114. https://doi.org/10.1016/S0166-0934(01)00404-9.\u003c/p\u003e\n\u003cp\u003eKriszti\u0026aacute;n B\u0026aacute;nyai and \u003ca href=\"https://www.sciencedirect.com/science/article/pii/S0140673618311280?via%3Dihub#!\"\u003eMary KEstes\u003c/a\u003e, et al. (2018). \"Viral gastroenteritis.\" lancet 392: 175\u0026ndash;86. http://dx.doi.org/10.1016/S0140-6736(18)31128-0.\u003c/p\u003e\n\u003cp\u003eLi, Y. and Z. Yu, et al. (2020). \"Development of a recombinase-aided amplification assay for rapid and sensitive detection of porcine circovirus 3.\" Journal of Virological Methods 282: 113904.\u003c/p\u003e\n\u003cp\u003eLoisy, F. and R. L. Atmar, et al. (2005). \"Real-time RT-PCR for norovirus screening in shellfish.\" Journal of Virological Methods 123 (1): 1-7. https://doi.org/10.1016/j.jviromet.2020.113904.\u003c/p\u003e\n\u003cp\u003eLuo, J. W. X. X. (2012). \"Colorimetric detection of norovirus genotype GII by reverse transcription loop-mediated isothermal amplification.\" Chinese journal of virology 28 (2): 165-71.\u003c/p\u003e\n\u003cp\u003eMoore, M. D. and L. Jaykus (2017). \"Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses.\" Scientific Reports 7 (1). https://doi.org/10.1038/srep40244.\u003c/p\u003e\n\u003cp\u003eMoore, M. D. and R. M. Goulter, et al. (2015). \"Human Norovirus as a Foodborne Pathogen: Challenges and Developments.\" Annual review of food science and technology 6 (1): 411-433. https://doi.org/10.1146/annurev-food-022814-015643.\u003c/p\u003e\n\u003cp\u003eNenonen, N. P. and C. Hannoun, et al. (2014). \"Norovirus GII.4 Detection in Environmental Samples from Patient Rooms during Nosocomial Outbreaks.\" Journal of Clinical Microbiology 52 (7): 2352-2358. https://doi.org/10.1128/JCM.00266-14.\u003c/p\u003e\n\u003cp\u003eOsazuwa, F. and H. S. Grobler, et al. (2020). \"Phylogenetic lineage of GII.17 norovirus identified among children in South-South, Nigeria.\" BMC Research Notes 13 (1). https://doi.org/10.1186/s13104-020-05185-0.\u003c/p\u003e\n\u003cp\u003ePersson, S. and R. Eriksson, et al. (2018). \"Comparison between RT droplet digital PCR and RT real-time PCR for quantification of noroviruses in oysters.\" International Journal of Food Microbiology 284: 73-83. https://doi.org/10.1016/j.ijfoodmicro.2018.06.022.\u003c/p\u003e\n\u003cp\u003eSiebenga, J. J. and H. Vennema, et al. (2009). \"Norovirus Illness Is a Global Problem: Emergence and Spread of Norovirus GII.4 Variants, 2001\u0026ndash;2007.\" The Journal of Infectious Diseases 200 (5): 802-812. https://doi.org/10.1086/605127.\u003c/p\u003e\n\u003cp\u003eSilva, L. D. D. and E. L. Rodrigues, et al. (2013). \"Detection of the pandemic norovirus variant GII.4 Sydney 2012 in Rio Branco, state of Acre, northern Brazil.\" Mem\u0026oacute;rias do Instituto Oswaldo Cruz 108 (8): 1068-1070. https://doi.org/0.1590/0074-0276130293.\u003c/p\u003e\n\u003cp\u003eVinj\u0026eacute;, J. (2015). \"Advances in Laboratory Methods for Detection and Typing of Norovirus.\" Journal of Clinical Microbiology 53 (2): 373-381. https://doi.org/10.1128/JCM.01535-14.\u003c/p\u003e\n\u003cp\u003eWang, Y. and Y. Cui, et al. (2020). \"Development of a recombinase-aided amplification assay for detection of orf virus.\" Journal of Virological Methods 280: 113861. https://doi.org/10.1016/j.jviromet.2020.113861.\u003c/p\u003e\n\u003cp\u003eXue, G. and S. Li, et al. (2020). \"Reverse-Transcription Recombinase-Aided Amplification Assay for Rapid Detection of the 2019 Novel Coronavirus (SARS-CoV-2).\" Analytical Chemistry 92 (14): 9699-9705. https://doi.org/0.1021/acs.analchem.0c01032.\u003c/p\u003e\n\u003cp\u003eXue, G. and S. Li, et al. (2020). \"Use of a rapid recombinase-aided amplification assay for Mycoplasma pneumoniae detection.\" BMC Infectious Diseases 20 (1). https://doi.org/10.1186/s12879-019-4750-4.\u003c/p\u003e\n\u003cp\u003eXue, L. and R. Dong, et al. (2016). \"Molecular epidemiology of noroviruses associated with sporadic gastroenteritis in Guangzhou, China, 2013-2015.\" Archives of Virology 161 (5): 1377-1384. https://doi.org/10.1007/s00705-016-2784-0.\u003c/p\u003e\n\u003cp\u003eYan, H. and F. Yagyu, et al. (2003). \"Detection of norovirus (GI, GII), Sapovirus and astrovirus in fecal samples using reverse transcription single-round multiplex PCR.\" Journal of Virological Methods 114 (1): 37-44. https://doi.org/10.1016/j.jviromet.2003.08.009.\u003c/p\u003e\n\u003cp\u003eYan, T. and X. Li, et al. (2018). \"Development of a reverse transcription recombinase-aided amplification assay for the detection of coxsackievirus A10 and coxsackievirus A6 RNA.\" Archives of Virology 163 (6): 1455-1461. https://doi.org/10.1007/s00705-018-3734-9.\u003c/p\u003e\n\u003cp\u003eYaren, O. and K. M. Bradley, et al. (2016). \"A norovirus detection architecture based on isothermal amplification and expanded genetic systems.\" Journal of Virological Methods 237: 64-71. https://doi.org/10.1016/j.jviromet.2016.08.012.\u003c/p\u003e\n\u003cp\u003eYoo, J. E. and C. Lee, et al. (2017). \"Evaluation of Various Real-Time Reverse Transcription Quantitative PCR Assays for Norovirus Detection.\" Journal of Microbiology and Biotechnology 27 (4): 816-824. https://doi.org/10.4014/jmb.1612.12026.\u003c/p\u003e\n\u003cp\u003eZaid Haddadin, M. D. E. B. (2020). \"Characteristics of GII.4 Norovirus versus other Genotypes in Sporadic Pediatric Infections in Davidson County, Tennessee, USA.\" Clinical infectious diseases. https://doi.org/10.1093/cid/ciaa1001.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-infectious-diseases","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"infd","sideBox":"Learn more about [BMC Infectious Diseases](http://bmcinfectdis.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/infd","title":"BMC Infectious Diseases","twitterHandle":"#bmcinfectdis","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Norovirus, Detection, Rapid diagnostic technique, Recombinase-aided amplification","lastPublishedDoi":"10.21203/rs.3.rs-132273/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-132273/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Human noroviruses are one of the main causes of foodborne illnesses and represent a serious public health concern. Rapid and sensitive assays for human norovirus detection are undoubtedly necessary for clinical diagnosis, especially in regions without more sophisticated equipment.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethod:\u003c/strong\u003e The recombinase-aided amplification (RT-RAA) is a fast, robust and isothermal nucleic acid detection method based on enzyme reaction. This method can complete the sample detection at 39°C in 30 minutes. In this study, we successfully established a rapid reverse transcription recombinase-aided amplification (RT-RAA) assay for the detection of human norovirus GII.4 and applied this assay to clinical samples, as well as comparison with commercial RT-qPCR.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eAn analytical sensitivity detection of the RT-RAA at a 95% probability of 3.425 log10 genomic copies (LGC)/reaction. Moreover, no cross-reaction was observed with other norovirus genogroups and other common foodborne viruses. Stool samples were examined by RT-RAA and reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). Compared with RT-qPCR, kappa values for human norovirus detection with RT-RAA were 0.894 (p \u0026lt; 0.001), indicating that both assays were in agreement.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThis RT-RAA assay provides a rapid, specific, and sensitive assay for human norovirus detection and is suitable for clinical testing.\u003c/p\u003e","manuscriptTitle":"Development of a Recombinase-Aided Amplification Assay for Rapid Detection of Human Norovirus GII.4","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-12-22 19:34:55","doi":"10.21203/rs.3.rs-132273/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revision","date":"2021-02-10T00:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-02-07T00:00:00+00:00","index":2,"fulltext":"Recommendation: Accept after minor essential revisions\nForm responses:\n---\n\nComments to Author:\n---\nComments to the Author\n\nThe purpose of this study was to establish a rapid reverse transcription recombinase-aided amplification (RT-RAA) assay for the detection of human norovirus GII.4 and applied this assay to clinical samples. The sensitivity of the newly established RT-RAA assay reached 3.245 LGC per reaction and the kappa values of RT-RAA and RT-qPCR indicated that both assays were highly consistent. Also, the RT-RAA assay was so rapid that produced positive signal approximately 5 mins,and the entire detection protocol could be completed within 30 mins. Overall, the study is straight forward, the quality of the analysis is solid, and the data is concisely presented. Other than the specific recommendation below, no revisions are suggested. Since\n\nLine 38-39.The sentence\"An analytical sensitivity detection of the RT-RAA at a 95% probability of 3.425 log10 genomic copies (LGC)/reaction\" is awkward. Please rephrase it.\nL43: \"with\"change into \"of\";\nL55: \"has been reported\" change into \"been noted that\";\nL95: \" were retrieved from\" change into \" were obtained from\";\nL108-114: \" vector\" change into \" Vector\";\" version\" change into \" Version\";\" according to\" change into \" depending on\"\nL130: \"kit\"change into \"Kit\";\nL143-144: \"was determined using\" change into \"was identified using\";\"were performed in\" change into\" were conducted in\"\nL147: \"clinical\"change into \"the clinical\";\nL221: \"established\"change into \"set up\";\nL259: \" limited\"change into \"restricted\"\n* Publons Reviewer Recognition. Springer Nature can send verification of this review directly to Publons (a subsidiary of Clarivate Analytics). If you would like to take advantage of this service, please click on the “Yes” option below. Your name, email address, title of the reviewed manuscript, name of the journal, and date of your review submission (the “Review Data”) will then be transmitted to Publons upon publication of the manuscript. If you have already registered at Publons, they will notify you of the receipt of this review and update your profile as per your settings and their policy. If you are not registered with Publons, you will receive an email from them asking you to register in order for them to be able to recognize your review on your new profile page. Publons may use the Review Data to generate derivative metadata for the benefit of Publons and you as a reviewer, carefully considering the sensitivity of such information. For example, Publons may verify your record as a reviewer by updating your profile published on its webservice if you have registered for such service or help editors to identify candidate reviewers. Please find the details of processing in Publons’ privacy policy https://publons.com/about/terms: **Yes**\n* Declaration of competing interests: **I declare that I have no competing interests' below**\n* Reviewer Publication Consent. I agree for my report to be made available under an Open Access Creative Commons CC-BY License (http://creativecommons.org/licenses/by/4.0) if this manuscript is accepted for publication. Any comments that I do not wish to be included in the published report have been included as confidential comments to the editor, which will not be published.: **I agree to the terms of the CC-BY 4.0 license; please publish my name with my report.**\n* Is the study design appropriate to answer the research question (including the use of appropriate controls), and are the conclusions supported by the evidence presented?: **Yes**\n* Are the methods sufficiently described to allow the study to be repeated?: **Yes**\n* Is the use of statistics and treatment of uncertainties appropriate?: **Yes**\n* Is the presentation of the work clear?: **Yes**\n* Are the images in this manuscript (including electrophoretic gels and blots) free from apparent manipulation?: **Yes**\n"},{"type":"editorInvitedReview","content":"","date":"2021-02-01T00:00:00+00:00","index":1,"fulltext":"Recommendation: Accept after minor essential revisions\nForm responses:\n---\n\nComments to Author:\n---\n\nThe manuscript\" Development of a recombinase-aided amplification assay for rapid detection of human norovirus GII.4\" by Qin et al reported a rapid reverse transcription recombinase amplification (RT-RAA) assay for the detection of human norovirus GII.4. The data is solid and clear. The manuscript could be considered for publication after a minor revision and clarification. Specific comments:\n1. Line 32 add rapid reverse transcription before recombinase-..\n2. Line 37 spell out RT-qPCR when I shows up at the 1st time\n3. Line 52, 10% of what?\n4Line 87. change to ... were collected from our previous studies\n5.Section2.4.. How to remove DNA template after transcription of cRNA?\n6. Line 228 RT-PCR?\n7. line 252, temporarily? replace with at current stage?\n8. line 264, add RT-qPCR, RT-PCR\n\n\n\n\n* Publons Reviewer Recognition. Springer Nature can send verification of this review directly to Publons (a subsidiary of Clarivate Analytics). If you would like to take advantage of this service, please click on the “Yes” option below. Your name, email address, title of the reviewed manuscript, name of the journal, and date of your review submission (the “Review Data”) will then be transmitted to Publons upon publication of the manuscript. If you have already registered at Publons, they will notify you of the receipt of this review and update your profile as per your settings and their policy. If you are not registered with Publons, you will receive an email from them asking you to register in order for them to be able to recognize your review on your new profile page. Publons may use the Review Data to generate derivative metadata for the benefit of Publons and you as a reviewer, carefully considering the sensitivity of such information. For example, Publons may verify your record as a reviewer by updating your profile published on its webservice if you have registered for such service or help editors to identify candidate reviewers. Please find the details of processing in Publons’ privacy policy https://publons.com/about/terms: **Yes**\n* Declaration of competing interests: **I declare that I have no competing interests**\n* Reviewer Publication Consent. I agree for my report to be made available under an Open Access Creative Commons CC-BY License (http://creativecommons.org/licenses/by/4.0) if this manuscript is accepted for publication. Any comments that I do not wish to be included in the published report have been included as confidential comments to the editor, which will not be published.: **I agree to the terms of the CC-BY 4.0 license; please do not publish my name with my report. (default)**\n* Is the study design appropriate to answer the research question (including the use of appropriate controls), and are the conclusions supported by the evidence presented?: **Yes**\n* Are the methods sufficiently described to allow the study to be repeated?: **Yes**\n* Is the use of statistics and treatment of uncertainties appropriate?: **Yes**\n* Is the presentation of the work clear?: **Yes**\n* Are the images in this manuscript (including electrophoretic gels and blots) free from apparent manipulation?: **Yes**\n"},{"type":"reviewerAgreed","content":"","date":"2021-01-31T00:00:00+00:00","index":2,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-01-17T00:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2021-01-17T00:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2021-01-14T00:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-12-19T14:01:28+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-12-18T00:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2020-10-21T00:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-infectious-diseases","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"infd","sideBox":"Learn more about [BMC Infectious Diseases](http://bmcinfectdis.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/infd","title":"BMC Infectious Diseases","twitterHandle":"#bmcinfectdis","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3cbe521b-a7f9-4efa-9190-1ba30ce753fa","owner":[],"postedDate":"December 22nd, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":1581416,"name":"Infectious Diseases"}],"tags":[],"updatedAt":"2021-03-14T15:00:34+00:00","versionOfRecord":{"articleIdentity":"rs-132273","link":"https://doi.org/10.1186/s12879-021-05942-x","journal":{"identity":"bmc-infectious-diseases","isVorOnly":false,"title":"BMC Infectious Diseases"},"publishedOn":"2021-03-09 15:00:27","publishedOnDateReadable":"March 9th, 2021"},"versionCreatedAt":"2020-12-22 19:34:55","video":"","vorDoi":"10.1186/s12879-021-05942-x","vorDoiUrl":"https://doi.org/10.1186/s12879-021-05942-x","workflowStages":[]},"version":"v1","identity":"rs-132273","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-132273","identity":"rs-132273","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}