Mechanism by which the inhibition of glycolysis by sodium butyrate alleviates liver injury in subchronic fluoride-exposed mice

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Aim At present, liver injury caused by fluoride exposure has been found in animals and humans, but there is a lack of relevant drug treatments and research on the corresponding underlying mechanisms. Sodium butyrate is a new drug used to improve glucose metabolism that has been shown to have a positive effect on liver injury, but it has not been extensively studied in the field of liver injury caused by fluoride exposure. Therefore, in this study, exposure to fluoride in drinking water was used to establish a subchronic fluoride exposure mouse model to explore the specific metabolism-related mechanism by which sodium butyrate alleviates subchronic fluoride exposure-induced liver injury in mice to provide a theoretical basis for the prevention and treatment of endemic fluoride exposure-related liver injury. Materials and methods In the present study, the mice were randomly allocated into four groups of ten mice each group: the control group, the fluorine exposure group (NaF), the sodium butyrate group (NaB), and the treatment group (NaF + NaB). Key findings: NaF-induced hepatic injury was confirmed by alterations in the levels of liver enzymes (ALT and AST), glucose and the glycolytic metabolite lactate and alterations in the protein and mRNA expression levels of ALDOA, PKM2, PFKp, PGK1 and LDH. Concurrent administration of sodium butyrate and NaF significantly reversed the alterations in the abovementioned parameters.
Full text 124,090 characters · extracted from preprint-html · click to expand
Mechanism by which the inhibition of glycolysis by sodium butyrate alleviates liver injury in subchronic fluoride-exposed mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mechanism by which the inhibition of glycolysis by sodium butyrate alleviates liver injury in subchronic fluoride-exposed mice Zimei Wu, Cuijing Su, Zhiyu Ma, Nan Yan, Funing Liu, Xin Li, Jiayi Chen, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4563409/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aim At present, liver injury caused by fluoride exposure has been found in animals and humans, but there is a lack of relevant drug treatments and research on the corresponding underlying mechanisms. Sodium butyrate is a new drug used to improve glucose metabolism that has been shown to have a positive effect on liver injury, but it has not been extensively studied in the field of liver injury caused by fluoride exposure. Therefore, in this study, exposure to fluoride in drinking water was used to establish a subchronic fluoride exposure mouse model to explore the specific metabolism-related mechanism by which sodium butyrate alleviates subchronic fluoride exposure-induced liver injury in mice to provide a theoretical basis for the prevention and treatment of endemic fluoride exposure-related liver injury. Materials and methods In the present study, the mice were randomly allocated into four groups of ten mice each group: the control group, the fluorine exposure group (NaF), the sodium butyrate group (NaB), and the treatment group (NaF + NaB). Key findings: NaF-induced hepatic injury was confirmed by alterations in the levels of liver enzymes (ALT and AST), glucose and the glycolytic metabolite lactate and alterations in the protein and mRNA expression levels of ALDOA, PKM2, PFKp, PGK1 and LDH. Concurrent administration of sodium butyrate and NaF significantly reversed the alterations in the abovementioned parameters. fluoride exposure glycolysis sodium butyrate liver injury Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Fluorine is a naturally occurring element found in soil, water, food materials and natural minerals, where it occurs along with other elements in the form of fluoride compounds [ 1 ] . Excessive exposure to fluoride is an industrial, food, water and geological factor affecting the health of millions of people around the world. According to World Health Organization (WHO) standards, long-term excessive exposure to more than 1.5 mg/L fluoride can cause fluorosis in humans, characterized by dental fluorosis, skeletal fluorosis, and lesions in the liver and other organ [ 2 – 4 ] . At present, the abundance of fluorine in the environment and drinking water is the main cause of fluorosis. Fluorosis is a serious public health problem in 24 countries, including China [ 5 – 7 ] . Testing of samples from rural areas in various regions of the world show that the fluoride concentration in 80% of villages exceeds the limits allowed by the World Health Organization (WHO). People living in these areas are affected by skeletal fluorosis, and fluorosis occurs in most parts of Africa and Asia, affecting approximately 10 billion people [ 8 , 9 ] . China seriously affected by fluorosis, and with the exception of Shanghai and Hainan, all other provinces have reported this disease [ 10 – 12 ] . The government has attempted to educate the public to raise awareness of the dangers of fluorosis and the importance of drinking safe water, contacting the affected patients by public health personnel through routine investigations, developing a range of antioxidant drugs, and implementing various mitigation programs and strategies around the world. However, the threat of fluorosis has not yet been eradicated, and there is currently no specific treatment [ 13 ] . Fluorosis can be divided into dental fluorosis, skeletal fluorosis and nonskeletal fluorosis. In the past, our research on fluorosis has focused mainly on skeletal tissues [ 14 , 15 ] , but in recent years, as research has progressed, the research focus has gradually shifted to nonskeletal tissues [ 16 , 17 ] . Epidemiological investigations and in vivo and in vitro studies based on fluoride have also confirmed that fluoride can not only cause bone damage but also cause nonskeletal damage involving the cardiovascular system, nervous system, liver and kidney function, reproductive system, thyroid function, glucose homeostasis, and immune system [ 18 ] . The liver is the most important organ for detoxification, and it is also the most susceptible to the infiltration and accumulation of toxic agents. According to a Mexican cohort study, water fluoridation levels above 2.0 mg/L can lead to impaired liver function in children [ 19 ] . An animal study showed that excessive fluoride exposure results in changes in the expression of clinical indicators in the liver, such as hepatic enzymes (alanine aminotransferase (ALT) and aspartate transaminase (AST)) [ 20 ] . Another study involving American adolescents suggested that fluoride exposure might lead to aberrant changes in parameters related to liver function in adolescents [ 21 ] . In January 2019, Li et al. conducted an occupational health survey for 677 workers in a fluorine chemical enterprise in Hunan Province. The duration of fluoride exposure in patients with occupational chronic fluorosis was strongly correlated with the detection rate of fatty liver [ 22 ] . In an animal study, low fluoride concentrations (15 mg/L NAF-RRB) led to decreased levels of glutathione (GSH) and glutathione S-transferase (GST) activity, decreased malondialdehyde (MDA) production, and abnormal changes in liver function in mice; furthermore, severe structural changes in the liver were detected [ 23 ] . Therefore, the study of fluorine-induced liver damage has theoretical and practical significance. The liver is the largest detoxifying organ, but it is also involved in the regulation of energy metabolism. The liver is a hub for the metabolism of various substances and plays a major role in metabolic homeostasis, and glycolysis, gluconeogenesis, lipogenesis, and glycogen production can all be carried out in the liver [ 24 , 25 ] . As a result, liver disease can lead to systemic metabolic disorders. A study of healthy subjects in urban Japan showed that slightly elevated serum fluoride levels inhibited insulin secretion and increased glucose levels [ 26 ] , suggesting that fluoride affects glucose homeostasis even at low fluoride concentrations. The liver regulates glucose dynamics to maintain glucose homeostasis for energy [ 27 ] . Metabolomics revealed significant changes in pathways related to hepatic energy metabolism after fluoride exposure [ 28 ] . Glycolysis is an important metabolic methods that converts glucose into pyruvate under the gradual catalysis of hexokinase (HK), phosphofructokinase (PFK), pyruvate kinase (PKM) and other enzymes. The converted pyruvate can be oxidized and decomposed into acetyl-CoA by pyruvate dehydrogenase (PDH) through the mitochondrial tricarboxylic acid cycle or converted into lactic acid by lactate dehydrogenase (LDH) through the glycolysis pathway when the oxygen supply of the cell is insufficient. Compared with oxidative phosphorylation, aerobic glycolysis has a low energy supply efficiency. A molecule of glucose can only produce 2 ATP molecules, but the glucose metabolism rate is 100 times that of oxidative phosphorylation. Therefore, under certain pathological conditions, cells cannot effectively use oxidative phosphorylation to produce ATP, but glycolysis can ensure short-term energy needs by consuming a large amount of glucose [ 27 , 29 , 30 ] . Moreover, changes in glycolysis are found in many liver diseases. The glycolytic activity of hepatic stellate cells in the fibrotic liver is greater than that of hepatic stellate cells in the healthy liver [ 31 ] . In hepatocellular carcinoma, elevations in aerobic glycolysis and decreases in oxidative phosphorylation can lead to the development of cancer [ 30 ] . In patients with nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH), glycolysis is markedly increased in hepatocytes, lactate production is increased, the tricarboxylic acid (TCA) cycle is inhibited, and mitochondrial respiration is reduced, which can exacerbate disease progression [ 32 , 33 ] . Similar metabolic changes are present in steatotic hepatocytes. Compared with mice fed conventional food, mice fed a high-fat diet have significantly increased mRNA levels of key glycolytic enzymes (HK2, PFK, and PKM) in their livers [ 34 ] . Given the importance and complexity of liver glycolysis, it is reasonable to study the metabolic profile of the liver under both healthy and pathological conditions. We hypothesize that fluorine-induced liver damage may be related to the glycolytic pathway. Sodium butyrate (NaB) is a type of short-chain fatty acid (SCFA) in the butyrate family that is produced by microbial fermentation of dietary fiber in the lower intestinal layer [ 35 ] . NaB has attracted extensive attention due to its antioxidant, immunomodulatory, and anticancer effects [ 36 , 37 ] . In recent years, with the introduction of the gut-liver axis theory, a variety of intestinal microbes have been shown to affect the development and progression of liver metabolic diseases through the gut-liver axis to alter energy absorption, regulate metabolism, and change intestinal permeability [ 38 – 40 ] . Sodium butyrate can participate in gene regulation, immune regulation, intestinal barrier function regulation, oxidative stress and other physiological activities in vivo. It can also reduce obesity and insulin resistance induced by a high-fat diet in mice and play important roles in the prevention and alleviation of the occurrence and development of metabolic-associated fatty liver disease (MAFLD) [ 41 ] . However, the effect of sodium butyrate on fluoride-induced liver injury has not been reported. In addition, Xing et al. noted that sodium butyrate regulates energy metabolism and mitochondrial function, inhibits glycolysis, enhances the tricarboxylic acid cycle and oxidative phosphorylation, and increases the activity of antioxidant enzymes, thereby promoting cell survival [ 42 ] . In hepatocellular carcinoma, sodium butyrate can inhibit the expression of HK2, downregulate aerobic glycolysis, inhibit the production of lactate, glucose and lactate in hepatocellular carcinoma cells, and induce apoptosis through the c-myc pathway. In the case of damage to various organs, such as the brain [ 43 ] , lung [ 44 ] , intestine [ 45 , 46 ] , and liver [ 47 ] , sodium butyrate has been shown to alleviate organ abnormalities by regulating the glycolytic pathway. Therefore, sodium butyrate may be a promising molecule for the prevention and treatment of glucose metabolism disorders. However, the effect of sodium butyrate on fluorine-induced liver injury related to the glycolytic pathway has not been studied. In summary, based on the results of fluorosis-related studies, this study speculated that abnormal glycolysis is another important pathogenic factor of liver injury caused by fluoride exposure. In this study, a mouse model of subchronic fluoride exposure was treated with sodium butyrate, and relevant techniques, such as HE histopathological staining, biochemical kit detection, RT‒qPCR, and Western blotting, were used to study the glycolysis-related effects of sodium butyrate on liver injury in mice subjected to subchronic fluoride exposure. To further reveal the underlying mechanisms of fluoride-induced liver injury, we aimed to provide a new prevention and treatment strategy or approach for liver injury caused by endemic fluorosis. 2. Materials and methods 2.1. Chemicals NaB and sodium fluoride (NaF) were purchased from Sigma (USA) and were of analytical grade. The ionometer and total ion concentration buffer were obtained from Leici Instrument (Shanghai, China). The BCA Protein Assay Kit was purchased from Dingguochangsheng Biotechnology (Shenyang, China). PDH, MDH and ALDOA were used for Western blot analysis and were obtained from CST (USA). LDH and PKM were obtained from Wanleibio (Shenyang, China), and β-actin was purchased from Abclone (Wuhan, China). The PCR kit was obtained from Vazyme (China). 2.2. Animals Forty mice (four weeks old) of the SPF-grade ICR line were obtained from Liaoning Changsheng Biotechnology Co., Ltd., for experimental purposes. The animals were fed in plastic cages under standard laboratory conditions (12 h light/dark cycle, 24 ± 2°C and 55 ± 5% humidity). The mice were provided a commercial chow diet and water ad libitum. All procedures relating to animals were approved by The Animal Research Association (SYYXY2021031502) of Shenyang Medical College. 2.3. Experimental design The animals were randomly allocated into four groups of ten mice per group. In Group I (control), distilled water was given orally for 3 months. After 3 months, 1000 mg/kg normal saline was given orally by gavage for 8 weeks. In Group II (NaF), 100 mg/l NaF was added to the drinking water, and the mice were allowed to acclimate for 3 months. After 3 months, 1000 mg/kg normal saline was given orally by gavage for 8 weeks. In Group III (NaB), distilled water was given orally for 3 months. After 3 months, 1000 mg/kg NaB was given orally via gavage for 8 weeks. In Group IV (NaF + NaB), 100 mg/l NaF was added to the drinking water, and the animals were allowed to acclimate for 3 months. After 3 months, 1000 mg/kg NaB was given orally via gavage for 8 weeks. 2.4. Fluoride ion selective electrode method The mice were placed in a metabolic cage and deprived of water for 24 hours to collect urine. Subsequently, the mice were euthanized by cervical dislocation, and blood was collected retro-orbitally. Blood samples were centrifuged (3000 rpm, 10 min) to obtain serum. The ionometer (Leici Instrument, Shanghai, China) was calibrated with standard solutions of different concentrations of uranium. The sample and total ion concentration buffer (Leici Instrument, Shanghai, China) were added at a ratio of 1:1, and the mixture was placed under a Uoride ion meter for 30 seconds to measure the mean concentration. 2.5. HE staining Hematoxylin-eosin (HE) was used to detect alterations in liver morphology. First, the mice were sacrificed. Then, the liver was quickly removed, fixed in 4% paraformaldehyde, washed, dehydrated, hyalinized, embedded, and sliced into 5 µm paraffin sections. The sections were stained with HE and then sealed with neutral resin. Liver morphology damage was observed with an ordinary microscope. 2.6. AST and ALT kit tests Liver functionality was assessed by detecting the levels of AST and ALT in the serum and liver. The blood sample was centrifuged for 5 min (4°C, 6000 rpm), and the supernatant was collected to obtain the serum. The liver was washed with PBS, wiped dry with filter paper, and homogenized in PBS. The homogenate was centrifuged at 12000 rpm and 4°C, after which the supernatant was collected. The levels of AST and ALT in the serum and liver homogenate supernatants were detected by following the protocols of commercial detection kits. 2.7. Glucose kit and lactate content kit test The tissue samples were accurately weighed, and normal saline was added at a weight (g):volume (mL) ratio of 1:9. The samples were mechanically homogenized in an ice water bath at 2500 rpm/min and centrifuged for 10 minutes, after which the amount of supernatant (10% homogenate) was determined. The supernatant of the 10% homogenate was diluted to different concentrations with normal saline, and the preexperiment was performed according to the operation table. A concentration of absolute OD between 0.05 and 0.35 was selected as the best sampling concentration. 2.8. Western blotting analysis Colonic proteins were extracted using 1 mM RIPA buffer (Dingguochangsheng Biotechnology, Shenyang, China) and PMSF (Dingguochangsheng Biotechnology, Shenyang, China) supplemented with phosphatase inhibitors. Using the BCA Protein Assay Kit, (Dingguochangsheng Biotechnology, Shenyang, China) the protein concentration was measured. After 30–40 mg of protein sample was denatured, proteins of varying molecular weights were separated via SDS‒PAGE according to the manufacturer’s directions (Dingguochangsheng Biotechnology, Shenyang, China). The protein extract was transferred to PVDF membranes (Millipore, Billerica, MA, USA), and then, the membranes were incubated in a 5% skim milk powder solution at 37°C for 2 h. TBST-diluted primary antibodies against LDH (1:500, Wanleibio, Shenyang, China), PDH (1:1000, CST, MA, USA), MDH (1:1000, CST, MA, USA), ALDOA (1:1000, CST, MA, USA), PKM (1:1000, Wanleibio) and β-actin (1:5000, Abclone, Wuhan, China) were used. The membrane was incubated with primary antibody at 4°C for 12 h and then incubated with goat anti-rabbit IgG and HRP secondary antibodies (1:6000, Wuhan, Abclone). ImageJ 1.4 (Bethesda, Maryland, USA) was used to analyze the signal strength. 2.9. Gene expression analysis The liver tissues of each group of mice were collected separately. Total RNA was extracted by the TRIzol method and reverse transcribed to cDNA. Fructose diphosphate aldolase A (ALDOA), M2-type pyruvate kinase (PKM2), lactate dehydrogenase (LDH), platelet-type phosphofructokinase (PFKp), pyruvate dehydrogenase (PDH), and malate dehydrogenase 2 (MDH2) transcript levels were detected in the liver by real-time fluorescence quantitative PCR. The primers used are shown in Table 1 . Table 1 Sequences of Primers used for real-time PCR Gene Forward primer Reverse primer PKM2 GCTCTAGGTATCGCAGCAGG TCAGCCGAGCCACATTCATT PFKp CCCATGGTTATGGTTCCTGCT GGTCGCACGTGTCTGTGATA PDH AAGCTCTCTGTCGGTTCCCA TCGTTTCCTTTTCACAGCACAT LDH GCTTCCATTTAAGGCCCCGC GGTCCTTGAGGGTTGCCATC ALDOA CAGCTGAATAGGCTGCGTTC GGTGGCAGTGCTTTCCTTTC MDH2 GCATCATTGCCAACCCAGTG CCACAAACGTGTTCGCTCTG 2.10. Statistical analysis All values are expressed as the mean ± standard error of the mean (SEM). Multiple comparisons were carried out using one-way ANOVA followed by Tukey's post hoc test in GraphPad Prism 8.0. A p value less than 0.05 was considered to indicate statistical significance. 3. Results 3.1 Establishment of a mouse model of fluoride exposure 3.1.1 Mouse body weight and liver parameters After chronic fluoride exposure for 5 months, the mice in the NaF group exhibited obvious disorderly fur, loss of appetite, and lethargy, and the mice in the control and NaB groups exhibited smooth hair, a good appetite, and a quick response. Moreover, as shown in Fig. 1.1 and Table 1.1 , compared with those in the control and NaB groups, the body weights and liver indices of the mice in the NaF group were decreased to varying degrees (p < 0.05, p < 0.01). With the intervention of sodium butyrate, the body weight and liver coefficient of the mice in the NaF + NaB group were restored to a certain extent (p < 0.05, p < 0.01). Table 1.1 Body weight and liver coefficient Group Body weight (g) Liver coefficient (%) Control 47.73 ± 1.742 5.89 ± 0.214 NaB 47.06 ± 2.111 5.66 ± 0.390 NaF 40.98 ± 3.074** 4.94 ± 0.849* NaF + NaB 45.88 ± 0.744# 5.84 ± 0.326# The data are expressed as the mean ± SEM. * p < 0.05, ** p < 0.01 vs. Control mice; # p < 0.05, ## p < 0.01 vs. NaF mice. 3.1.2 Concentration of fluoride ions in serum and urine To investigate whether 12 weeks of fluoride exposure resulted int the accumulation of fluoride in mice, the fluoride ion concentration in the serum and urine was measured by the fluoride ion selective electrode method. As shown in Table 1.2 , there was no significant difference in the fluoride content between the control group and the NaB group. Compared with those in the control group, the serum fluoride concentration and urine fluoride concentration in the NaF group were significantly greater, suggesting that the metabolic rate of the mice was greater (p < 0.01). Compared with those in the NaF group, the serum fluoride concentration and urine fluoride concentration in the NaF + NaB group were significantly lower (p < 0.01). Thus, the mouse model of subchronic fluoride exposure was successfully treated with sodium butyrate. Table 1.2 Concentration of fluoride ions in the serum and urine of mice Group Serum fluoride concentration (mg/L) Urine fluoride concentration (mg/L) Control 0.167938 ± 0.001 1.587438 ± 0.089 NaB 0.171 ± 0.001 1.490875 ± 0.103 NaF 0.236 ± 0.003** 9.794125 ± 0.163** NaF + NaB 0.177938 ± 0.003## 6.526063 ± 0.151## The data are expressed as the mean ± SEM. * p < 0.05, ** p < 0.01 vs. Control mice; # p < 0.05, ## p < 0.01 vs. NaF mice. 3.2 Sodium butyrate attenuates liver damage in fluoride-exposed mice 3.2.1 Serum and liver transaminase levels in mice A preliminary exploration of the effect of sodium butyrate on the liver of fluorotic mice was performed by measuring the levels of ALT and AST in serum and liver tissue homogenates. As shown in Fig. 2.1 , compared with those in the control group, the serum and liver ALT and AST levels in the mice in the fluorosis group were significantly greater (p < 0.05). In contrast, the ALT and AST levels in the liver and serum were significantly decreased after sodium butyrate treatment (p < 0.05, p < 0.01). These results indicate that NaF can cause liver damage and that sodium butyrate can alleviate liver damage. (A&B) Sodium butyrate attenuates hepatic AST and ALT levels in fluoride-exposed mice. (C&D) Sodium butyrate attenuates serum AST and ALT levels in fluoride-exposed mice. The data are expressed as the mean ± SEM. * p < 0.05, ** p < 0.01 vs. Control mice; # p < 0.05, ## p < 0.01 vs. NaF mice. 3.2.2 Mouse Pathology via H&E Staining To further assess liver injury caused by subchronic fluoride exposure, H&E staining was used to evaluate liver morphological changes. As shown in Fig. 2.2 , the liver tissue structure of the control and NaB groups was normal, with liver cells arranged tightly and neatly in a radial shape and no vacuoles in the cells. After three months of NaF exposure, the arrangement of liver cells was relatively disordered, with inflammatory cell infiltration and a large amount of vacuolar steatosis. The inflammatory infiltration symptoms in the sodium butyrate intervention group were alleviated compared to those in the fluoride-exposed group, and the liver cells were arranged neatly with a small amount of fat vacuoles visible. These findings indicate that sodium butyrate can alleviate liver damage caused by long-term excessive fluoride exposure. (B) the sodium butyrate-treated group, (C) the fluoride-exposed group, and (D) the fluoride-exposed and sodium butyrate-treated group 3.3 Effect of sodium butyrate on glycolysis-related metabolic enzymes in fluoride-exposed mice ALDOA, PKM2 and PFKp are the predominant glycolysis-related metabolic enzymes involved in the conversion of glucose to pyruvate, and LDH promotes anaerobic glycolysis. We performed WB, and the results are shown in Fig. 3.1 A-C. The expression levels of ALDOA, PKM2, PFKp and LDH in the NaF group were significantly increased (p < 0.05, p < 0.01). In contrast, the expression of histones in the treatment group was significantly decreased (p < 0.05, p < 0.01) (Fig. 3.1 ). In addition, in the NaF group, the RT‒qPCR results indicated that the ALDOA, PKM2, PFKp and LDH mRNA levels in the NaF group were significantly greater than those in the control group (p < 0.05, p < 0.01), and the ALDOA, PKM2, PFKp and LDH mRNA levels in the treatment group were significantly lower than those in the NaF group (p < 0.05, p < 0.01). 3.4 Effect of sodium butyrate on liver function in fluoride-exposed mice The results revealed that relative to those of control mice, the glucose level and the glycolytic metabolite lactate level in the NaF group were significantly increased (p < 0.05, p < 0.01). These findings indicate that fluorine could inhibit glucose uptake, thus elevating the glucose and lactate levels in the tissues (Fig. 4.1 ). In contrast, treatment with sodium butyrate resulted in an increase in inhibited glucose uptake capacity and a significant decrease in lactate levels (p < 0.05, p < 0.01). butyrate enhances glucose uptake in the livers of fluoride-exposed mice. (B) Sodium butyrate reduces lactate levels in the livers of fluoride-exposed mice. The data are expressed as the mean ± SEM. * p < 0.05, ** p < 0.01 vs. Control mice; # p < 0.05, ## p < 0.01 vs. NaF mice. 3.5. Effect of sodium butyrate on TCA cycle-related enzymes in fluoride-exposed mice After the conversion of glucose to pyruvate, pyruvate conversion is catalyzed by PDH and MDH oxidative phosphorylation-related enzymes in the TCA cycle to produce energy. Both the WB and RT‒qPCR results indicated that the gene and protein expression levels of TCA cycle-related enzymes in the NaF group were significantly lower than those in the control group (p < 0.05, p < 0.01). In contrast to those in the NaF group, the gene and protein expression levels of TCA cycle-related enzymes in the treatment group were significantly elevated (p < 0.05, p < 0.01) (Fig. 5.1 ). These results suggest that sodium butyrate can increase the abnormal decrease in liver oxidative phosphorylation levels caused by fluoride exposure in mice. Discussion The toxic effects of fluoride are a major public health problem worldwide; these effects can cause dental fluorosis, skeletal fluorosis, and hepatotoxicity [ 29 ] . The liver is an important target organ for fluorosis [ 30 ] . Previous studies have shown that liver disease is associated with abnormal glucose metabolism [ 31 ] , and sodium butyrate, a drug that regulates glucose metabolism, can also alleviate liver damage caused by various factors. However, this phenomenon has not been addressed in the field of fluoride-induced liver injury. Therefore, in this study, a mouse model of fluorosis was treated with sodium butyrate, and sodium butyrate treatment alleviated liver injury in fluoride-exposed mice through the glycolytic pathway. Blood fluoride and urine fluoride levels in mice are important indicators for determining the success of fluoride-exposed models. In this study, the amount of fluoride in the blood and urine increased significantly after fluoride exposure, indicating that the fluoride exposure model was successfully established. The liver is the largest detoxification organ in the human body, and fluoride, an exogenous poison, accumulates most frequently in the liver. The organ coefficient is a commonly used indicator of tissue damage. In this study, we measured the liver organ coefficient after fluoride exposure, and the results showed that the liver organ coefficient decreased significantly. These findings suggest liver damage after fluoride exposure, and the liver is one of the important target organs of fluorosis. Studies have confirmed that fluorine can accumulate in the liver and cause structural and functional damage. Li et al. reported that sodium fluoride can cause morphological and pathological changes in the liver, which are manifested by irregular arrangement of hepatocytes, vacuolar degeneration, nuclear condensation, and lysis [ 32 ] . Similar to the above studies, Yu et al. demonstrated that fluoride exposure aggravates pathological damage and fibrosis in liver tissue and increases the presence of ALT and AST in the liver and blood [ 33 ] . When the liver is damaged, the aminotransferases in the liver are released into the blood, and the levels of ALT and AST in the blood increase, indicating liver damage [ 34 ] . Moreover, sodium butyrate is highly important for liver protection. Studies have confirmed that coated sodium butyrate (CSB) enhances liver antioxidant function in chickens and has a positive effect on preventing liver injury and alleviating lipid accumulation and inflammation [ 35 ] . Sodium butyrate can attenuate hepatic oxidative stress and inflammatory responses through NR4A2-mediated histone acetylation, effectively reversing liver injury caused by deoxynivalenol (DON) [ 36 ] . It has also been shown that butyrate supplementation can improve fetal liver damage caused by a high-fat diet [ 37 ] . Similar to the above results, in this study, the histopathological structure of the liver was damaged after fluoride exposure, and the levels of AST and ALT in the liver were significantly increased compared with those in the control group. These conditions were significantly improved after sodium butyrate treatment, suggesting that the liver was damaged after fluorosis and that sodium butyrate was beneficial for alleviating the damage. Glycolysis is the process by which one molecule of glucose is metabolized in the cytoplasm to produce two molecules of pyruvate, two molecules of NADH and two molecules of adenosine triphosphate (ATP). Glycolysis is a key pathway of cellular glucose metabolism, providing an intermediate product for energy production, and its rate is mainly regulated and controlled by hexokinase (HK), phosphofructokinase (PFK), pyruvate kinase (PK), and lactate dehydrogenase (LDH). Aldolase A (ALDOA) is an enzyme that plays an important role in glycolysis and gluconeogenesis. Pyruvate kinase (PK) and phosphoglycerate kinase 1 (PGK1) are the only two ATP-producing enzymes. Studies have shown that inhibition of the glycolysis-related genes PGK1 and ALDOA regulates Th17 cell metabolism [ 38 ] . PDH is an important regulatory enzyme that catalyzes the conversion of pyruvate to acetyl-CoA and links anaerobic glycolysis to the TCA cycle [ 39 ] , which is the same negative regulatory enzyme of glycolysis as MDH. Recent studies have shown that inhibition of PDH can modulate metabolic flux through the TCA cycle and reduce glucose utilization [ 40 ] . Alterations in liver metabolism are essential for the development of liver disease, and abnormal changes in glycolysis are present in many diseases. The high and low expression of HK1, PFKp and PKM2, which are the three rate-limiting enzymes of glycolysis, and PDH and MDH, which are the negative regulators of glycolysis, can indicate the development of abnormalities in the metabolism of glycolysis or oxidative phosphorylation to a certain extent, and these alterations promote the progression of the disease. Similar to the previous finding of an imbalance between glycolysis and oxidative phosphorylation in liver disease, our experimental results showed that the expression of glycolysis-related proteins was upregulated in fluoride-exposed livers and significantly downregulated after sodium butyrate treatment. The expression of PDH and MDH was downregulated in the livers of fluoride-exposed mice and upregulated after sodium butyrate treatment. Intrahepatic glucose metabolism in fluoride-exposed individuals mice is more likely to involve glycolysis rather than oxidative phosphorylation for energy. In normal tissues, 90% of ATP is derived from oxidative phosphorylation and 10% of ATP is derived from glycolysis. In contrast, in fluoride-exposed livers, tissues use glycolysis rather than oxidative phosphorylation to produce energy. This may be due to external stimuli, decreased oxidative phosphorylation capacity, insufficient energy supply, or damage to liver tissue, so the body compensates by increasing the level of glycolysis to produce a large amount of ATP to meet the body's energy needs. Glucose is the raw material of glycolysis, and lactic acid is the final product of glycolysis. Thus, the determination of glucose and lactate levels can further indicate the therapeutic effect of glycolysis in fluoride-exposed livers treated with sodium butyrate. Previous studies have shown that the Warburg effect in tumor cells is manifested by enhanced aerobic glycolysis and lactate production [ 41 ] . Lactate production in fatty liver tissue is significantly greater than that in normal liver tissue. Moreover, increased lactate not only worsens steatosis but also increases acetylation of histone H3K9 by decreasing the activity of nuclear histone deacetylase (HDAC), further aggravating the disease [ 42 , 43 ] . Studies have confirmed that sodium butyrate can downregulate aerobic glycolysis, inhibit the production of glucose and lactate in hepatocellular carcinoma cells, and inhibit the expression of HK2, downregulating aerobic glycolysis and cell proliferation in hepatocellular carcinoma [ 44 ] . Other studies have shown that butyrate plays an important role in inhibiting lactate release and reducing the threshold concentration of lactate utilization [ 45 ] , and changes in metabolite flux, particularly glucose uptake and the glycolytic pathway, can be observed with butyrate treatment [ 46 ] . Our experimental results showed that fluoride could increase lactate levels and reduce glucose levels in liver tissues, and sodium butyrate could alleviate the phenomenon of increased lactate levels and glucose consumption in fluorotic liver injury. According to biochemical detection and the expression of glycolysis-related enzymes at the protein and mRNA levels, sodium butyrate can inhibit the enhanced glycolytic ability and reduce the oxidative phosphorylation ability in fluorotic liver injury. Under normal conditions, oxidative phosphorylation is essential for energy production and cell survival, and many genes involved in oxidative phosphorylation are downregulated in chronic hepatitis [ 47 ] . Similarly, liver damage due to fluorosis results in abnormal metabolic changes, such as increased glycolytic capacity and decreased oxidative phosphorylation capacity. Sodium butyrate can inhibit the production of glucose and lactate, downregulate the expression of PGK1, PFKp, PKM2 and LDH, and increase the expression levels of PDH and MDH2, and these effects have a positive effect on alleviating liver damage caused by fluoride exposure. Conclusion The results of this study demonstrated that fluoride exposure can cause liver injury in mice, resulting in liver histopathological changes, increased intrahepatic aminotransferase levels, and abnormal intrahepatic metabolism. However, sodium butyrate can downregulate glycolysis, inhibit the production of glucose and lactate, significantly alleviate the above abnormalities, and protect the liver. Sodium butyrate has been shown to be a promising protective agent against fluoride-induced liver damage. Declarations Compliance with ethical standards The number of mice involved in this experiment and all the protocols were reviewed and approved by the Animal Use and Care Committee at Shenyang Medical College (protocol number: SYYXY2021031502), in accordance with the regulations and requirements of the Animal Ethics Committee and in accordance with the management regulations of experimental animals in Liaoning Province. Competing interests All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or nonfinancial interest in the subject matter or materials discussed in this manuscript. Funding Information This work was funded by the Basic Research Project of Liaoning Provincial Department of Education (JYTMS20231391) to Zhengdong Wang; This work was supported by Center Guiding Local Science and Technology Foundation of Liaoning Science and Technology Committee(2023JH6/100100021) to Fu Ren. Author Contribution All the authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Z.W, C. S, Z.M, N.Y, Z. W. The first draft of the manuscript was written by Z.W, F.L, X.L, J.C., Q.B, F.R, and all authors commented on previous versions of the manuscript. All the authors have read and approved the final manuscript. Acknowledgments Not applicable Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. References PRANESH MB, ARJUNDAS G (2019) Autopsy study of a case of skeletal fluorosis (1977) [J]. Neurol India 67(3):643–647 KURDI MS (2016) Chronic fluorosis: The disease and its anaesthetic implications [J]. Indian J Anaesth 60(3):157–162 MOHAMMADI A A, YOUSEFI M, YASERI M et al (2017) Skeletal fluorosis in relation to drinking water in rural areas of West Azerbaijan. Iran [J] Sci Rep 7(1):17300 BUZALAF M A R (2018) Review of Fluoride Intake and Appropriateness of Current Guidelines [J]. Adv Dent Res 29(2):157–166 Review of the Draft NTP Monograph (2020) Systematic Review of Fluoride Exposure and Neurodevelopmental and Cognitive Health Effects. Washington (DC) WEN C, ZHANG Q, XIE F et al (2022) Brick tea consumption and its relationship with fluorosis in Tibetan areas [J]. Front Nutr 9:1030344 ZHANG L, DONG D, LV S et al (2023) Spatial evolution analysis of groundwater chemistry, quality, and fluoride health risk in southern Hebei Plain, China [J]. Environ Sci Pollut Res Int 30(21):61032–61051 SAH O, ZOHOORI MAGUIREA (2020) Effect of altitude on urinary, plasma and nail fluoride levels in children and adults in Nepal [J]. J Trace Elem Med Biol 57:1–8 SOLANKI Y S AGARWALM, GUPTA A B et al (2022) Fluoride occurrences, health problems, detection, and remediation methods for drinking water: A comprehensive review [J]. Sci Total Environ 807(Pt 1):150601 YUN Z J, CHEN P Z, BIAN J C et al (2010) [Epidemiological investigation on endemic fluorosis along the Yellow River alluvial plain of Shandong province] [J]. Zhonghua Liu Xing Bing Xue Za Zhi 31(11):1280–1283 ZHU C, BAI G, LIU X et al (2006) Screening high-fluoride and high-arsenic drinking waters and surveying endemic fluorosis and arsenism in Shaanxi province in western China [J]. Water Res 40(16):3015–3022 SRIVASTAVA S, FLORA S J S (2020) Fluoride in Drinking Water and Skeletal Fluorosis: a Review of the Global Impact [J]. Curr Environ Health Rep 7(2):140–146 ZHENG D, LIU Y (2020) Spatial variation and health risk assessment of fluoride in drinking water in the Chongqing urban areas, China [J]. Environ Geochem Health 42(9):2925–2941 LI R, GONG Z, YU Y et al (2022) Alleviative Effects of Exercise on Bone Remodeling in Fluorosis Mice [J]. Biol Trace Elem Res 200(3):1248–1261 WANG J, XU H, CHENG X et al (2020) Calcium relieves fluoride-induced bone damage through the PI3K/AKT pathway [J]. Food Funct 11(1):1155–1164 LI H, HAO Z, WANG L et al (2022) Dietary Calcium Alleviates Fluorine-Induced Liver Injury in Rats by Mitochondrial Apoptosis Pathway [J]. Biol Trace Elem Res 200(1):271–280 LI H, FAN J, ZHAO Y et al (2021) Calcium alleviates fluoride-induced kidney damage via FAS/FASL, TNFR/TNF, DR5/TRAIL pathways in rats [J]. Ecotoxicol Environ Saf 226:112851 ZHOU J (2023) Necessity to Pay Attention to the Effects of Low Fluoride on Human Health: an Overview of Skeletal and Non-skeletal Damages in Epidemiologic Investigations and Laboratory Studies [J]. Biol Trace Elem Res 201(4):1627–1638 XIONG X, LIU J, HE W et al (2007) Dose-effect relationship between drinking water fluoride levels and damage to liver and kidney functions in children [J]. Environ Res 103(1):112–116 CAGLAYAN C, KANDEMIR F M DARENDELIOGLUE et al (2021) Hesperidin protects liver and kidney against sodium fluoride-induced toxicity through anti-apoptotic and anti-autophagic mechanisms [J]. Life Sci 281:119730 MALIN A J, LESSEUR C, BUSGANG S A et al (2019) Fluoride exposure and kidney and liver function among adolescents in the United States: NHANES, 2013–2016 [J]. Environ Int 132:105012 LI Q, LI W, LAI Y et al (2021) [Analysis on results of occupational health examination in 677 workers exposed to inorganic fluorine] [J]. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi 39(5):382–384 CHATTOPADHYAY A, PODDER S (2011) Fluoride-induced histopathology and synthesis of stress protein in liver and kidney of mice [J]. Arch Toxicol 85(4):327–335 KHAN RS, BRIL F, CUSI K et al (2019) Modulation of Insulin Resistance in Nonalcoholic Fatty Liver Disease [J]. Hepatology 70(2):711–724 TANASE D M, GOSAV E M, COSTEA C F et al (2020) The Intricate Relationship between Type 2 Diabetes Mellitus (T2DM), Insulin Resistance (IR), and Nonalcoholic Fatty Liver Disease (NAFLD) [J]. J Diabetes Res, 2020: 3920196 ITAI K, ONODA T, NOHARA M et al (2021) Slightly Elevated Serum Ionic Fluoride Levels Inhibit Insulin Secretion and Increase Glucose Levels in a General Japanese Population: a Cross-sectional Study [J]. Biol Trace Elem Res 199(8):2819–2825 RUI L. Energy metabolism in the liver [J]. Compr Physiol, (2014) 4(1): 177–197 PEREIRA H A, LEITE ADE L, CHARONE S et al (2013) Proteomic analysis of liver in rats chronically exposed to fluoride [J]. PLoS ONE 8(9):e75343 AGIUS L. Glucokinase and molecular aspects of liver glycogen metabolism [J]. Biochem J, (2008) 414(1): 1–18 ZHANG Y, LI W, BIAN Y et al (2023) Multifaceted roles of aerobic glycolysis and oxidative phosphorylation in hepatocellular carcinoma [J]. PeerJ 11:e14797 MEJIAS M, GALLEGO J, NARANJO-SUAREZ S et al (2020) CPEB4 Increases Expression of PFKFB3 to Induce Glycolysis and Activate Mouse and Human Hepatic Stellate Cells, Promoting Liver Fibrosis [J]. Gastroenterology 159(1):273–288 PETERSEN MC (2018) SHULMAN G I. Mechanisms of Insulin Action and Insulin Resistance [J]. Physiol Rev 98(4):2133–2223 HAEUSLER R A, MCGRAW T E ACCILID (2018) Biochemical and cellular properties of insulin receptor signalling [J]. Nat Rev Mol Cell Biol 19(1):31–44 LIU J, JIANG S, ZHAO Y et al (2018) Geranylgeranyl diphosphate synthase (GGPPS) regulates non-alcoholic fatty liver disease (NAFLD)-fibrosis progression by determining hepatic glucose/fatty acid preference under high-fat diet conditions [J]. J Pathol 246(3):277–288 YU Q, DAI W (2022) Sodium butyrate inhibits aerobic glycolysis of hepatocellular carcinoma cells via the c-myc/hexokinase 2 pathway [J]. J Cell Mol Med 26(10):3031–3045 YING X D, WEI G (2021) Sodium butyrate relieves lung ischemia-reperfusion injury by inhibiting NF-kappaB and JAK2/STAT3 signaling pathways [J]. Eur Rev Med Pharmacol Sci 25(1):413–422 WANG HG, HUANG X D, SHEN P et al (2013) Anticancer effects of sodium butyrate on hepatocellular carcinoma cells in vitro [J]. Int J Mol Med 31(4):967–974 WANG K, YANG X, WU Z et al (2020) Dendrobium officinale Polysaccharide Protected CCl(4)-Induced Liver Fibrosis Through Intestinal Homeostasis and the LPS-TLR4-NF-kappaB Signaling Pathway [J]. Front Pharmacol 11:240 YAO N, YANG Y, LI X et al (2022) Effects of Dietary Nutrients on Fatty Liver Disease Associated With Metabolic Dysfunction (MAFLD): Based on the Intestinal-Hepatic Axis [J]. Front Nutr 9:906511 YU S Y XUL (2021) The interplay between host cellular and gut microbial metabolism in NAFLD development and prevention [J]. J Appl Microbiol 131(2):564–582 ZHANG N (2021) [Research progress of sodium butyrate in metabolic-associated fatty liver disease] [J]. Zhonghua Gan Zang Bing Za Zhi 29(12):1229–1232 XING X, JIANG Z, TANG X et al (2016) Sodium butyrate protects against oxidative stress in HepG2 cells through modulating Nrf2 pathway and mitochondrial function [J]. J Physiol Biochem 73(3):405–414 XU Y, PENG S, CAO X et al (2021) High doses of butyrate induce a reversible body temperature drop through transient proton leak in mitochondria of brain neurons [J]. Life Sci 278:119614 AMOEDO ND, RODRIGUES M F, PEZZUTO P et al (2011) Energy metabolism in H460 lung cancer cells: effects of histone deacetylase inhibitors [J]. PLoS ONE 6(7):e22264 FOOTE A P, ZAREK C M KUEHNLA et al (2017) Effect of abomasal butyrate infusion on gene expression in the duodenum of lambs [J]. J Anim Sci 95(3):1191–1196 GONCALVES P (2013) Butyrate and colorectal cancer: the role of butyrate transport [J]. Curr Drug Metab 14(9):994–1008 MORAND C, BESSON C, DEMIGNE C et al (1994) Importance of the modulation of glycolysis in the control of lactate metabolism by fatty acids in isolated hepatocytes from fed rats [J]. Arch Biochem Biophys 309(2):254–260 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4563409","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":318427580,"identity":"e47c1842-1b89-449a-a8bc-a5d67151a989","order_by":0,"name":"Zimei Wu","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zimei","middleName":"","lastName":"Wu","suffix":""},{"id":318427582,"identity":"3a122565-6a5f-438b-a519-88945a099785","order_by":1,"name":"Cuijing Su","email":"","orcid":"","institution":"Central Hospital of Shenyang Sujiatun","correspondingAuthor":false,"prefix":"","firstName":"Cuijing","middleName":"","lastName":"Su","suffix":""},{"id":318427583,"identity":"d1d36fbb-65e5-4074-aed0-22858ce1b702","order_by":2,"name":"Zhiyu Ma","email":"","orcid":"","institution":"Central Hospital of Shenyang Sujiatun","correspondingAuthor":false,"prefix":"","firstName":"Zhiyu","middleName":"","lastName":"Ma","suffix":""},{"id":318427587,"identity":"0c77898f-343b-4f8c-844b-fd62f7c10d1b","order_by":3,"name":"Nan Yan","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Nan","middleName":"","lastName":"Yan","suffix":""},{"id":318427588,"identity":"41df5b0f-75b1-448f-ae89-8c86e748dfc8","order_by":4,"name":"Funing Liu","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Funing","middleName":"","lastName":"Liu","suffix":""},{"id":318427590,"identity":"b151c6a0-d1fb-4fad-9e17-28d1cc230726","order_by":5,"name":"Xin Li","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Li","suffix":""},{"id":318427591,"identity":"93f94871-bd02-4744-b982-ee157f0c37ee","order_by":6,"name":"Jiayi Chen","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Jiayi","middleName":"","lastName":"Chen","suffix":""},{"id":318427592,"identity":"a89dd1cd-2049-4abe-84b1-78efebe175ed","order_by":7,"name":"Qifeng Bai","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Qifeng","middleName":"","lastName":"Bai","suffix":""},{"id":318427594,"identity":"ffb051d2-ea4f-4678-a04c-8a9f7b20ff7a","order_by":8,"name":"Zhenxiang Sun","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zhenxiang","middleName":"","lastName":"Sun","suffix":""},{"id":318427596,"identity":"c08256d4-75be-4a27-ad3b-1618cc8a0bf0","order_by":9,"name":"Zhengdong Wang","email":"","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zhengdong","middleName":"","lastName":"Wang","suffix":""},{"id":318427597,"identity":"046b3e03-9bfd-4a82-b6eb-f741386fecd6","order_by":10,"name":"Fu Ren","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApklEQVRIiWNgGAWjYDAC5sMHoKwEYrWwpcGUEq8lx4BELeZtPJ8/8+bYMfCzA/X+3EGEFpljvNukebclM0j2vDFg7D1DhBYJ+d5tzLzbDjAY3MgxYGZsI0YLG8/jzyAt9qRoYZAG2yJBvBY2M8m525J5JM48KzjYS5wW5scf3m6zk+NvT9744CcxWkCAiYeBgQfEOECkBgYGxh9EKx0Fo2AUjIIRCQBzZC4VdchaswAAAABJRU5ErkJggg==","orcid":"","institution":"Shenyang Medical College","correspondingAuthor":true,"prefix":"","firstName":"Fu","middleName":"","lastName":"Ren","suffix":""}],"badges":[],"createdAt":"2024-06-11 10:32:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4563409/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4563409/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59375890,"identity":"a7c39253-fcdf-4c0d-8099-bffac00f5511","added_by":"auto","created_at":"2024-07-01 03:59:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":49879,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 1.1 Changes in body weight and the liver coefficient in each group\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/7634f00acec252b56d8cf3e1.png"},{"id":59376238,"identity":"ec383706-0052-41b0-bf67-d374c264f196","added_by":"auto","created_at":"2024-07-01 04:07:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":64651,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 2.1. Effect of sodium butyrate on serum and liver transaminases in mice exposed to fluoride\u003c/p\u003e\n\u003cp\u003e(A\u0026amp;B) Sodium butyrate attenuates hepatic AST and ALT levels in fluoride-exposed mice. (C\u0026amp;D) Sodium butyrate attenuates serum AST and ALT levels in fluoride-exposed mice. The data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/b94ca0796b3b6e674b0514a5.png"},{"id":59375530,"identity":"602bd208-2129-4eac-a271-f19746314398","added_by":"auto","created_at":"2024-07-01 03:51:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1057133,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 2.2. Sodium butyrate reduces liver damage in fluoride-exposed mice. (A) The control group,\u003c/p\u003e\n\u003cp\u003e(B) the sodium butyrate-treated group, (C) the fluoride-exposed group, and (D) the fluoride-exposed and sodium butyrate-treated group\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/ea668a58ba0a2b18f5b27bf4.png"},{"id":59375528,"identity":"84889ee0-ca4f-4baa-b3ff-ffc89d1ccfeb","added_by":"auto","created_at":"2024-07-01 03:51:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":252798,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 3.1. Sodium butyrate inhibits glycolysis in the livers of mice exposed to fluoride. (A-G) Protein expression of ALDOA, PKM2, PGK1, PFKp and LDH. The data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/22b9b691d835fe2cf670156b.png"},{"id":59375526,"identity":"f08c8ef2-902c-4bfe-9f50-56ff49321417","added_by":"auto","created_at":"2024-07-01 03:51:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":73344,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 3.2. Sodium butyrate inhibits glycolysis in the livers of mice exposed to fluoride. (A-E) mRNA expression of ALDOA, PKM2, PGK1, PFKp and LDH. The data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/2682d0f352007e19832b97f5.png"},{"id":59375525,"identity":"17d7e3d3-89f2-42ad-b559-a4e8208ad5ea","added_by":"auto","created_at":"2024-07-01 03:51:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":40604,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 4.1. Sodium butyrate enhances glucose uptake and reduces lactate levels. (A) Sodium\u003c/p\u003e\n\u003cp\u003ebutyrate enhances glucose uptake in the livers of fluoride-exposed mice. (B) Sodium butyrate reduces lactate levels in the livers of fluoride-exposed mice. The data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/a23062da2172bb794eec905d.png"},{"id":59375531,"identity":"23f37dc4-9a5f-4d44-b6e7-b71ee5cc0bd9","added_by":"auto","created_at":"2024-07-01 03:51:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":113932,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 5.1. Sodium butyrate increases the expression of TCA cycle-related enzymes in the livers of mice exposed to fluoride. (A-B) Protein expression of PDH and MDH. (C-D) mRNA expression of PDH and MDH. The data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/e60a76e33c3f6941cdb3976d.png"},{"id":61524471,"identity":"564a7bdc-d95f-41a4-b6ec-7f449ff11ee4","added_by":"auto","created_at":"2024-07-31 19:22:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2321652,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4563409/v1/e7891554-def7-4dea-9201-1f29d15cd6ec.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanism by which the inhibition of glycolysis by sodium butyrate alleviates liver injury in subchronic fluoride-exposed mice","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eFluorine is a naturally occurring element found in soil, water, food materials and natural minerals, where it occurs along with other elements in the form of fluoride compounds \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Excessive exposure to fluoride is an industrial, food, water and geological factor affecting the health of millions of people around the world. According to World Health Organization (WHO) standards, long-term excessive exposure to more than 1.5 mg/L fluoride can cause fluorosis in humans, characterized by dental fluorosis, skeletal fluorosis, and lesions in the liver and other organ \u003csup\u003e[\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. At present, the abundance of fluorine in the environment and drinking water is the main cause of fluorosis. Fluorosis is a serious public health problem in 24 countries, including China \u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Testing of samples from rural areas in various regions of the world show that the fluoride concentration in 80% of villages exceeds the limits allowed by the World Health Organization (WHO). People living in these areas are affected by skeletal fluorosis, and fluorosis occurs in most parts of Africa and Asia, affecting approximately 10\u0026nbsp;billion people \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. China seriously affected by fluorosis, and with the exception of Shanghai and Hainan, all other provinces have reported this disease \u003csup\u003e[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. The government has attempted to educate the public to raise awareness of the dangers of fluorosis and the importance of drinking safe water, contacting the affected patients by public health personnel through routine investigations, developing a range of antioxidant drugs, and implementing various mitigation programs and strategies around the world. However, the threat of fluorosis has not yet been eradicated, and there is currently no specific treatment \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFluorosis can be divided into dental fluorosis, skeletal fluorosis and nonskeletal fluorosis. In the past, our research on fluorosis has focused mainly on skeletal tissues \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, but in recent years, as research has progressed, the research focus has gradually shifted to nonskeletal tissues \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Epidemiological investigations and in vivo and in vitro studies based on fluoride have also confirmed that fluoride can not only cause bone damage but also cause nonskeletal damage involving the cardiovascular system, nervous system, liver and kidney function, reproductive system, thyroid function, glucose homeostasis, and immune system \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. The liver is the most important organ for detoxification, and it is also the most susceptible to the infiltration and accumulation of toxic agents. According to a Mexican cohort study, water fluoridation levels above 2.0 mg/L can lead to impaired liver function in children \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. An animal study showed that excessive fluoride exposure results in changes in the expression of clinical indicators in the liver, such as hepatic enzymes (alanine aminotransferase (ALT) and aspartate transaminase (AST)) \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Another study involving American adolescents suggested that fluoride exposure might lead to aberrant changes in parameters related to liver function in adolescents \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. In January 2019, Li et al. conducted an occupational health survey for 677 workers in a fluorine chemical enterprise in Hunan Province. The duration of fluoride exposure in patients with occupational chronic fluorosis was strongly correlated with the detection rate of fatty liver \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. In an animal study, low fluoride concentrations (15 mg/L NAF-RRB) led to decreased levels of glutathione (GSH) and glutathione S-transferase (GST) activity, decreased malondialdehyde (MDA) production, and abnormal changes in liver function in mice; furthermore, severe structural changes in the liver were detected \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Therefore, the study of fluorine-induced liver damage has theoretical and practical significance.\u003c/p\u003e \u003cp\u003eThe liver is the largest detoxifying organ, but it is also involved in the regulation of energy metabolism. The liver is a hub for the metabolism of various substances and plays a major role in metabolic homeostasis, and glycolysis, gluconeogenesis, lipogenesis, and glycogen production can all be carried out in the liver \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. As a result, liver disease can lead to systemic metabolic disorders. A study of healthy subjects in urban Japan showed that slightly elevated serum fluoride levels inhibited insulin secretion and increased glucose levels \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e, suggesting that fluoride affects glucose homeostasis even at low fluoride concentrations. The liver regulates glucose dynamics to maintain glucose homeostasis for energy\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Metabolomics revealed significant changes in pathways related to hepatic energy metabolism after fluoride exposure\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Glycolysis is an important metabolic methods that converts glucose into pyruvate under the gradual catalysis of hexokinase (HK), phosphofructokinase (PFK), pyruvate kinase (PKM) and other enzymes. The converted pyruvate can be oxidized and decomposed into acetyl-CoA by pyruvate dehydrogenase (PDH) through the mitochondrial tricarboxylic acid cycle or converted into lactic acid by lactate dehydrogenase (LDH) through the glycolysis pathway when the oxygen supply of the cell is insufficient. Compared with oxidative phosphorylation, aerobic glycolysis has a low energy supply efficiency. A molecule of glucose can only produce 2 ATP molecules, but the glucose metabolism rate is 100 times that of oxidative phosphorylation. Therefore, under certain pathological conditions, cells cannot effectively use oxidative phosphorylation to produce ATP, but glycolysis can ensure short-term energy needs by consuming a large amount of glucose \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Moreover, changes in glycolysis are found in many liver diseases. The glycolytic activity of hepatic stellate cells in the fibrotic liver is greater than that of hepatic stellate cells in the healthy liver\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. In hepatocellular carcinoma, elevations in aerobic glycolysis and decreases in oxidative phosphorylation can lead to the development of cancer\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. In patients with nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH), glycolysis is markedly increased in hepatocytes, lactate production is increased, the tricarboxylic acid (TCA) cycle is inhibited, and mitochondrial respiration is reduced, which can exacerbate disease progression \u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Similar metabolic changes are present in steatotic hepatocytes. Compared with mice fed conventional food, mice fed a high-fat diet have significantly increased mRNA levels of key glycolytic enzymes (HK2, PFK, and PKM) in their livers \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Given the importance and complexity of liver glycolysis, it is reasonable to study the metabolic profile of the liver under both healthy and pathological conditions. We hypothesize that fluorine-induced liver damage may be related to the glycolytic pathway.\u003c/p\u003e \u003cp\u003eSodium butyrate (NaB) is a type of short-chain fatty acid (SCFA) in the butyrate family that is produced by microbial fermentation of dietary fiber in the lower intestinal layer\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. NaB has attracted extensive attention due to its antioxidant, immunomodulatory, and anticancer effects\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. In recent years, with the introduction of the gut-liver axis theory, a variety of intestinal microbes have been shown to affect the development and progression of liver metabolic diseases through the gut-liver axis to alter energy absorption, regulate metabolism, and change intestinal permeability \u003csup\u003e[\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. Sodium butyrate can participate in gene regulation, immune regulation, intestinal barrier function regulation, oxidative stress and other physiological activities in vivo. It can also reduce obesity and insulin resistance induced by a high-fat diet in mice and play important roles in the prevention and alleviation of the occurrence and development of metabolic-associated fatty liver disease (MAFLD) \u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. However, the effect of sodium butyrate on fluoride-induced liver injury has not been reported. In addition, Xing et al. noted that sodium butyrate regulates energy metabolism and mitochondrial function, inhibits glycolysis, enhances the tricarboxylic acid cycle and oxidative phosphorylation, and increases the activity of antioxidant enzymes, thereby promoting cell survival \u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. In hepatocellular carcinoma, sodium butyrate can inhibit the expression of HK2, downregulate aerobic glycolysis, inhibit the production of lactate, glucose and lactate in hepatocellular carcinoma cells, and induce apoptosis through the c-myc pathway. In the case of damage to various organs, such as the brain \u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e, lung \u003csup\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e, intestine \u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e, and liver \u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e, sodium butyrate has been shown to alleviate organ abnormalities by regulating the glycolytic pathway. Therefore, sodium butyrate may be a promising molecule for the prevention and treatment of glucose metabolism disorders. However, the effect of sodium butyrate on fluorine-induced liver injury related to the glycolytic pathway has not been studied.\u003c/p\u003e \u003cp\u003eIn summary, based on the results of fluorosis-related studies, this study speculated that abnormal glycolysis is another important pathogenic factor of liver injury caused by fluoride exposure. In this study, a mouse model of subchronic fluoride exposure was treated with sodium butyrate, and relevant techniques, such as HE histopathological staining, biochemical kit detection, RT‒qPCR, and Western blotting, were used to study the glycolysis-related effects of sodium butyrate on liver injury in mice subjected to subchronic fluoride exposure. To further reveal the underlying mechanisms of fluoride-induced liver injury, we aimed to provide a new prevention and treatment strategy or approach for liver injury caused by endemic fluorosis.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Chemicals\u003c/h2\u003e \u003cp\u003eNaB and sodium fluoride (NaF) were purchased from Sigma (USA) and were of analytical grade. The ionometer and total ion concentration buffer were obtained from Leici Instrument (Shanghai, China). The BCA Protein Assay Kit was purchased from Dingguochangsheng Biotechnology (Shenyang, China). PDH, MDH and ALDOA were used for Western blot analysis and were obtained from CST (USA). LDH and PKM were obtained from Wanleibio (Shenyang, China), and β-actin was purchased from Abclone (Wuhan, China). The PCR kit was obtained from Vazyme (China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Animals\u003c/h2\u003e \u003cp\u003eForty mice (four weeks old) of the SPF-grade ICR line were obtained from Liaoning Changsheng Biotechnology Co., Ltd., for experimental purposes. The animals were fed in plastic cages under standard laboratory conditions (12 h light/dark cycle, 24\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 55\u0026thinsp;\u0026plusmn;\u0026thinsp;5% humidity). The mice were provided a commercial chow diet and water ad libitum. All procedures relating to animals were approved by The Animal Research Association (SYYXY2021031502) of Shenyang Medical College.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Experimental design\u003c/h2\u003e \u003cp\u003eThe animals were randomly allocated into four groups of ten mice per group.\u003c/p\u003e \u003cp\u003eIn Group I (control), distilled water was given orally for 3 months. After 3 months, 1000 mg/kg normal saline was given orally by gavage for 8 weeks.\u003c/p\u003e \u003cp\u003eIn Group II (NaF), 100 mg/l NaF was added to the drinking water, and the mice were allowed to acclimate for 3 months. After 3 months, 1000 mg/kg normal saline was given orally by gavage for 8 weeks.\u003c/p\u003e \u003cp\u003eIn Group III (NaB), distilled water was given orally for 3 months. After 3 months, 1000 mg/kg NaB was given orally via gavage for 8 weeks.\u003c/p\u003e \u003cp\u003eIn Group IV (NaF\u0026thinsp;+\u0026thinsp;NaB), 100 mg/l NaF was added to the drinking water, and the animals were allowed to acclimate for 3 months. After 3 months, 1000 mg/kg NaB was given orally via gavage for 8 weeks.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Fluoride ion selective electrode method\u003c/h2\u003e \u003cp\u003eThe mice were placed in a metabolic cage and deprived of water for 24 hours to collect urine. Subsequently, the mice were euthanized by cervical dislocation, and blood was collected retro-orbitally. Blood samples were centrifuged (3000 rpm, 10 min) to obtain serum. The ionometer (Leici Instrument, Shanghai, China) was calibrated with standard solutions of different concentrations of uranium. The sample and total ion concentration buffer (Leici Instrument, Shanghai, China) were added at a ratio of 1:1, and the mixture was placed under a Uoride ion meter for 30 seconds to measure the mean concentration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. HE staining\u003c/h2\u003e \u003cp\u003eHematoxylin-eosin (HE) was used to detect alterations in liver morphology. First, the mice were sacrificed. Then, the liver was quickly removed, fixed in 4% paraformaldehyde, washed, dehydrated, hyalinized, embedded, and sliced into 5 \u0026micro;m paraffin sections. The sections were stained with HE and then sealed with neutral resin. Liver morphology damage was observed with an ordinary microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. AST and ALT kit tests\u003c/h2\u003e \u003cp\u003eLiver functionality was assessed by detecting the levels of AST and ALT in the serum and liver. The blood sample was centrifuged for 5 min (4\u0026deg;C, 6000 rpm), and the supernatant was collected to obtain the serum. The liver was washed with PBS, wiped dry with filter paper, and homogenized in PBS. The homogenate was centrifuged at 12000 rpm and 4\u0026deg;C, after which the supernatant was collected. The levels of AST and ALT in the serum and liver homogenate supernatants were detected by following the protocols of commercial detection kits.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Glucose kit and lactate content kit test\u003c/h2\u003e \u003cp\u003eThe tissue samples were accurately weighed, and normal saline was added at a weight (g):volume (mL) ratio of 1:9. The samples were mechanically homogenized in an ice water bath at 2500 rpm/min and centrifuged for 10 minutes, after which the amount of supernatant (10% homogenate) was determined. The supernatant of the 10% homogenate was diluted to different concentrations with normal saline, and the preexperiment was performed according to the operation table. A concentration of absolute OD between 0.05 and 0.35 was selected as the best sampling concentration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Western blotting analysis\u003c/h2\u003e \u003cp\u003eColonic proteins were extracted using 1 mM RIPA buffer (Dingguochangsheng Biotechnology, Shenyang, China) and PMSF (Dingguochangsheng Biotechnology, Shenyang, China) supplemented with phosphatase inhibitors. Using the BCA Protein Assay Kit, (Dingguochangsheng Biotechnology, Shenyang, China) the protein concentration was measured. After 30\u0026ndash;40 mg of protein sample was denatured, proteins of varying molecular weights were separated via SDS‒PAGE according to the manufacturer\u0026rsquo;s directions (Dingguochangsheng Biotechnology, Shenyang, China). The protein extract was transferred to PVDF membranes (Millipore, Billerica, MA, USA), and then, the membranes were incubated in a 5% skim milk powder solution at 37\u0026deg;C for 2 h. TBST-diluted primary antibodies against LDH (1:500, Wanleibio, Shenyang, China), PDH (1:1000, CST, MA, USA), MDH (1:1000, CST, MA, USA), ALDOA (1:1000, CST, MA, USA), PKM (1:1000, Wanleibio) and β-actin (1:5000, Abclone, Wuhan, China) were used. The membrane was incubated with primary antibody at 4\u0026deg;C for 12 h and then incubated with goat anti-rabbit IgG and HRP secondary antibodies (1:6000, Wuhan, Abclone). ImageJ 1.4 (Bethesda, Maryland, USA) was used to analyze the signal strength.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Gene expression analysis\u003c/h2\u003e \u003cp\u003eThe liver tissues of each group of mice were collected separately. Total RNA was extracted by the TRIzol method and reverse transcribed to cDNA. Fructose diphosphate aldolase A (ALDOA), M2-type pyruvate kinase (PKM2), lactate dehydrogenase (LDH), platelet-type phosphofructokinase (PFKp), pyruvate dehydrogenase (PDH), and malate dehydrogenase 2 (MDH2) transcript levels were detected in the liver by real-time fluorescence quantitative PCR. The primers used are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of Primers used for real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePKM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCTAGGTATCGCAGCAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGCCGAGCCACATTCATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePFKp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCATGGTTATGGTTCCTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCGCACGTGTCTGTGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGCTCTCTGTCGGTTCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGTTTCCTTTTCACAGCACAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTCCATTTAAGGCCCCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCCTTGAGGGTTGCCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALDOA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCTGAATAGGCTGCGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGGCAGTGCTTTCCTTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMDH2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATCATTGCCAACCCAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACAAACGTGTTCGCTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll values are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Multiple comparisons were carried out using one-way ANOVA followed by Tukey's post hoc test in GraphPad Prism 8.0. A p value less than 0.05 was considered to indicate statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Establishment of a mouse model of fluoride exposure\u003c/h2\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e3.1.1 Mouse body weight and liver parameters\u003c/h2\u003e \u003cp\u003eAfter chronic fluoride exposure for 5 months, the mice in the NaF group exhibited obvious disorderly fur, loss of appetite, and lethargy, and the mice in the control and NaB groups exhibited smooth hair, a good appetite, and a quick response. Moreover, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1.1\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1.1\u003c/span\u003e, compared with those in the control and NaB groups, the body weights and liver indices of the mice in the NaF group were decreased to varying degrees (p \u0026lt; 0.05, p \u0026lt; 0.01). With the intervention of sodium butyrate, the body weight and liver coefficient of the mice in the NaF + NaB group were restored to a certain extent (p \u0026lt; 0.05, p \u0026lt; 0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"±\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"±\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1.1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBody weight and liver coefficient\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBody weight (g)\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLiver coefficient (%)\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e47.73 ± 1.742\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e5.89 ± 0.214\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaB\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e47.06 ± 2.111\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e5.66 ± 0.390\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaF\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e40.98 ± 3.074**\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e4.94 ± 0.849*\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaF + NaB\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e45.88 ± 0.744#\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e5.84 ± 0.326#\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003eThe data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003e3.1.2 Concentration of fluoride ions in serum and urine\u003c/h2\u003e \u003cp\u003eTo investigate whether 12 weeks of fluoride exposure resulted int the accumulation of fluoride in mice, the fluoride ion concentration in the serum and urine was measured by the fluoride ion selective electrode method. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e1.2\u003c/span\u003e, there was no significant difference in the fluoride content between the control group and the NaB group. Compared with those in the control group, the serum fluoride concentration and urine fluoride concentration in the NaF group were significantly greater, suggesting that the metabolic rate of the mice was greater (p \u0026lt; 0.01). Compared with those in the NaF group, the serum fluoride concentration and urine fluoride concentration in the NaF + NaB group were significantly lower (p \u0026lt; 0.01). Thus, the mouse model of subchronic fluoride exposure was successfully treated with sodium butyrate.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"±\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"±\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1.2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eConcentration of fluoride ions in the serum and urine of mice\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSerum fluoride concentration (mg/L)\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUrine fluoride concentration (mg/L)\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e0.167938 ± 0.001\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e1.587438 ± 0.089\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaB\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e0.171 ± 0.001\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e1.490875 ± 0.103\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaF\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e0.236 ± 0.003**\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e9.794125 ± 0.163**\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaF + NaB\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c2\"\u003e \u003cp\u003e0.177938 ± 0.003##\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\"±\" colname=\"c3\"\u003e \u003cp\u003e6.526063 ± 0.151##\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003eThe data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Sodium butyrate attenuates liver damage in fluoride-exposed mice\u003c/h2\u003e \u003cdiv id=\"Sec18\" class=\"Section3\"\u003e \u003ch2\u003e3.2.1 Serum and liver transaminase levels in mice\u003c/h2\u003e \u003cp\u003eA preliminary exploration of the effect of sodium butyrate on the liver of fluorotic mice was performed by measuring the levels of ALT and AST in serum and liver tissue homogenates. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2.1\u003c/span\u003e, compared with those in the control group, the serum and liver ALT and AST levels in the mice in the fluorosis group were significantly greater (p \u0026lt; 0.05). In contrast, the ALT and AST levels in the liver and serum were significantly decreased after sodium butyrate treatment (p \u0026lt; 0.05, p \u0026lt; 0.01). These results indicate that NaF can cause liver damage and that sodium butyrate can alleviate liver damage.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(A\u0026amp;B) Sodium butyrate attenuates hepatic AST and ALT levels in fluoride-exposed mice. (C\u0026amp;D) Sodium butyrate attenuates serum AST and ALT levels in fluoride-exposed mice. The data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section3\"\u003e \u003ch2\u003e3.2.2 Mouse Pathology via H\u0026amp;E Staining\u003c/h2\u003e \u003cp\u003eTo further assess liver injury caused by subchronic fluoride exposure, H\u0026amp;E staining was used to evaluate liver morphological changes. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2.2\u003c/span\u003e, the liver tissue structure of the control and NaB groups was normal, with liver cells arranged tightly and neatly in a radial shape and no vacuoles in the cells. After three months of NaF exposure, the arrangement of liver cells was relatively disordered, with inflammatory cell infiltration and a large amount of vacuolar steatosis. The inflammatory infiltration symptoms in the sodium butyrate intervention group were alleviated compared to those in the fluoride-exposed group, and the liver cells were arranged neatly with a small amount of fat vacuoles visible. These findings indicate that sodium butyrate can alleviate liver damage caused by long-term excessive fluoride exposure.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e(B) the sodium butyrate-treated group, (C) the fluoride-exposed group, and (D) the fluoride-exposed and sodium butyrate-treated group\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Effect of sodium butyrate on glycolysis-related metabolic enzymes in fluoride-exposed mice\u003c/h2\u003e \u003cp\u003eALDOA, PKM2 and PFKp are the predominant glycolysis-related metabolic enzymes involved in the conversion of glucose to pyruvate, and LDH promotes anaerobic glycolysis. We performed WB, and the results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3.1\u003c/span\u003eA-C. The expression levels of ALDOA, PKM2, PFKp and LDH in the NaF group were significantly increased (p \u0026lt; 0.05, p \u0026lt; 0.01). In contrast, the expression of histones in the treatment group was significantly decreased (p \u0026lt; 0.05, p \u0026lt; 0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3.1\u003c/span\u003e). In addition, in the NaF group, the RT‒qPCR results indicated that the ALDOA, PKM2, PFKp and LDH mRNA levels in the NaF group were significantly greater than those in the control group (p \u0026lt; 0.05, p \u0026lt; 0.01), and the ALDOA, PKM2, PFKp and LDH mRNA levels in the treatment group were significantly lower than those in the NaF group (p \u0026lt; 0.05, p \u0026lt; 0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Effect of sodium butyrate on liver function in fluoride-exposed mice\u003c/h2\u003e \u003cp\u003eThe results revealed that relative to those of control mice, the glucose level and\u003c/p\u003e \u003cp\u003ethe glycolytic metabolite lactate level in the NaF group were significantly increased\u003c/p\u003e \u003cp\u003e(p \u0026lt; 0.05, p \u0026lt; 0.01). These findings indicate that fluorine could inhibit glucose uptake, thus elevating the glucose and lactate levels in the tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4.1\u003c/span\u003e). In contrast, treatment with sodium butyrate resulted in an increase in inhibited glucose uptake capacity and a significant decrease in lactate levels (p \u0026lt; 0.05, p \u0026lt; 0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ebutyrate enhances glucose uptake in the livers of fluoride-exposed mice. (B) Sodium butyrate reduces lactate levels in the livers of fluoride-exposed mice. The data are expressed as the mean ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 vs. Control mice; # p \u0026lt; 0.05, ## p \u0026lt; 0.01 vs. NaF mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Effect of sodium butyrate on TCA cycle-related enzymes in fluoride-exposed mice\u003c/h2\u003e \u003cp\u003eAfter the conversion of glucose to pyruvate, pyruvate conversion is catalyzed\u003c/p\u003e \u003cp\u003eby PDH and MDH oxidative phosphorylation-related enzymes in the TCA cycle to\u003c/p\u003e \u003cp\u003eproduce energy. Both the WB and RT‒qPCR results indicated that the gene and protein expression levels of TCA cycle-related enzymes in the NaF group were significantly lower than those in the control group (p \u0026lt; 0.05, p \u0026lt; 0.01). In contrast to those in the NaF group, the gene and protein expression levels of TCA cycle-related enzymes in the treatment group were significantly elevated (p \u0026lt; 0.05, p \u0026lt; 0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5.1\u003c/span\u003e). These results suggest that sodium butyrate can increase the abnormal decrease in liver oxidative phosphorylation levels caused by fluoride exposure in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe toxic effects of fluoride are a major public health problem worldwide; these effects can cause dental fluorosis, skeletal fluorosis, and hepatotoxicity\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. The liver is an important target organ for fluorosis\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Previous studies have shown that liver disease is associated with abnormal glucose metabolism \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e, and sodium butyrate, a drug that regulates glucose metabolism, can also alleviate liver damage caused by various factors. However, this phenomenon has not been addressed in the field of fluoride-induced liver injury. Therefore, in this study, a mouse model of fluorosis was treated with sodium butyrate, and sodium butyrate treatment alleviated liver injury in fluoride-exposed mice through the glycolytic pathway.\u003c/p\u003e\u003cp\u003eBlood fluoride and urine fluoride levels in mice are important indicators for determining the success of fluoride-exposed models. In this study, the amount of fluoride in the blood and urine increased significantly after fluoride exposure, indicating that the fluoride exposure model was successfully established. The liver is the largest detoxification organ in the human body, and fluoride, an exogenous poison, accumulates most frequently in the liver. The organ coefficient is a commonly used indicator of tissue damage. In this study, we measured the liver organ coefficient after fluoride exposure, and the results showed that the liver organ coefficient decreased significantly. These findings suggest liver damage after fluoride exposure, and the liver is one of the important target organs of fluorosis. Studies have confirmed that fluorine can accumulate in the liver and cause structural and functional damage. Li et al. reported that sodium fluoride can cause morphological and pathological changes in the liver, which are manifested by irregular arrangement of hepatocytes, vacuolar degeneration, nuclear condensation, and lysis\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Similar to the above studies, Yu et al. demonstrated that fluoride exposure aggravates pathological damage and fibrosis in liver tissue and increases the presence of ALT and AST in the liver and blood \u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. When the liver is damaged, the aminotransferases in the liver are released into the blood, and the levels of ALT and AST in the blood increase, indicating liver damage \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Moreover, sodium butyrate is highly important for liver protection. Studies have confirmed that coated sodium butyrate (CSB) enhances liver antioxidant function in chickens and has a positive effect on preventing liver injury and alleviating lipid accumulation and inflammation \u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Sodium butyrate can attenuate hepatic oxidative stress and inflammatory responses through NR4A2-mediated histone acetylation, effectively reversing liver injury caused by deoxynivalenol (DON)\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. It has also been shown that butyrate supplementation can improve fetal liver damage caused by a high-fat diet \u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Similar to the above results, in this study, the histopathological structure of the liver was damaged after fluoride exposure, and the levels of AST and ALT in the liver were significantly increased compared with those in the control group. These conditions were significantly improved after sodium butyrate treatment, suggesting that the liver was damaged after fluorosis and that sodium butyrate was beneficial for alleviating the damage.\u003c/p\u003e\u003cp\u003eGlycolysis is the process by which one molecule of glucose is metabolized in the cytoplasm to produce two molecules of pyruvate, two molecules of NADH and two molecules of adenosine triphosphate (ATP). Glycolysis is a key pathway of cellular glucose metabolism, providing an intermediate product for energy production, and its rate is mainly regulated and controlled by hexokinase (HK), phosphofructokinase (PFK), pyruvate kinase (PK), and lactate dehydrogenase (LDH). Aldolase A (ALDOA) is an enzyme that plays an important role in glycolysis and gluconeogenesis. Pyruvate kinase (PK) and phosphoglycerate kinase 1 (PGK1) are the only two ATP-producing enzymes. Studies have shown that inhibition of the glycolysis-related genes PGK1 and ALDOA regulates Th17 cell metabolism\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. PDH is an important regulatory enzyme that catalyzes the conversion of pyruvate to acetyl-CoA and links anaerobic glycolysis to the TCA cycle \u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e, which is the same negative regulatory enzyme of glycolysis as MDH. Recent studies have shown that inhibition of PDH can modulate metabolic flux through the TCA cycle and reduce glucose utilization \u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. Alterations in liver metabolism are essential for the development of liver disease, and abnormal changes in glycolysis are present in many diseases. The high and low expression of HK1, PFKp and PKM2, which are the three rate-limiting enzymes of glycolysis, and PDH and MDH, which are the negative regulators of glycolysis, can indicate the development of abnormalities in the metabolism of glycolysis or oxidative phosphorylation to a certain extent, and these alterations promote the progression of the disease. Similar to the previous finding of an imbalance between glycolysis and oxidative phosphorylation in liver disease, our experimental results showed that the expression of glycolysis-related proteins was upregulated in fluoride-exposed livers and significantly downregulated after sodium butyrate treatment. The expression of PDH and MDH was downregulated in the livers of fluoride-exposed mice and upregulated after sodium butyrate treatment. Intrahepatic glucose metabolism in fluoride-exposed individuals mice is more likely to involve glycolysis rather than oxidative phosphorylation for energy. In normal tissues, 90% of ATP is derived from oxidative phosphorylation and 10% of ATP is derived from glycolysis. In contrast, in fluoride-exposed livers, tissues use glycolysis rather than oxidative phosphorylation to produce energy. This may be due to external stimuli, decreased oxidative phosphorylation capacity, insufficient energy supply, or damage to liver tissue, so the body compensates by increasing the level of glycolysis to produce a large amount of ATP to meet the body's energy needs.\u003c/p\u003e\u003cp\u003eGlucose is the raw material of glycolysis, and lactic acid is the final product of glycolysis. Thus, the determination of glucose and lactate levels can further indicate the therapeutic effect of glycolysis in fluoride-exposed livers treated with sodium butyrate. Previous studies have shown that the Warburg effect in tumor cells is manifested by enhanced aerobic glycolysis and lactate production \u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Lactate production in fatty liver tissue is significantly greater than that in normal liver tissue. Moreover, increased lactate not only worsens steatosis but also increases acetylation of histone H3K9 by decreasing the activity of nuclear histone deacetylase (HDAC), further aggravating the disease \u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e. Studies have confirmed that sodium butyrate can downregulate aerobic glycolysis, inhibit the production of glucose and lactate in hepatocellular carcinoma cells, and inhibit the expression of HK2, downregulating aerobic glycolysis and cell proliferation in hepatocellular carcinoma\u003csup\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. Other studies have shown that butyrate plays an important role in inhibiting lactate release and reducing the threshold concentration of lactate utilization \u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e, and changes in metabolite flux, particularly glucose uptake and the glycolytic pathway, can be observed with butyrate treatment \u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. Our experimental results showed that fluoride could increase lactate levels and reduce glucose levels in liver tissues, and sodium butyrate could alleviate the phenomenon of increased lactate levels and glucose consumption in fluorotic liver injury. According to biochemical detection and the expression of glycolysis-related enzymes at the protein and mRNA levels, sodium butyrate can inhibit the enhanced glycolytic ability and reduce the oxidative phosphorylation ability in fluorotic liver injury. Under normal conditions, oxidative phosphorylation is essential for energy production and cell survival, and many genes involved in oxidative phosphorylation are downregulated in chronic hepatitis \u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. Similarly, liver damage due to fluorosis results in abnormal metabolic changes, such as increased glycolytic capacity and decreased oxidative phosphorylation capacity. Sodium butyrate can inhibit the production of glucose and lactate, downregulate the expression of PGK1, PFKp, PKM2 and LDH, and increase the expression levels of PDH and MDH2, and these effects have a positive effect on alleviating liver damage caused by fluoride exposure.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe results of this study demonstrated that fluoride exposure can cause liver injury in mice, resulting in liver histopathological changes, increased intrahepatic aminotransferase levels, and abnormal intrahepatic metabolism. However, sodium butyrate can downregulate glycolysis, inhibit the production of glucose and lactate, significantly alleviate the above abnormalities, and protect the liver. Sodium butyrate has been shown to be a promising protective agent against fluoride-induced liver damage.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompliance with ethical standards\u003c/h2\u003e \u003cp\u003e The number of mice involved in this experiment and all the protocols were reviewed and approved by the Animal Use and Care Committee at Shenyang Medical College (protocol number: SYYXY2021031502), in accordance with the regulations and requirements of the Animal Ethics Committee and in accordance with the management regulations of experimental animals in Liaoning Province.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eAll authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or nonfinancial interest in the subject matter or materials discussed in this manuscript.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding Information\u003c/h2\u003e \u003cp\u003e This work was funded by the Basic Research Project of Liaoning Provincial Department of Education (JYTMS20231391) to Zhengdong Wang; This work was supported by Center Guiding Local Science and Technology Foundation of Liaoning Science and Technology Committee(2023JH6/100100021) to Fu Ren.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll the authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Z.W, C. S, Z.M, N.Y, Z. W. The first draft of the manuscript was written by Z.W, F.L, X.L, J.C., Q.B, F.R, and all authors commented on previous versions of the manuscript. All the authors have read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eNot applicable\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e \u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ePRANESH MB, ARJUNDAS G (2019) Autopsy study of a case of skeletal fluorosis (1977) [J]. Neurol India 67(3):643\u0026ndash;647\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKURDI MS (2016) Chronic fluorosis: The disease and its anaesthetic implications [J]. Indian J Anaesth 60(3):157\u0026ndash;162\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMOHAMMADI A A, YOUSEFI M, YASERI M et al (2017) Skeletal fluorosis in relation to drinking water in rural areas of West Azerbaijan. Iran [J] Sci Rep 7(1):17300\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBUZALAF M A R (2018) Review of Fluoride Intake and Appropriateness of Current Guidelines [J]. Adv Dent Res 29(2):157\u0026ndash;166\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReview of the Draft NTP Monograph (2020) Systematic Review of Fluoride Exposure and Neurodevelopmental and Cognitive Health Effects. Washington (DC)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWEN C, ZHANG Q, XIE F et al (2022) Brick tea consumption and its relationship with fluorosis in Tibetan areas [J]. Front Nutr 9:1030344\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG L, DONG D, LV S et al (2023) Spatial evolution analysis of groundwater chemistry, quality, and fluoride health risk in southern Hebei Plain, China [J]. Environ Sci Pollut Res Int 30(21):61032\u0026ndash;61051\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSAH O, ZOHOORI MAGUIREA (2020) Effect of altitude on urinary, plasma and nail fluoride levels in children and adults in Nepal [J]. J Trace Elem Med Biol 57:1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSOLANKI Y S AGARWALM, GUPTA A B et al (2022) Fluoride occurrences, health problems, detection, and remediation methods for drinking water: A comprehensive review [J]. Sci Total Environ 807(Pt 1):150601\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYUN Z J, CHEN P Z, BIAN J C et al (2010) [Epidemiological investigation on endemic fluorosis along the Yellow River alluvial plain of Shandong province] [J]. Zhonghua Liu Xing Bing Xue Za Zhi 31(11):1280\u0026ndash;1283\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHU C, BAI G, LIU X et al (2006) Screening high-fluoride and high-arsenic drinking waters and surveying endemic fluorosis and arsenism in Shaanxi province in western China [J]. Water Res 40(16):3015\u0026ndash;3022\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSRIVASTAVA S, FLORA S J S (2020) Fluoride in Drinking Water and Skeletal Fluorosis: a Review of the Global Impact [J]. Curr Environ Health Rep 7(2):140\u0026ndash;146\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHENG D, LIU Y (2020) Spatial variation and health risk assessment of fluoride in drinking water in the Chongqing urban areas, China [J]. Environ Geochem Health 42(9):2925\u0026ndash;2941\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI R, GONG Z, YU Y et al (2022) Alleviative Effects of Exercise on Bone Remodeling in Fluorosis Mice [J]. Biol Trace Elem Res 200(3):1248\u0026ndash;1261\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG J, XU H, CHENG X et al (2020) Calcium relieves fluoride-induced bone damage through the PI3K/AKT pathway [J]. Food Funct 11(1):1155\u0026ndash;1164\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI H, HAO Z, WANG L et al (2022) Dietary Calcium Alleviates Fluorine-Induced Liver Injury in Rats by Mitochondrial Apoptosis Pathway [J]. Biol Trace Elem Res 200(1):271\u0026ndash;280\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI H, FAN J, ZHAO Y et al (2021) Calcium alleviates fluoride-induced kidney damage via FAS/FASL, TNFR/TNF, DR5/TRAIL pathways in rats [J]. Ecotoxicol Environ Saf 226:112851\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHOU J (2023) Necessity to Pay Attention to the Effects of Low Fluoride on Human Health: an Overview of Skeletal and Non-skeletal Damages in Epidemiologic Investigations and Laboratory Studies [J]. Biol Trace Elem Res 201(4):1627\u0026ndash;1638\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXIONG X, LIU J, HE W et al (2007) Dose-effect relationship between drinking water fluoride levels and damage to liver and kidney functions in children [J]. Environ Res 103(1):112\u0026ndash;116\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCAGLAYAN C, KANDEMIR F M DARENDELIOGLUE et al (2021) Hesperidin protects liver and kidney against sodium fluoride-induced toxicity through anti-apoptotic and anti-autophagic mechanisms [J]. Life Sci 281:119730\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMALIN A J, LESSEUR C, BUSGANG S A et al (2019) Fluoride exposure and kidney and liver function among adolescents in the United States: NHANES, 2013\u0026ndash;2016 [J]. Environ Int 132:105012\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI Q, LI W, LAI Y et al (2021) [Analysis on results of occupational health examination in 677 workers exposed to inorganic fluorine] [J]. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi 39(5):382\u0026ndash;384\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHATTOPADHYAY A, PODDER S (2011) Fluoride-induced histopathology and synthesis of stress protein in liver and kidney of mice [J]. Arch Toxicol 85(4):327\u0026ndash;335\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKHAN RS, BRIL F, CUSI K et al (2019) Modulation of Insulin Resistance in Nonalcoholic Fatty Liver Disease [J]. Hepatology 70(2):711\u0026ndash;724\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTANASE D M, GOSAV E M, COSTEA C F et al (2020) The Intricate Relationship between Type 2 Diabetes Mellitus (T2DM), Insulin Resistance (IR), and Nonalcoholic Fatty Liver Disease (NAFLD) [J]. J Diabetes Res, 2020: 3920196\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eITAI K, ONODA T, NOHARA M et al (2021) Slightly Elevated Serum Ionic Fluoride Levels Inhibit Insulin Secretion and Increase Glucose Levels in a General Japanese Population: a Cross-sectional Study [J]. Biol Trace Elem Res 199(8):2819\u0026ndash;2825\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRUI L. Energy metabolism in the liver [J]. Compr Physiol, (2014) 4(1): 177\u0026ndash;197\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePEREIRA H A, LEITE ADE L, CHARONE S et al (2013) Proteomic analysis of liver in rats chronically exposed to fluoride [J]. PLoS ONE 8(9):e75343\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAGIUS L. Glucokinase and molecular aspects of liver glycogen metabolism [J]. Biochem J, (2008) 414(1): 1\u0026ndash;18\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG Y, LI W, BIAN Y et al (2023) Multifaceted roles of aerobic glycolysis and oxidative phosphorylation in hepatocellular carcinoma [J]. PeerJ 11:e14797\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMEJIAS M, GALLEGO J, NARANJO-SUAREZ S et al (2020) CPEB4 Increases Expression of PFKFB3 to Induce Glycolysis and Activate Mouse and Human Hepatic Stellate Cells, Promoting Liver Fibrosis [J]. Gastroenterology 159(1):273\u0026ndash;288\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePETERSEN MC (2018) SHULMAN G I. Mechanisms of Insulin Action and Insulin Resistance [J]. Physiol Rev 98(4):2133\u0026ndash;2223\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHAEUSLER R A, MCGRAW T E ACCILID (2018) Biochemical and cellular properties of insulin receptor signalling [J]. Nat Rev Mol Cell Biol 19(1):31\u0026ndash;44\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLIU J, JIANG S, ZHAO Y et al (2018) Geranylgeranyl diphosphate synthase (GGPPS) regulates non-alcoholic fatty liver disease (NAFLD)-fibrosis progression by determining hepatic glucose/fatty acid preference under high-fat diet conditions [J]. J Pathol 246(3):277\u0026ndash;288\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYU Q, DAI W (2022) Sodium butyrate inhibits aerobic glycolysis of hepatocellular carcinoma cells via the c-myc/hexokinase 2 pathway [J]. J Cell Mol Med 26(10):3031\u0026ndash;3045\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYING X D, WEI G (2021) Sodium butyrate relieves lung ischemia-reperfusion injury by inhibiting NF-kappaB and JAK2/STAT3 signaling pathways [J]. Eur Rev Med Pharmacol Sci 25(1):413\u0026ndash;422\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG HG, HUANG X D, SHEN P et al (2013) Anticancer effects of sodium butyrate on hepatocellular carcinoma cells in vitro [J]. Int J Mol Med 31(4):967\u0026ndash;974\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG K, YANG X, WU Z et al (2020) Dendrobium officinale Polysaccharide Protected CCl(4)-Induced Liver Fibrosis Through Intestinal Homeostasis and the LPS-TLR4-NF-kappaB Signaling Pathway [J]. Front Pharmacol 11:240\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYAO N, YANG Y, LI X et al (2022) Effects of Dietary Nutrients on Fatty Liver Disease Associated With Metabolic Dysfunction (MAFLD): Based on the Intestinal-Hepatic Axis [J]. Front Nutr 9:906511\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYU S Y XUL (2021) The interplay between host cellular and gut microbial metabolism in NAFLD development and prevention [J]. J Appl Microbiol 131(2):564\u0026ndash;582\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG N (2021) [Research progress of sodium butyrate in metabolic-associated fatty liver disease] [J]. Zhonghua Gan Zang Bing Za Zhi 29(12):1229\u0026ndash;1232\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXING X, JIANG Z, TANG X et al (2016) Sodium butyrate protects against oxidative stress in HepG2 cells through modulating Nrf2 pathway and mitochondrial function [J]. J Physiol Biochem 73(3):405\u0026ndash;414\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXU Y, PENG S, CAO X et al (2021) High doses of butyrate induce a reversible body temperature drop through transient proton leak in mitochondria of brain neurons [J]. Life Sci 278:119614\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAMOEDO ND, RODRIGUES M F, PEZZUTO P et al (2011) Energy metabolism in H460 lung cancer cells: effects of histone deacetylase inhibitors [J]. PLoS ONE 6(7):e22264\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFOOTE A P, ZAREK C M KUEHNLA et al (2017) Effect of abomasal butyrate infusion on gene expression in the duodenum of lambs [J]. J Anim Sci 95(3):1191\u0026ndash;1196\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGONCALVES P (2013) Butyrate and colorectal cancer: the role of butyrate transport [J]. Curr Drug Metab 14(9):994\u0026ndash;1008\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMORAND C, BESSON C, DEMIGNE C et al (1994) Importance of the modulation of glycolysis in the control of lactate metabolism by fatty acids in isolated hepatocytes from fed rats [J]. Arch Biochem Biophys 309(2):254\u0026ndash;260\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"fluoride exposure, glycolysis, sodium butyrate, liver injury","lastPublishedDoi":"10.21203/rs.3.rs-4563409/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4563409/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eAim\u003c/h2\u003e \u003cp\u003eAt present, liver injury caused by fluoride exposure has been found in animals and humans, but there is a lack of relevant drug treatments and research on the corresponding underlying mechanisms. Sodium butyrate is a new drug used to improve glucose metabolism that has been shown to have a positive effect on liver injury, but it has not been extensively studied in the field of liver injury caused by fluoride exposure. Therefore, in this study, exposure to fluoride in drinking water was used to establish a subchronic fluoride exposure mouse model to explore the specific metabolism-related mechanism by which sodium butyrate alleviates subchronic fluoride exposure-induced liver injury in mice to provide a theoretical basis for the prevention and treatment of endemic fluoride exposure-related liver injury.\u003c/p\u003e\u003ch2\u003eMaterials and methods\u003c/h2\u003e \u003cp\u003eIn the present study, the mice were randomly allocated into four groups of ten mice each group: the control group, the fluorine exposure group (NaF), the sodium butyrate group (NaB), and the treatment group (NaF\u0026thinsp;+\u0026thinsp;NaB).\u003c/p\u003e\u003ch2\u003eKey findings:\u003c/h2\u003e \u003cp\u003eNaF-induced hepatic injury was confirmed by alterations in the levels of liver enzymes (ALT and AST), glucose and the glycolytic metabolite lactate and alterations in the protein and mRNA expression levels of ALDOA, PKM2, PFKp, PGK1 and LDH. Concurrent administration of sodium butyrate and NaF significantly reversed the alterations in the abovementioned parameters.\u003c/p\u003e","manuscriptTitle":"Mechanism by which the inhibition of glycolysis by sodium butyrate alleviates liver injury in subchronic fluoride-exposed mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-01 03:51:05","doi":"10.21203/rs.3.rs-4563409/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"72cf0c37-22a9-45f2-9196-450dd6c9c560","owner":[],"postedDate":"July 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-31T19:14:21+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-01 03:51:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4563409","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4563409","identity":"rs-4563409","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-29T02:00:03.542394+00:00
License: CC-BY-4.0