Identification and characterization of candidate R gene controlling resistance to Mungbean yellow mosaic virus disease in mungbean (Vigna radiata (L.) Wilczek).

Identification and characterization of candidate R gene controlling resistance to Mungbean yellow mosaic virus disease in mungbean (Vigna radiata (L.) Wilczek). | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification and characterization of candidate R gene controlling resistance to Mungbean yellow mosaic virus disease in mungbean (Vigna radiata (L.) Wilczek). Arshiya K B, Nagaraju N, Ramesh S, Padmaja A S, Mahammad Azar K This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7057081/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Mungbean ( Vigna radiata (L.) Wilczek) is a vital legume crop in Asia, but its productivity is severely hampered by Mungbean yellow mosaic virus (MYMV), often leading to yield losses up to 85%. Developing MYMV-resistant cultivars through genetic intervention is a sustainable approach to disease management. In this study, 16 mungbean genotypes, including resistant and susceptible lines, were evaluated for MYMV resistance using both natural and artificial inoculation methods. Genomic DNA was isolated and amplified using two pairs of degenerate Resistance Gene Analog (RGA) primers, CYR1 and VMR1, targeting conserved NBS-LRR domains associated with disease resistance. PCR amplification confirmed the presence of MYMV resistance genes in several genotypes, notably MYB-6, MYB-7, MYB-8, MYB-9, MYB-12, DR-12, DR-3, and KKM-3. Sequencing and BLASTn analysis of the RGA amplicons revealed high similarity with known resistance genes in Vigna species. Phylogenetic analysis further validated the relationship of these candidate R genes with established MYMV resistance genes. The study demonstrates the utility of RGA-based markers for rapid identification and characterization of MYMV resistance in mungbean, providing valuable tools for marker-assisted selection and breeding of resistant cultivars. Mungbean Vigna radiata Mungbean yellow mosaic virus (MYMV) Disease resistance Resistance gene analogs (RGA) NBS-LRR Marker-assisted selection PCR Genetic diversity Phylogenetic analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Mungbean ( Vigna radiata (L.) Wilczek) is an ancient and economically significant leguminous crop widely cultivated across Asia. Characterized by its rapid growth and adaptation to warm seasons, mungbean is a diploid species (2n = 22) that predominantly self-pollinates via cleistogamous flowers. The crop is believed to have originated in India (Vavilov 1926 ), with Vigna radiata var. sublobata Verdc. identified as its closest wild relative and progenitor (Mehandi et al. 2019 ). Despite its agronomic value, mungbean productivity in India is constrained by various biotic stresses (Pratap et al. 2019 ). Among these, Mungbean yellow mosaic virus (MYMV) disease is particularly destructive, with yield losses reported up to 85% depending on infection severity and crop stage (Karthikeyan et al. 2014 ; Kang et al. 2005 ). MYMV was first reported by Nariani ( 1960 ) at the Indian Agricultural Research Institute, New Delhi, and is now recognized as a major limiting factor for mungbean cultivation in South and Southeast Asia. MYMV is a member of the family Geminiviridae, subgroup II, genus Begomovirus and possesses a bipartite single-stranded DNA genome (DNA-A and DNA-B), each approximately 2.7 kb in size. These components share a conserved common region (CR) of 200–250 bp, which is nearly identical within a virus species but variable among species. While DNA-A encodes essential functions for replication and encapsidation (Rogers et al. 1986 ; Sunter et al. 1987 ), both DNA-A and DNA-B are required for infectivity (Hamilton et al. 1983 ). The virus is transmitted in a persistent manner by the whitefly ( Bemicia tabaci Genn.) with the B biotype being the most prevalent vector in Asia (Prasanna et al. 2015 ). Typical symptoms of MYMV infection include yellow spots or flecks, irregular yellow and green patches, reduced flowering and pods with immature, shrivelled seeds. Severe infections can result in necrosis, shortened internodes, and stunted plants, with yield losses ranging from 10–100% (Akhtar et al. 2009 ). The development of MYMV-resistant cultivars through genetic improvement is widely regarded as the most sustainable and eco-friendly approach to disease management. Plant resistance is mediated by resistance (R) genes, which encode proteins that recognize pathogen effectors and activate defence signalling (Morel and Dangl 1997 ). Notably, the nucleotide-binding site-leucine-rich repeat (NBS-LRR) class of R genes is the most prevalent and well-characterized in crop species (Bent et al. 1996 ). These genes contain conserved motifs, such as the p-loop, kinase-2, kinase-3a, and GLPL, which are critical for ATP and GTP binding (Meyers et al. 1999 ; Meyers et al. 2003 ) and can be used as molecular probes to identify homologous resistance genes across species (Singh et al. 1988 ). The use of Resistance Gene Analog (RGA)-based markers has proven effective in enhancing the pace and precision of breeding for disease resistance. RGAs have been isolated and characterized in several legume species, including mungbean (Maiti et al. 2011 ), urdbean (Basak et al. 2005 ; Maiti et al. 2011 ), soybean (Kanazin et al. 1996 ; He et al. 2003 ), common bean (Mutlu et al. 2006 ), chickpea (Huettel et al. 2002 ; Palomiro et al. 2006 ), pea (Timmerman-Vaughan et al. 2000 ), lentil (Yaish et al. 2004 ), and faba bean (Palomiro et al. 2006 ). Materials and Methods Selection of Mungbean Genotypes A total of 14 mungbean genotypes, comprising 13 MYMV-resistant and one susceptible genotype, were selected for this study. These genotypes were cultivated across three seasons- summer, rainy and winter and were also subjected to artificial inoculation in a glasshouse for one season. Resistance was assessed based on delayed symptom expression, percent disease index (PDI), and area under the disease progress curve (AUDPC) following both natural infection and artificial challenge. Five genotypes—AVMU 1698, AVMU 1699, AVMU 16100, AVMU 16101, and KPS 2 were identified as resistant to yellow mosaic disease (YMD) (Nagaraj et al. 2018 ). Further confirmation of resistance was performed using vector transmission by the whitefly ( Bemisia tabaci ). In total, 16 genotypes—including the 14 original lines, two F₂-derived lines (Bengaluru lines 1 and 3), and KKM-3 (a UAS-B released variety)—were screened under natural infection at the Main Research Station (MRS), Hebbal, University of Agricultural Sciences (UAS), Bangalore, India, during 2020–2021. Genomic DNA Isolation Genomic DNA was extracted from 15–20-day-old seedlings using the cetyltrimethylammonium bromide (CTAB) method as described by Lodhi et al. ( 1994 ), with modifications by Maruthi et al. ( 2002 ). DNA concentration and purity were determined using a Nanodrop spectrophotometer, and samples were diluted with 1× TE buffer to a final concentration of 50 ng/µl for subsequent analyses. Amplification of RGA-Primed Genomic Regions Two pairs of degenerate resistance gene analog (RGA) primers—CYR1 (from mungbean) and VMR1 (from mungbean and blackgram)—were used to amplify genomic regions from the 16 mungbean genotypes (Table 1). PCR reactions were performed in a 25 µl volume containing 2 µl of each primer (forward and reverse), 0.5 µl dNTPs, 0.5 µl Taq DNA polymerase (3 units), 2.5 µl Taq buffer, 17.5 µl nuclease-free water, and 2 µl genomic DNA, using an Eppendorf thermocycler. The PCR cycling conditions for the CYR1 primer were initial denaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1.5 min; followed by a final extension at 72°C for 10 min. For the VMR1 primer, the conditions were: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 45 s, annealing at 48.5°C for 45 s, and extension at 72°C for 1 min; with a final extension at 72°C for 10 min. PCR products were separated by electrophoresis on a 1.5% agarose gel stained with ethidium bromide in 1× TAE buffer and visualized under UV light. Table:1 Degenerate RGA primers used to amplify genomic regions in 16 mungbean genotypes. Identity of Marker and host Primer sequences Annealing temp ( o C) Reference CYR1 (Mungbean) F: GGGTGGNTTGGGTAAGACCAC R: NTCGCGGTGNGTGAAAAGNCT 57.0 Maiti et al., ( 2011 ) VMYR1 (Mungbean and black gram) F: AGTTTATAATTCGATTGCT R: ACTACGATTCAAGACGTCCT 48.5 Basak et al., ( 2005 ) Molecular Characterization of Resistance Gene Analogs (RGAs) PCR products corresponding to resistance gene analogs (RGAs) from mungbean samples were purified and subjected to Sanger sequencing. The resulting sequences were analysed using the NCBI BLASTn tool to determine homology with known resistance genes. For phylogenetic analysis, the obtained RGA sequences were aligned with reference resistance gene analog sequences retrieved from the GenBank database. Phylogenetic trees were constructed using the neighbor-joining method implemented in MEGA version 7.0 (Kumar et al. 2016), enabling the assessment of evolutionary relationships between the mungbean RGAs and established resistance genes from related legume species. Result Detection of Resistance Gene Analogs (RGAs) PCR amplification using the CYR1 and VMR1 degenerate primers was successful confirming the presence of MYMV disease. Specifically, amplification of CYR1-primed genomic regions indicated the presence of MYMV resistance genes in genotypes MYB-6, MYB-7, MYB-8, MYB-9, MYB-12, DR-12, DR-3, and KKM-3. Similarly, VMR1-primed regions were amplified in the same set of genotypes, further confirming the presence of MYMV resistance genes. The VMR1 amplicons (~ 445 bp) were notably smaller than those generated by CYR1 (~ 1236 bp), but both markers consistently identified the same resistant genotypes (Fig. 1 and Fig. 2). Where L = Ladder (1000bp), 1 = MYB-1, 2 = MYB-2, 3 = MYB-3, 4 = MYB-4, 5 = MYB-5, 6 = MYB-6, 7 = MYB = 7, 8 = MYB-8, 9 = MYB-9, 10 = MYB-10, 11 = MYB-11(susceptible check), 12 = MYB-12, 13 = MYB-13, 14 = KKM-3 15 = DR-1 ,16 = DR-3 Where, L = Ladder(100bp), 1 = MYB-1, 2 = MYB-2, 3 = MYB-3, 4 = MYB-4, 5 = MYB-5, 6 = MYB-6, 7 = MYB = 7, 8 = MYB-8, 9 = MYB-9, 10 = MYB-10, 11 = MYB-11 (susceptible check), 12 = MYB-12, 13 = MYB-13, 14 = KKM-3 15 = DR-1, 16 = DR-3 Molecular Characterization of RGAs The RGA amplicons were sequenced and analyzed using NCBI BLASTn. The current RGA-CYR1 isolate had 96.71% identity with Vigna radiata var. radiata putative disease resistance RPP13-1ike protein 1 (XM014647468.2) and 95.41% identity with Vigna mungo disease resistance protein CYR1 (CYR1) mRNA, complete sequence (HQ704837.1). The current RGA-VMR1 isolate has 89.64% identity with Vigna mungo disease resistance protein (VMYR-1) gene, partial sequence (AY297425.2) and 94.47% identity with Vigna mungo disease resistance protein (YR-3) mRNA, partial sequence (EF446378.1). The isolates have 89.11% identity Vigna radiata viral resistance candidate (MYR-1) gene, partial sequence (AY301990.1). The phylogenetic analysis of RGA sequence was carried out together with the known RGA sequences obtained from GenBank database by using MEGA 7.0 software (Table 2 and Table 3 ). GenBank accession numbers of different RGA used for current isolate sequence and analysis of nucleotide sequence of RGA against yellow mosaic virus associated with mungbean showed through phylogenetic tree (Fig. 3 ) and (Fig. 4 ). Table 2 List of RGA CYR1 used for comparison of different resistant gene sequences. Sl. No. RGA Analogous Per cent identity (%) Accession number 1 Vigna radiata var. radiata putative disease resistance RPP13-like protein 1 96.71 XM014647468.2 2 Vigna mungo disease resistance protein CYR1 (CYR1) mRNA, complete sequence 95.41 HQ704837.1 3 Vigna mungo disease resistance protein CYR1 (CYR1) gene, partial sequence 95.76 HQ704838.1 4 Vigna mungo cultivar T-9 disease resistance protein CYR1 95.61 KR350634.1 5 Vigna mungo cultivar WBU-108 disease resistance protein CYR1 (YR2) 97.22 EU258701.1 6 Phaseolus vulgaris hypothetical protein 86.53 XM007151255.1 7 Phaseolusvulgaris NBS-LRRdisease resistance-like protein 84.13 EU856786.1 8 Phaseolus vulgaris clone ContB2, complete sequence 85.10 EU931622.1 9 Phaseolus vulgaris NBS-LRR resistance-like protein complete sequence 84.06 AF306506.1 10 Vigna unguiculata putative disease resistance RPP13-like protein 1, transcript variant X2 81.81 XR003603755.1 11 Vignaunguiculata cultivarXiabao2 chromosome Vu04 80.54 XP098765578.1 12 Phaseolusvulgaris hypotheticalprotein mRNA, complete sequence 85.5 XM007143843.1 Table 3 List of RGA VMR1 used for comparison of different resistant gene sequences. Sl. No. RGA Analogous Per cent identity (%) Accession number 1 Vigna radiata var . radiata TMV resistance protein N-like, transcript variant X3, mRNA 96.12 XM022784106.1 2 Vigna mungo disease resistance protein (YR-3) mRNA, partial sequence 94.47 EF446378.1 3 Vigna mungo resistance protein (VMYR-2) gene, partial sequence 94.72 AY301991.1 4 Vigna angularis var. angularis DNA, chromosome 11, almost complete sequence, cultivar: Shumari 91.99 AP015044.1 5 Vigna mungo disease resistance protein (VMYR-1) gene, partial sequence 89.64 AY297425.2 6 Vigna radiata viral resistance candidate (MYR-1) gene, partial sequence 89.11 AY301990.1 7 Phaseolus vulgaris hypothetical protein mRNA, complete sequence 85.34 XM007152493.1 8 Glycine max strain Williams 82 clone, complete sequence 82.15 AC235351.1 9 Vigna unguiculata cultivar Xiabao 2 chromosome Vu03 79.02 CP039346.1 10 Phaseolus vulgaris hypothetical protein mRNA, complete sequence 78.66 XM007152501.1 11 Phaseolus vulgaris cloneputative resistance protein TIR 31 gene, partial cds 78.66 JQ313629.1 12 Glycine max clone, complete sequence 77.67 AC235891.2 13 Cajanuscajan TMVresistanceproteinN, transcript variant X4, mRNA 77.51 XM020366882.2 14 Glycine soja TMV resistance protein N-like, mRNA 77.43 XM028349904.1 15 Vigna unguiculata TMV resistance protein N-like , mRNA 77.4 XM028068349.1 16 Abrus precatorius TMV resistance protein N-like transcript variant X1, mRNA 76.89 XM027501909.1 17 Vigna vexillata disease resistance protein homolog gene, partial sequence 79.01 AF141015.1 Discussion The identification and characterization of resistance gene analogs (RGAs) in mungbean provide critical insights into the molecular basis of resistance against Mungbean yellow mosaic virus (MYMV), a major constraint to mungbean production in Asia. The present study demonstrates that the use of degenerate primers targeting conserved domains of plant R genes—specifically CYR1 and VMR1—enables the effective detection of candidate resistance genes in diverse mungbean genotypes. Structure and Function of Plant R Genes Plant R genes, particularly those belonging to the nucleotide-binding site-leucine-rich repeat (NBS-LRR) class, play a pivotal role in the recognition of pathogen-derived effectors and the activation of downstream defense responses. The NBS domain is involved in ATP/GTP binding and hydrolysis, which is essential for signal transduction, while the LRR domain mediates specific protein-protein interactions, allowing plants to recognize a wide array of pathogen effectors (Sekhwal et al., 2015 ). The ARC (activity-regulated cytoskeletal) domain, together with the NES (nucleotide exchange site), forms the core of the nucleotide-binding region, which is crucial for the conformational changes required during defense signaling. The high degree of sequence conservation in these domains across plant species has facilitated the development of degenerate primers, such as CYR1 and VMR1, which can amplify homologous resistance gene sequences in different legumes. Validation and Comparative Analysis of RGA Markers In this study, the amplification of CYR1 and VMR1 markers in multiple resistant mungbean genotypes (MYB-6, MYB-7, MYB-8, MYB-9, MYB-12, DR-1, DR-3, and KKM-3) confirms their association with MYMV resistance. This is in agreement with earlier reports by Maiti et al. ( 2011 ), who demonstrated the linkage of CYR1 with MYMIV resistance in both mungbean and urdbean. Similarly, Kabi et al. ( 2017 ) and Panigrahi et al. ( 2016 ) provided evidence for the utility of CYR1 in marker-assisted selection (MAS) for yellow mosaic virus resistance. The consistency of these results across studies and species highlights the robustness and transferability of these markers. The VMR1 marker, originally developed for blackgram (Basak et al., 2005 ), also proved effective in mungbean, further supporting the hypothesis that resistance gene analogs are conserved across Vigna species. However, as noted by Sowmini and Jayamani ( 2014 ), the expression of some markers may be monomorphic in certain genetic backgrounds, underscoring the importance of validating markers in target populations before deployment in breeding programs. Implications for Breeding and Genetic Resource Management The practical application of RGA markers in breeding programs is multifaceted. First, they enable rapid and accurate screening of breeding populations and germplasm collections for resistance alleles, significantly reducing the time and resources required for phenotypic selection. Second, the use of molecular markers circumvents the challenges posed by environmental variability and the often-quantitative nature of disease resistance. Third, RGA markers facilitate the pyramiding of multiple resistance genes, which is essential for achieving durable and broad-spectrum resistance. In the context of genetic resource management, the identification of diverse resistance sources and their molecular characterization enriches the genetic base available for mungbean improvement. This is particularly important given the narrow genetic diversity observed in many cultivated mungbean varieties. The conservation of RGA sequences across Vigna and other legume species also opens avenues for the introgression of resistance genes from wild relatives, leveraging the rich genetic resources present in gene banks. Evolutionary and Functional Insights The phylogenetic analysis conducted in this study revealed that the identified RGAs cluster closely with known resistance genes from Vigna radiata , Vigna mungo , and other legumes, indicating a shared evolutionary origin and functional conservation. Such analyses provide valuable information on the diversification and adaptation of R genes in response to pathogen pressure. The observed sequence similarity with resistance genes from other legumes, such as Phaseolus vulgaris and Glycine max , suggests that similar defence mechanisms may operate across different legume crops and that knowledge gained in one species can inform resistance breeding in others. Furthermore, the functional validation of these RGAs, through fine-mapping, gene expression analysis, and ultimately gene cloning, will be essential to confirm their role in MYMV resistance and to elucidate the molecular mechanisms underlying plant-virus interactions. Such studies can also reveal the presence of gene clusters, gene duplications, and other evolutionary processes that shape the R gene repertoire in mungbean and related species. Future Prospects Looking ahead, the integration of RGA-based markers with high-throughput genotyping platforms and next-generation sequencing technologies will enable the construction of high-density genetic maps and the identification of quantitative trait loci (QTLs) associated with disease resistance. This will further enhance the efficiency of MAS and facilitate the development of mungbean cultivars with durable resistance to MYMV and other pathogens. Additionally, the insights gained from RGA characterization can inform the design of gene editing strategies, such as CRISPR/Cas9-mediated targeted mutagenesis, to engineer novel resistance alleles or to enhance existing resistance traits. Conclusion The present study provides comprehensive insights into the identification and molecular characterization of candidate resistance gene analogs (RGAs) conferring resistance to Mungbean yellow mosaic virus (MYMV) in mungbean (Vigna radiata) . By employing degenerate primers (CYR1 and VMR1) targeting conserved domains of plant resistance genes, we successfully amplified and detected RGA sequences in several MYMV-resistant mungbean genotypes. Sequence analysis and phylogenetic comparisons revealed a high degree of similarity between these RGAs and known resistance genes from Vigna and other legume species, underscoring the evolutionary conservation of disease resistance mechanisms within the Fabaceae. The validation of CYR1 and VMR1 markers across diverse genotypes demonstrates their robustness and utility for marker-assisted selection (MAS) in mungbean breeding programs. These markers enable the rapid and precise identification of resistant individuals, thereby accelerating the development of MYMV-resistant cultivars. This is particularly significant given the challenges of phenotypic screening for viral diseases, which are often influenced by environmental variability and complex inheritance patterns. The deployment of RGA-based markers thus represents a powerful approach for enhancing the efficiency and accuracy of resistance breeding. From a genetic resource perspective, the identification of novel and diverse sources of MYMV resistance enriches the available germplasm pool and broadens the genetic base for mungbean improvement. The conservation of RGA sequences across Vigna and related genera also highlights the potential for utilizing wild relatives and landraces as reservoirs of valuable resistance genes. This is especially relevant in the context of ongoing efforts to conserve and utilize plant genetic resources for crop improvement and adaptation to emerging biotic stresses. Moreover, the findings of this study have important implications for understanding the molecular evolution of plant resistance genes. The clustering of mungbean RGAs with homologous sequences from other legumes suggests that common evolutionary pressures have shaped the diversification of R genes in response to pathogen challenges. Further functional validation and fine mapping of these candidate genes will provide deeper insights into the mechanisms of resistance and facilitate the cloning and transfer of effective resistance genes across species. In conclusion, this research advances our knowledge of the genetic architecture of MYMV resistance in mungbean and provides validated molecular tools for breeding programs aimed at developing durable, virus-resistant cultivars. The integration of RGA-based marker technology with conventional breeding and genetic resource management will play a pivotal role in safeguarding mungbean productivity and sustainability. The approaches and outcomes presented here can serve as a model for resistance gene discovery and utilization in other crop species, contributing to global efforts in crop improvement and food security. Declarations Author Contribution Dr. Nagaraju is my Guide during this whole research Program. Dr Ramesh and Ms. Padmaja were my members of research committee during my Master's Program. These three members helped me through my whole research from setting up the objective to completion of manuscript. Azar has helped me in data collection and completing the technical and no technical work. References Akhtar, KP, Kitsanachandee R, Srinives P, Abbas G, Asghar MJ, Shah, TM, Atta BM, Chatchawankanphanich O, Sarwar G, Ahmad M And Sarwar N. 2009. Field evaluation of mungbean recombinant inbred lines against mungbean yellow mosaic disease using new disease scale in Thailand. Plant Pathology. 25: 422–428. Basak J, Kundagrami S, Ghose TK. and Pal A. 2005. Development of Yellow mosaic virus (YMV) resistance linked DNA marker in Vigna mungo from populations segregating for YMV-reaction. Molecular Biotechnology. 14 (4): 375–383. Bent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R, Giradaut J, Leung J and Staskawicz BJ. 1996. RPS2 of Arabidopsis thaliana : a leucine-rich repeat class of plant disease resistance genes. Science. 265: 1856–1860. Hamilton WD0, Bisaro DM, Coutts RHA. and Buck K W. 1983.Demonstration of the bipartite nature of the genome of a single-stranded DNA plant virus by infection with the cloned DNA components. Nucleic Acids Research. 11:7387–7396. He CY, Tian AG, Zhang JS, Zhang ZY, Gai JY and Chen SY. 2003. Isolation and characterization of a full-length resistance gene homolog from soybean. Theory Applied Genetics. 106 (5): 786–793. Huettel B, Santra D, Muehlbauer F and Kahl G. 2002. Resistance gene analogues of chickpea ( Cicer arietinum L.) isolation, genetic mapping and association with a Fusarium resistance gene cluster Theory Applied Genetics. 255 (2):245–255. Kabi M, Das TR, Baisakh B. and Swain D. 2017. Resistant gene analogous marker assisted selection of Yellow mosaic virus (YMV) resistant genotypes in green gram ( Vigna radiata ). Current Microbiology and Applied Sciences. 6: 3247–3252. Kanazin, V, Marek, LF and Shoemaker RC. 1996. Resistance gene analogs are conserved and clustered in soybean. Proceedings National Academy of Sciences, U.S. A. 93 (21): 11746–11750. Kang BC, Yeam I. and Jahn MM. 2005. Genetics of plant virus resistance. Annual Review Phytopathology. 43: 581–621. Karthikeyan A, Shobhana VG, Sudha M, Raveendran M, Senthil N, Pandiyan M. and Nagarajan P. 2014. Mungbean Yellow Mosaic Virus (MYMV): a threat to green gram ( Vigna radiata ) production in Asia. Pest Management. 60: 314–324. Lodhi MA. Ye GN, Weeden NF and Reisch B. 1994. A simple and efficient method for DNA extraction from grapevine cultivars and Vitis species. Plant Molecular Biology. 12: 16–13. Maiti S, Basak J, Kundagrani S, Kundu AJ. and Pal A. 2011. Molecular marker assisted genotyping of Mungbean yellow mosaic India virus (MYMIV) resistant germplasm of mungbean. Mycology and Plant Pathology. 43 (3): 201–334. Maruthi MN, Colvin J, Seal SE, Gibson G. and Cooper J. 2002. Co-adaptation between Cassava Mosaic Geminiviruses and their local vector population. Virus research. 86: 71–85. Mehandi S, Quatadah S, Mishra SP, Singh 1, Praveen N. and Dwivedi N. 2019. Mungbean ( Vigna radiata L. Wilczek): retrospect and prospects. Legume Crops Characterization and Breeding for Improved Food Security, ed. El-Esawi MA (London: IntechOpen:49–66). Meyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW and Young ND 1999. Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant Journal. 20 (3): 317–332. Meyers BC, Kozik A, Griego A, Kuang H and Michelmore RW. 2003. Genome wide analysis of NBS-LRR-encoding genes in Arabidopsis. The Plant Cell. 15 (4): 809–834. Morel J B. and Dangl JL. 1997. The hypersensitive response and the induction of cell death in plants. Cell Death and Differentiation. 4 (8): 671–683. Mutlu N, Miklas PN. and Coyne DP. 2006. Resistance gene analog polymorphism (RGAP) markers co-localize with disease resistance genes and QTL in common bean. Molecular Breeding. 17 (2): 127–135. Nagaraj, Basavaraj S, Padmaja AS, Nagaraju N. and Ramesh S. 2018. Identification of stable sources of resistance to mungbean yellow mosaic virus (MYMV) disease in mungbean [ Vigna radiata (L.) Wilczek]. Plant Genetics Research. 17 (4): 362–370. Nariani TK. 1960. Yellow mosaic of mung ( Phaseolus aureus L.). Indian Phytopathogy. 13: 24–29. Palomiro C, Satovic Z, Cubero JJ and Torres AM. 2006. Identification and characterization of NBS-LRR class resistant gene analogs (RGAs) in faba bean ( Vicia faba L.) and chickpea ( Cicer arietinum L.) Genome. 49 (10): 1227–1237. Panigrahi KK, Das TR, Baisakh B, Mohanty A. and Pradhan J. 2016. Validation of CYR-1 marker linked with Yellow Mosaic Virus (YMV) resistance in black gram ( Vigna mungo ). Indian Genetics and Plant Breeding. 76 (1): 104–106. Prasanna HC, Kanakala S, Archana K, Jyothsna P, Varma Rk. and Malathi VG. 2015. Cryptic species composition and genetic diversity within Bemisia tabaci complex in soybean in India revealed by mtCOI DNA sequence. Integrative Agriculture. 14: 1786–1795. Pratap A. Gupta S, Basu PS, Tomar R, Dubey s, Rathore M, Prajapati Us, Singh P. and Kumari G. 2019. Towards development of climate smart mungbean: Challenges and opportunities. In Genomic Designing of Climate-Smart Pulse Crops. 235–264. Rogers SG, Bisaro DM, Horsch RB, Fraley RT, Hoffmann NL, Brand L, Elmer JS. and Lloyd AM. 1986. Tomato golden mosaic virus A component DNA replicates autonomously in transgenic plants. Cell. 45: 593–600. Sekhwal MK, Li P, Lam I, Wang X, Cloutier S. and You FM. 2015. Disease Resistance Gene Analogues (RGAs) in plants. International Journal of Molecular Sciences. 16 (8):19248–19290. Singh G, Kapoor S. and Singh K. 1988. Multiple disease resistance in mungbean with special emphasis on Mungbean yellow mosaic virus (MYMV). Trends Biotechnology. 21: 290–296. Sowmini K. and Jayamani P. 2014. Validation of molecular markers linked with yellow mosaic disease resistance in black gram. Legume Genomics Genetics. 5 (4): 25–30. Sunter G, Gardiner WE, Rushing AE, Rogers SG. and Bisaro DM. 1987. Independent encapsidation of Tomato golden mosaic virus , A component DNA in transgenic plants. Plant Molecular Biology. 8: 477–484. Tanksley SD, Young ND, Paterson AH. and Bonierable MD. 1989. RFLP mapping in plant breeding: new tools for old science. Biotechnology. 7: 257 – 26. Timmerman-Vaughan GM, Frew TJ and Weeden NF. 2000. Characterisation and linkage mapping of R-gene analogues DNA sequences in pea ( Pisum sativum L.) Theor.Appl. Genet. 101(1–2): 241–247. Vavilov NZ. 1926. Studies on the origin of cultivated plants. Chronica Botanica. 13(1/6): 1949–1950. Yaish MWE, Saenz LE, De Miera and De La Vega MP. 2004. Isolation of a family of resistance gene analog sequences of the nucleotide binding site (NBS) type from Lens species. Genome. 47: 650–659. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7057081","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":481541837,"identity":"63f02d65-58e5-4863-9fff-5b847109d5b3","order_by":0,"name":"Arshiya K B","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIie3RPQrCMBiA4ZRAugRdU/y7QkohIohepSXg1E0QxKGDEK8geI84i0KX4Cy4WIXuDoKCg6mIY9pRMO8QCHwPSQgANttvhkAIAKUQbk56h2vViSs4LQiqREBBsGLkuzVVX6X5KRODoEtiNr3FgyYCMDsfDITs4y6NBGe95WhybEmuL4aCIDYdozAikYB9euDy6EmoCUYNE+koN9ck0SRkY08m5YQqwDTZMqp2zLnKbTnxFWYk3KdBbyF4w5EpRrDkLW19Me8+mflr/ZXXh5wN6+48uxifX+R8/gLi91o2/u75ofdK0zabzfZvvQDZEkSZLo6togAAAABJRU5ErkJggg==","orcid":"","institution":"University of Agricultural Sciences, Bangalore","correspondingAuthor":true,"prefix":"","firstName":"Arshiya","middleName":"K","lastName":"B","suffix":""},{"id":481541838,"identity":"d73be22f-924b-4940-8f11-ff7bea3d2c53","order_by":1,"name":"Nagaraju N","email":"","orcid":"","institution":"University of Agricultural Sciences, Bangalore","correspondingAuthor":false,"prefix":"","firstName":"Nagaraju","middleName":"","lastName":"N","suffix":""},{"id":481541839,"identity":"58c1566a-c011-4339-8e6d-9f046b3e8c16","order_by":2,"name":"Ramesh S","email":"","orcid":"","institution":"University of Agricultural Sciences, Bangalore","correspondingAuthor":false,"prefix":"","firstName":"Ramesh","middleName":"","lastName":"S","suffix":""},{"id":481541840,"identity":"8c58355c-3587-439d-9122-8a5313ac88b3","order_by":3,"name":"Padmaja A S","email":"","orcid":"","institution":"University of Agricultural Sciences, Bangalore","correspondingAuthor":false,"prefix":"","firstName":"Padmaja","middleName":"A","lastName":"S","suffix":""},{"id":481541841,"identity":"b5b3e743-de45-4776-9db9-87691883fa90","order_by":4,"name":"Mahammad Azar K","email":"","orcid":"","institution":"University of Agricultural Sciences, Bangalore","correspondingAuthor":false,"prefix":"","firstName":"Mahammad","middleName":"Azar","lastName":"K","suffix":""}],"badges":[],"createdAt":"2025-07-06 09:53:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7057081/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7057081/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86249709,"identity":"5fa72303-efc4-42b7-ac02-883c71654190","added_by":"auto","created_at":"2025-07-08 12:24:41","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":37125,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR amplification of CYR-1 marker in mungbean genotypes\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7057081/v1/b752871fa1d0a2beba278736.jpg"},{"id":86251211,"identity":"a8ff1aed-02e9-4334-9680-5afc9e897cab","added_by":"auto","created_at":"2025-07-08 12:40:41","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":30686,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR amplification of VMR1 marker in mungbean genotypes\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7057081/v1/ffc9bede96fbe6afa9587d28.jpg"},{"id":86250185,"identity":"8288e725-db24-43fa-9e62-e5dfa7fe7ba7","added_by":"auto","created_at":"2025-07-08 12:32:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":93726,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic relationship of RGA\u003c/strong\u003e-\u003cstrong\u003eCYR1 used for comparison of different resistant gene sequences by Neighbour joining method.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7057081/v1/4f7f8179a0ff0fab8c6d347b.png"},{"id":86249710,"identity":"d7253943-eb66-4b59-b303-74688b2955ee","added_by":"auto","created_at":"2025-07-08 12:24:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":90503,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic relationship of RGA\u003c/strong\u003e -\u003cstrong\u003eVMR1 used for comparison of different resistant gene sequences by Neighbor joining method\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7057081/v1/6d74c18f5a3b6542bbd8fe8d.png"},{"id":93450370,"identity":"d3982f72-5992-4004-8b2c-24c48c4bb3ba","added_by":"auto","created_at":"2025-10-14 03:16:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":914912,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7057081/v1/d1d2248b-52ff-4ce1-989d-b3d2f5b01984.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification and characterization of candidate R gene controlling resistance to Mungbean yellow mosaic virus disease in mungbean (Vigna radiata (L.) Wilczek).","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMungbean (\u003cem\u003eVigna radiata\u003c/em\u003e (L.) Wilczek) is an ancient and economically significant leguminous crop widely cultivated across Asia. Characterized by its rapid growth and adaptation to warm seasons, mungbean is a diploid species (2n\u0026thinsp;=\u0026thinsp;22) that predominantly self-pollinates via cleistogamous flowers. The crop is believed to have originated in India (Vavilov \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1926\u003c/span\u003e), with \u003cem\u003eVigna radiata\u003c/em\u003e var. \u003cem\u003esublobata\u003c/em\u003e Verdc. identified as its closest wild relative and progenitor (Mehandi et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDespite its agronomic value, mungbean productivity in India is constrained by various biotic stresses (Pratap et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Among these, \u003cem\u003eMungbean yellow mosaic virus\u003c/em\u003e (MYMV) disease is particularly destructive, with yield losses reported up to 85% depending on infection severity and crop stage (Karthikeyan et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kang et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). MYMV was first reported by Nariani (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1960\u003c/span\u003e) at the Indian Agricultural Research Institute, New Delhi, and is now recognized as a major limiting factor for mungbean cultivation in South and Southeast Asia.\u003c/p\u003e\u003cp\u003eMYMV is a member of the family Geminiviridae, subgroup II, genus \u003cem\u003eBegomovirus\u003c/em\u003e and possesses a bipartite single-stranded DNA genome (DNA-A and DNA-B), each approximately 2.7 kb in size. These components share a conserved common region (CR) of 200\u0026ndash;250 bp, which is nearly identical within a virus species but variable among species. While DNA-A encodes essential functions for replication and encapsidation (Rogers et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1986\u003c/span\u003e; Sunter et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1987\u003c/span\u003e), both DNA-A and DNA-B are required for infectivity (Hamilton et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1983\u003c/span\u003e). The virus is transmitted in a persistent manner by the whitefly (\u003cem\u003eBemicia tabaci\u003c/em\u003e Genn.) with the B biotype being the most prevalent vector in Asia (Prasanna et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTypical symptoms of MYMV infection include yellow spots or flecks, irregular yellow and green patches, reduced flowering and pods with immature, shrivelled seeds. Severe infections can result in necrosis, shortened internodes, and stunted plants, with yield losses ranging from 10\u0026ndash;100% (Akhtar et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe development of MYMV-resistant cultivars through genetic improvement is widely regarded as the most sustainable and eco-friendly approach to disease management. Plant resistance is mediated by resistance (R) genes, which encode proteins that recognize pathogen effectors and activate defence signalling (Morel and Dangl \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). Notably, the nucleotide-binding site-leucine-rich repeat (NBS-LRR) class of R genes is the most prevalent and well-characterized in crop species (Bent et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). These genes contain conserved motifs, such as the p-loop, kinase-2, kinase-3a, and GLPL, which are critical for ATP and GTP binding (Meyers et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Meyers et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) and can be used as molecular probes to identify homologous resistance genes across species (Singh et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1988\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe use of Resistance Gene Analog (RGA)-based markers has proven effective in enhancing the pace and precision of breeding for disease resistance. RGAs have been isolated and characterized in several legume species, including mungbean (Maiti et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), urdbean (Basak et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Maiti et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), soybean (Kanazin et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; He et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), common bean (Mutlu et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), chickpea (Huettel et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Palomiro et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), pea (Timmerman-Vaughan et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), lentil (Yaish et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), and faba bean (Palomiro et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eSelection of Mungbean Genotypes\u003c/p\u003e\u003cp\u003eA total of 14 mungbean genotypes, comprising 13 MYMV-resistant and one susceptible genotype, were selected for this study. These genotypes were cultivated across three seasons- summer, rainy and winter and were also subjected to artificial inoculation in a glasshouse for one season. Resistance was assessed based on delayed symptom expression, percent disease index (PDI), and area under the disease progress curve (AUDPC) following both natural infection and artificial challenge. Five genotypes\u0026mdash;AVMU 1698, AVMU 1699, AVMU 16100, AVMU 16101, and KPS 2 were identified as resistant to yellow mosaic disease (YMD) (Nagaraj et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Further confirmation of resistance was performed using vector transmission by the whitefly (\u003cem\u003eBemisia tabaci\u003c/em\u003e).\u003c/p\u003e\u003cp\u003eIn total, 16 genotypes\u0026mdash;including the 14 original lines, two F₂-derived lines (Bengaluru lines 1 and 3), and KKM-3 (a UAS-B released variety)\u0026mdash;were screened under natural infection at the Main Research Station (MRS), Hebbal, University of Agricultural Sciences (UAS), Bangalore, India, during 2020\u0026ndash;2021.\u003c/p\u003e\u003cp\u003eGenomic DNA Isolation\u003c/p\u003e\u003cp\u003eGenomic DNA was extracted from 15\u0026ndash;20-day-old seedlings using the cetyltrimethylammonium bromide (CTAB) method as described by Lodhi et al. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1994\u003c/span\u003e), with modifications by Maruthi et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). DNA concentration and purity were determined using a Nanodrop spectrophotometer, and samples were diluted with 1\u0026times; TE buffer to a final concentration of 50 ng/\u0026micro;l for subsequent analyses.\u003c/p\u003e\u003cp\u003eAmplification of RGA-Primed Genomic Regions\u003c/p\u003e\u003cp\u003eTwo pairs of degenerate resistance gene analog (RGA) primers\u0026mdash;CYR1 (from mungbean) and VMR1 (from mungbean and blackgram)\u0026mdash;were used to amplify genomic regions from the 16 mungbean genotypes (Table\u0026nbsp;1). PCR reactions were performed in a 25 \u0026micro;l volume containing 2 \u0026micro;l of each primer (forward and reverse), 0.5 \u0026micro;l dNTPs, 0.5 \u0026micro;l Taq DNA polymerase (3 units), 2.5 \u0026micro;l Taq buffer, 17.5 \u0026micro;l nuclease-free water, and 2 \u0026micro;l genomic DNA, using an Eppendorf thermocycler.\u003c/p\u003e\u003cp\u003eThe PCR cycling conditions for the CYR1 primer were initial denaturation at 94\u0026deg;C for 4 min; 35 cycles of denaturation at 94\u0026deg;C for 1 min, annealing at 57\u0026deg;C for 1 min, and extension at 72\u0026deg;C for 1.5 min; followed by a final extension at 72\u0026deg;C for 10 min. For the VMR1 primer, the conditions were: initial denaturation at 94\u0026deg;C for 5 min; 35 cycles of denaturation at 94\u0026deg;C for 45 s, annealing at 48.5\u0026deg;C for 45 s, and extension at 72\u0026deg;C for 1 min; with a final extension at 72\u0026deg;C for 10 min.\u003c/p\u003e\u003cp\u003ePCR products were separated by electrophoresis on a 1.5% agarose gel stained with ethidium bromide in 1\u0026times; TAE buffer and visualized under UV light.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTable:1 Degenerate RGA primers used to amplify genomic regions in 16 mungbean genotypes.\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIdentity of Marker and host\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAnnealing temp (\u003csup\u003eo\u003c/sup\u003e C)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eReference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCYR1\u003c/p\u003e\u003cp\u003e(Mungbean)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGGTGGNTTGGGTAAGACCAC\u003c/p\u003e\u003cp\u003eR: NTCGCGGTGNGTGAAAAGNCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e57.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMaiti et al., (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVMYR1\u003c/p\u003e\u003cp\u003e(Mungbean and black gram)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: AGTTTATAATTCGATTGCT\u003c/p\u003e\u003cp\u003eR: ACTACGATTCAAGACGTCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e48.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eBasak et al., (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2005\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eMolecular Characterization of Resistance Gene Analogs (RGAs)\u003c/p\u003e\u003cp\u003ePCR products corresponding to resistance gene analogs (RGAs) from mungbean samples were purified and subjected to Sanger sequencing. The resulting sequences were analysed using the NCBI BLASTn tool to determine homology with known resistance genes. For phylogenetic analysis, the obtained RGA sequences were aligned with reference resistance gene analog sequences retrieved from the GenBank database. Phylogenetic trees were constructed using the neighbor-joining method implemented in MEGA version 7.0 (Kumar et al. 2016), enabling the assessment of evolutionary relationships between the mungbean RGAs and established resistance genes from related legume species.\u003c/p\u003e"},{"header":"Result","content":"\u003cp\u003eDetection of Resistance Gene Analogs (RGAs)\u003c/p\u003e\u003cp\u003ePCR amplification using the CYR1 and VMR1 degenerate primers was successful confirming the presence of MYMV disease. Specifically, amplification of CYR1-primed genomic regions indicated the presence of MYMV resistance genes in genotypes MYB-6, MYB-7, MYB-8, MYB-9, MYB-12, DR-12, DR-3, and KKM-3. Similarly, VMR1-primed regions were amplified in the same set of genotypes, further confirming the presence of MYMV resistance genes. The VMR1 amplicons (~\u0026thinsp;445 bp) were notably smaller than those generated by CYR1 (~\u0026thinsp;1236 bp), but both markers consistently identified the same resistant genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;2).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWhere L\u0026thinsp;=\u0026thinsp;Ladder (1000bp), 1\u0026thinsp;=\u0026thinsp;MYB-1, 2\u0026thinsp;=\u0026thinsp;MYB-2, 3\u0026thinsp;=\u0026thinsp;MYB-3, 4\u0026thinsp;=\u0026thinsp;MYB-4, 5\u0026thinsp;=\u0026thinsp;MYB-5, 6\u0026thinsp;=\u0026thinsp;MYB-6, 7\u0026thinsp;=\u0026thinsp;MYB\u0026thinsp;=\u0026thinsp;7, 8\u0026thinsp;=\u0026thinsp;MYB-8, 9\u0026thinsp;=\u0026thinsp;MYB-9, 10\u0026thinsp;=\u0026thinsp;MYB-10, 11\u0026thinsp;=\u0026thinsp;MYB-11(susceptible check), 12\u0026thinsp;=\u0026thinsp;MYB-12, 13\u0026thinsp;=\u0026thinsp;MYB-13, 14\u0026thinsp;=\u0026thinsp;KKM-3 15\u0026thinsp;=\u0026thinsp;DR-1 ,16\u0026thinsp;=\u0026thinsp;DR-3\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWhere, L\u0026thinsp;=\u0026thinsp;Ladder(100bp), 1\u0026thinsp;=\u0026thinsp;MYB-1, 2\u0026thinsp;=\u0026thinsp;MYB-2, 3\u0026thinsp;=\u0026thinsp;MYB-3, 4\u0026thinsp;=\u0026thinsp;MYB-4, 5\u0026thinsp;=\u0026thinsp;MYB-5, 6\u0026thinsp;=\u0026thinsp;MYB-6, 7\u0026thinsp;=\u0026thinsp;MYB\u0026thinsp;=\u0026thinsp;7, 8\u0026thinsp;=\u0026thinsp;MYB-8, 9\u0026thinsp;=\u0026thinsp;MYB-9, 10\u0026thinsp;=\u0026thinsp;MYB-10, 11\u0026thinsp;=\u0026thinsp;MYB-11 (susceptible check), 12\u0026thinsp;=\u0026thinsp;MYB-12, 13\u0026thinsp;=\u0026thinsp;MYB-13, 14\u0026thinsp;=\u0026thinsp;KKM-3 15\u0026thinsp;=\u0026thinsp;DR-1, 16\u0026thinsp;=\u0026thinsp;DR-3\u003c/p\u003e\u003cp\u003eMolecular Characterization of RGAs\u003c/p\u003e\u003cp\u003eThe RGA amplicons were sequenced and analyzed using NCBI BLASTn. The current RGA-CYR1 isolate had 96.71% identity with \u003cem\u003eVigna radiata var. radiata\u003c/em\u003e putative disease resistance RPP13-1ike protein 1 (XM014647468.2) and 95.41% identity with \u003cem\u003eVigna mungo\u003c/em\u003e disease resistance protein CYR1 (CYR1) mRNA, complete sequence (HQ704837.1). The current RGA-VMR1 isolate has 89.64% identity with \u003cem\u003eVigna mungo\u003c/em\u003e disease resistance protein (VMYR-1) gene, partial sequence (AY297425.2) and 94.47% identity with \u003cem\u003eVigna mungo\u003c/em\u003e disease resistance protein (YR-3) mRNA, partial sequence (EF446378.1). The isolates have 89.11% identity \u003cem\u003eVigna radiata\u003c/em\u003e viral resistance candidate (MYR-1) gene, partial sequence (AY301990.1). The phylogenetic analysis of RGA sequence was carried out together with the known RGA sequences obtained from GenBank database by using MEGA 7.0 software (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e). GenBank accession numbers of different RGA used for current isolate sequence and analysis of nucleotide sequence of RGA against yellow mosaic virus associated with mungbean showed through phylogenetic tree (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e) and (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of RGA CYR1 used for comparison of different resistant gene sequences.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSl.\u003c/p\u003e\u003cp\u003eNo.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRGA Analogous\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePer cent identity (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAccession number\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna radiata\u003c/em\u003e var. radiata putative disease resistance RPP13-like protein 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e96.71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM014647468.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna mungo\u003c/em\u003e disease resistance protein CYR1 (CYR1) mRNA, complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e95.41\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHQ704837.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna mungo\u003c/em\u003e disease resistance protein CYR1 (CYR1) gene, partial sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e95.76\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHQ704838.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna mungo\u003c/em\u003e cultivar T-9 disease resistance protein CYR1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e95.61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eKR350634.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna mungo\u003c/em\u003e cultivar WBU-108 disease resistance protein CYR1 (YR2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e97.22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEU258701.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e hypothetical protein\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e86.53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM007151255.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolusvulgaris\u003c/em\u003eNBS-LRRdisease resistance-like protein\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e84.13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEU856786.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e clone ContB2, complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e85.10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEU931622.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e NBS-LRR resistance-like protein complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e84.06\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAF306506.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna unguiculata\u003c/em\u003e putative disease resistance RPP13-like protein 1, transcript variant X2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e81.81\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXR003603755.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVignaunguiculata\u003c/em\u003ecultivarXiabao2 chromosome Vu04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e80.54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXP098765578.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolusvulgaris\u003c/em\u003ehypotheticalprotein mRNA, complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e85.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM007143843.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of RGA VMR1 used for comparison of different resistant gene sequences.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSl.\u003c/p\u003e\u003cp\u003eNo.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRGA Analogous\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePer cent identity (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAccession number\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna radiata var\u003c/em\u003e. radiata TMV resistance protein N-like, transcript variant X3, mRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e96.12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM022784106.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna mungo\u003c/em\u003e disease resistance protein (YR-3) mRNA, partial sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e94.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEF446378.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna mungo\u003c/em\u003e resistance protein (VMYR-2) gene, partial sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e94.72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAY301991.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna angularis\u003c/em\u003e var. angularis DNA, chromosome 11, almost complete sequence, cultivar: Shumari\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e91.99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAP015044.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna mungo\u003c/em\u003e disease resistance protein (VMYR-1) gene, partial sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e89.64\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAY297425.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna radiata\u003c/em\u003e viral resistance candidate (MYR-1) gene, partial sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e89.11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAY301990.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e hypothetical protein mRNA, complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e85.34\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM007152493.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eGlycine max\u003c/em\u003e strain Williams 82 clone, complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e82.15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAC235351.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna unguiculata\u003c/em\u003e cultivar Xiabao 2 chromosome Vu03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e79.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCP039346.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e hypothetical protein mRNA, complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e78.66\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM007152501.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e cloneputative resistance protein TIR 31 gene, partial cds\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e78.66\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJQ313629.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eGlycine max\u003c/em\u003e clone, complete sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e77.67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAC235891.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eCajanuscajan\u003c/em\u003eTMVresistanceproteinN, transcript variant X4, mRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e77.51\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM020366882.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eGlycine soja\u003c/em\u003e TMV resistance protein N-like, mRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e77.43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM028349904.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna unguiculata\u003c/em\u003e TMV resistance protein N-like\u003c/p\u003e\u003cp\u003e, mRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e77.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM028068349.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eAbrus precatorius\u003c/em\u003e TMV resistance protein N-like transcript variant X1, mRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e76.89\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eXM027501909.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eVigna vexillata\u003c/em\u003e disease resistance protein homolog gene, partial sequence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e79.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAF141015.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe identification and characterization of resistance gene analogs (RGAs) in mungbean provide critical insights into the molecular basis of resistance against Mungbean yellow mosaic virus (MYMV), a major constraint to mungbean production in Asia. The present study demonstrates that the use of degenerate primers targeting conserved domains of plant R genes\u0026mdash;specifically CYR1 and VMR1\u0026mdash;enables the effective detection of candidate resistance genes in diverse mungbean genotypes.\u003c/p\u003e\u003cp\u003eStructure and Function of Plant R Genes\u003c/p\u003e\u003cp\u003ePlant R genes, particularly those belonging to the nucleotide-binding site-leucine-rich repeat (NBS-LRR) class, play a pivotal role in the recognition of pathogen-derived effectors and the activation of downstream defense responses. The NBS domain is involved in ATP/GTP binding and hydrolysis, which is essential for signal transduction, while the LRR domain mediates specific protein-protein interactions, allowing plants to recognize a wide array of pathogen effectors (Sekhwal et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The ARC (activity-regulated cytoskeletal) domain, together with the NES (nucleotide exchange site), forms the core of the nucleotide-binding region, which is crucial for the conformational changes required during defense signaling. The high degree of sequence conservation in these domains across plant species has facilitated the development of degenerate primers, such as CYR1 and VMR1, which can amplify homologous resistance gene sequences in different legumes.\u003c/p\u003e\u003cp\u003eValidation and Comparative Analysis of RGA Markers\u003c/p\u003e\u003cp\u003eIn this study, the amplification of CYR1 and VMR1 markers in multiple resistant mungbean genotypes (MYB-6, MYB-7, MYB-8, MYB-9, MYB-12, DR-1, DR-3, and KKM-3) confirms their association with MYMV resistance. This is in agreement with earlier reports by Maiti et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), who demonstrated the linkage of CYR1 with MYMIV resistance in both mungbean and urdbean. Similarly, Kabi et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and Panigrahi et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) provided evidence for the utility of CYR1 in marker-assisted selection (MAS) for yellow mosaic virus resistance. The consistency of these results across studies and species highlights the robustness and transferability of these markers.\u003c/p\u003e\u003cp\u003eThe VMR1 marker, originally developed for blackgram (Basak et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), also proved effective in mungbean, further supporting the hypothesis that resistance gene analogs are conserved across Vigna species. However, as noted by Sowmini and Jayamani (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), the expression of some markers may be monomorphic in certain genetic backgrounds, underscoring the importance of validating markers in target populations before deployment in breeding programs.\u003c/p\u003e\u003cp\u003eImplications for Breeding and Genetic Resource Management\u003c/p\u003e\u003cp\u003eThe practical application of RGA markers in breeding programs is multifaceted. First, they enable rapid and accurate screening of breeding populations and germplasm collections for resistance alleles, significantly reducing the time and resources required for phenotypic selection. Second, the use of molecular markers circumvents the challenges posed by environmental variability and the often-quantitative nature of disease resistance. Third, RGA markers facilitate the pyramiding of multiple resistance genes, which is essential for achieving durable and broad-spectrum resistance.\u003c/p\u003e\u003cp\u003eIn the context of genetic resource management, the identification of diverse resistance sources and their molecular characterization enriches the genetic base available for mungbean improvement. This is particularly important given the narrow genetic diversity observed in many cultivated mungbean varieties. The conservation of RGA sequences across Vigna and other legume species also opens avenues for the introgression of resistance genes from wild relatives, leveraging the rich genetic resources present in gene banks.\u003c/p\u003e\u003cp\u003eEvolutionary and Functional Insights\u003c/p\u003e\u003cp\u003eThe phylogenetic analysis conducted in this study revealed that the identified RGAs cluster closely with known resistance genes from \u003cem\u003eVigna radiata\u003c/em\u003e, \u003cem\u003eVigna mungo\u003c/em\u003e, and other legumes, indicating a shared evolutionary origin and functional conservation. Such analyses provide valuable information on the diversification and adaptation of R genes in response to pathogen pressure. The observed sequence similarity with resistance genes from other legumes, such as \u003cem\u003ePhaseolus vulgaris\u003c/em\u003e and \u003cem\u003eGlycine max\u003c/em\u003e, suggests that similar defence mechanisms may operate across different legume crops and that knowledge gained in one species can inform resistance breeding in others.\u003c/p\u003e\u003cp\u003eFurthermore, the functional validation of these RGAs, through fine-mapping, gene expression analysis, and ultimately gene cloning, will be essential to confirm their role in MYMV resistance and to elucidate the molecular mechanisms underlying plant-virus interactions. Such studies can also reveal the presence of gene clusters, gene duplications, and other evolutionary processes that shape the R gene repertoire in mungbean and related species.\u003c/p\u003e\u003cp\u003eFuture Prospects\u003c/p\u003e\u003cp\u003eLooking ahead, the integration of RGA-based markers with high-throughput genotyping platforms and next-generation sequencing technologies will enable the construction of high-density genetic maps and the identification of quantitative trait loci (QTLs) associated with disease resistance. This will further enhance the efficiency of MAS and facilitate the development of mungbean cultivars with durable resistance to MYMV and other pathogens.\u003c/p\u003e\u003cp\u003eAdditionally, the insights gained from RGA characterization can inform the design of gene editing strategies, such as CRISPR/Cas9-mediated targeted mutagenesis, to engineer novel resistance alleles or to enhance existing resistance traits.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe present study provides comprehensive insights into the identification and molecular characterization of candidate resistance gene analogs (RGAs) conferring resistance to \u003cem\u003eMungbean yellow mosaic virus\u003c/em\u003e (MYMV) in mungbean \u003cem\u003e(Vigna radiata)\u003c/em\u003e. By employing degenerate primers (CYR1 and VMR1) targeting conserved domains of plant resistance genes, we successfully amplified and detected RGA sequences in several MYMV-resistant mungbean genotypes. Sequence analysis and phylogenetic comparisons revealed a high degree of similarity between these RGAs and known resistance genes from \u003cem\u003eVigna\u003c/em\u003e and other legume species, underscoring the evolutionary conservation of disease resistance mechanisms within the Fabaceae.\u003c/p\u003e\u003cp\u003eThe validation of CYR1 and VMR1 markers across diverse genotypes demonstrates their robustness and utility for marker-assisted selection (MAS) in mungbean breeding programs. These markers enable the rapid and precise identification of resistant individuals, thereby accelerating the development of MYMV-resistant cultivars. This is particularly significant given the challenges of phenotypic screening for viral diseases, which are often influenced by environmental variability and complex inheritance patterns. The deployment of RGA-based markers thus represents a powerful approach for enhancing the efficiency and accuracy of resistance breeding.\u003c/p\u003e\u003cp\u003eFrom a genetic resource perspective, the identification of novel and diverse sources of MYMV resistance enriches the available germplasm pool and broadens the genetic base for mungbean improvement. The conservation of RGA sequences across \u003cem\u003eVigna\u003c/em\u003e and related genera also highlights the potential for utilizing wild relatives and landraces as reservoirs of valuable resistance genes. This is especially relevant in the context of ongoing efforts to conserve and utilize plant genetic resources for crop improvement and adaptation to emerging biotic stresses.\u003c/p\u003e\u003cp\u003eMoreover, the findings of this study have important implications for understanding the molecular evolution of plant resistance genes. The clustering of mungbean RGAs with homologous sequences from other legumes suggests that common evolutionary pressures have shaped the diversification of R genes in response to pathogen challenges. Further functional validation and fine mapping of these candidate genes will provide deeper insights into the mechanisms of resistance and facilitate the cloning and transfer of effective resistance genes across species.\u003c/p\u003e\u003cp\u003eIn conclusion, this research advances our knowledge of the genetic architecture of MYMV resistance in mungbean and provides validated molecular tools for breeding programs aimed at developing durable, virus-resistant cultivars. The integration of RGA-based marker technology with conventional breeding and genetic resource management will play a pivotal role in safeguarding mungbean productivity and sustainability. The approaches and outcomes presented here can serve as a model for resistance gene discovery and utilization in other crop species, contributing to global efforts in crop improvement and food security.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eDr. Nagaraju is my Guide during this whole research Program. Dr Ramesh and Ms. Padmaja were my members of research committee during my Master's Program. These three members helped me through my whole research from setting up the objective to completion of manuscript. Azar has helped me in data collection and completing the technical and no technical work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAkhtar, KP, Kitsanachandee R, Srinives P, Abbas G, Asghar MJ, Shah, TM, Atta BM, Chatchawankanphanich O, Sarwar G, Ahmad M And Sarwar N. 2009. Field evaluation of mungbean recombinant inbred lines against mungbean yellow mosaic disease using new disease scale in Thailand. Plant Pathology. 25: 422\u0026ndash;428.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBasak J, Kundagrami S, Ghose TK. and Pal A. 2005. Development of \u003cem\u003eYellow mosaic virus\u003c/em\u003e (YMV) resistance linked DNA marker in \u003cem\u003eVigna mungo\u003c/em\u003e from populations segregating for YMV-reaction. Molecular Biotechnology. 14 (4): 375\u0026ndash;383.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R, Giradaut J, Leung J and Staskawicz BJ. 1996. RPS2 of \u003cem\u003eArabidopsis thaliana\u003c/em\u003e: a leucine-rich repeat class of plant disease resistance genes. Science. 265: 1856\u0026ndash;1860.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHamilton WD0, Bisaro DM, Coutts RHA. and Buck K W. 1983.Demonstration of the bipartite nature of the genome of a single-stranded DNA plant virus by infection with the cloned DNA components. Nucleic Acids Research. 11:7387\u0026ndash;7396.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe CY, Tian AG, Zhang JS, Zhang ZY, Gai JY and Chen SY. 2003. Isolation and characterization of a full-length resistance gene homolog from soybean. Theory Applied Genetics. 106 (5): 786\u0026ndash;793.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuettel B, Santra D, Muehlbauer F and Kahl G. 2002. Resistance gene analogues of chickpea (\u003cem\u003eCicer arietinum\u003c/em\u003e L.) isolation, genetic mapping and association with a Fusarium resistance gene cluster Theory Applied Genetics. 255 (2):245\u0026ndash;255.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKabi M, Das TR, Baisakh B. and Swain D. 2017. Resistant gene analogous marker assisted selection of \u003cem\u003eYellow mosaic virus\u003c/em\u003e (YMV) resistant genotypes in green gram (\u003cem\u003eVigna radiata\u003c/em\u003e). Current Microbiology and Applied Sciences. 6: 3247\u0026ndash;3252.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKanazin, V, Marek, LF and Shoemaker RC. 1996. Resistance gene analogs are conserved and clustered in soybean. Proceedings National Academy of Sciences, U.S. A. 93 (21): 11746\u0026ndash;11750.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKang BC, Yeam I. and Jahn MM. 2005. Genetics of plant virus resistance. Annual Review Phytopathology. 43: 581\u0026ndash;621.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarthikeyan A, Shobhana VG, Sudha M, Raveendran M, Senthil N, Pandiyan M. and Nagarajan P. 2014. \u003cem\u003eMungbean Yellow Mosaic Virus\u003c/em\u003e (MYMV): a threat to green gram (\u003cem\u003eVigna radiata\u003c/em\u003e) production in Asia. Pest Management. 60: 314\u0026ndash;324.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLodhi MA. Ye GN, Weeden NF and Reisch B. 1994. A simple and efficient method for DNA extraction from grapevine cultivars and \u003cem\u003eVitis\u003c/em\u003e species. Plant Molecular Biology. 12: 16\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaiti S, Basak J, Kundagrani S, Kundu AJ. and Pal A. 2011. Molecular marker assisted genotyping of \u003cem\u003eMungbean yellow mosaic India virus\u003c/em\u003e (MYMIV) resistant germplasm of mungbean. Mycology and Plant Pathology. 43 (3): 201\u0026ndash;334.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaruthi MN, Colvin J, Seal SE, Gibson G. and Cooper J. 2002. Co-adaptation between \u003cem\u003eCassava Mosaic Geminiviruses\u003c/em\u003e and their local vector population. Virus research. 86: 71\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMehandi S, Quatadah S, Mishra SP, Singh 1, Praveen N. and Dwivedi N. 2019. Mungbean (\u003cem\u003eVigna radiata\u003c/em\u003e L. Wilczek): retrospect and prospects. Legume Crops Characterization and Breeding for Improved Food Security, ed. El-Esawi MA (London: IntechOpen:49\u0026ndash;66).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW and Young ND 1999. Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant Journal. 20 (3): 317\u0026ndash;332.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeyers BC, Kozik A, Griego A, Kuang H and Michelmore RW. 2003. Genome wide analysis of NBS-LRR-encoding genes in Arabidopsis. The Plant Cell. 15 (4): 809\u0026ndash;834.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorel J B. and Dangl JL. 1997. The hypersensitive response and the induction of cell death in plants. Cell Death and Differentiation. 4 (8): 671\u0026ndash;683.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMutlu N, Miklas PN. and Coyne DP. 2006. Resistance gene analog polymorphism (RGAP) markers co-localize with disease resistance genes and QTL in common bean. Molecular Breeding. 17 (2): 127\u0026ndash;135.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNagaraj, Basavaraj S, Padmaja AS, Nagaraju N. and Ramesh S. 2018. Identification of stable sources of resistance to mungbean yellow mosaic virus (MYMV) disease in mungbean [\u003cem\u003eVigna radiata\u003c/em\u003e (L.) Wilczek]. Plant Genetics Research. 17 (4): 362\u0026ndash;370.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNariani TK. 1960. Yellow mosaic of mung (\u003cem\u003ePhaseolus aureus\u003c/em\u003e L.). Indian Phytopathogy. 13: 24\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePalomiro C, Satovic Z, Cubero JJ and Torres AM. 2006. Identification and characterization of NBS-LRR class resistant gene analogs (RGAs) in faba bean (\u003cem\u003eVicia faba\u003c/em\u003e L.) and chickpea (\u003cem\u003eCicer arietinum\u003c/em\u003e L.) Genome. 49 (10): 1227\u0026ndash;1237.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePanigrahi KK, Das TR, Baisakh B, Mohanty A. and Pradhan J. 2016. Validation of CYR-1 marker linked with Yellow Mosaic Virus (YMV) resistance in black gram (\u003cem\u003eVigna mungo\u003c/em\u003e). Indian Genetics and Plant Breeding. 76 (1): 104\u0026ndash;106.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrasanna HC, Kanakala S, Archana K, Jyothsna P, Varma Rk. and Malathi VG. 2015. Cryptic species composition and genetic diversity within \u003cem\u003eBemisia tabaci\u003c/em\u003e complex in soybean in India revealed by mtCOI DNA sequence. Integrative Agriculture. 14: 1786\u0026ndash;1795.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePratap A. Gupta S, Basu PS, Tomar R, Dubey s, Rathore M, Prajapati Us, Singh P. and Kumari G. 2019. Towards development of climate smart mungbean: Challenges and opportunities. In Genomic Designing of Climate-Smart Pulse Crops. 235\u0026ndash;264.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRogers SG, Bisaro DM, Horsch RB, Fraley RT, Hoffmann NL, Brand L, Elmer JS. and Lloyd AM. 1986. \u003cem\u003eTomato golden mosaic virus\u003c/em\u003e A component DNA replicates autonomously in transgenic plants. Cell. 45: 593\u0026ndash;600.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSekhwal MK, Li P, Lam I, Wang X, Cloutier S. and You FM. 2015. Disease Resistance Gene Analogues (RGAs) in plants. International Journal of Molecular Sciences. 16 (8):19248\u0026ndash;19290.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh G, Kapoor S. and Singh K. 1988. Multiple disease resistance in mungbean with special emphasis on \u003cem\u003eMungbean yellow mosaic virus\u003c/em\u003e (MYMV). Trends Biotechnology. 21: 290\u0026ndash;296.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSowmini K. and Jayamani P. 2014. Validation of molecular markers linked with yellow mosaic disease resistance in black gram. Legume Genomics Genetics. 5 (4): 25\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSunter G, Gardiner WE, Rushing AE, Rogers SG. and Bisaro DM. 1987. Independent encapsidation of \u003cem\u003eTomato golden mosaic virus\u003c/em\u003e, A component DNA in transgenic plants. Plant Molecular Biology. 8: 477\u0026ndash;484.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTanksley SD, Young ND, Paterson AH. and Bonierable MD. 1989. RFLP mapping in plant breeding: new tools for old science. Biotechnology. 7: 257\u0026thinsp;\u0026ndash;\u0026thinsp;26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTimmerman-Vaughan GM, Frew TJ and Weeden NF. 2000. Characterisation and linkage mapping of R-gene analogues DNA sequences in pea (\u003cem\u003ePisum sativum\u003c/em\u003e L.) Theor.Appl. Genet. 101(1\u0026ndash;2): 241\u0026ndash;247.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVavilov NZ. 1926. Studies on the origin of cultivated plants. Chronica Botanica. 13(1/6): 1949\u0026ndash;1950.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYaish MWE, Saenz LE, De Miera and De La Vega MP. 2004. Isolation of a family of resistance gene analog sequences of the nucleotide binding site (NBS) type from Lens species. Genome. 47: 650\u0026ndash;659.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":false,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Mungbean, Vigna radiata, Mungbean yellow mosaic virus (MYMV), Disease resistance, Resistance gene analogs (RGA), NBS-LRR, Marker-assisted selection, PCR, Genetic diversity, Phylogenetic analysis","lastPublishedDoi":"10.21203/rs.3.rs-7057081/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7057081/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMungbean (\u003cem\u003eVigna radiata (L.)\u003c/em\u003e Wilczek) is a vital legume crop in Asia, but its productivity is severely hampered by \u003cem\u003eMungbean yellow mosaic virus\u003c/em\u003e (MYMV), often leading to yield losses up to 85%. Developing MYMV-resistant cultivars through genetic intervention is a sustainable approach to disease management. In this study, 16 mungbean genotypes, including resistant and susceptible lines, were evaluated for MYMV resistance using both natural and artificial inoculation methods. Genomic DNA was isolated and amplified using two pairs of degenerate Resistance Gene Analog (RGA) primers, CYR1 and VMR1, targeting conserved NBS-LRR domains associated with disease resistance. PCR amplification confirmed the presence of MYMV resistance genes in several genotypes, notably MYB-6, MYB-7, MYB-8, MYB-9, MYB-12, DR-12, DR-3, and KKM-3. Sequencing and BLASTn analysis of the RGA amplicons revealed high similarity with known resistance genes in Vigna species. Phylogenetic analysis further validated the relationship of these candidate R genes with established MYMV resistance genes. The study demonstrates the utility of RGA-based markers for rapid identification and characterization of MYMV resistance in mungbean, providing valuable tools for marker-assisted selection and breeding of resistant cultivars.\u003c/p\u003e","manuscriptTitle":"Identification and characterization of candidate R gene controlling resistance to Mungbean yellow mosaic virus disease in mungbean (Vigna radiata (L.) Wilczek).","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-08 12:24:36","doi":"10.21203/rs.3.rs-7057081/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cd897a7f-8fde-4cd5-a1e3-f0ba696e5cf9","owner":[],"postedDate":"July 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-14T03:08:40+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-08 12:24:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7057081","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7057081","identity":"rs-7057081","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}