Genome-wide identification and expression analysis of GATA gene family in wheat

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07+body, 2026-07-05

This study identified 79 wheat GATA genes, analyzed their genomic properties, phylogenetic relationships, and expression patterns in different tissues and under stress, suggesting their role in abiotic stress responses.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-05 · read from full text

This preprint reports a genome-wide bioinformatics and expression study of the GATA transcription factor family in wheat, identifying 79 TaGATA genes (TaGATA01–TaGATA79) from Ensembl Plants and analyzing gene structure, phylogeny, chromosome distribution, predicted protein properties, conserved motifs, and cis-acting regulatory elements. The authors found TaGATA proteins range from 146–499 amino acids with isoelectric points 4.76–10.12 and all were predicted unstable, and they classified the genes into six subfamilies with broadly similar structures within subfamilies; TaGATA genes were unevenly distributed across 21 chromosomes and promoter elements included hormone- and stress-related motifs, with TaGATA12 having the most and TaGATA55 the fewest cis-elements. Using qRT-PCR, they assessed expression of 23 TaGATA genes across tissues and under abiotic stresses, observing most genes highly expressed in stems, and reporting upregulation under ABA stress plus some downregulation under low-temperature stress. The paper is a preprint and is not peer reviewed, and functional validation beyond expression profiling is not reported here. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match for “endometriosis/adenomyosis” research indexing rules in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background: GATA gene family is a transcription factor in eukaryotes, which plays an important role in plant growth and development, cell differentiation, decomposition and apoptosis, and plant response to environmental changes. However, no genome-wide analysis of this gene family has been reported in wheat. Results: : In this study, 79 members of wheat GATA family were identified based on wheat genome information and named TaGATA01 ~ TaGATA79 . The gene structure, phylogeny, chromosome distribution, physical and chemical properties, conserved motifs and cis-acting elements of TaGATA family members were systematically analyzed by bioinformatics methods. The results showed that TaGATA family members encoded 146 ~ 499 amino acids, with isoelectric points ranging from 4.76 to 10.12 and instability index ranging from 41.99 to 86.02, which were all unstable proteins; Phylogenetic tree results showed that 79 TaGATA transcription factors were divided into six subfamilies, and members of the same subfamily had highly similar gene structure; MG2C was used to analyze the chromosomes, and it was found that TaGATA family members were unevenly distributed on 21 chromosomes; Plant CARE was used to identify 10 Plant hormone-related elements and 4 stress-related elements, among which TaGATA12 contained the most cis-acting elements and TaGATA55 contained the least cis-acting elements. qRT-PCR was used to analyze the expression levels of 23 TaGATA genes in different tissues and different abiotic stresses. It was found that most of the genes were highly expressed in stem, but few in panicle; Most genes were up-regulated under ABA stress and some genes were down-regulated under low temperature stress. Conclusions: : It was found that GATA transcription factors may be involved in the regulation of low temperature, drought and other stress responses of wheat, and play an important role in plant response to abiotic stress. This study analyzed the bioinformatics characteristics of each member of wheat GATA family and laid a theoretical foundation for the subsequent research on its functions.
Full text 113,004 characters · extracted from preprint-html · click to expand
Genome-wide identification and expression analysis of GATA gene family in wheat | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genome-wide identification and expression analysis of GATA gene family in wheat Yumeng Sun, Chunyue Li, Qihang Chang, Changhong Guo, Yan Bai This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1963114/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: GATA gene family is a transcription factor in eukaryotes, which plays an important role in plant growth and development, cell differentiation, decomposition and apoptosis, and plant response to environmental changes. However, no genome-wide analysis of this gene family has been reported in wheat. Results: In this study, 79 members of wheat GATA family were identified based on wheat genome information and named TaGATA01 ~ TaGATA79 . The gene structure, phylogeny, chromosome distribution, physical and chemical properties, conserved motifs and cis-acting elements of TaGATA family members were systematically analyzed by bioinformatics methods. The results showed that TaGATA family members encoded 146 ~ 499 amino acids, with isoelectric points ranging from 4.76 to 10.12 and instability index ranging from 41.99 to 86.02, which were all unstable proteins; Phylogenetic tree results showed that 79 TaGATA transcription factors were divided into six subfamilies, and members of the same subfamily had highly similar gene structure; MG2C was used to analyze the chromosomes, and it was found that TaGATA family members were unevenly distributed on 21 chromosomes; Plant CARE was used to identify 10 Plant hormone-related elements and 4 stress-related elements, among which TaGATA12 contained the most cis-acting elements and TaGATA55 contained the least cis-acting elements. qRT-PCR was used to analyze the expression levels of 23 TaGATA genes in different tissues and different abiotic stresses. It was found that most of the genes were highly expressed in stem, but few in panicle; Most genes were up-regulated under ABA stress and some genes were down-regulated under low temperature stress. Conclusions: It was found that GATA transcription factors may be involved in the regulation of low temperature, drought and other stress responses of wheat, and play an important role in plant response to abiotic stress. This study analyzed the bioinformatics characteristics of each member of wheat GATA family and laid a theoretical foundation for the subsequent research on its functions. Wheat GATA gene family Bioinformatics Abiotic stress Expression analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Background Wheat ( Triticum aestivum L.) is a widely cultivated cereal crop, which accounts for about third of the cultivated area and is the main food for about 35 percent to 40 percent of the world's population [ 1 ] . The yield and quality of wheat are affected by various environmental stresses during its growth and development, among which abiotic stresses such as salt, drought and low temperature are more serious [ 2 ] . GATA transcription factors are important zinc finger transcription factors in organisms, which play an important role in abiotic stress resistance, cytokinin response, and carbon and nitrogen metabolism. However, no genome-wide identification of wheat GATA transcription factors has been reported. In this study, bioinformatics methods were used to explore the function of wheat GATA transcription factor family, which is of great significance to the breeding of wheat superior varieties. The GATA family is an important class of zinc finger transcription factors in organisms, containing highly conserved zinc finger domain ⅳ, which is widely involved in multiple biological processes of plants, animals and microorganisms. Most of the GATA transcription factors in plants include one or two zinc finger domains. The common sequence is CX 2 CX 18 − 20 CX 2 C [ 3 ][ 4 ] . In 1988, Evans et al. [ 5 ] discovered the (T/A)GATA(A/G) sequence that can be bound by six GATA transcription factors (GATA1-GATA6) in the promoter of chicken globin gene. The transcription factor GATA-1 was discovered in 1991, followed by GATA-2, GATA-3, GATA-4, GATA-5, GATA-6 and other GATA transcription factors, which together form the GATA transcription factor family [ 6 ] . In 1993, the first plant GATA transcription factor was identified in tobacco and was named NTL1 due to its similarity to a protein of Neurospora crassis [ 7 ] . Subsequently, Teakle and Gilmartin [ 8 ] also identified GATA transcription factors in Arabidopsis thaliana. As GATA transcription factors have been reported in animals, fungi and plants, scientists have found that GATA transcription factors not only play an important role in cell differentiation, but also play an important role in stress signal transduction and metabolic pathways. For example, the first GATA zinc finger transcription factor NTL1 cloned from tobacco in plants has been shown to be involved in the nitrogen metabolism pathway. In recent years, it has been reported that GATA transcription factors in plants play a key role in regulating flower development, carbon and nitrogen metabolism [ 9 ] , chlorophyll levels [ 9 ] and abiotic stress response processes such as drought, cold injury and darkness [ 11 ][ 12 ][ 13 ] . So far, Arabidopsis thaliana [ 14 ] , Ricinus communis L. [ 15 ] , Apple ( Malus domestica ) [ 12 ] , rice ( Oryza sativa L.) [ 14 ] , Sorghum [ 16 ] , Capsicum annuum L. [ 17 ] and other plants GATA family members were identified at the whole gene level, which provided theoretical reference for studying the biological functions of GATA transcription factors in other plants. Based on the whole-genome data of wheat downloaded from the Ensembl Plants database, this study identified the members of the GATA gene family and analyzed their physical and chemical properties, gene structure, conservative motifs, chromosome distribution, homeopathic elements and systematic evolution. Meanwhile, qRT-PCR was used to further clarify the expression patterns of 23 wheat GATA family members under different tissues and different abiotic stresses, which laid a certain foundation for further understanding the function and role of wheat GATA transcription factors. 2. Results 2.1 Basic information analysis of TaGATA gene family members The amino acid sequence of wheat GATA gene was obtained by HMMER 3.0 software. Then, the protein structure was predicted by SMART and NCBI online tool CDD to verify that the wheat GATA transcription factor contained the unique conserved domain of GATA. A total of 79 wheat GATA gene family members were obtained. They are numbered from top to bottom according to their relative positions on the chromosome and named TaGATA1 - TaGATA79 (Table 1 ). These TaGATA family members encode 146 ~ 499 amino acids with isoelectric points ranging from 4.76 to 10.12 and molecular weights ranging from 16077.01 to 54149.63Da. Among them, 35 were acidic proteins (isoelectric point 7.0). The coding amino acids and isoelectric points of TaGATA67 sequence could not be determined due to the unknown bases. The instability index ranged from 41.99 to 86.02, and all of them were unstable proteins (instability index > 40). The average hydrophilic coefficients were all negative, indicating that wheat GATA proteins were all hydrophilic proteins. Table 1 TaGATA genes information identified in the wheat genome Gene name Gene ID Coded amino acids Isoelec-tric Point Molecularweight Instability index Hydrophob-icity Group TaGATA01 TraesCS1A01G097300.1 159 9.30 17489.64 62.81 -0.740 Ⅱ TaGATA02 TraesCS1A01G144400.1 288 9.64 32348.81 73.48 -0.925 Ⅵ TaGATA03 TraesCS1A01G221600.1 349 6.85 36867.15 44.51 -0.408 Ⅰ TaGATA04 TraesCS1A01G285100.1 304 6.71 32162.59 52.36 -0.813 Ⅱ TaGATA05 TraesCS1A01G340900.1 387 5.45 39932.58 61.50 -0.388 Ⅰ TaGATA06 TraesCS1A01G418200.1 219 8.48 23297.76 57.95 -0.572 Ⅱ TaGATA07 TraesCS1B01G126600.1 146 9.46 16077.01 71.51 -0.945 Ⅱ TaGATA08 TraesCS1B01G161800.1 285 9.33 31706.00 71.20 -0.941 Ⅵ TaGATA09 TraesCS1B01G234800.1 357 7.03 37531.83 47.97 -0.411 Ⅰ TaGATA10 TraesCS1B01G353700.1 400 5.91 41602.28 62.66 -0.511 Ⅰ TaGATA11 TraesCS1B01G448200.1 217 8.11 23109.65 64.63 -0.540 Ⅱ TaGATA12 TraesCS1D01G106100.1 146 9.62 16100.05 69.90 -0.950 Ⅱ TaGATA13 TraesCS1D01G143500.1 294 9.67 32777.33 73.08 -0.974 Ⅵ TaGATA14 TraesCS1D01G223200.1 357 6.87 37424.71 45.17 -0.384 Ⅰ TaGATA15 TraesCS1D01G284100.1 322 6.55 34071.68 54.44 -0.764 Ⅱ TaGATA16 TraesCS1D01G343000.1 383 5.80 39641.28 58.54 -0.451 Ⅰ TaGATA17 TraesCS1D01G425900.1 219 8.16 23317.83 50.89 -0.539 Ⅱ TaGATA18 TraesCS2A01G388300.1 432 6.29 46270.74 67.86 -0.655 Ⅰ TaGATA19 TraesCS2A01G391700.1 441 7.20 48058.86 54.56 -0.677 Ⅳ TaGATA20 TraesCS2A01G520600.1 294 8.69 31357.04 48.95 -0.678 Ⅶ 2.2 Phylogenetic analysis of members of TaGATA gene family The GATA phylogenetic tree was constructed using MEGA 7.0 software (Fig. 1 ). The GATA protein sequences of arabidopsis thaliana and rice were compared with those of wheat, and the wheat GATA genes were divided into six subgroups. Subgroup Ⅰ for TaGATA03, TaGATA05 , TaGATA09 , TaGATA10 , TaGATA14 , TaGATA16 , TaGATA18 , TaGATA24 , TaGATA29 , TaGATA34, TaGATA37 , TaGATA40 , TaGATA49 , TaGATA52 , TaGATA55 , TaGATA64 , TaGATA65 , TaGATA68 , TaGATA69 , TaGATA72 , TaGATA73 ; subgroup Ⅱ for TaGATA01 , TaGATA04, TaGATA06 , TaGATA07 , TaGATA11 , TaGATA12 , TaGATA15, TaGATA17 , TaGATA33 , TaGATA35 , TaGATA36 , TaGATA38 , TaGATA39 , TaGATA41 , TaGATA45 , TaGATA58 , TaGATA61 , TaGATA63 , TaGATA67 , TaGATA71 , TaGATA74 , TaGATA76 , TaGATA78 : subgroup Ⅲ for TaGATA43 , TaGATA44 , TaGATA47 , TaGATA50 , TaGATA62 , TaGATA66 , TaGATA70 , TaGATA75 , TaGATA77 , TaGATA79 ; subgroup Ⅳ for TaGATA19 , TaGATA21 , TaGATA22 , TaGATA23 , TaGATA25 , TaGATA26 , TaGATA27 , TaGATA28 , TaGATA30, TaGATA31, TaGATA32 ; subgroup Ⅵ for TaGATA02 , TaGATA08 , TaGATA13 , TaGATA46, TaGATA53 , TaGATA54 , TaGATA56 , TaGATA57 , TaGATA59 , TaGATA60 ; subgroup Ⅶ for TaGATA20 , TaGATA42 , TaGATA48 , TaGATA51. The members of subgroups Ⅰ, Ⅱ, Ⅳ and Ⅶ all contained only one GATA domain. The members of subgroup Ⅲ all contain one tify, one CCT and one GATA domain except TaGATA44 (which contains only CCT and GATA domain). The members of subgroup Ⅵ all contain two or three GATA domains. 2.3 Structural characterization of TaGATA gene family In order to analyze the structural characteristics of each gene in wheat GATA family, the online tool MEME was used to predict 10 conserved motifs of the protein sequence of wheat GATA gene. The results of conserved motifs prediction, intron-exon composition and phylogenetic combination of GATA gene family members were analyzed by Tbtools software. Figure 2A shows the phylogenetic tree of GATA. Figure 2B shows 10 conserved motifs of GATA gene protein sequence: Motif 1, Motif 2, Motif 3, Motif 4, Motif 5, Motif 6, Motif 7, Motif 8, Motif 9, Motif 10. It can be seen from the analysis of Fig. 2A and 2B, all members of subgroup Ⅰ contain Motif 1, Motif 2, Motif 4, Motif 5 and Motif 7. All members of subgroup Ⅲ contain Motif 1, Motif 3, Motif 4, Motif 8 except TaGATA44 . All members of subgroup Ⅳ contain Motif 1, Motif 4, Motif 5, Motif 6, Motif 7, Motif 8, and Motif 9, and TaGATA21 , TaGATA23 , and TaGATA28 contain Motif 10 in addition. In addition, Motif 1 and Motif 4 were found in all members, while Motif 10 was found only in some members of subgroup Ⅳ. These results suggest that the GATA gene family may have lost or acquired conserved motifs during the evolution of wheat. As shown in Fig. 2C, the structures of members of subgroup Ⅰ and subgroup Ⅵ are similar, with 2 or 3 exons. Members of subgroup Ⅱ have 1–3 exons. The members of subgroup Ⅲ had 7 or 8 exons. The members of subgroup Ⅳ have 3–6 exons. Members of subgroup Ⅶ have only one exon. It can be seen that there is little difference in the number of measured exons in the members of the same subgroup, especially the number of measured exons in the members of subgroup Ⅶ is the same (the gene structure of the members of the same subfamily has strong consistency). The genetic structure of these GATA transcription factors is similar to that of Arabidopsis thaliana and rice. 2.4 Chromosome localization analysis of TaGATA gene family As can be seen from Fig. 3, 79 TaGATA genes were unevenly distributed on 21 chromosomes, with most of them on chromosomes 1A, 2A and 1D, each containing 6 genes. Secondly, there are 5 genes on chromosome 1B, 2B and 4A. Four genes were distributed on 2D, 6A, 6B and 6D chromosomes. Chromosome 3A, 3B, 3D, 4B, 4D, 5A, 5B and 5D all contain three genes. The 7A, 7B and 7D chromosomes contain the least number of genes, with only 2 genes. 2.5 Cis-acting element analysis of TaGATA gene family In order to understand the potential expression regulation mechanism of wheat GATA gene family members, 79 cis-acting elements of wheat GATA genes were identified. A total of 14 cis-acting elements related to plant hormones and stress response were identified (FIG. 4 ), among which 10 elements were related to plant hormones. Respectively are abscisic acid reaction elements (ABRE), auxin response element (TGA-Element, AUXRR-core), methyl jasmonate response element (TGACG-motif, CGTCA-motif), ethylene response element (ERE), gibberellin response element (TATC-box, Pbox, Gare-motif) and Salicylic acid response element (TCA-element); There ARE four elements related to stress response, which ARE anaerobic induction element (ARE), cis-acting element (TC-rich repeats) involved in defense and stress response, low temperature induction element (LTR) and drought induction response element (MBS). 2.6 Expression of TaGATA gene family under different tissue and abiotic stress and hormone treatment 23 wheat GATA genes were selected from 79 wheat GATA genes, and the expression patterns of TaGATA in different tissues (root, stem, leaf, ear, pollen) and abiotic stresses (drought, low temperature, salt and ABA) were analyzed by QRT-PCR (Fig. 5 Fig. 6 ). Twenty-three genes were expressed to varying degrees in all tissues, and most (15) genes were highly expressed in stem, but few in spike. TaGATA43 , TaGATA47 , TaGATA50 , TaGATA54 and TaGATA60 were highly expressed in leaves, while TaGATA71 , TaGATA7 4 and TaGATA7 6 were specifically expressed in stems. TaGATA26 and TaGATA64 were highly expressed in pollen, and TaGATA02 was highly expressed in roots. TaGATA responded to abiotic stress but expressed at different levels (Fig. 6 ). Under salt stress, TaGATA02, TaGATA26, TaGATA60 and TaGATA64 were up-regulated. Under drought stress, only TaGATA22 and TaGATA64 were significantly up-regulated. Most genes were up-regulated under ABA stress, among which 13 genes, including TaGATA02, TaGATA14 and TaGATA18, were significantly up-regulated compared with the control group. Under low temperature stress, 12 genes including TaGATA27, TaGATA30 and TaGATA32 were down-regulated. TaGATA22, TaGATA27, TaGATA53, TaGATA64, TaGATA71, TaGATA74 and TaGATA76 were significantly up-regulated or down-regulated under the four stresses compared with the control group. 3. Discussion GATA transcription factors are universal in eukaryotes and have a special zinc finger structure. At present, GATA families have been identified from many species, such as Arabidopsis thaliana (30) [ 3 ] , rice (29) [ 20 ] , pepper (24) [ 17 ] , castor bean (19) [ 15 ] , sorghum (31) [ 16 ] , apple (39) [ 12 ] , tomato (30) [ 21 ] , etc. Previous studies on these plants found that most amino acid sites in the zinc finger structure of most GATA members were highly conserved. In this study, the conserved nature of wheat GATA transcription factor family members was basically consistent with previous studies. In addition, GATA transcription factors play an important role in many biological processes, such as light response regulation and chlorophyll synthesis [ 10 ][ 22 ] , cytokinin response [ 24 ][ 25 ], flower development [ 26 ], seed germination [ 27 ] and plant stress response [ 28 ] . A total of 79 TaGATA family members were identified in this study, indicating that the number of GATA family members in wheat was significantly higher than that of other species, which may be because wheat is allohexaploid with more homologous genes. Phylogenetic analysis of 79 TaGATA family members showed that the TaGATA gene family was divided into six subfamilies (subfamilies I, II, III, IV, VI, VII, lacking subfamily V), which were similar to rice, a monocotyledon plant. Rice GATA proteins are divided into six subfamilies (subfamilies I, II, III, V, VI, VII, and lack of subfamily IV), and the similarities between wheat and rice GATA members in gene and protein structure suggest that wheat and rice GATA proteins may have similar functions. Chromosome location analysis showed that 79 TaGATA members were unevenly dispersed on 21 chromosomes, and most of the protein sequences contained C-X 2 -C-X 18 -C-X 2 -C zinc finger domain, which was basically consistent with studies in Arabidopsis, rice and sorghum. According to the analysis of gene structure and conserved motifs, most GATA genes belonging to the same subfamily have the same type of protein conserved motifs and the same number of introns, indicating that the genes of the same subfamily may have similar functions and structures. Many cis-acting elements were detected, including methyl jasmonate, ethylene, gibberellin, auxin, salicylic acid, low temperature and drought, which were related to plant hormones and abiotic stress. Qrt-pcr results of 23 TaGATA family members showed that the GATA gene family was expressed differently in different tissues, and most of the genes were expressed at a higher level in the stem. Therefore, it was speculated that GATA transcription factors played an important role in the growth and development of wheat. Most of the genes were up-regulated under ABA stress and down-regulated under low temperature stress, indicating that TaGATAs were regulated differently by plant hormones and abiotic stress, thus playing a role in resisting adverse environment. 4. Conclusion A total of 79 TaGATA gene family members were identified in the whole wheat genome, which were divided into seven subgroups. The large number of members of the GATA transcription factor gene family in wheat is most likely due to the heterohexaploid nature of wheat, which has more GATA genes than the reported Arabidopsis or rice genomes. Based on the comprehensive study of wheat physicochemical properties, phylogenetic evolution, gene structure, chromosomal localization, cis-acting elements and expression pattern, the wheat GATA transcription factor gene family was summarized. These studies and analysis are beneficial to the research of wheat GATA gene regulating wheat growth and stress tolerance. 5. Materials And Methods 5.1 Materials and treatment The plant experimental material is Triticum aestivum L. (Chinese Spring). The wheat seeds were soaked and disinfected with 75 percent alcohol for 3 minute, washed with distilled water for 3 times, and then soaked and disinfected with 10 percent sodium hypochlorite for 3 minute. After rinsing with distilled water, the seeds were placed in sterile petri dishes and germinated for 24 h. The seeds were transplanted to wheat hydroponic box containing half of Hoagland nutrient solution and grew in a greenhouse with constant temperature and light for 16 h. Roots, stems and leaves were collected for tissue expression analysis when wheat seedlings grew to 2 weeks of age, and then they were treated with 0.2 mol L − 1 NaCl, 20 percent PEG, 100 µmol L − 1 ABA and 4℃, respectively. After 6 h of treatment, the roots, stems and leaves of plants in treatment group and control group were collected with 3 replicates per sample. In addition, wheat ears and pollen were collected from the field from April to July for tissue expression analysis, with 3 replicates per sample. All samples were frozen with liquid nitrogen sealed with tin foil and stored at -80℃ for subsequent RNA extraction. 5.2 Identification and physicochemical properties of GATA gene family members in wheat Use Ensembl Plants database ( http://plants.ensembl.org/index.html ) download the wheat genome data, protein sequence and annotation file. GATA family member domain Hidden Markov model (PF00320) downloaded from the Pfam database ( http://pfam.xfam.org/ ). The functional protein sequence database of wheat genome was searched by HMMER 3.0 software combined with the GATA family member domain hidden Markov model, and the candidate wheat GATA protein sequence was obtained. To confirm the reliability of the predicted genes as members of the GATA gene family, After weight loss, the GATA protein sequences of wheat were submitted to SMART ( http://smart.embl-heidelberg.de/ ) and NCBI's online tool CDD (Conserved Domain Database) for protein structure prediction. To determine that it contains the unique conserved domain of GATA, named TaGATA. Using ExPASy website ( https://web.expasy.org/protparam/ ) analysis on the basic physical and chemical properties of wheat GATA protein sequence information, such as: the molecular weight, isoelectric point, stability, etc. 5.3 Phylogenetic analysis of GATA gene family in wheat ClustalX software was used for multi-sequence alignment of GATA amino acid sequences in wheat, and neighbor-joining algorithm was used by MEGA7.0 software. Execute 1000 repetitions of Poission correction, Pairwise deletion, and Bootstrap to construct the system evolution tree. 5.4 Analysis of gene structure and conserved elements of wheat GATA family Using the GSDS website introns and exons gene model [ 18 ] , intron exon download information from plant transcription factor database ( http://planttfdb.cbi.pku.edu.cn/ ) and SGN net ( https://solgenomics.net/ ). Use online software MEME ( http://memesuite.org/tools/meme ) to predict conservative motif [ 19 ] . 5.5 Chromosome localization of GATA gene family in wheat The chromosome location of TaGATA was extracted from the wheat gene information GFF3 file, and the chromosome location map was made using the online website MG2C ( http://mg2c.iask.in/mg2c_v2.1/ ). 5.6 Cis-acting elements analysis of GATA gene family in wheat Each wheat GATA gene promoter region (upstream 2000 bp) was extracted from the whole wheat genome database. Using Plant CARE software ( http://bioinformatics.psb.ugent.be/webtools/plantcare/ ) analysis and Plant hormone and stress response of cis element. 5.7 RNA extraction and real-time fluorescence quantitative PCR analysis Specific quantitative primers were designed using software Primer 5 (see Table 2 ), in which wheat Actin was the internal reference gene. Total RNA was extracted from wheat using the RNAprep Pure Plant Kit and then TransStart® Top Green qPCR SuperMix (AQ131, TRAN) Kit. The extracted total RNA was used as template for reverse transcription to obtain cDNA. The PCR reaction system was as follows: cDNA 2 µL, 2×TransStart® Top Green qPCR SuperMix 10 µL, positive and reverse primers 0.4 µL, and nuclease-free Water 7.2 µL. The amplification procedure was as follows: 94℃ for 30 s; 94℃ 5 s, 54℃ 15 s, 72℃ 31 s, 40 cycles. Three biological replicates were performed for each sample, and data were processed using the 2 ‒ΔΔCT method. SPSS software was used for significance analysis, P < 0.05 means significant difference, P < 0.01 means extremely significant difference. Table 2 Primers for quantitative real-time PCR of TaGATA family Gene name Forward primer (5′–3′) Reverse primer (5′–3′) TaGATA02 ACCCAGCGACGGACTTT TCTTCGGCTCCACTGTCTC TaGATA14 GCCCTCGTCCTCGTGTT CCAGACTTGAACCGCACA TaGATA18 CTTCTCGCCCTACTTCCTG TCTTGCCGTGCTTGGACT TaGATA19 GGACTGCCTCGTTTGTTG TTTCCTCCTGTTTCCTTAGTG TaGATA22 GTGCCCCGTATGGTTCTAT GCAGGAGTTTCGCTGTGAT TaGATA25 GGACTGCCTCGTTTGTTGT GTATTTTCATTTCCTCCTGTT TaGATA26 CCTTGGAGACAGGGGATG GAACCGTGGAACCAGAACA TaGATA27 CCACCAGACAAGCCAGTTC GCATTCCCCATCTTCCAG TaGATA30 AAACTCAGGGACTGCTTCG CTGGTGGATTTGGTAAGGTC TaGATA32 TATGGGAAATGCGGACAC AGAAGGCTTAGGACGACTGA TaGATA43 TGCTCTGTTGGTGCTTGG CCTTTACGCCGTTTCATCT TaGATA47 AGCGGCGTAAAGGACAGT CAAGCCACAAGCATTACAGA TaGATA50 TGCTCTGTTGGTGCTTGG CCTTTACGCCGTTTCATCT TaGATA53 TCCTTCATCTTCCAATCCC TCCTCGTGTTCCTGCTCC TaGATA54 CAAAGCAACGACGAGCAT CATTGATTGGGTTGTCGGT TaGATA56 GTGAAGACAGCAGCACAGAGT CGGTGGCTCAACAATCAG TaGATA60 CAAAGCAACGACGAGCAT AAGCAGCAGCGAGTCCA TaGATA64 CGCACCAAGAGCAAGAAC CACTGGGGCGTCTTCTG TaGATA71 AAGCAGTGAAGGCAACAAAG CAAGACCGCAGGATAGGG TaGATA74 CCGAAGGTGAAGAAGGAGA ACTGGCACCGCAAAGG TaGATA75 CGGATGAGGTTTAGGGAGA GCCTGCCAGTTCAGATGTT TaGATA76 CCGAAGGTGAAGAAGGAGA AGGGCTCTTGCTCCAGTT TaGATA77 AGGCGAACATCTGAACTGG CTGATAGGTCCCGCAACAT TaActin TACTCCCTCACAACAACCG AGAACCTCCACTGAGAACAA Declarations Ethics approval and consent to participate All methods of this study were carried out in accordance with the relevant guidelines and regulations of the School of Life Science and Technology of Harbin Normal University.The wheat seeds used in this study, as well as the wheat tissue, ears and pollen grown in the field between April and July for tissue expression analysis studies, were obtained from private land and were collected with "landowner's permission". Consent for publication Not applicable Availability of data and materials Whole genome data, protein sequences and annotation files of wheat were downloaded from Ensembl Plants database, and GATA gene sequences and protein sequences of Arabidopsis and rice were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/). Competing interests The authors declare that they have no competing interest. Funding: the work was supported by a grant from the National Natural Science Foundation of China(Grant No:31600184),a grant from the Scientific Research Foundation for Phd of Harbin Normal University(Grant No:XKB201419) and a grant from the Innovation Research Foundation of Heilongjiang(Grant No:UNPYSCT-2018178) Authors' contributions Changhong Guo and Yan Bai evaluated the conceptualization of the study. Yan Bai and Yumeng Sun conceivedand designed the methodology. Data were analyzed by Yumeng Sun, Chunyue Li, Qihang Chang, Changhong Guoand Yan Bai. Yumeng Sun prepared and wrote the original draft. Yan Bai supervised the study. All authors have been read and approved. Acknowledgments We thank Wenrui Zhang for their help during this research work. References He Z.H., Zhang Q.S., Cheng S.H., Zhao Z.D., and Liu X. Wheat production and technology improvement in China. NongxueXuebao (Journal of Agriculture). 2018;8(1):99–106. Ru J N, Yu T F, Chen J, Chen M, Zhou Y B, Ma Y Z, Xu Z S, Min D H. Response of wheat Zinc-Finger transcription factor TaDi19A to cold and its screening of interacting proteins. Scientia Agricultura Sinica. 2017;50(13):2411–2422. REYES J C, MURO-PASTOR M I, FLORENCIO F J. The GATA family of transcri-ption factors in Arabidopsis and rice[J]. Plant Physiol. 2004;134(4):1718–1732. ZHANG C, HOU Y, HAO Q, et al. Genome-wide survey of the soybean GATA tra-nscription factor gene family and expression analysis under low nitrogen stress[J]. PLoS One. 2015;10(4):e0125174. Evans T, Reitman M, Felsenfeld G. An erythrocyte-specific DNA binding factor reco-gnizes a regulatory sequence common to all chicken globin genes.[J]. Proceedings of the national academy of sciences of the united states of america. 1988;85(16):5976 – 4980. Shi Y H, Xu Z R. Recent advances in GATA transcription factor[J]. Bulletin of Biology. 2005;40(3):1–2. Daniel-Vedele F, Caboche M. A tobacco cDNA clone encoding a GATA-1 zin-c finger protein homologous to regulators of nitrogen metabolism in fungi. Mol Genet.Genomics. 1993;240:365–373. Teakle GR, Gilmartin PM. Two forms of type IV zinc-finger motifand their kingdom-specific distribution between the flora, fauna and fungi. Trends Biochem Sci. 1998;23:100–102. Reyes J.C., Muro-pastor M.I., and Florencio F.J.. The GATA family of transcription factors in Arabidopsis and rice. Plant Physiol. 2004;134(4):1718–1732. Hudson D., Guevara D., Yaish M.W., Hannam C., Long N., Clarke J.D., Bi Y.M., and Rothstein S.J.. GNC and CGA1 modulate chlorophyll biosynthesis and gluta-mate synthase (GLU1/Fd-GOGAT) expression in Arabidopsis. PLos ONE. 2011;6(11):e26765. SHI Junna, LIU Meiqin, SHI Jing, et al. Sequence analysis and expression pattern of AmZFPG encoding a GATA type zinc finger protein in Ammopiptanthus mongolicus [J]. Journal of Beijing Forestry University. 2011;33(3):21–25. CHEN Hongfei. Genome-wide identification, phylogenetic evolution and expression analysis of CCO and GATA gene families in apple[D]. Yangling: Northwest A&F University. 2018. Peng X J, Wu Q Q, Teng L H, et al. Transcriptional regulation of the paper mulberry under cold stress as 16revealed by a comprehensive analysis of transcription factors[J]. BMC Plant Biology. 2015;15:108. Reyes José C, Muro- Pastor M Isabel, Florencio Francisco J. The GATA family of transcription factors in Arabidopsis and rice.[J]. Plant Physiology. 2004;134(4):1718–1732. AO Tao, LIAO Xiaojia, XU Wei, et al. Identification and characterization of GATA gene family in castor bean ( Ricinus communis )[J]. Plant Diversity and Resources. 2015;37(4):453–462. Yao M X, Zhou G Y, Ding Y Q, Li K Y, Ren M J. Identification and expression p-attern analysis of sorghum GATA transcription factor family[J]. Molecular Plant Breeding. Yuan Q, Zhang C L, Zhao T T, et al. Bioinformatics analysis of GATA transcripti-on factor in pepper[J]. ChineseAgricultural Science Bulletin. 2017;33(17):24–31. HU B, JIN J, GUO A Y, et al. GSDS 2.0: An upgraded gene feature visualization server[J]. Bioinformatics. 2015;31(8):1296–1297. BAILEY T L, BODEN M, BUSKE F A, et al. MEME SUITE: Tools for motif disc-overy and searching[J]. Nucleic Acids ï¼²es. 2009; 37:W202-W208. Luo Y, Wang Y C, Wang W P, et al. Bioinformatics analysis of GATA gene family in rice[J]. Molecular Plant Breeding. 2018;16(17):5514–5522. Yuan Q. Whole-genome mining of GATA transcription factor from tomato and screening of resistance-related genes[D]. Harbin: Northeast Agricultural University.2018. Shokrollahi B, Baneh H. (Co) variance components and genetc parameters for growth traits in Arabi sheep using different animal models[J]. Genetics and Molecular Research. 2012;(1):305–314. An Y, Han X, Tang S, et al. Poplar GATA transcription factor PdGNC is capable of regulating chloroplast ultrastructure, photosynthesis, and vegetative growth in Arabidopsis under varying nitrogen levels[J]. Plant Cell. Tissue and Organ Culture. 2014;119(2):313–327. Kiba T, Naitou T, Koizumi N, et al. Combinatorial microarray analysis revealing Arabidopsis genes implicated in cytokinin responses through the His→Asp phosphorelay circuitry[J]. Plant and Cell Physiology. 2005;46(2):339–355. Naito T, Kiba T, Koizumi N, et al. Characterization of a unique GATA family gene that responds to both light and cytokinin in Arabidopsis thaliana[J]. Bioscience, Biotechnology, and Biochemistry. 2007;71(6):1557–1560. Mara C D, Irish V F. Two GATA transcription factors are downstream effectors of floral homeotic gene action in Arabidopsis[J]. Plant Physiology. 2008;147(2):707–718. Liu P P, Koizuka N, Martin R C, et al. The BME3 (Blue Micropylar End 3) GATA zinc finger transcription factor is a positive regulator of Arabidopsis seed germination[J]. The Plant Journal. 2005;44(6):960–971. Huang X.Y., Chao D.Y., Gao J.P., Zhu M.Z., Shi M., and Lin H.X., A previously u-nknown zine finger protein, DST, regulates drought and salt tolerance in rice via stomatal aperture control. Genes Dev. 2009;23(15):1805–1817. Qiu S.G., Zhang T.Y., Yang S.M., Song L., and Zhao D.G.. Genome-wide identification and bioinformatics analysis of TALE transcription factor family in Lotus japonicus , Zhiwu Yichuan Ziyuan Xuebao (Journal of Plant Genetic Resources). 2019;20(2):466–475. Dröge-Laser W., Sniek B.L., Berend S., and Weiste C.. The Arabidopsis bZIP transcription factor family-an update, Curr. Opin Plant Biol. 2018;45:36–49. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1963114","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":130147385,"identity":"7b9cbb3b-73b6-4bf7-9d4d-b4d577f61272","order_by":0,"name":"Yumeng Sun","email":"","orcid":"","institution":"Harbin Normal University Songbei Campus","correspondingAuthor":false,"prefix":"","firstName":"Yumeng","middleName":"","lastName":"Sun","suffix":""},{"id":130147386,"identity":"8fb1aa7f-8b44-4407-adae-f38d6d83cb63","order_by":1,"name":"Chunyue Li","email":"","orcid":"","institution":"Harbin Normal University Songbei Campus","correspondingAuthor":false,"prefix":"","firstName":"Chunyue","middleName":"","lastName":"Li","suffix":""},{"id":130147387,"identity":"760ec1cd-523e-4313-823a-7dc9a8ab3a2a","order_by":2,"name":"Qihang Chang","email":"","orcid":"","institution":"Harbin Normal University Songbei Campus","correspondingAuthor":false,"prefix":"","firstName":"Qihang","middleName":"","lastName":"Chang","suffix":""},{"id":130147388,"identity":"32158b31-3cf0-45fb-9c3c-c71ac5a543c6","order_by":3,"name":"Changhong Guo","email":"","orcid":"","institution":"Harbin Normal University Songbei Campus","correspondingAuthor":false,"prefix":"","firstName":"Changhong","middleName":"","lastName":"Guo","suffix":""},{"id":130147389,"identity":"36634159-8ccf-4376-8869-6dc083ac2ea1","order_by":4,"name":"Yan Bai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYBACAwbGBiD1X46fvbHx4QcStDAbS/YcbjaWIE4LGDAnbriR3ibAQ4wWc/bDbRI/d7AZG9x82MYgwWAnp9tAQItlT2KbZO8ZHjnJ24ltDwoYko3NDhBy2IHENgneNgljvtuJ7QYSDAcStxHUcv5hm+TfNoPEhpsH2yR4iNJyI7FNmrctIXHCDUYitVjOeNhsLdt2ABjIicBANiDCL+b86Q9vvm07AIzK4w8ffqiwkyOoBQhYkCLQgLByEGAmKpmMglEwCkbBCAYAPN1GbH6tx/EAAAAASUVORK5CYII=","orcid":"","institution":"Harbin Normal University Songbei Campus","correspondingAuthor":true,"prefix":"","firstName":"Yan","middleName":"","lastName":"Bai","suffix":""}],"badges":[],"createdAt":"2022-08-15 08:14:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1963114/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1963114/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":25506187,"identity":"8b637b8b-7ced-438b-86c2-a2c351fd21f1","added_by":"auto","created_at":"2022-08-22 17:09:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":29125,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree of GATA gene family in wheat\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1963114/v1/6742b02cb62dbe6c597f7fb6.png"},{"id":25506188,"identity":"a94f7ec5-c86a-487e-bb97-048c8073588f","added_by":"auto","created_at":"2022-08-22 17:09:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":80136,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAn analytical view of GATA family in wheat\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eNote:a: Phylogenetic tree; b: Gene structure; c: Protein structure\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1963114/v1/734e0bd3ed4a69a8d9219ed3.png"},{"id":25506391,"identity":"d9961cfd-a895-4b73-b967-66cb6ddda566","added_by":"auto","created_at":"2022-08-22 17:14:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":61330,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe chromosome location of the TaGATA gene family\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1963114/v1/227538ad1f34402b741e15f7.png"},{"id":25506183,"identity":"3917171d-47b9-4016-a391-90191ddc79d0","added_by":"auto","created_at":"2022-08-22 17:09:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":131120,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCis-acting element analysis of TaGATA\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eNote: ABRE: cis-acting element involved in the abscisic acid responsiveness; ARE: cis-acting regulatory elementessential for the anaerobic induction; CGTCA-Motif: cis-acting regulatory element involved in the MeJA-responsiveness; P-box: gibberellin-responsive element; TGACG-motif: cis-acting regulatory element involvedin the MeJA-responsiveness; TC-rich repeats: cis-acting element involved in defense and stress responsiveness; TGA-element: auxin-responsive element; GARE-motif: gibberellin-responsive element; ERE: ethylene-response element; LTR: cis-acting element involved in low-temperature responsiveness; AuxRR-core: auxin-responsive element; MBS: MYB binding site involved in drought-inducibility; TCA-element: cis-acting element involved in salicylic acid responsiveness; TATC-box: cis-acting element involved in gibberellin-responsiveness\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1963114/v1/4b275834a76e0e9f06805247.png"},{"id":25506923,"identity":"b5febbac-7732-4ccb-a5fc-04bb78506b87","added_by":"auto","created_at":"2022-08-22 17:19:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":63875,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression profile of GATA gene family in different tissues of wheat\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eNote: A: Root; B: Stem; C: Leaf; D: Spike; E: Pollen\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-1963114/v1/974d898ea66d7cc94322d044.png"},{"id":25506393,"identity":"36705d9b-54f7-4666-b925-c6cc7afdb1a7","added_by":"auto","created_at":"2022-08-22 17:14:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":54509,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression profile of GATA gene family under different treatments in wheat\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eNote: A: control; B: six hours of 0.2 mol L\u003csup\u003e‒1\u003c/sup\u003e NaCl treatment; C: six hours of 20% PEG treatment; D: six hours of 100 μmol L\u003csup\u003e‒1\u003c/sup\u003e ABA treatment; E: six hours of 4℃ treatment. * and ** indicate significantly different at P \u0026lt; 0.05 and P \u0026lt; 0.01, respectively\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-1963114/v1/e9619642d3329f09386f25b0.png"},{"id":26950362,"identity":"951e239b-15f9-4bf7-b8f7-51592e814470","added_by":"auto","created_at":"2022-09-26 05:29:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1047699,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1963114/v1/5c5aeac2-4bc8-4c9c-a0d3-00e53b9e9071.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genome-wide identification and expression analysis of GATA gene family in wheat","fulltext":[{"header":"1. Background","content":"\u003cp\u003eWheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) is a widely cultivated cereal crop, which accounts for about third of the cultivated area and is the main food for about 35 percent to 40 percent of the world's population \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. The yield and quality of wheat are affected by various environmental stresses during its growth and development, among which abiotic stresses such as salt, drought and low temperature are more serious \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. GATA transcription factors are important zinc finger transcription factors in organisms, which play an important role in abiotic stress resistance, cytokinin response, and carbon and nitrogen metabolism. However, no genome-wide identification of wheat GATA transcription factors has been reported. In this study, bioinformatics methods were used to explore the function of wheat GATA transcription factor family, which is of great significance to the breeding of wheat superior varieties.\u003c/p\u003e \u003cp\u003eThe GATA family is an important class of zinc finger transcription factors in organisms, containing highly conserved zinc finger domain ⅳ, which is widely involved in multiple biological processes of plants, animals and microorganisms. Most of the GATA transcription factors in plants include one or two zinc finger domains. The common sequence is CX\u003csub\u003e2\u003c/sub\u003eCX\u003csub\u003e18\u0026thinsp;\u0026minus;\u0026thinsp;20\u003c/sub\u003eCX\u003csub\u003e2\u003c/sub\u003eC\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e][\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. In 1988, Evans et al.\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e discovered the (T/A)GATA(A/G) sequence that can be bound by six GATA transcription factors (GATA1-GATA6) in the promoter of chicken globin gene. The transcription factor GATA-1 was discovered in 1991, followed by GATA-2, GATA-3, GATA-4, GATA-5, GATA-6 and other GATA transcription factors, which together form the GATA transcription factor family\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. In 1993, the first plant GATA transcription factor was identified in tobacco and was named NTL1 due to its similarity to a protein of Neurospora crassis\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Subsequently, Teakle and Gilmartin\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e also identified GATA transcription factors in Arabidopsis thaliana. As GATA transcription factors have been reported in animals, fungi and plants, scientists have found that GATA transcription factors not only play an important role in cell differentiation, but also play an important role in stress signal transduction and metabolic pathways. For example, the first GATA zinc finger transcription factor NTL1 cloned from tobacco in plants has been shown to be involved in the nitrogen metabolism pathway. In recent years, it has been reported that GATA transcription factors in plants play a key role in regulating flower development, carbon and nitrogen metabolism\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e, chlorophyll levels\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e and abiotic stress response processes such as drought, cold injury and darkness\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e][\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e][\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. So far, \u003cem\u003eArabidopsis thaliana\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e, \u003cem\u003eRicinus communis\u003c/em\u003e L. \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, Apple (\u003cem\u003eMalus domestica\u003c/em\u003e)\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.)\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e, \u003cem\u003eSorghum\u003c/em\u003e\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, \u003cem\u003eCapsicum annuum\u003c/em\u003e L. \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e and other plants GATA family members were identified at the whole gene level, which provided theoretical reference for studying the biological functions of GATA transcription factors in other plants.\u003c/p\u003e \u003cp\u003eBased on the whole-genome data of wheat downloaded from the Ensembl Plants database, this study identified the members of the GATA gene family and analyzed their physical and chemical properties, gene structure, conservative motifs, chromosome distribution, homeopathic elements and systematic evolution. Meanwhile, qRT-PCR was used to further clarify the expression patterns of 23 wheat GATA family members under different tissues and different abiotic stresses, which laid a certain foundation for further understanding the function and role of wheat GATA transcription factors.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003e2.1 Basic information analysis of TaGATA gene family members\u003c/h2\u003e\n\u003cp\u003eThe amino acid sequence of wheat GATA gene was obtained by HMMER 3.0 software. Then, the protein structure was predicted by SMART and NCBI online tool CDD to verify that the wheat GATA transcription factor contained the unique conserved domain of GATA. A total of 79 wheat GATA gene family members were obtained. They are numbered from top to bottom according to their relative positions on the chromosome and named \u003cem\u003eTaGATA1\u003c/em\u003e-\u003cem\u003eTaGATA79\u003c/em\u003e (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). These TaGATA family members encode 146\u0026thinsp;~\u0026thinsp;499 amino acids with isoelectric points ranging from 4.76 to 10.12 and molecular weights ranging from 16077.01 to 54149.63Da. Among them, 35 were acidic proteins (isoelectric point\u0026thinsp;\u0026lt;\u0026thinsp;7.0) and 43 were basic proteins (isoelectric point\u0026thinsp;\u0026gt;\u0026thinsp;7.0). The coding amino acids and isoelectric points of TaGATA67 sequence could not be determined due to the unknown bases. The instability index ranged from 41.99 to 86.02, and all of them were unstable proteins (instability index\u0026thinsp;\u0026gt;\u0026thinsp;40). The average hydrophilic coefficients were all negative, indicating that wheat GATA proteins were all hydrophilic proteins.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eTaGATA genes information identified in the wheat genome\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene ID\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eCoded amino acids\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eIsoelec-tric\u003c/p\u003e\n\u003cp\u003ePoint\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eMolecularweight\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eInstability index\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eHydrophob-icity\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eGroup\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA01\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1A01G097300.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e159\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.30\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e17489.64\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e62.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.740\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA02\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1A01G144400.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e288\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.64\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e32348.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e73.48\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.925\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅥ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA03\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1A01G221600.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e349\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.85\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e36867.15\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e44.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.408\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅠ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA04\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1A01G285100.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e304\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.71\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e32162.59\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e52.36\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.813\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA05\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1A01G340900.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e387\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e39932.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e61.50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.388\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅠ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA06\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1A01G418200.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e219\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.48\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e23297.76\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e57.95\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.572\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA07\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1B01G126600.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e146\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.46\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e16077.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e71.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.945\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA08\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1B01G161800.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e285\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e31706.00\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e71.20\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.941\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅥ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA09\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1B01G234800.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e357\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.03\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e37531.83\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e47.97\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.411\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅠ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA10\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1B01G353700.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e400\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.91\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e41602.28\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e62.66\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.511\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅠ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA11\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1B01G448200.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e217\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.11\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e23109.65\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e64.63\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.540\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA12\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1D01G106100.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e146\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.62\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e16100.05\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e69.90\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.950\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA13\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1D01G143500.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e294\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e9.67\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e32777.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e73.08\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.974\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅥ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA14\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1D01G223200.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e357\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.87\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e37424.71\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e45.17\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.384\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅠ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA15\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1D01G284100.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e322\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e34071.68\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e54.44\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.764\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA16\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1D01G343000.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e383\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.80\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e39641.28\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e58.54\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.451\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅠ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA17\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS1D01G425900.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e219\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.16\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e23317.83\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e50.89\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.539\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅡ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA18\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS2A01G388300.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e432\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.29\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e46270.74\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e67.86\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.655\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅠ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA19\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS2A01G391700.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e441\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7.20\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e48058.86\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e54.56\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.677\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅣ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA20\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTraesCS2A01G520600.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e294\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.69\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e31357.04\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e48.95\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e-0.678\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eⅦ\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003e2.2 Phylogenetic analysis of members of TaGATA gene family\u003c/h2\u003e\n\u003cp\u003eThe GATA phylogenetic tree was constructed using MEGA 7.0 software (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The GATA protein sequences of arabidopsis thaliana and rice were compared with those of wheat, and the wheat GATA genes were divided into six subgroups. Subgroup Ⅰ for \u003cem\u003eTaGATA03, TaGATA05\u003c/em\u003e, \u003cem\u003eTaGATA09\u003c/em\u003e, \u003cem\u003eTaGATA10\u003c/em\u003e, \u003cem\u003eTaGATA14\u003c/em\u003e, \u003cem\u003eTaGATA16\u003c/em\u003e, \u003cem\u003eTaGATA18\u003c/em\u003e, \u003cem\u003eTaGATA24\u003c/em\u003e, \u003cem\u003eTaGATA29\u003c/em\u003e, \u003cem\u003eTaGATA34, TaGATA37\u003c/em\u003e, \u003cem\u003eTaGATA40\u003c/em\u003e, \u003cem\u003eTaGATA49\u003c/em\u003e, \u003cem\u003eTaGATA52\u003c/em\u003e, \u003cem\u003eTaGATA55\u003c/em\u003e, \u003cem\u003eTaGATA64\u003c/em\u003e, \u003cem\u003eTaGATA65\u003c/em\u003e, \u003cem\u003eTaGATA68\u003c/em\u003e, \u003cem\u003eTaGATA69\u003c/em\u003e, \u003cem\u003eTaGATA72\u003c/em\u003e, \u003cem\u003eTaGATA73\u003c/em\u003e; subgroup Ⅱ for \u003cem\u003eTaGATA01\u003c/em\u003e, \u003cem\u003eTaGATA04, TaGATA06\u003c/em\u003e, \u003cem\u003eTaGATA07\u003c/em\u003e, \u003cem\u003eTaGATA11\u003c/em\u003e, \u003cem\u003eTaGATA12\u003c/em\u003e, \u003cem\u003eTaGATA15, TaGATA17\u003c/em\u003e, \u003cem\u003eTaGATA33\u003c/em\u003e, \u003cem\u003eTaGATA35\u003c/em\u003e, \u003cem\u003eTaGATA36\u003c/em\u003e, \u003cem\u003eTaGATA38\u003c/em\u003e, \u003cem\u003eTaGATA39\u003c/em\u003e, \u003cem\u003eTaGATA41\u003c/em\u003e, \u003cem\u003eTaGATA45\u003c/em\u003e, \u003cem\u003eTaGATA58\u003c/em\u003e, \u003cem\u003eTaGATA61\u003c/em\u003e, \u003cem\u003eTaGATA63\u003c/em\u003e, \u003cem\u003eTaGATA67\u003c/em\u003e, \u003cem\u003eTaGATA71\u003c/em\u003e, \u003cem\u003eTaGATA74\u003c/em\u003e, \u003cem\u003eTaGATA76\u003c/em\u003e, \u003cem\u003eTaGATA78\u003c/em\u003e: subgroup Ⅲ for \u003cem\u003eTaGATA43\u003c/em\u003e, \u003cem\u003eTaGATA44\u003c/em\u003e, \u003cem\u003eTaGATA47\u003c/em\u003e, \u003cem\u003eTaGATA50\u003c/em\u003e, \u003cem\u003eTaGATA62\u003c/em\u003e, \u003cem\u003eTaGATA66\u003c/em\u003e, \u003cem\u003eTaGATA70\u003c/em\u003e, \u003cem\u003eTaGATA75\u003c/em\u003e, \u003cem\u003eTaGATA77\u003c/em\u003e, \u003cem\u003eTaGATA79\u003c/em\u003e; subgroup Ⅳ for \u003cem\u003eTaGATA19\u003c/em\u003e, \u003cem\u003eTaGATA21\u003c/em\u003e, \u003cem\u003eTaGATA22\u003c/em\u003e, \u003cem\u003eTaGATA23\u003c/em\u003e, \u003cem\u003eTaGATA25\u003c/em\u003e, \u003cem\u003eTaGATA26\u003c/em\u003e, \u003cem\u003eTaGATA27\u003c/em\u003e, \u003cem\u003eTaGATA28\u003c/em\u003e, \u003cem\u003eTaGATA30, TaGATA31, TaGATA32\u003c/em\u003e; subgroup Ⅵ for \u003cem\u003eTaGATA02\u003c/em\u003e, \u003cem\u003eTaGATA08\u003c/em\u003e, \u003cem\u003eTaGATA13\u003c/em\u003e, \u003cem\u003eTaGATA46, TaGATA53\u003c/em\u003e, \u003cem\u003eTaGATA54\u003c/em\u003e, \u003cem\u003eTaGATA56\u003c/em\u003e, \u003cem\u003eTaGATA57\u003c/em\u003e, \u003cem\u003eTaGATA59\u003c/em\u003e, \u003cem\u003eTaGATA60\u003c/em\u003e; subgroup Ⅶ for \u003cem\u003eTaGATA20\u003c/em\u003e, \u003cem\u003eTaGATA42\u003c/em\u003e, \u003cem\u003eTaGATA48\u003c/em\u003e, \u003cem\u003eTaGATA51.\u003c/em\u003e The members of subgroups Ⅰ, Ⅱ, Ⅳ and Ⅶ all contained only one GATA domain. The members of subgroup Ⅲ all contain one tify,\u003c/p\u003e\n\u003cp\u003eone CCT and one GATA domain except \u003cem\u003eTaGATA44\u003c/em\u003e (which contains only CCT and GATA domain). The members of subgroup Ⅵ all contain two or three GATA domains.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003e2.3 Structural characterization of TaGATA gene family\u003c/h2\u003e\n\u003cp\u003eIn order to analyze the structural characteristics of each gene in wheat GATA family, the online tool MEME was used to predict 10 conserved motifs of the protein sequence of wheat GATA gene. The results of conserved motifs prediction, intron-exon composition and phylogenetic combination of GATA gene family members were analyzed by Tbtools software. Figure\u0026nbsp;2A shows the phylogenetic tree of GATA. Figure\u0026nbsp;2B shows 10 conserved motifs of GATA gene protein sequence: Motif 1, Motif 2, Motif 3, Motif 4, Motif 5, Motif 6, Motif 7, Motif 8, Motif 9, Motif 10. It can be seen from the analysis of Fig.\u0026nbsp;2A and 2B, all members of subgroup Ⅰ contain Motif 1, Motif 2, Motif 4, Motif 5 and Motif 7. All members of subgroup Ⅲ contain Motif 1, Motif 3, Motif 4, Motif 8 except \u003cem\u003eTaGATA44\u003c/em\u003e. All members of subgroup Ⅳ contain Motif 1, Motif 4, Motif 5, Motif 6, Motif 7, Motif 8, and Motif 9, and \u003cem\u003eTaGATA21\u003c/em\u003e, \u003cem\u003eTaGATA23\u003c/em\u003e, and \u003cem\u003eTaGATA28\u003c/em\u003e contain Motif 10 in addition. In addition, Motif 1 and Motif 4 were found in all members, while Motif 10 was found only in some members of subgroup Ⅳ. These results suggest that the GATA gene family may have lost or acquired conserved motifs during the evolution of wheat.\u003c/p\u003e\n\u003cp\u003eAs shown in Fig.\u0026nbsp;2C, the structures of members of subgroup Ⅰ and subgroup Ⅵ are similar, with 2 or 3 exons. Members of subgroup Ⅱ have 1\u0026ndash;3 exons. The members of subgroup Ⅲ had 7 or 8 exons. The members of subgroup Ⅳ have 3\u0026ndash;6 exons. Members of subgroup Ⅶ have only one exon. It can be seen that there is little difference in the number of measured exons in the members of the same subgroup, especially the number of measured exons in the members of subgroup Ⅶ is the same (the gene structure of the members of the same subfamily has strong consistency). The genetic structure of these GATA transcription factors is similar to that of Arabidopsis thaliana and rice.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003e2.4 Chromosome localization analysis of TaGATA gene family\u003c/h2\u003e\n\u003cp\u003eAs can be seen from Fig.\u0026nbsp;3, 79 TaGATA genes were unevenly distributed on 21 chromosomes, with most of them on chromosomes 1A, 2A and 1D, each containing 6 genes. Secondly, there are 5 genes on chromosome 1B, 2B and 4A. Four genes were distributed on 2D, 6A, 6B and 6D chromosomes. Chromosome 3A, 3B, 3D, 4B, 4D, 5A, 5B and 5D all contain three genes. The 7A, 7B and 7D chromosomes contain the least number of genes, with only 2 genes.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003e2.5 Cis-acting element analysis of TaGATA gene family\u003c/h2\u003e\n\u003cp\u003eIn order to understand the potential expression regulation mechanism of wheat GATA gene family members, 79 cis-acting elements of wheat GATA genes were identified. A total of 14 cis-acting elements related to plant hormones and stress response were identified (FIG. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e), among which 10 elements were related to plant hormones. Respectively are abscisic acid reaction elements (ABRE), auxin response element (TGA-Element, AUXRR-core), methyl jasmonate response element (TGACG-motif, CGTCA-motif), ethylene response element (ERE), gibberellin response element (TATC-box, Pbox, Gare-motif) and Salicylic acid response element (TCA-element); There ARE four elements related to stress response, which ARE anaerobic induction element (ARE), cis-acting element (TC-rich repeats) involved in defense and stress response, low temperature induction element (LTR) and drought induction response element (MBS).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003e2.6 Expression of TaGATA gene family under different tissue and abiotic stress and hormone treatment\u003c/h2\u003e\n\u003cp\u003e23 wheat GATA genes were selected from 79 wheat GATA genes, and the expression patterns of TaGATA in different tissues (root, stem, leaf, ear, pollen) and abiotic stresses (drought, low temperature, salt and ABA) were analyzed by QRT-PCR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). Twenty-three genes were expressed to varying degrees in all tissues, and most (15) genes were highly expressed in stem, but few in spike. \u003cem\u003eTaGATA43\u003c/em\u003e, \u003cem\u003eTaGATA47\u003c/em\u003e, \u003cem\u003eTaGATA50\u003c/em\u003e, \u003cem\u003eTaGATA54\u003c/em\u003e and \u003cem\u003eTaGATA60\u003c/em\u003e were highly expressed in leaves, while \u003cem\u003eTaGATA71\u003c/em\u003e, \u003cem\u003eTaGATA7\u003c/em\u003e4 and \u003cem\u003eTaGATA7\u003c/em\u003e6 were specifically expressed in stems. \u003cem\u003eTaGATA26\u003c/em\u003e and \u003cem\u003eTaGATA64\u003c/em\u003e were highly expressed in pollen, and \u003cem\u003eTaGATA02\u003c/em\u003e was highly expressed in roots.\u003c/p\u003e\n\u003cp\u003eTaGATA responded to abiotic stress but expressed at different levels (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). Under salt stress, TaGATA02, TaGATA26, TaGATA60 and TaGATA64 were up-regulated. Under drought stress, only TaGATA22 and TaGATA64 were significantly up-regulated. Most genes were up-regulated under ABA stress, among which 13 genes, including TaGATA02, TaGATA14 and TaGATA18, were significantly up-regulated compared with the control group. Under low temperature stress, 12 genes including TaGATA27, TaGATA30 and TaGATA32 were down-regulated. TaGATA22, TaGATA27, TaGATA53, TaGATA64, TaGATA71, TaGATA74 and TaGATA76 were significantly up-regulated or down-regulated under the four stresses compared with the control group.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eGATA transcription factors are universal in eukaryotes and have a special zinc finger structure. At present, GATA families have been identified from many species, such as Arabidopsis thaliana (30)\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e, rice (29)\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, pepper (24)\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, castor bean (19)\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, sorghum (31)\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, apple (39)\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, tomato (30)\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e, etc. Previous studies on these plants found that most amino acid sites in the zinc finger structure of most GATA members were highly conserved. In this study, the conserved nature of wheat GATA transcription factor family members was basically consistent with previous studies. In addition, GATA transcription factors play an important role in many biological processes, such as light response regulation and chlorophyll synthesis \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e][\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e, cytokinin response \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e][\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e],\u003c/sup\u003e flower development \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e],\u003c/sup\u003e seed germination \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e and plant stress response \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. A total of 79 TaGATA family members were identified in this study, indicating that the number of GATA family members in wheat was significantly higher than that of other species, which may be because wheat is allohexaploid with more homologous genes.\u003c/p\u003e \u003cp\u003ePhylogenetic analysis of 79 TaGATA family members showed that the TaGATA gene family was divided into six subfamilies (subfamilies I, II, III, IV, VI, VII, lacking subfamily V), which were similar to rice, a monocotyledon plant. Rice GATA proteins are divided into six subfamilies (subfamilies I, II, III, V, VI, VII, and lack of subfamily IV), and the similarities between wheat and rice GATA members in gene and protein structure suggest that wheat and rice GATA proteins may have similar functions. Chromosome location analysis showed that 79 TaGATA members were unevenly dispersed on 21 chromosomes, and most of the protein sequences contained C-X\u003csub\u003e2\u003c/sub\u003e-C-X\u003csub\u003e18\u003c/sub\u003e-C-X\u003csub\u003e2\u003c/sub\u003e-C zinc finger domain, which was basically consistent with studies in Arabidopsis, rice and sorghum. According to the analysis of gene structure and conserved motifs, most GATA genes belonging to the same subfamily have the same type of protein conserved motifs and the same number of introns, indicating that the genes of the same subfamily may have similar functions and structures. Many cis-acting elements were detected, including methyl jasmonate, ethylene, gibberellin, auxin, salicylic acid, low temperature and drought, which were related to plant hormones and abiotic stress. Qrt-pcr results of 23 TaGATA family members showed that the GATA gene family was expressed differently in different tissues, and most of the genes were expressed at a higher level in the stem. Therefore, it was speculated that GATA transcription factors played an important role in the growth and development of wheat. Most of the genes were up-regulated under ABA stress and down-regulated under low temperature stress, indicating that TaGATAs were regulated differently by plant hormones and abiotic stress, thus playing a role in resisting adverse environment.\u003c/p\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eA total of 79 TaGATA gene family members were identified in the whole wheat genome, which were divided into seven subgroups. The large number of members of the GATA transcription factor gene family in wheat is most likely due to the heterohexaploid nature of wheat, which has more GATA genes than the reported Arabidopsis or rice genomes. Based on the comprehensive study of wheat physicochemical properties, phylogenetic evolution, gene structure, chromosomal localization, cis-acting elements and expression pattern, the wheat GATA transcription factor gene family was summarized. These studies and analysis are beneficial to the research of wheat GATA gene regulating wheat growth and stress tolerance.\u003c/p\u003e"},{"header":"5. Materials And Methods","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003e5.1 Materials and treatment\u003c/h2\u003e\n\u003cp\u003eThe plant experimental material is \u003cem\u003eTriticum aestivum\u003c/em\u003e L. (Chinese Spring). The wheat seeds were soaked and disinfected with 75 percent alcohol for 3 minute, washed with distilled water for 3 times, and then soaked and disinfected with 10 percent sodium hypochlorite for 3 minute. After rinsing with distilled water, the seeds were placed in sterile petri dishes and germinated for 24 h. The seeds were transplanted to wheat hydroponic box containing half of Hoagland nutrient solution and grew in a greenhouse with constant temperature and light for 16 h. Roots, stems and leaves were collected for tissue expression analysis when wheat seedlings grew to 2 weeks of age, and then they were treated with 0.2 mol L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e NaCl, 20 percent PEG, 100 \u0026micro;mol L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e ABA and 4℃, respectively. After 6 h of treatment, the roots, stems and leaves of plants in treatment group and control group were collected with 3 replicates per sample. In addition, wheat ears and pollen were collected from the field from April to July for tissue expression analysis, with 3 replicates per sample. All samples were frozen with liquid nitrogen sealed with tin foil and stored at -80℃ for subsequent RNA extraction.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003e5.2 Identification and physicochemical properties of GATA gene family members in wheat\u003c/h2\u003e\n\u003cp\u003eUse Ensembl Plants database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://plants.ensembl.org/index.html\u003c/span\u003e\u003c/span\u003e) download the wheat genome data, protein sequence and annotation file. GATA family member domain Hidden Markov model (PF00320) downloaded from the Pfam database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pfam.xfam.org/\u003c/span\u003e\u003c/span\u003e). The functional protein sequence database of wheat genome was searched by HMMER 3.0 software combined with the GATA family member domain hidden Markov model, and the candidate wheat GATA protein sequence was obtained. To confirm the reliability of the predicted genes as members of the GATA gene family, After weight loss, the GATA protein sequences of wheat were submitted to SMART (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://smart.embl-heidelberg.de/\u003c/span\u003e\u003c/span\u003e) and NCBI's online tool CDD (Conserved Domain Database) for protein structure prediction. To determine that it contains the unique conserved domain of GATA, named TaGATA. Using ExPASy website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/protparam/\u003c/span\u003e\u003c/span\u003e) analysis on the basic physical and chemical properties of wheat GATA protein sequence information, such as: the molecular weight, isoelectric point, stability, etc.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003e5.3 Phylogenetic analysis of GATA gene family in wheat\u003c/h2\u003e\n\u003cp\u003eClustalX software was used for multi-sequence alignment of GATA amino acid sequences in wheat, and neighbor-joining algorithm was used by MEGA7.0 software. Execute 1000 repetitions of Poission correction, Pairwise deletion, and Bootstrap to construct the system evolution tree.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003e5.4 Analysis of gene structure and conserved elements of wheat GATA family\u003c/h2\u003e\n\u003cp\u003eUsing the GSDS website introns and exons gene model\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e, intron exon download information from plant transcription factor database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://planttfdb.cbi.pku.edu.cn/\u003c/span\u003e\u003c/span\u003e) and SGN net (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://solgenomics.net/\u003c/span\u003e\u003c/span\u003e). Use online software MEME (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://memesuite.org/tools/meme\u003c/span\u003e\u003c/span\u003e) to predict conservative motif \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003e5.5 Chromosome localization of GATA gene family in wheat\u003c/h2\u003e\n\u003cp\u003eThe chromosome location of TaGATA was extracted from the wheat gene information GFF3 file, and the chromosome location map was made using the online website MG2C (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://mg2c.iask.in/mg2c_v2.1/\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003e5.6 Cis-acting elements analysis of GATA gene family in wheat\u003c/h2\u003e\n\u003cp\u003eEach wheat GATA gene promoter region (upstream 2000 bp) was extracted from the whole wheat genome database. Using Plant CARE software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bioinformatics.psb.ugent.be/webtools/plantcare/\u003c/span\u003e\u003c/span\u003e) analysis and Plant hormone and stress response of cis element.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003e5.7 RNA extraction and real-time fluorescence quantitative PCR analysis\u003c/h2\u003e\n\u003cp\u003eSpecific quantitative primers were designed using software Primer 5 (see Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e), in which wheat Actin was the internal reference gene. Total RNA was extracted from wheat using the RNAprep Pure Plant Kit and then TransStart\u0026reg; Top Green qPCR SuperMix (AQ131, TRAN) Kit. The extracted total RNA was used as template for reverse transcription to obtain cDNA. The PCR reaction system was as follows: cDNA 2 \u0026micro;L, 2\u0026times;TransStart\u0026reg; Top Green qPCR SuperMix 10 \u0026micro;L, positive and reverse primers 0.4 \u0026micro;L, and nuclease-free Water 7.2 \u0026micro;L. The amplification procedure was as follows: 94℃ for 30 s; 94℃ 5 s, 54℃ 15 s, 72℃ 31 s, 40 cycles. Three biological replicates were performed for each sample, and data were processed using the 2\u003csup\u003e‒\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method. SPSS software was used for significance analysis, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 means significant difference, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 means extremely significant difference.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimers for quantitative real-time PCR of TaGATA family\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eForward primer (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eReverse primer (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA02\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACCCAGCGACGGACTTT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTCTTCGGCTCCACTGTCTC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA14\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCCCTCGTCCTCGTGTT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCAGACTTGAACCGCACA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA18\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCTTCTCGCCCTACTTCCTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTCTTGCCGTGCTTGGACT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA19\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGGACTGCCTCGTTTGTTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTTTCCTCCTGTTTCCTTAGTG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA22\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGTGCCCCGTATGGTTCTAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCAGGAGTTTCGCTGTGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA25\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGGACTGCCTCGTTTGTTGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGTATTTTCATTTCCTCCTGTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA26\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTTGGAGACAGGGGATG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGAACCGTGGAACCAGAACA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA27\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCACCAGACAAGCCAGTTC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCATTCCCCATCTTCCAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA30\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAACTCAGGGACTGCTTCG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCTGGTGGATTTGGTAAGGTC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA32\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTATGGGAAATGCGGACAC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGAAGGCTTAGGACGACTGA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA43\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTGCTCTGTTGGTGCTTGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTTTACGCCGTTTCATCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA47\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGCGGCGTAAAGGACAGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCAAGCCACAAGCATTACAGA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA50\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTGCTCTGTTGGTGCTTGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTTTACGCCGTTTCATCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA53\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTCCTTCATCTTCCAATCCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTCCTCGTGTTCCTGCTCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA54\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCAAAGCAACGACGAGCAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCATTGATTGGGTTGTCGGT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA56\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGTGAAGACAGCAGCACAGAGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCGGTGGCTCAACAATCAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA60\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCAAAGCAACGACGAGCAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGCAGCAGCGAGTCCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA64\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCGCACCAAGAGCAAGAAC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCACTGGGGCGTCTTCTG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA71\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGCAGTGAAGGCAACAAAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCAAGACCGCAGGATAGGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA74\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCGAAGGTGAAGAAGGAGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACTGGCACCGCAAAGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA75\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCGGATGAGGTTTAGGGAGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCCTGCCAGTTCAGATGTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA76\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCGAAGGTGAAGAAGGAGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGGGCTCTTGCTCCAGTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaGATA77\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGGCGAACATCTGAACTGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCTGATAGGTCCCGCAACAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eTaActin\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTACTCCCTCACAACAACCG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGAACCTCCACTGAGAACAA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll methods of this study were carried out in accordance with the relevant guidelines and regulations of the School of Life Science and Technology of Harbin Normal University.The wheat seeds used in this study, as well as the wheat tissue, ears and pollen grown in the field between April and July for tissue expression analysis studies, were obtained from private land and were collected with \u0026quot;landowner\u0026apos;s permission\u0026quot;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhole genome data, protein sequences and annotation files of wheat were downloaded from Ensembl Plants database, and\u0026nbsp;GATA\u0026nbsp;gene sequences and protein sequences of Arabidopsis and rice were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ethe work was supported by a grant from the National Natural Science Foundation of China(Grant No:31600184),a grant from the Scientific Research Foundation for Phd of Harbin Normal University(Grant No:XKB201419) and a grant from the Innovation Research Foundation of Heilongjiang(Grant No:UNPYSCT-2018178)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChanghong Guo and Yan Bai evaluated the conceptualization of the study. Yan Bai and Yumeng Sun conceivedand designed the methodology. Data were analyzed by Yumeng Sun, Chunyue Li, Qihang Chang, Changhong\u0026nbsp;Guoand Yan Bai.\u0026nbsp;Yumeng Sun prepared and wrote the original draft. Yan Bai supervised the study. All authors have been read and approved.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Wenrui Zhang for their help during this research work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHe Z.H., Zhang Q.S., Cheng S.H., Zhao Z.D., and Liu X. Wheat production and technology improvement in China. NongxueXuebao (Journal of Agriculture). 2018;8(1):99\u0026ndash;106.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRu J N, Yu T F, Chen J, Chen M, Zhou Y B, Ma Y Z, Xu Z S, Min D H. Response of wheat Zinc-Finger transcription factor TaDi19A to cold and its screening of interacting proteins. Scientia Agricultura Sinica. 2017;50(13):2411\u0026ndash;2422.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eREYES J C, MURO-PASTOR M I, FLORENCIO F J. The GATA family of transcri-ption factors in Arabidopsis and rice[J]. Plant Physiol. 2004;134(4):1718\u0026ndash;1732.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG C, HOU Y, HAO Q, et al. Genome-wide survey of the soybean GATA tra-nscription factor gene family and expression analysis under low nitrogen stress[J]. PLoS One. 2015;10(4):e0125174.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvans T, Reitman M, Felsenfeld G. An erythrocyte-specific DNA binding factor reco-gnizes a regulatory sequence common to all chicken globin genes.[J]. Proceedings of the national academy of sciences of the united states of america. 1988;85(16):5976 \u0026ndash; 4980.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi Y H, Xu Z R. Recent advances in GATA transcription factor[J]. Bulletin of Biology. 2005;40(3):1\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaniel-Vedele F, Caboche M. A tobacco cDNA clone encoding a GATA-1 zin-c finger protein homologous to regulators of nitrogen metabolism in fungi. Mol Genet.Genomics. 1993;240:365\u0026ndash;373.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeakle GR, Gilmartin PM. Two forms of type IV zinc-finger motifand their kingdom-specific distribution between the flora, fauna and fungi. Trends Biochem Sci. 1998;23:100\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReyes J.C., Muro-pastor M.I., and Florencio F.J.. The GATA family of transcription factors in Arabidopsis and rice. Plant Physiol. 2004;134(4):1718\u0026ndash;1732.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHudson D., Guevara D., Yaish M.W., Hannam C., Long N., Clarke J.D., Bi Y.M., and Rothstein S.J.. GNC and CGA1 modulate chlorophyll biosynthesis and gluta-mate synthase (GLU1/Fd-GOGAT) expression in Arabidopsis. PLos ONE. 2011;6(11):e26765.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSHI Junna, LIU Meiqin, SHI Jing, et al. Sequence analysis and expression pattern of \u003cem\u003eAmZFPG\u003c/em\u003e encoding a GATA type zinc finger protein in \u003cem\u003eAmmopiptanthus mongolicus\u003c/em\u003e[J]. Journal of Beijing Forestry University. 2011;33(3):21\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHEN Hongfei. Genome-wide identification, phylogenetic evolution and expression analysis of \u003cem\u003eCCO\u003c/em\u003e and \u003cem\u003eGATA\u003c/em\u003e gene families in apple[D]. Yangling: Northwest A\u0026amp;F University. 2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng X J, Wu Q Q, Teng L H, et al. Transcriptional regulation of the paper mulberry under cold stress as 16revealed by a comprehensive analysis of transcription factors[J]. BMC Plant Biology. 2015;15:108.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReyes Jos\u0026eacute; C, Muro- Pastor M Isabel, Florencio Francisco J. The GATA family of transcription factors in \u003cem\u003eArabidopsis\u003c/em\u003e and rice.[J]. Plant Physiology. 2004;134(4):1718\u0026ndash;1732.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAO Tao, LIAO Xiaojia, XU Wei, et al. Identification and characterization of \u003cem\u003eGATA\u003c/em\u003e gene family in castor bean (\u003cem\u003eRicinus communis\u003c/em\u003e)[J]. Plant Diversity and Resources. 2015;37(4):453\u0026ndash;462.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao M X, Zhou G Y, Ding Y Q, Li K Y, Ren M J. Identification and expression p-attern analysis of sorghum GATA transcription factor family[J]. Molecular Plant Breeding.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan Q, Zhang C L, Zhao T T, et al. Bioinformatics analysis of GATA transcripti-on factor in pepper[J]. ChineseAgricultural Science Bulletin. 2017;33(17):24\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHU B, JIN J, GUO A Y, et al. GSDS 2.0: An upgraded gene feature visualization server[J]. Bioinformatics. 2015;31(8):1296\u0026ndash;1297.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBAILEY T L, BODEN M, BUSKE F A, et al. MEME SUITE: Tools for motif disc-overy and searching[J]. Nucleic Acids \u0026iuml;\u0026frac14;\u0026sup2;es. 2009; 37:W202-W208.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo Y, Wang Y C, Wang W P, et al. Bioinformatics analysis of GATA gene family in rice[J]. Molecular Plant Breeding. 2018;16(17):5514\u0026ndash;5522.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan Q. Whole-genome mining of GATA transcription factor from tomato and screening of resistance-related genes[D]. Harbin: Northeast Agricultural University.2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShokrollahi B, Baneh H. (Co) variance components and genetc parameters for growth traits in Arabi sheep using different animal models[J]. Genetics and Molecular Research. 2012;(1):305\u0026ndash;314.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAn Y, Han X, Tang S, et al. Poplar GATA transcription factor PdGNC is capable of regulating chloroplast ultrastructure, photosynthesis, and vegetative growth in Arabidopsis under varying nitrogen levels[J]. Plant Cell. Tissue and Organ Culture. 2014;119(2):313\u0026ndash;327.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKiba T, Naitou T, Koizumi N, et al. Combinatorial microarray analysis revealing Arabidopsis genes implicated in cytokinin responses through the His\u0026rarr;Asp phosphorelay circuitry[J]. Plant and Cell Physiology. 2005;46(2):339\u0026ndash;355.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaito T, Kiba T, Koizumi N, et al. Characterization of a unique GATA family gene that responds to both light and cytokinin in Arabidopsis thaliana[J]. Bioscience, Biotechnology, and Biochemistry. 2007;71(6):1557\u0026ndash;1560.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMara C D, Irish V F. Two GATA transcription factors are downstream effectors of floral homeotic gene action in Arabidopsis[J]. Plant Physiology. 2008;147(2):707\u0026ndash;718.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu P P, Koizuka N, Martin R C, et al. The BME3 (Blue Micropylar End 3) GATA zinc finger transcription factor is a positive regulator of Arabidopsis seed germination[J]. The Plant Journal. 2005;44(6):960\u0026ndash;971.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang X.Y., Chao D.Y., Gao J.P., Zhu M.Z., Shi M., and Lin H.X., A previously u-nknown zine finger protein, DST, regulates drought and salt tolerance in rice via stomatal aperture control. Genes Dev. 2009;23(15):1805\u0026ndash;1817.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu S.G., Zhang T.Y., Yang S.M., Song L., and Zhao D.G.. Genome-wide identification and bioinformatics analysis of TALE transcription factor family in \u003cem\u003eLotus japonicus\u003c/em\u003e, Zhiwu Yichuan Ziyuan Xuebao (Journal of Plant Genetic Resources). 2019;20(2):466\u0026ndash;475.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDr\u0026ouml;ge-Laser W., Sniek B.L., Berend S., and Weiste C.. The Arabidopsis bZIP transcription factor family-an update, Curr. Opin Plant Biol. 2018;45:36\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Wheat, GATA gene family, Bioinformatics, Abiotic stress, Expression analysis","lastPublishedDoi":"10.21203/rs.3.rs-1963114/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1963114/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eGATA gene family is a transcription factor in eukaryotes, which plays an important role in plant growth and development, cell differentiation, decomposition and apoptosis, and plant response to environmental changes. However, no genome-wide analysis of this gene family has been reported in wheat.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eIn this study, 79 members of wheat GATA family were identified based on wheat genome information and named \u003cem\u003eTaGATA01\u003c/em\u003e ~ \u003cem\u003eTaGATA79\u003c/em\u003e. The gene structure, phylogeny, chromosome distribution, physical and chemical properties, conserved motifs and cis-acting elements of TaGATA family members were systematically analyzed by bioinformatics methods. The results showed that TaGATA family members encoded 146 ~ 499 amino acids, with isoelectric points ranging from 4.76 to 10.12 and instability index ranging from 41.99 to 86.02, which were all unstable proteins; Phylogenetic tree results showed that 79 TaGATA transcription factors were divided into six subfamilies, and members of the same subfamily had highly similar gene structure; MG2C was used to analyze the chromosomes, and it was found that TaGATA family members were unevenly distributed on 21 chromosomes; Plant CARE was used to identify 10 Plant hormone-related elements and 4 stress-related elements, among which \u003cem\u003eTaGATA12\u003c/em\u003e contained the most cis-acting elements and \u003cem\u003eTaGATA55\u003c/em\u003e contained the least cis-acting elements. qRT-PCR was used to analyze the expression levels of 23 TaGATA genes in different tissues and different abiotic stresses. It was found that most of the genes were highly expressed in stem, but few in panicle; Most genes were up-regulated under ABA stress and some genes were down-regulated under low temperature stress.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eIt was found that GATA transcription factors may be involved in the regulation of low temperature, drought and other stress responses of wheat, and play an important role in plant response to abiotic stress. This study analyzed the bioinformatics characteristics of each member of wheat GATA family and laid a theoretical foundation for the subsequent research on its functions.\u003c/p\u003e","manuscriptTitle":"Genome-wide identification and expression analysis of GATA gene family in wheat","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-08-22 17:09:00","doi":"10.21203/rs.3.rs-1963114/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a17fe108-0833-4170-b756-96ac00612807","owner":[],"postedDate":"August 22nd, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-09-26T05:29:12+00:00","versionOfRecord":[],"versionCreatedAt":"2022-08-22 17:09:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1963114","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1963114","identity":"rs-1963114","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-29T02:00:03.542394+00:00
License: CC-BY-4.0