The Potential Roles of 77C>T Variant and Growth Hormone-Releasing Hormone Elevation in Pituitary Adenoma Cases Associated with Acromegaly | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Potential Roles of 77C>T Variant and Growth Hormone-Releasing Hormone Elevation in Pituitary Adenoma Cases Associated with Acromegaly Thualfiqar Ghalib Turki, Khadija abbas Sahan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6106115/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Acromegaly (ACM) is an endocrine disorder characterized by the elevation of growth hormone-releasing hormone (GHRH), growth hormone (GH), and insulin-like growth factor-1 (IGF-1). Objectives: This study aims to elucidate the correlation between the 77C>T (rs368475481) variant in the GHRH gene and elevated growth hormone-releasing hormone levels in patients with acromegaly. Materials and Methods: This study, conducted from January to August 2024, analyzed 80 samples from Iraqi acromegaly patients collected at the Diabetic National Center, Al-Mustansiriyah University, alongside 80 samples from healthy individuals. Growth hormone and insulin-like growth factor-1 levels were quantified using chemiluminescence immunoassay, while growth hormone-releasing hormone levels were measured by enzyme-linked immunosorbent assay (ELISA). The 77C>T (rs368475481) SNP was detected via Sanger sequencing to assess genetic variation between acromegaly patients and healthy controls. Results: The serum levels of GHRH, GH, and IGF-1 were elevated in acromegaly patients compared to controls. The genetic results indicate the presence of the rs368475481 variation in the amplified fragment of the GHRH gene (a 791 bp amplicon including exons 2 and 3, and intron 2), with the CC homozygous genotype observed in 80 (100%) of controls and 40 (50%) of acromegaly patients. The CT heterozygous genotype was present in 40 (50%) of acromegaly patients. Conclusion: The elevated levels of growth hormone-releasing hormone and the GHRH 77C>T rs368475481 polymorphism in the GHRH gene were shown to be associated with pituitary adenomas, which cause acromegaly. Cancer Biology Molecular Biology Growth-Hormone Releasing Hormone Acromegaly Growth Hormone Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Pituitary adenomas are various types of tumors that occur in the anterior pituitary. The classification of pituitary adenomas depends on the origin of the cell and the size of the tumor. Additionally, most pituitary tumors are benign and slow-growing [ 1 ]. Acromegaly is a chronic clinical disorder and a rare endocrine disease caused by a non-cancerous tumor in the adenohypophysis. It is one of the rare chronic neuroendocrine disorders, arising from excessive secretion of growth hormone after the closure of growth plates, leading to increased production of insulin-like growth factor-1[ 2 ]. Neurologist Pierre Marie discovered and diagnosed acromegaly in 1886. He was the first to scientifically describe the somatic growth tumor and coined the term 'acromegaly' to define it as a distinct clinical disease [ 3 ]. In about 95% of cases, the increased production of growth hormone is due to a benign tumor called a pituitary somatotroph adenoma[ 4 ]. Acromegaly affects approximately 60 people per million, with an annual incidence of 3 to 4 new cases per million [ 5 , 6 ]. Diabetes mellitus, hypertension, sleep apnea, respiratory failure, cardiomyopathy with progression to heart failure, and hypogonadism are hallmark clinical indicators of the disease[ 7 ]. The exact onset of the disease cannot be determined, and the signs of acromegaly may remain undetected or unchanged for a long time, leading to a delayed diagnosis of approximately 10 to 11 years [ 8 ]. Somatocrinin, also known as growth hormone-releasing hormone, is a neuropeptide composed of a single polypeptide chain containing 44 amino acids. It is secreted by the hypothalamus, specifically from the arcuate nucleus region. GHRH receptors (GHRH-R) are located on somatotropic cells in the pituitary gland, where the binding of GHRH to its receptor stimulates the synthesis and secretion of growth hormone. Notably, GHRH and its receptor are expressed in various extra-hypothalamic locations, including tumor cell lines derived from human cancers, and have been observed in surgical specimens[ 9 ]. The growth hormone-releasing hormone gene comprises five exons and is located on chromosome 20 at position 11.23[ 10 ]. In some cases of acromegaly, patients show resistance to treatment targeting GH-secreting pituitary adenomas. This condition, termed ectopic acromegaly, primarily results from increased levels of GHRH, as somatotroph adenoma cells may also secrete GHRH. Thus, GHRH measurement has emerged as a valuable diagnostic tool for acromegaly[ 11 , 12 ]. Elevated GHRH levels are considered an effective diagnostic marker for ectopic acromegaly and an indicator of disease activity following surgical intervention, as well as a sensitive marker for detecting disease recurrence[ 13 ]. When a pituitary tumor arises in somatotropic cells, irregular GH production manifests as common symptoms of acromegaly. Consequently, the primary treatment goal is to decrease or normalize GH and IGF-1 levels, which suppresses somatotroph adenoma activity or reduces tumor size[ 14 ]. GH production in the pituitary is regulated by a balance between ghrelin and GHRH. In the hypothalamic arcuate nucleus, where ghrelin co-localizes with GHRH, ghrelin can directly stimulate GHRH secretion[ 15 ]. Acromegaly is also associated with diabetes mellitus and metabolic syndrome[ 16 ]. Growth hormone is the primary hormone pathologically affected in acromegaly[ 17 ]. In acromegaly, GH and insulin-like growth factor 1 play central roles, exerting direct and indirect effects on disease progression. Excess GH secretion from the pituitary gland stimulates liver cells to increase IGF-1 production, which in turn promotes abnormal growth of bones and body tissues[ 18 ]. Mortality rates in acromegaly patients with elevated GH and IGF-1 levels are approximately 2.6 to 3.5 times higher than in the general population[ 19 ]. Regulating or reducing GH and IGF-1 levels can help bring acromegaly patient mortality rates closer to those of the general population. In clinical studies on acromegaly, drug efficacy is often assessed by monitoring GH and IGF-1 levels[ 20 ]. Materials and Methods Samples Collection Blood samples were collected from acromegaly patients at the Diabetic National Center in Al-Mustansiriyah University between January to August 2024. All participants had a history of pituitary adenoma for over one year and were receiving monthly long-acting octreotide injections for the same duration. A total of 160 samples were divided into two groups: the first group consisted of 80 samples from acromegaly patients, while the second group included 80 samples from healthy controls. Genomic DNA Isolation and Genotyping DNA extraction: DNA extraction from whole blood was performed according to the instructions provided in the Geneaid catalog (catalog numbers GS004, GS100, GS300). The isolated genomic DNA from all samples in this study was analyzed using NanoDrop spectrophotometers. All DNA samples were measured at 260/280 nm to assess their purity. Primer design: Primer-Blast at NCBI, based on NC_000020.11, was used to design a primer for detecting the (rs566092278) SNP in the GHRH gene. Table 1 Primer sequence and PCR product size for the (rs566092278) C/T SNP in the GHRH gene. GENE T m PRIMER COD Sequence description (5 − 3)Sequence Amplicon size bp GHRH 62 F1 CTGCAGGGTGTGGGAAGAAA 790 R1 GCTCCATCACGCCCATTCTA Table 2 Levels of GHRH, GH, and IGF-1 in control and patients (Means ± standard deviation) Groups GHRH GH IGF-1 Control 10.63 ± 0.91 3.91 ± 0.34 287.3 ± 17.7 Patients 153.2 ± 18.1 9.48 ± 0.74 577.2 ± 18.01 P-value 0.00001* 0.0005* 0.0001* (P < 0.05): *Significant Different letters between any two means vertically denote to the significant difference at P < 0.05 Table 3 Correlation Among Studied Parameters in Acromegaly Patients Parameters Correlation and P-value GH IGF GHRH GH R 1 P value 0 IGF R 0.515** 1 P value 0 0 GHRH R 0.551** 0.382** 1 P value 0 0 0 ** Correlation is significant at P < 0.01 Table 4 Genotype and Allele Frequencies for the (rs368475481) variant in the GHRH Gene. Genotype Patients No.=80 Control No.=80 X 2 P-value OR Etiological fraction 95% CI No. % No. % CC 40 50 80 100 30 0.012* 0.012 0.31 0.007 to 0.2077 CT 40 50 0 0 30 0.012* 81 0.18 4.8150 to 1362.62 TT 0 0 0 0 0 1 0.503 0 0.009 to 25.82 Alleles C 120 75 80 100 24 0.005* 0.01 0.4 0.0011 to 0.3049 T 40 25 0 0 24 0.005* 54.11 0 3.2802 to 892.66 * Significant difference at P < 0.05 Table 5 Association of the (rs368475481) variant with GHRH Concentrations in Acromegaly Patients (Mean ± SE). Gene SNP Parameters Groups Genotypes (mean ± SE) P-value CC CT TT rs368475481 GHRH Patients 118.2 ± 22.7 204.2 ± 26.7 - 0.017* * Significant difference at P T Missense rs566092278 81C > T Missense rs368475481 95A > T Missense Novel 297A > T Intronic Novel 456G > C Silent Novel 484T > A Missense rs1211791568 631T > A Intronic Novel PCR master mix preparation: The primer was purchased as lyophilized powder from BIONEAR (KOREA). PROMEGA PCR Master Mix was used in the PCR experiment (PROMEGA, USA). Each PCR reaction was performed in a total volume of 50 µl and contained 25 µl of Master Mix, 2 µl of genomic DNA, 2 µl each of the F1 and F2 primers, and 19 µl of nuclease-free water. The conventional PCR protocol for amplifying the GHRH gene in this study included six steps: (1) Initial denaturation at 94°C for 3 minutes (1 cycle); (2) Denaturation at 94°C for 30 seconds (35 cycles); (3) Annealing at 62°C for 30 seconds (35 cycles); (4) Extension at 72°C for 1 minute (35 cycles); (5) Final extension at 72°C for 1 minute (1 cycle); and (6) Final holding at 4°C for 4 minutes. Statistical Analysis: A statistical study was conducted using the Statistical Package for Social Sciences (SPSS version 26, Inc., Chicago, IL, USA) and Microsoft Excel. The results and findings of the current study were analyzed. P-value significance was determined when the value was less than 0.05 (P < 0.05), and Odds Ratio (OR) and 95% Confidence Interval were also calculated. Ethical Approval: The study was conducted in accordance with the ethical principles originating from the Declaration of Helsinki. The study protocol and the subject information and consent form were reviewed and approved by a local ethics committee under document number 1742 on November 24, 2022, from AL-Qassim Green University/College of Biotechnology. Results Biochemical results: Growth hormone-releasing hormone was measured in the blood serum of all acromegaly patients and healthy controls. Results showed that GHRH is significantly increased in acromegaly patients compared to healthy controls, with a P-value of 0.00001. The mean serum GHRH concentration in the acromegaly patient group is 153.2 ± 18.1 pg/ml, compared with 10.63 ± 0.91 pg/ml in the healthy control group. There was a statistically significant difference between the mean values of the two groups (control and patients). This result is shown in Table 2. The study results note that there is an increase in the mean average in the patient group compared to the healthy controls. Growth hormone was measured in the blood serum of all acromegaly patients and healthy controls. Results showed that GH is significantly increased in acromegaly patients compared to healthy controls, with a P-value of 0.0005. The mean serum GH concentration in the acromegaly patient group is 9.48 ± 0.74 ng/ml, compared with 3.31 ± 0.34 ng/ml in the healthy control group. There was a statistically significant difference between the mean values of the two groups (control and patients). This result is shown in Table 2. The study results note that there is an increase in the mean average in the patient group compared to the healthy group. Insulin-like Growth Factor -1 was measured in the blood serum of all acromegaly patients and healthy controls. Results showed that IGF-1 is significantly increased in acromegaly patients compared to healthy controls, with a P-value of 0.0005. The mean serum IGF-1 concentration in the acromegaly patient group is 577.2±18.01 ng/ml, compared with 287.3±17.7 ng/ml in the healthy control group. There was a statistically significant difference between the mean values of the two groups (control and patients). This result is shown in Table 2. The study results note that there is an increase in the mean average in the patient group compared to the healthy group. Table 3 illustrates the examination of 80 acromegaly patients. The results of the association between GHRH concentration and the parameters estimated in this study are presented. For IGF-1, there are statistically significant differences (P < 0.01) between IGF-1 and GH (P-value = 0), indicating that IGF-1 has a statistically significant correlation with GH (R = 0.515). For GHRH, there are significant differences (P < 0.01) between GHRH, GH, and IGF-1 (P-value = 0), showing that GHRH has statistically significant correlations with GH (R = 0.551) and IGF-1 (R = 0.382). Molecular result A total of 160 samples were selected from the patient and control groups used in the molecular study; these were selected based on disorders in biochemical parameters for the patient group, which confirmed acromegaly, while the control group was selected based on regular biochemical parameters. This study was conducted to investigate the possible association of single nucleotide polymorphisms in the growth hormone-releasing hormone gene with ACM in a population consisting of eighty controls (assigned C1–C80) and eighty patients (assigned P1–P80) in Iraq. DNA Extraction Result Genomic DNA was isolated from 160 samples, including 80 individuals with ACM and 80 apparently healthy control individuals. The quality of the DNA samples was also checked by electrophoresis on a 0.8% agarose gel and was of high integrity, with distinct bands at the top of the gel indicating high-quality, non-degraded genomic DNA (Fig. 1). The target fragment of the GHRH gene included exons 2 and 3 and intron 2. After optimization of PCR amplification conditions, 60°C was selected as the annealing temperature (Fig. 2). Electrophoresis was performed on all PCR product samples (Fig. 3). Sequencing Result In the present study, the investigated sequences of the GHRH geneare suited to chromosome 20. The GHRH gene encodes for the growth hormone-releasing hormone, which stimulates the secretion of growth hormone (https://www.uniprot.org/uniprotkb/P01286/entry).The sequence reaction indicated the exact identity of this genetic fragment after performing NCBI blastn(https://blastn.ncbi.gov.Blast.cgi). Concerning the currently investigated 791 bp amplicons of the GHRH gene, the NCBI BLASTn engine showed up to 99% sequence similarities between the sequenced samples and the intended reference target sequences, which completely cover all the exon 2 and exon 3 and some of their upstream and downstream portions. By comparing the observed DNA sequences of these investigated samples with the retrieved DNA sequences (GenBank acc. NC_000020.11), the accurate positions and other details of the retrieved PCR fragments were identified (Fig. 4). Sequencing analysis for the 77C>T (rs368475481) variant in the GHRH gene revealed distinct allele and genotype distributions between the control and acromegaly groups. In the control group, allele C was observed in all samples (80/80, 100%), whereas in the acromegaly patient group, allele C was present in 75% (120/160), with allele T exclusively found in the patient group at a frequency of 25% (40/160). Genotype distributions in the control group were as follows: CC in 100% (80/80), with no occurrences of CT or TT. In contrast, among acromegaly patients, CC was present in 50% (40/80), CT in 50% (40/80), and TT was absent. Notably, the CT heterozygous genotype showed a statistically significant association with acromegaly compared to controls (0% vs. 50%, P < 0.05; OR = 81, 95% CI = 4.82–1362.62, χ² = 30, etiological fraction = 0.18, P = 0.012). These data suggest that the presence of the CT genotype may be a specific marker for acromegaly, as it was identified solely within the patient cohort. A detailed summary of these findings is provided in Table 4. Table 5 details the analysis of GHRH concentrations by genotype among 80 acromegaly patients, highlighting the association between GHRH levels and the rs368475481 variant. Statistically significant differences (P < 0.05) in GHRH levels were observed between the CC and CT genotypes, with mean concentrations of 118.2 ± 22.7 pg/ml and 204.2 ± 26.7 pg/ml, respectively (P-value = 0.017* ). The CT genotype was associated with elevated GHRH serum levels. The sequence result of fragment encompassing exons 2 and 3 and intron 2 of the GHRH gene also included six other variants, illustrated in Table 6. In these plots, LD values between any two variants are graphically displayed using standard colored triangles, ranging from white (indicating low LD values) to red (indicating high LD values). In the analyzed 791 bp region of the GHRH amplicons, seven retrieved variants (rs368475481, rs566092278, 95A>T, 297T>A, 456G>C, rs1211791568, and 631T>A) were found to be distributed across seven distinct loci. Our LD analyses showed that the first three SNPs formed a single block and exhibited complete homology among them (Fig. 5). Within this block, the first three identified SNPs (rs368475481, rs566092278, and 95A>T) exhibited complete co-inheritance. In contrast, other identified blocks exhibited varying degrees of co-inheritance, reflecting different recombination ratios among these polymorphic loci. Discussion The results of the current study demonstrated that the elevation of GHRH concentration in serum correlates with acromegaly. This finding is consistent with the results of Gesmundo et al . (2021), which showed that the use of MIAMI class GHRH antagonists (MIA-602 and MIA-690) inhibited cell growth and availability, as well as promoted apoptosis in GH/prolactin-secreting GH3 pituitary adenoma cells transfected with the human GHRH receptor[21]. A study by Giustina et al . (2017) demonstrated that the hypothalamus produces GHRH, which enters the portal system, targets somatotroph cells, binds to specific surface receptors, and triggers intracellular signaling that regulates pituitary GH synthesis and secretion. Hypothalamic tumors, including hamartomas, choristomas, gliomas, and gangliocytomas, may lead to excessive GHRH production, resulting in GH hypersecretion and subsequent acromegaly. Affected patients may experience somatotroph hyperplasia or, more rarely, pituitary GH-cell adenomas, supporting the concept that excess hypothalamic GHRH can induce pituitary hyperplasia and, subsequently, adenoma formation[22]. These results align with findings by Borson et al . (2012), who investigated GHRH expression across various tumor types and reported its presence in 25% of endocrine tumors, particularly in pheochromocytomas, gastroenteropancreatic tumors, and small-cell lung carcinomas. GHRH expression was rare in non-endocrine tumors, with one reported case of a GHRH-secreting tumor associated with both pituitary hyperplasia and somatotroph adenoma[23]. With regard to the identified 77C>T variant, it was found that this SNP is deposited in the database under the name rs368475481 (Fig. 4).This SNP was detected at an extremely low frequency within the coding sequences of the GHRH gene, with the deposited frequency of the T allele being 0.00007 (as referenced in NCBI SNP rs368475481). In contrast, the frequency of this allele in the present study was found to be 33.3%. This observation indicates a remarkable difference between the study population and the reference data. Furthermore, this SNP results in a missense variation in the encoded protein, specifically NP_001171660.1:p.Arg51His. The C77T variant causes a change in the amino acid sequence, substituting arginine, which has a positively charged guanidino group, with histidine, which contains an imidazole group. Histidine is unique among common amino acids due to its ionizable side chain with a pKa close to neutrality. In many enzyme-catalyzed reactions, a histidine residue can facilitate the reaction by acting as a proton donor or acceptor. To date, no publications have mentioned this SNP in PubMed indices, making this study the first investigation of the variant in available databases. The homozygous CC genotype of rs368475481, representing the wild-type allele, was observed in both control and acromegaly patient groups and showed no association with acromegaly. In contrast, the heterozygous CT genotype was identified exclusively in 50% (40/80) of acromegaly patients and was absent in controls, indicating a strong association with acromegaly in this population. These findings suggest that the CT genotype may serve as a potential marker for diagnosing acromegaly. Conclusion Elevated growth hormone-releasing hormone levels are linked to acromegaly cases in which somatotroph tumors produce GHRH, thereby stimulating pituitary adenomas to secrete growth hormone. This GH overproduction subsequently prompts the liver to increase insulin-like growth factor-1 secretion. Additionally, the 77C>T (rs368475481) variant has been strongly associated with pituitary adenoma development, contributing to the incidence of acromegaly in Iraqi patients. References Molitch M. E. (2017). Diagnosis and Treatment of Pituitary Adenomas: A Review. JAMA, 317(5), 516–524. https://doi.org/10.1001/jama.2016.19699 Fleseriu, M., Langlois, F., Lim, D. S. T., Varlamov, E. V., & Melmed, S. (2022). Acromegaly: pathogenesis, diagnosis, and management. The lancet. Diabetes & endocrinology, 10(11), 804–826. https://doi.org/10.1016/S2213-8587(22)00244-3 Quaranta, M., Orsini, E., Zoli, M., Ratti, S., Maltoni, L., Leonardi, L., & Manzoli, L. (2020). An early scientific report on acromegaly: solving an intriguing endocrinological (c)old case?. Hormones (Athens, Greece), 19(4), 611–618. https://doi.org/10.1007/s42000-020-00175-0 Aagaard, C., Christophersen, A. S., Finnerup, S., Rosendal, C., Gulisano, H. A., Ettrup, K. S., Vestergaard, P., Karmisholt, J., Nielsen, E. H., & Dal, J. (2022). The prevalence of acromegaly is higher than previously reported: Changes over a three-decade period. Clinical endocrinology, 97(6), 773–782. https://doi.org/10.1111/cen.14828 Lavrentaki, A., Paluzzi, A., Wass, J. A., & Karavitaki, N. (2017). Epidemiology of acromegaly: review of population studies. Pituitary, 20(1), 4–9. https://doi.org/10.1007/s11102-016-0754-x Fernandez, A., Karavitaki, N., & Wass, J. A. (2010). Prevalence of pituitary adenomas: a community-based, cross-sectional study in Banbury (Oxfordshire, UK). Clinical endocrinology, 72(3), 377–382. https://doi.org/10.1111/j.1365-2265.2009.03667.x. Slagboom, T. N. A., van Bunderen, C. C., De Vries, R., Bisschop, P. H., & Drent, M. L. (2023). Prevalence of clinical signs, symptoms and comorbidities at diagnosis of acromegaly: a systematic review in accordance with PRISMA guidelines. Pituitary, 26(4), 319–332. https://doi.org/10.1007/s11102-023-01322-7 Wu, J. C., Huang, W. C., Chang, H. K., Ko, C. C., Lirng, J. F., & Chen, Y. C. (2020). Natural History of Acromegaly: Incidences, Re-operations, Cancers, and Mortality Rates in a National Cohort. Neuroendocrinology, 110(11-12), 977–987. https://doi.org/10.1159/000505332 Gesmundo, I., Pedrolli, F., Cai, R., Sha, W., Schally, A. V., & Granata, R. (2024). Growth hormone-releasing hormone and cancer. Reviews in endocrine & metabolic disorders, 10.1007/s11154-024-09919-4. Advance online publication. https://doi.org/10.1007/s11154-024-09919-4 Deloukas, P., Matthews, L. H., Ashurst, J., Burton, J., Gilbert, J. G., Jones, M., Stavrides, G., Almeida, J. P., Babbage, A. K., Bagguley, C. L., Bailey, J., Barlow, K. F., Bates, K. N., Beard, L. M., Beare, D. M., Beasley, O. P., Bird, C. P., Blakey, S. E., Bridgeman, A. M., Brown, A. J., … Rogers, J. (2001). The DNA sequence and comparative analysis of human chromosome 20. Nature, 414(6866), 865–871. https://doi.org/10.1038/414865a Zendran, I., Gut, G., Kałużny, M., Zawadzka, K., & Bolanowski, M. (2022). Acromegaly Caused by Ectopic Growth Hormone Releasing Hormone Secretion: A Review. Frontiers in endocrinology, 13, 867965. https://doi.org/10.3389/fendo.2022.867965 Akirov, A., Masri-Iraqi, H., Dotan, I., & Shimon, I. (2021). The Biochemical Diagnosis of Acromegaly. Journal of clinical medicine , 10 (5), 1147. https://doi.org/10.3390/jcm10051147 Fainstein-Day, P., Ullmann, T. E., Dalurzo, M. C. L., Sevlever, G. E., & Smith, D. E. (2024). The clinical and biochemical spectrum of ectopic acromegaly. Best practice & research. Clinical endocrinology & metabolism, 38(3), 101877. https://doi.org/10.1016/j.beem.2024.101877 Ershadinia, N., & Tritos, N. A. (2022). Diagnosis and Treatment of Acromegaly: An Update. Mayo Clinic proceedings, 97(2), 333–346. https://doi.org/10.1016/j.mayocp.2021.11.007 Devesa, J. (2021). The complex world of regulation of pituitary growth hormone secretion: the role of ghrelin, klotho, and nesfatins in it. Frontiers in Endocrinology, 12, 636403. Turki, T. G., & Ammar, J. W. (2024). Role of gonadotropin-releasing hormone, leptin hormone, luteinizing hormone, follicle-stimulating hormone, and obesity in polycystic ovarian syndrome. Int. J. Sci. Res. in Biological Sciences Vol, 11(4). Maffezzoni, F., Porcelli, T., Delbarba, A., Pezzaioli, L., Cappelli, C., & Ferlin, A. (2020). Biomarkers of Acromegaly and Growth Hormone Action. Protein and peptide letters, 27(12), 1231–1245. https://doi.org/10.2174/0929866527666200420103816 Peixe, C., Sánchez-García, M., Grossman, A. B., Korbonits, M., & Marques, P. (2022). Biochemical discrepancies in the evaluation of the somatotroph axis: Elevated GH or IGF-1 levels do not always diagnose acromegaly. Growth Hormone & IGF Research, 64, 101467. Holdaway, I. M., Rajasoorya, R. C., & Gamble, G. D. (2004). Factors influencing mortality in acromegaly. The Journal of clinical endocrinology and metabolism, 89(2), 667–674. https://doi.org/10.1210/jc.2003-031199 Campana, C., Cocchiara, F., Corica, G., Nista, F., Arvigo, M., Amarù, J., Rossi, D. C., Zona, G., Ferone, D., & Gatto, F. (2021). Discordant GH and IGF-1 Results in Treated Acromegaly: Impact of GH Cutoffs and Mean Values Assessment. The Journal of clinical endocrinology and metabolism, 106(3), 789–801. https://doi.org/10.1210/clinem/dgaa859 Gesmundo, I., Granato, G., Fuentes-Fayos, A. C., Alvarez, C. V., Dieguez, C., Zatelli, M. C., Congiusta, N., Banfi, D., Prencipe, N., Leone, S., Brunetti, L., Castaño, J. P., Luque, R. M., Cai, R., Sha, W., Ghigo, E., Schally, A. V., & Granata, R. (2021). Antagonists of Growth Hormone-Releasing Hormone Inhibit the Growth of Pituitary Adenoma Cells by Hampering Oncogenic Pathways and Promoting Apoptotic Signaling. Cancers, 13(16), 3950. https://doi.org/10.3390/cancers13163950 Giustina, A., Biermasz, N., Casanueva, F. F., Fleseriu, M., Mortini, P., Strasburger, C., van der Lely, A. J., Wass, J., Melmed, S., & Acromegaly Consensus Group (2024). Correction: consensus on criteria for acromegaly diagnosis and remission. Pituitary, 27(1), 88. https://doi.org/10.1007/s11102-023-01373-w Borson-Chazot, F., Garby, L., Raverot, G., Claustrat, F., Raverot, V., Sassolas, G., & GTE group (2012). Acromegaly induced by ectopic secretion of GHRH: a review 30 years after GHRH discovery. Annales d'endocrinologie, 73(6), 497–502. https://doi.org/10.1016/j.ando.2012.09.004 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6106115","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":420780964,"identity":"4bbb4acf-ac64-41bd-9217-c52019dd820a","order_by":0,"name":"Thualfiqar Ghalib Turki","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYFAC5oYPCUCKjZn5AJCSkCGogYeBsXEGSAsfexuIkuAhTguIIcdzxgAiQAjYsx9sbHhQZpfPJpHz+dWNGgseBvbDRzfgtYUnsbEh4VyyZZtE7jbrnGNAh/Gkpd3A77DE9geJbcwGbEAtxjlsQC0SPGb4tfA/bGxIbKsHasl5ZpzzjxgtEokgLYcN2HjOMD/ObSNGy42HIL8cN2BjbzNjzu2T4GEj5Bf2/uSDjT/Kqg3km5kff875VifHz374GF4tEMAGISUQbCK1MH8gTvUoGAWjYBSMNAAA9flE4IA/8HMAAAAASUVORK5CYII=","orcid":"https://orcid.org/0009-0004-4674-2410","institution":"Al-Qasim Green University","correspondingAuthor":true,"prefix":"","firstName":"Thualfiqar","middleName":"Ghalib","lastName":"Turki","suffix":""},{"id":420781931,"identity":"126b9942-404f-438a-b3b2-9445bb6bd637","order_by":1,"name":"Khadija abbas Sahan","email":"","orcid":"","institution":"Institution University of information Technology and Communications","correspondingAuthor":false,"prefix":"","firstName":"Khadija","middleName":"abbas","lastName":"Sahan","suffix":""}],"badges":[],"createdAt":"2025-02-25 14:26:06","currentVersionCode":1,"declarations":{"humanSubjects":true,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":true,"humanSubjectConsent":true,"humanSubjectClinicalTrial":true,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-6106115/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6106115/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":77358074,"identity":"7f5104e5-4418-43cd-941a-9a0955603489","added_by":"auto","created_at":"2025-02-27 18:26:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":116370,"visible":true,"origin":"","legend":"\u003cp\u003eIntegrity of genomic DNA extracted from the blood of representative samples. The DNA was run on a 0.8% agarose gel at 75 volts for 60 minutes, stained in 500 ml of 1X TBE buffer containing 0.6 μg of ethidium bromide, and then visualized by a UV transilluminator. Lane order: Lanes 1–5 show DNA extracted from healthy individuals, and lanes 6–12 show DNA from patients' samples with acromegaly.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6106115/v1/57ee67f5d7168b60efe9622e.png"},{"id":77357244,"identity":"cd68b56d-963c-44b2-ba94-f107a55583f9","added_by":"auto","created_at":"2025-02-27 18:18:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":417363,"visible":true,"origin":"","legend":"\u003cp\u003eOptimization of PCR amplification conditions for exons 2 and 3, and intron 2 of the GHRH gene using conventional PCR. The PCR products were run on a 1.5% agarose gel at 70 volts for 90 minutes, followed by visualization under a UV transilluminator. Lane order: lanes 1-3 represent samples from control individuals, while lanes 4-9 correspond to acromegaly patient samples. Lane M indicates a 100 bp DNA ladder. The annealing temperatures (T\u003csub\u003eM\u003c/sub\u003e) range from 54°C in lane 1 to 62°C in lane 9.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6106115/v1/73a238d58493745bfe751b2d.png"},{"id":77357246,"identity":"b08063c4-e8c8-4ff0-b861-0ca31aaa27e8","added_by":"auto","created_at":"2025-02-27 18:18:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":114834,"visible":true,"origin":"","legend":"\u003cp\u003ePCR amplification of a 791 bp fragment encompassing exons 2 and 3, and intron 2 of the GHRH gene. Lanes 1-5 show PCR products from healthy individuals, while lanes 6-11 represent PCR products from acromegaly patient samples. Lane M contains a 100 bp DNA ladder. Electrophoresis was performed on a 1.5% (w/v) agarose gel stained with ethidium bromide (0.6 μg/ml) and run in TBE buffer at 70 V for 80 minutes.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6106115/v1/c9678553e675b83a2f3a46aa.png"},{"id":77358075,"identity":"2ab42577-cd0a-46f3-827f-076871c279ed","added_by":"auto","created_at":"2025-02-27 18:26:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":94892,"visible":true,"origin":"","legend":"\u003cp\u003eIllustrated SNP annotations for GHRH genetic single nucleotide polymorphisms using the dbSNP server. The identified known SNPs were marked in blue. GenBank accession number NC_000020.11 was used to position the identified SNPs in the GHRH gene. The targeted sequences are located on the positive strand.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6106115/v1/040adad9b761ba9d968a9a6a.png"},{"id":77358076,"identity":"b86153be-7805-4633-b2b9-bdfee83f99c9","added_by":"auto","created_at":"2025-02-27 18:26:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":296712,"visible":true,"origin":"","legend":"\u003cp\u003eLinkage disequilibrium graphical representation among all possible pairs of seven variants observed in the amplified 791 bp fragment of the \u003cem\u003eGHRH \u003c/em\u003egene using standard D'/LOD Color Scheme. LD values are expressed as differences in the shade of each color. The white color in the first rows refers to the low LD values among the adjacent loci. The blue and red colors in the second rows refer to the neutral and high LD values respectively among the non-adjacent loci. The numbers given at the top of the figure indicate the coordinate of sites in the 791 bp amplicon.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6106115/v1/391ca5b75f61f5f4e99c7c12.png"},{"id":77358971,"identity":"4de6b171-0030-410d-a104-664e988a4fd6","added_by":"auto","created_at":"2025-02-27 18:50:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1521751,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6106115/v1/69c44558-58c9-428a-bbd4-12d89b8ddcd0.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eThe Potential Roles of 77C\u0026gt;T Variant and Growth Hormone-Releasing Hormone Elevation in Pituitary Adenoma Cases Associated with Acromegaly\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePituitary adenomas are various types of tumors that occur in the anterior pituitary. The classification of pituitary adenomas depends on the origin of the cell and the size of the tumor. Additionally, most pituitary tumors are benign and slow-growing [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Acromegaly is a chronic clinical disorder and a rare endocrine disease caused by a non-cancerous tumor in the adenohypophysis. It is one of the rare chronic neuroendocrine disorders, arising from excessive secretion of growth hormone after the closure of growth plates, leading to increased production of insulin-like growth factor-1[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Neurologist Pierre Marie discovered and diagnosed acromegaly in 1886. He was the first to scientifically describe the somatic growth tumor and coined the term 'acromegaly' to define it as a distinct clinical disease [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In about 95% of cases, the increased production of growth hormone is due to a benign tumor called a pituitary somatotroph adenoma[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Acromegaly affects approximately 60 people per million, with an annual incidence of 3 to 4 new cases per million [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Diabetes mellitus, hypertension, sleep apnea, respiratory failure, cardiomyopathy with progression to heart failure, and hypogonadism are hallmark clinical indicators of the disease[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The exact onset of the disease cannot be determined, and the signs of acromegaly may remain undetected or unchanged for a long time, leading to a delayed diagnosis of approximately 10 to 11 years [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSomatocrinin, also known as growth hormone-releasing hormone, is a neuropeptide composed of a single polypeptide chain containing 44 amino acids. It is secreted by the hypothalamus, specifically from the arcuate nucleus region. GHRH receptors (GHRH-R) are located on somatotropic cells in the pituitary gland, where the binding of GHRH to its receptor stimulates the synthesis and secretion of growth hormone. Notably, GHRH and its receptor are expressed in various extra-hypothalamic locations, including tumor cell lines derived from human cancers, and have been observed in surgical specimens[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The growth hormone-releasing hormone gene comprises five exons and is located on chromosome 20 at position 11.23[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In some cases of acromegaly, patients show resistance to treatment targeting GH-secreting pituitary adenomas. This condition, termed ectopic acromegaly, primarily results from increased levels of GHRH, as somatotroph adenoma cells may also secrete GHRH. Thus, GHRH measurement has emerged as a valuable diagnostic tool for acromegaly[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Elevated GHRH levels are considered an effective diagnostic marker for ectopic acromegaly and an indicator of disease activity following surgical intervention, as well as a sensitive marker for detecting disease recurrence[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhen a pituitary tumor arises in somatotropic cells, irregular GH production manifests as common symptoms of acromegaly. Consequently, the primary treatment goal is to decrease or normalize GH and IGF-1 levels, which suppresses somatotroph adenoma activity or reduces tumor size[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. GH production in the pituitary is regulated by a balance between ghrelin and GHRH. In the hypothalamic arcuate nucleus, where ghrelin co-localizes with GHRH, ghrelin can directly stimulate GHRH secretion[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Acromegaly is also associated with diabetes mellitus and metabolic syndrome[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGrowth hormone is the primary hormone pathologically affected in acromegaly[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In acromegaly, GH and insulin-like growth factor 1 play central roles, exerting direct and indirect effects on disease progression. Excess GH secretion from the pituitary gland stimulates liver cells to increase IGF-1 production, which in turn promotes abnormal growth of bones and body tissues[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Mortality rates in acromegaly patients with elevated GH and IGF-1 levels are approximately 2.6 to 3.5 times higher than in the general population[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Regulating or reducing GH and IGF-1 levels can help bring acromegaly patient mortality rates closer to those of the general population. In clinical studies on acromegaly, drug efficacy is often assessed by monitoring GH and IGF-1 levels[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSamples Collection\u003c/h2\u003e \u003cp\u003eBlood samples were collected from acromegaly patients at the Diabetic National Center in Al-Mustansiriyah University between January to August 2024. All participants had a history of pituitary adenoma for over one year and were receiving monthly long-acting octreotide injections for the same duration. A total of 160 samples were divided into two groups: the first group consisted of 80 samples from acromegaly patients, while the second group included 80 samples from healthy controls.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGenomic DNA Isolation and Genotyping\u003c/h3\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction:\u003c/h2\u003e \u003cp\u003eDNA extraction from whole blood was performed according to the instructions provided in the Geneaid catalog (catalog numbers GS004, GS100, GS300). The isolated genomic DNA from all samples in this study was analyzed using NanoDrop spectrophotometers. All DNA samples were measured at 260/280 nm to assess their purity.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePrimer design:\u003c/h3\u003e\n\u003cp\u003ePrimer-Blast at NCBI, based on NC_000020.11, was used to design a primer for detecting the (rs566092278) SNP in the GHRH gene.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence and PCR product size for the (rs566092278) C/T SNP in the GHRH gene.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGENE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT\u003csub\u003em\u003c/sub\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePRIMER COD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence description (5\u0026thinsp;\u0026minus;\u0026thinsp;3)Sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAmplicon size bp\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGHRH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGCAGGGTGTGGGAAGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e790\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTCCATCACGCCCATTCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLevels of GHRH, GH, and IGF-1 in control and patients (Means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGHRH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIGF-1\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e287.3\u0026thinsp;\u0026plusmn;\u0026thinsp;17.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePatients\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e153.2\u0026thinsp;\u0026plusmn;\u0026thinsp;18.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e577.2\u0026thinsp;\u0026plusmn;\u0026thinsp;18.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.00001*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0005*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0001*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05): *Significant\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eDifferent letters between any two means vertically denote to the significant difference at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCorrelation Among Studied Parameters in Acromegaly Patients\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCorrelation and P-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIGF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGHRH\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIGF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.515**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGHRH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.551**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.382**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e** Correlation is significant at P\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenotype and Allele Frequencies for the (rs368475481) variant in the GHRH Gene.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ePatients No.=80\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eControl No.=80\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eX\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eOR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEtiological fraction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e95% CI\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.012*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.012\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.007 to 0.2077\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.012*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e4.8150 to 1362.62\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.503\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.009 to 25.82\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlleles\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"9\" nameend=\"c10\" namest=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e120\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.005*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.0011 to 0.3049\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.005*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e54.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3.2802 to 892.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"10\"\u003e* Significant difference at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAssociation of the (rs368475481) variant with GHRH Concentrations in Acromegaly Patients (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGene SNP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003eGenotypes (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTT\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ers368475481\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGHRH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePatients\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e118.2\u0026thinsp;\u0026plusmn;\u0026thinsp;22.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e204.2\u0026thinsp;\u0026plusmn;\u0026thinsp;26.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.017*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003e* Significant difference at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe variants found in the 791 bp fragment of the GHRH gene.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMutation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eType of mutation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003evariant novelty\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e77C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ers566092278\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e81C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ers368475481\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e95A\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNovel\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e297A\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIntronic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNovel\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e456G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSilent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNovel\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e484T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ers1211791568\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e631T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIntronic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNovel\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003ePCR master mix preparation:\u003c/h3\u003e\n\u003cp\u003eThe primer was purchased as lyophilized powder from BIONEAR (KOREA). PROMEGA PCR Master Mix was used in the PCR experiment (PROMEGA, USA). Each PCR reaction was performed in a total volume of 50 \u0026micro;l and contained 25 \u0026micro;l of Master Mix, 2 \u0026micro;l of genomic DNA, 2 \u0026micro;l each of the F1 and F2 primers, and 19 \u0026micro;l of nuclease-free water.\u003c/p\u003e \u003cp\u003eThe conventional PCR protocol for amplifying the GHRH gene in this study included six steps: (1) Initial denaturation at 94\u0026deg;C for 3 minutes (1 cycle); (2) Denaturation at 94\u0026deg;C for 30 seconds (35 cycles); (3) Annealing at 62\u0026deg;C for 30 seconds (35 cycles); (4) Extension at 72\u0026deg;C for 1 minute (35 cycles); (5) Final extension at 72\u0026deg;C for 1 minute (1 cycle); and (6) Final holding at 4\u0026deg;C for 4 minutes.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis:\u003c/h2\u003e \u003cp\u003eA statistical study was conducted using the Statistical Package for Social Sciences (SPSS version 26, Inc., Chicago, IL, USA) and Microsoft Excel. The results and findings of the current study were analyzed. P-value significance was determined when the value was less than 0.05 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and Odds Ratio (OR) and 95% Confidence Interval were also calculated.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eEthical Approval:\u0026nbsp;\u003c/strong\u003eThe study was conducted in accordance with the ethical principles originating from the Declaration of Helsinki. The study protocol and the subject information and consent form were reviewed and approved by a local ethics committee under document number 1742 on November 24, 2022, from AL-Qassim Green \u0026nbsp;University/College of Biotechnology.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eBiochemical results:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGrowth hormone-releasing hormone was measured in the blood serum of all acromegaly patients and healthy controls. Results showed that GHRH is significantly increased in acromegaly patients compared to healthy controls, with a P-value of 0.00001. The mean serum GHRH concentration in the acromegaly patient group is 153.2 ± 18.1 pg/ml, compared with 10.63 ± 0.91 pg/ml in the healthy control group. There was a statistically significant difference between the mean values of the two groups (control and patients). This result is shown in Table 2. The study results note that there is an increase in the mean average in the patient group compared to the healthy controls.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGrowth hormone \u0026nbsp;was measured in the blood serum of all acromegaly patients and healthy controls. Results showed that GH is significantly increased in acromegaly patients compared to healthy controls, with a P-value of 0.0005. The mean serum GH concentration in the acromegaly patient group is 9.48 ± 0.74 ng/ml, compared with 3.31 ± 0.34 ng/ml in the healthy control group. There was a statistically significant difference between the mean values of the two groups (control and patients). This result is shown in Table 2. The study results note that there is an increase in the mean average in the patient group compared to the healthy group. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInsulin-like Growth Factor -1 was measured in the blood serum of all acromegaly patients and healthy controls. Results showed that IGF-1 is significantly increased in acromegaly patients compared to healthy controls, with a P-value of 0.0005. The mean serum IGF-1 concentration in the acromegaly patient group is 577.2±18.01 ng/ml, compared with 287.3±17.7\u0026nbsp;ng/ml in the healthy control group. There was a statistically significant difference between the mean values of the two groups (control and patients). This result is shown in Table 2. The study results note that there is an increase in the mean average in the patient group compared to the healthy group. \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 3 illustrates the examination of 80 acromegaly patients. The results of the association between GHRH concentration and the parameters estimated in this study are presented. For IGF-1, there are statistically significant differences (P \u0026lt; 0.01) between IGF-1 and GH (P-value = 0), indicating that IGF-1 has a statistically significant correlation with GH (R = 0.515). For GHRH, there are significant differences (P \u0026lt; 0.01) between GHRH, GH, and IGF-1 (P-value = 0), showing that GHRH has statistically significant correlations with GH (R = 0.551) and IGF-1 (R = 0.382). \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular result\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 160 samples were selected from the patient and control groups used in the molecular study; these were selected based on disorders in biochemical parameters for the patient group, which confirmed acromegaly, while the control group was selected based on regular biochemical parameters. This study was conducted to investigate the possible association of single nucleotide polymorphisms in the growth hormone-releasing hormone gene with ACM in a population consisting of eighty controls (assigned C1–C80) and eighty patients (assigned P1–P80) in Iraq.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA Extraction Result\u003c/strong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGenomic DNA was isolated from 160 samples, including 80 individuals with ACM and 80 apparently healthy control individuals. The quality of the DNA samples was also checked by electrophoresis on a 0.8% agarose gel and was of high integrity, with distinct bands at the top of the gel indicating high-quality, non-degraded genomic DNA (Fig. 1).\u003c/p\u003e\n\u003cp\u003eThe target fragment of the GHRH gene included exons 2 and 3 and intron 2. After optimization of PCR amplification conditions, 60°C was selected as the annealing temperature (Fig. 2). Electrophoresis was performed on all PCR product samples (Fig. 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequencing Result\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the present study, the investigated sequences of the \u003cem\u003eGHRH\u0026nbsp;\u003c/em\u003egeneare suited to chromosome 20. The \u003cem\u003eGHRH\u0026nbsp;\u003c/em\u003egene encodes for the growth hormone-releasing hormone, which stimulates the secretion of growth hormone (https://www.uniprot.org/uniprotkb/P01286/entry).The sequence reaction indicated the exact identity of this genetic fragment after performing NCBI blastn(https://blastn.ncbi.gov.Blast.cgi).\u003c/p\u003e\n\u003cp\u003eConcerning the currently investigated 791 bp amplicons of the GHRH gene, the NCBI BLASTn engine showed up to 99% sequence similarities between the sequenced samples and the intended reference target sequences, which completely cover all the exon 2 and exon 3 and some of their upstream and downstream portions. By comparing the observed DNA sequences of these investigated samples with the retrieved DNA sequences (GenBank acc. NC_000020.11), the accurate positions and other details of the retrieved PCR fragments were identified (Fig. 4).\u003c/p\u003e\n\u003cp\u003eSequencing analysis for the 77C\u0026gt;T (rs368475481) variant in the GHRH gene revealed distinct allele and genotype distributions between the control and acromegaly groups. In the control group, allele C was observed in all samples (80/80, 100%), whereas in the acromegaly patient group, allele C was present in 75% (120/160), with allele T exclusively found in the patient group at a frequency of 25% (40/160). Genotype distributions in the control group were as follows: CC in 100% (80/80), with no occurrences of CT or TT. In contrast, among acromegaly patients, CC was present in 50% (40/80), CT in 50% (40/80), and TT was absent. Notably, the CT heterozygous genotype showed a statistically significant association with acromegaly compared to controls (0% vs. 50%, P \u0026lt; 0.05; OR = 81, 95% CI = 4.82–1362.62, χ² = 30, etiological fraction = 0.18, P = 0.012). These data suggest that the presence of the CT genotype may be a specific marker for acromegaly, as it was identified solely within the patient cohort. A detailed summary of these findings is provided in Table 4.\u003c/p\u003e\n\u003cp\u003eTable 5 details the analysis of GHRH concentrations by genotype among 80 acromegaly patients, highlighting the association between GHRH levels and the rs368475481 variant. Statistically significant differences (P \u0026lt; 0.05) in GHRH levels were observed between the CC and CT genotypes, with mean concentrations of 118.2 ± 22.7 pg/ml and 204.2 ± 26.7 pg/ml, respectively (P-value = 0.017* ). The CT genotype was associated with elevated GHRH serum levels.\u003c/p\u003e\n\u003cp\u003eThe sequence result of fragment encompassing exons 2 and 3 and intron 2 of the GHRH gene also included six other variants, illustrated in Table 6.\u003c/p\u003e\n\u003cp\u003eIn these plots, LD values between any two variants are graphically displayed using standard colored triangles, ranging from white (indicating low LD values) to red (indicating high LD values). In the analyzed 791 bp region of the GHRH amplicons, seven retrieved variants (rs368475481, rs566092278, 95A\u0026gt;T, 297T\u0026gt;A, 456G\u0026gt;C, rs1211791568, and 631T\u0026gt;A) were found to be distributed across seven distinct loci. Our LD analyses showed that the first three SNPs formed a single block and exhibited complete homology among them (Fig. 5). Within this block, the first three identified SNPs (rs368475481, rs566092278, and 95A\u0026gt;T) exhibited complete co-inheritance. In contrast, other identified blocks exhibited varying degrees of co-inheritance, reflecting different recombination ratios among these polymorphic loci.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe results of the current study demonstrated that the elevation of GHRH concentration in serum correlates with acromegaly. This finding is consistent with the results of Gesmundo \u003cem\u003eet al\u003c/em\u003e. (2021), which showed that the use of MIAMI class GHRH antagonists (MIA-602 and MIA-690) inhibited cell growth and availability, as well as promoted apoptosis in GH/prolactin-secreting GH3 pituitary adenoma cells transfected with the human GHRH receptor[21].\u003c/p\u003e\n\u003cp\u003eA study by Giustina \u003cem\u003eet al\u003c/em\u003e. (2017) demonstrated that the hypothalamus produces GHRH, which enters the portal system, targets somatotroph cells, binds to specific surface receptors, and triggers intracellular signaling that regulates pituitary GH synthesis and secretion. Hypothalamic tumors, including hamartomas, choristomas, gliomas, and gangliocytomas, may lead to excessive GHRH production, resulting in GH hypersecretion and subsequent acromegaly. Affected patients may experience somatotroph hyperplasia or, more rarely, pituitary GH-cell adenomas, supporting the concept that excess hypothalamic GHRH can induce pituitary hyperplasia and, subsequently, adenoma formation[22]. \u003c/p\u003e\n\u003cp\u003eThese results align with findings by Borson \u003cem\u003eet al\u003c/em\u003e. (2012), who investigated GHRH expression across various tumor types and reported its presence in 25% of endocrine tumors, particularly in pheochromocytomas, gastroenteropancreatic tumors, and small-cell lung carcinomas. GHRH expression was rare in non-endocrine tumors, with one reported case of a GHRH-secreting tumor associated with both pituitary hyperplasia and somatotroph adenoma[23]. \u003c/p\u003e\n\u003cp\u003eWith regard to the identified 77C\u0026gt;T variant, it was found that this SNP is deposited in the database under the name rs368475481 (Fig. 4).This SNP was detected at an extremely low frequency within the coding sequences of the GHRH gene, with the deposited frequency of the T allele being 0.00007 (as referenced in NCBI SNP rs368475481). In contrast, the frequency of this allele in the present study was found to be 33.3%. This observation indicates a remarkable difference between the study population and the reference data. Furthermore, this SNP results in a missense variation in the encoded protein, specifically NP_001171660.1:p.Arg51His. \u003c/p\u003e\n\u003cp\u003eThe C77T variant causes a change in the amino acid sequence, substituting arginine, which has a positively charged guanidino group, with histidine, which contains an imidazole group. Histidine is unique among common amino acids due to its ionizable side chain with a pKa close to neutrality. In many enzyme-catalyzed reactions, a histidine residue can facilitate the reaction by acting as a proton donor or acceptor. To date, no publications have mentioned this SNP in PubMed indices, making this study the first investigation of the variant in available databases.\u003c/p\u003e\n\u003cp\u003eThe homozygous CC genotype of rs368475481, representing the wild-type allele, was observed in both control and acromegaly patient groups and showed no association with acromegaly. In contrast, the heterozygous CT genotype was identified exclusively in 50% (40/80) of acromegaly patients and was absent in controls, indicating a strong association with acromegaly in this population. These findings suggest that the CT genotype may serve as a potential marker for diagnosing acromegaly.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eElevated growth hormone-releasing hormone levels are linked to acromegaly cases in which somatotroph tumors produce GHRH, thereby stimulating pituitary adenomas to secrete growth hormone. This GH overproduction subsequently prompts the liver to increase insulin-like growth factor-1 secretion. Additionally, the 77C\u0026gt;T (rs368475481) variant has been strongly associated with pituitary adenoma development, contributing to the incidence of acromegaly in Iraqi patients.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMolitch M. E. (2017). Diagnosis and Treatment of Pituitary Adenomas: A Review. JAMA, 317(5), 516\u0026ndash;524. https://doi.org/10.1001/jama.2016.19699\u003c/li\u003e\n\u003cli\u003eFleseriu, M., Langlois, F., Lim, D. S. T., Varlamov, E. V., \u0026amp; Melmed, S. (2022). Acromegaly: pathogenesis, diagnosis, and management. The lancet. Diabetes \u0026amp; endocrinology, 10(11), 804\u0026ndash;826. https://doi.org/10.1016/S2213-8587(22)00244-3\u003c/li\u003e\n\u003cli\u003eQuaranta, M., Orsini, E., Zoli, M., Ratti, S., Maltoni, L., Leonardi, L., \u0026amp; Manzoli, L. (2020). An early scientific report on acromegaly: solving an intriguing endocrinological (c)old case?. Hormones (Athens, Greece), 19(4), 611\u0026ndash;618. https://doi.org/10.1007/s42000-020-00175-0\u003c/li\u003e\n\u003cli\u003eAagaard, C., Christophersen, A. S., Finnerup, S., Rosendal, C., Gulisano, H. A., Ettrup, K. S., Vestergaard, P., Karmisholt, J., Nielsen, E. H., \u0026amp; Dal, J. (2022). The prevalence of acromegaly is higher than previously reported: Changes over a three-decade period. Clinical endocrinology, 97(6), 773\u0026ndash;782. https://doi.org/10.1111/cen.14828\u003c/li\u003e\n\u003cli\u003eLavrentaki, A., Paluzzi, A., Wass, J. A., \u0026amp; Karavitaki, N. (2017). Epidemiology of acromegaly: review of population studies. Pituitary, 20(1), 4\u0026ndash;9. https://doi.org/10.1007/s11102-016-0754-x\u003c/li\u003e\n\u003cli\u003eFernandez, A., Karavitaki, N., \u0026amp; Wass, J. A. (2010). Prevalence of pituitary adenomas: a community-based, cross-sectional study in Banbury (Oxfordshire, UK). Clinical endocrinology, 72(3), 377\u0026ndash;382. https://doi.org/10.1111/j.1365-2265.2009.03667.x. \u003c/li\u003e\n\u003cli\u003eSlagboom, T. N. A., van Bunderen, C. C., De Vries, R., Bisschop, P. H., \u0026amp; Drent, M. L. (2023). Prevalence of clinical signs, symptoms and comorbidities at diagnosis of acromegaly: a systematic review in accordance with PRISMA guidelines. Pituitary, 26(4), 319\u0026ndash;332. https://doi.org/10.1007/s11102-023-01322-7\u003c/li\u003e\n\u003cli\u003eWu, J. C., Huang, W. C., Chang, H. K., Ko, C. C., Lirng, J. F., \u0026amp; Chen, Y. C. (2020). Natural History of Acromegaly: Incidences, Re-operations, Cancers, and Mortality Rates in a National Cohort. Neuroendocrinology, 110(11-12), 977\u0026ndash;987. https://doi.org/10.1159/000505332\u003c/li\u003e\n\u003cli\u003eGesmundo, I., Pedrolli, F., Cai, R., Sha, W., Schally, A. V., \u0026amp; Granata, R. (2024). Growth hormone-releasing hormone and cancer. Reviews in endocrine \u0026amp; metabolic disorders, 10.1007/s11154-024-09919-4. Advance online publication. https://doi.org/10.1007/s11154-024-09919-4\u003c/li\u003e\n\u003cli\u003eDeloukas, P., Matthews, L. H., Ashurst, J., Burton, J., Gilbert, J. G., Jones, M., Stavrides, G., Almeida, J. P., Babbage, A. K., Bagguley, C. L., Bailey, J., Barlow, K. F., Bates, K. N., Beard, L. M., Beare, D. M., Beasley, O. P., Bird, C. P., Blakey, S. E., Bridgeman, A. M., Brown, A. J., \u0026hellip; Rogers, J. (2001). The DNA sequence and comparative analysis of human chromosome 20. Nature, 414(6866), 865\u0026ndash;871. https://doi.org/10.1038/414865a\u003c/li\u003e\n\u003cli\u003eZendran, I., Gut, G., Kałużny, M., Zawadzka, K., \u0026amp; Bolanowski, M. (2022). Acromegaly Caused by Ectopic Growth Hormone Releasing Hormone Secretion: A Review. Frontiers in endocrinology, 13, 867965. https://doi.org/10.3389/fendo.2022.867965\u003c/li\u003e\n\u003cli\u003eAkirov, A., Masri-Iraqi, H., Dotan, I., \u0026amp; Shimon, I. (2021). The Biochemical Diagnosis of Acromegaly. \u003cem\u003eJournal of clinical medicine\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(5), 1147. https://doi.org/10.3390/jcm10051147\u003c/li\u003e\n\u003cli\u003eFainstein-Day, P., Ullmann, T. E., Dalurzo, M. C. L., Sevlever, G. E., \u0026amp; Smith, D. E. (2024). The clinical and biochemical spectrum of ectopic acromegaly. Best practice \u0026amp; research. Clinical endocrinology \u0026amp; metabolism, 38(3), 101877. https://doi.org/10.1016/j.beem.2024.101877\u003c/li\u003e\n\u003cli\u003eErshadinia, N., \u0026amp; Tritos, N. A. (2022). Diagnosis and Treatment of Acromegaly: An Update. Mayo Clinic proceedings, 97(2), 333\u0026ndash;346. https://doi.org/10.1016/j.mayocp.2021.11.007\u003c/li\u003e\n\u003cli\u003eDevesa, J. (2021). The complex world of regulation of pituitary growth hormone secretion: the role of ghrelin, klotho, and nesfatins in it. Frontiers in Endocrinology, 12, 636403.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eTurki, T. G., \u0026amp; Ammar, J. W. (2024). Role of gonadotropin-releasing hormone, leptin hormone, luteinizing hormone, follicle-stimulating hormone, and obesity in polycystic ovarian syndrome. Int. J. Sci. Res. in Biological Sciences Vol, 11(4).\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eMaffezzoni, F., Porcelli, T., Delbarba, A., Pezzaioli, L., Cappelli, C., \u0026amp; Ferlin, A. (2020). Biomarkers of Acromegaly and Growth Hormone Action. Protein and peptide letters, 27(12), 1231\u0026ndash;1245. https://doi.org/10.2174/0929866527666200420103816\u003c/li\u003e\n\u003cli\u003ePeixe, C., S\u0026aacute;nchez-Garc\u0026iacute;a, M., Grossman, A. B., Korbonits, M., \u0026amp; Marques, P. (2022). Biochemical discrepancies in the evaluation of the somatotroph axis: Elevated GH or IGF-1 levels do not always diagnose acromegaly. Growth Hormone \u0026amp; IGF Research, 64, 101467.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eHoldaway, I. M., Rajasoorya, R. C., \u0026amp; Gamble, G. D. (2004). Factors influencing mortality in acromegaly. The Journal of clinical endocrinology and metabolism, 89(2), 667\u0026ndash;674. https://doi.org/10.1210/jc.2003-031199\u003c/li\u003e\n\u003cli\u003eCampana, C., Cocchiara, F., Corica, G., Nista, F., Arvigo, M., Amar\u0026ugrave;, J., Rossi, D. C., Zona, G., Ferone, D., \u0026amp; Gatto, F. (2021). Discordant GH and IGF-1 Results in Treated Acromegaly: Impact of GH Cutoffs and Mean Values Assessment. The Journal of clinical endocrinology and metabolism, 106(3), 789\u0026ndash;801. https://doi.org/10.1210/clinem/dgaa859\u003c/li\u003e\n\u003cli\u003eGesmundo, I., Granato, G., Fuentes-Fayos, A. C., Alvarez, C. V., Dieguez, C., Zatelli, M. C., Congiusta, N., Banfi, D., Prencipe, N., Leone, S., Brunetti, L., Casta\u0026ntilde;o, J. P., Luque, R. M., Cai, R., Sha, W., Ghigo, E., Schally, A. V., \u0026amp; Granata, R. (2021). Antagonists of Growth Hormone-Releasing Hormone Inhibit the Growth of Pituitary Adenoma Cells by Hampering Oncogenic Pathways and Promoting Apoptotic Signaling. Cancers, 13(16), 3950. https://doi.org/10.3390/cancers13163950\u003c/li\u003e\n\u003cli\u003eGiustina, A., Biermasz, N., Casanueva, F. F., Fleseriu, M., Mortini, P., Strasburger, C., van der Lely, A. J., Wass, J., Melmed, S., \u0026amp; Acromegaly Consensus Group (2024). Correction: consensus on criteria for acromegaly diagnosis and remission. Pituitary, 27(1), 88. https://doi.org/10.1007/s11102-023-01373-w\u003c/li\u003e\n\u003cli\u003eBorson-Chazot, F., Garby, L., Raverot, G., Claustrat, F., Raverot, V., Sassolas, G., \u0026amp; GTE group (2012). Acromegaly induced by ectopic secretion of GHRH: a review 30 years after GHRH discovery. Annales d\u0026apos;endocrinologie, 73(6), 497\u0026ndash;502. https://doi.org/10.1016/j.ando.2012.09.004 \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Al-Qasim Green University","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Growth-Hormone Releasing Hormone, Acromegaly, Growth Hormone","lastPublishedDoi":"10.21203/rs.3.rs-6106115/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6106115/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eAcromegaly (ACM) is an endocrine disorder characterized by the elevation of growth hormone-releasing hormone (GHRH), growth hormone (GH), and insulin-like growth factor-1 (IGF-1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjectives:\u003c/strong\u003e This study aims to elucidate the correlation between the 77C\u0026gt;T (rs368475481) variant in the GHRH gene and elevated growth hormone-releasing hormone levels in patients with acromegaly.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and Methods:\u003c/strong\u003e This study, conducted from January to August 2024, analyzed 80 samples from Iraqi acromegaly patients collected at the Diabetic National Center, Al-Mustansiriyah University, alongside 80 samples from healthy individuals. Growth hormone and insulin-like growth factor-1 levels were quantified using chemiluminescence immunoassay, while growth hormone-releasing hormone levels were measured by enzyme-linked immunosorbent assay (ELISA). The 77C\u0026gt;T (rs368475481) SNP was detected via Sanger sequencing to assess genetic variation between acromegaly patients and healthy controls.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e The serum levels of GHRH, GH, and IGF-1 were elevated in acromegaly patients compared to controls. The genetic results indicate the presence of the rs368475481 variation in the amplified fragment of the GHRH gene (a 791 bp amplicon including exons 2 and 3, and intron 2), with the CC homozygous genotype observed in 80 (100%) of controls and 40 (50%) of acromegaly patients. The CT heterozygous genotype was present in 40 (50%) of acromegaly patients.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThe elevated levels of growth hormone-releasing hormone and the GHRH 77C\u0026gt;T rs368475481 polymorphism in the GHRH gene were shown to be associated with pituitary adenomas, which cause acromegaly.\u003c/p\u003e","manuscriptTitle":"The Potential Roles of 77C\u0026gt;T Variant and Growth Hormone-Releasing Hormone Elevation in Pituitary Adenoma Cases Associated with Acromegaly","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-27 18:18:13","doi":"10.21203/rs.3.rs-6106115/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"81f6eff2-9c35-4a0c-a333-b80386d9982f","owner":[],"postedDate":"February 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":44960463,"name":"Cancer Biology"},{"id":44960464,"name":"Molecular Biology"}],"tags":[],"updatedAt":"2025-02-27T18:18:13+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-27 18:18:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6106115","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6106115","identity":"rs-6106115","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.