Isolation, screening, characterization, and optimization of bacterium isolated from calcareous soils for siderophore production

Isolation, screening, characterization, and optimization of bacterium isolated from calcareous soils for siderophore production | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation, screening, characterization, and optimization of bacterium isolated from calcareous soils for siderophore production REDDY KIRAN KALYAN V S, Meena S, Karthikeyan S, Jawahar D This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1365991/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract The most effective agricultural practice to prevent iron deficiency in calcareous soils is fertilizing with synthetic chelates. These compounds are non-biodegradable, and persistent in the environment and hence there is a risk of leaching metals into the soil horizon. To tackle iron deficiency-induced chlorosis (IDC) in crops grown under calcareous soils, an environmentally friendly effective solutions are needed rather than chemical application as it affects the soil health further. Hence the present work aimed at isolating and screening calcareous soil-specific bacteria capable of producing the iron-chelating siderophores. Siderophore producing bacteria (SPB) was isolated from the rhizosphere of calcareous soil-grown groundnut ( Arachis hypogea L.), of which seventeen bacterial isolates were positive for siderophore production assayed by Chrome Azurol Sulphonate. The performance of SPB isolates was compared for siderophore kinetics, level of siderophore production, type of siderophore produced (using Arnow and Csaky's tests), and iron-chelating capacity under 15mM KHCO 3 . Four best performing bacterial isolates were screened, with average siderophores yield ranging ∼60–80% under pH 8, with sucrose as a carbon source and NH 2 SO 4 as a nitrogen source at 37°C. The four efficient SPB were molecularly identified as Bacillus licheniformis , Bacillus subtilis , and Ochrobactrum grignonense based on 16S rDNA sequencing. The strains also showed a strong antagonistic effect against the phytopathogenic fungal strains viz., Sclerotium rolfsi and Macrophomina phaseolina in vitro. Our results indicate that the optimized conditions enhanced siderophores chelation and by suppressing the stem and root rot fungi which could help in cost effective and environmentally friendly manner. Arachis hypogea calcareous soils iron phytopathogenic and siderophores Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Even though Fe is one of the most predominant elements in the Earth's crust (Manthey et al., 1994 ) its availability to plants and microorganism is insufficient. A transition metal can be found in two oxidation states, Fe (III) and Fe (II). It is a crucial limiting factor for plants and microorganisms as it occurs as Fe 3+ (ferric form) which is not soluble at physiological pH (Bou-Abdallah, 2010) which is insoluble in the form of iron (Zuo and Zhang, 2011 ; Saha et al. , 2016). Iron is an essential element for plant growth and development (Barker and Pilbeam, 2015 ). Though Fe is not a chlorophyll component, it is vital for photosynthesis and the functioning of the photosynthetic apparatus (Broadley et al., 2012 ; Briat et al., 2015 ; Rangani et al., 2018 ). It also controls the biosynthesis of antibiotics, porphyrins, pigments, toxins, siderophores, cytochromes, and aromatic compounds (Messenger and Barclay, 1983 ). The iron deficiency of plants results in chlorosis, characterized by the yellow young leaves due to lack of iron for efficient chlorophyll production (Lucena, 2000 ; Barhoumi et al., 2021 ). These effects of chlorosis in plants result in lower biomass and yield, decreased flowers and fruits, and in critical cases total crop fatigue (Tripathi et al., 2015 ; Kabir et al., 2016 ). Because of iron chemical composition, low solubility, low bioavailability, and dissolubility kinetics makes problematic in absorbing iron on calcareous soils. IDC is widespread in plants grown in alkaline and calcareous soils as low Fe (Fe 2+ ) levels. Calcareous soils are estimated to cover about 30% of the world's cultivated soils (Chen and Barak, 1982 ; Di Gregorio, 2005 ; Barker and Pilbeam, 2015 ) which underscores the importance of iron deficiency as a major global agricultural challenge. This significantly affects crop yields and hinders low bioavailability in soil (Martins et al., 2017 ). Synthetic chelating agents viz ., o,o -ethylenediamine - di ( o -hydroxyphenylacetate)-Fe(III) and o , o -EDDHA/Fe(III) chelate (García-Marco et al., 2006 ; Bin et al., 2016 ) have been commonly used to overcome chlorosis in calcareous soils, but their non-biodegradable nature poses a hazard to soil health. Since these are powerful chelating agents, the pursuit of environmental protection and the proper chelating of iron fertilizers has therefore become a major challenge. Microbes have developed many strategies to scrounge iron from their atmosphere in response to iron limitation. One mechanism of microorganisms and plants is to produce low molecular (500–1000 Daltons) iron chelators termed siderophores (Greek sideros meaning iron and phores meaning bearer) to enhance the acquisition of iron from the soil environment, particularly under the Fe-limited circumstances, which selectively complex iron (III) with very high affinity (Sandy and Butler, 2009 ; Lis et al. , 2015). They exhibit strong interaction constants for iron complexation (Neilands, 1995 ). Siderophores are usually classified into three major classes, such as hydroxamates, catecholates, and carboxylates based on their structural units (Hider and Kong, 2010 ; Rungin et al., 2012 ). Some bacteria possess more than one form of siderophores and multiple absorption pathways for iron acquisition. The main feature of the siderophores is the chelating of Fe (III) and accumulation of complex heavy metals such as Fe 3+ , Cu 2+ , Zn 2+ , Ni 2+ and Cd 2+ and the production and retention of toxic metals such as Cu 2+ , Zn 2+ , and Pb 2+ affecting metal mobility (Braud et al., 2009 ; Dimkpa et al., 2009 ). Siderophore first bonds to the ferric form of iron and then forms a siderophore-iron complex, which enters the cells through unique cell membrane siderophore receptors. Many siderophores produced by microorganisms are attributable to the low atmospheric abundance of Fe and are more selective to Fe (III) than divalent metals. Approximately 500 biomolecules have been listed under siderophores where many genes and regulators are involved in their synthesis, distribution, and re-import into cells (Challis, 2005 ; Visca et al., 2007 ; Chu et al., 2010 ). Previous studies reported the siderophore beneath iron-deprived conditions forms complex with iron (Boukhalfa and Crumbliss, 2002 ; Tian et al., 2009 ; Prathap et al. , 2015). Several siderophore-producing rhizobacteria (SPR) have been assessed and reported as biocontrol agents against plant pathogens (Sulochana et al. , 2014; Sasirekha et al. , 2016), including the species of Pseudomonas (Weller, 2007 ; Ghazy and El-Nahrawy, 2021), Bacillus (Crosa et al., 2004 ; Peralta-Yahya et al., 2012 ; miao Sheng et al. , 2020; Ghazy and El-Nahrawy, 2021), and Enterobacter (Costa and Loper, 1994; Grobelak and Hiller, 2017 ; Sinha et al. , 2020). These strains develop siderophores under iron-restricting conditions that chelate the available iron and deprive the respective phytopathogens of iron nutrients (Lemanceau et al. , 1993; Ahmed and Holmström, 2015 ; Santoyo et al., 2016 ), thus limiting the dissemination of phytopathogens and root colonization. SPR is also known to impart induced systemic resistance (ISR) to plants (Pieterse et al., 2000 ; Aznar and Dellagi, 2015 ) and has been documented in biocontrol of M . Phaseolina, Rhizoctonia solani, Phytophthora nicotianae var. Parasitic, Pythium spp ., and Fusarium spp . (Blumer and Haas, 2000 ; Haas and Défago, 2005 ; Singh et al., 2009 ; Ali et al., 2018 ; El-Shabrawy and Shehata, 2018 ). With this context, our research focuses on the isolation and characterization of calcareous soil siderophore-producing bacteria and the culture conditions for higher siderophore production have also been optimized. 2. Materials And Methods 2.1. Micro-organisms and culture conditions Soils were sampled from both rhizosphere and bulk soils of groundnut, grown under calcareous soils in June 2019 near the villages of Thondamuthur block of Coimbatore, Tamil Nadu, India (10°99′N, 76°79′E). These sites were located about at an altitude of 473 m above sea level. The annual average precipitation is 618 mm and an annual average temperature of 28.9°C. The bedrock in the area is charnockite and gneiss. The soil samples for this study were taken from the rhizosphere soil and kept cold (4°C) until further analysis. 2.2. Isolation and identification of siderophore producing bacteria from soil The aerobic and facultative anaerobic siderophore-producing microorganisms were isolated from the soil solution. The samples were serially diluted (to 10 − 5 ) and inoculated in nutrient agar (NA) medium and incubated for 24 h at room temperature. The colonies were distinguished, sub-cultured, and purified (Gaonkar and Bhosle, 2013 ). The purified colonies were further tested for the production of siderophore using CAS (Schwyn and Neilands, 1987 ). The positive colonies were purified by three times subculture method on CAS Agar plates and stored in 20% (v/v) glycerol at -20 0 C. 2.2.1. Identification of strains Bacterial isolate showing efficient siderophore production was further characterized based on the morphological, biochemical, and molecular levels. Isolates were gram stained to understand the cell shape, size, arrangement, and gram nature. The purified isolates were subjected to biochemical characterization (Aneja, 2007 ) for the detection of organisms up at the genus level. Further, the molecular characterization was carried out using fD1 (5' AGAGTTTGATCCTGGCTCAG 3') and rP2 (5' ACGGCTACCTTGTTACGACTT 3') primers. The reaction mixture in each tube consisted of 20 µl with DNA template 50 ng, 1x Taq buffer, 0.2 mM of each dNTP mixture, 1 µM of each primer, 1.5 mM MgCl 2 , and 2U of Taq DNA polymerase (Bangalore Genei, India). PCR amplification was performed and products were separated by electrophoresis on 1% agarose gel (Sambrook et al., 1989 ). The 16S rRNA gene was sequenced in both directions and the obtained sequences were compared to sequences in the NCBI GenBank database using the BlastN (Altschul et al. , 1997). The recovered sequences, as well as the closest identified relatives, were aligned in Molecular Evolutionary Genetics Analysis (MEGA) Software ver. 10.0. All the sequences were submitted to the GenBank and accession numbers were acquired. 2.3. Partial purification of siderophore The cultures were grown in Fiss-glucose minimal media (Vellore, 2001 ) for 24 hours at 28°C on a rotary shaker. After incubation, the culture supernatant was collected by centrifuging at 7,000 rpm for 30 minutes. The supernatant was then acidified to pH 2.0 with 6 M HCl to make the siderophore less soluble in water and passed the acidified supernatant through a 30 x 5 cm column packed with Amberlite XAD-2 (Sigma, USA), which binds cyclic compounds were dissolved in distilled water and kept overnight for soaking. The loaded column was pre-washed twice with water, methanol, and water. The aqueous supernatant was allowed to slowly pass through the column at the rate of 5 mL min − 1 . Loading of supernatant was continued until the saturation of the column, which was indicated by the browning of the column. The column was then washed with five to ten-bed volumes of distilled water to remove all unbound components of the medium. The column was then equilibrated by changing the solvent to 50% methanol to facilitate the extraction of siderophores (Budzikiewicz, 1993 ). Different fractions were separately collected; filtrate, water wash, and eluted fractions were checked for CAS test. Fractions positive for siderophore were combined in a 100 ml boiling flask and the pH was adjusted to 3.0 with H 2 SO 4 and 50 percent ammonium sulfate solution was added to deproteinize and evaporated to dryness using a rotary evaporator. This aqueous phase was concentrated in a lyophilizer (Lark) and set aside in cold to crystallize. The filtrate was neutralized, reduced to dryness, extracted in dry hot methanol and were then separated on Whatman filter paper no. 44. The obtained purified siderophore crystals obtained were then subjected to Fourier transform infrared spectroscopy (FTIR)-ATR analysis (JASCO FT/IR-6800) for determination of the functional groups. The spectrum was recorded in the range from 400 to 4000 cm − 1 . The infrared spectrum wavelengths were determined based on their functional groups (Tank et al., 2012 ). 2.4. Quantitative and qualitative estimation of siderophores The purified bacterial isolates were grown in an iron-deficient succinate medium and incubated for 48 h with constant shaking at 120 rpm. All the isolates were screened for siderophore production viz spectrophotometric means at A630 nm (Grimm and Allen, 1954 ) which was further confirmed by the Chrome Azurol sulphonate (CAS) agar test. The production of siderophore by the isolate was quantitatively determined using (CAS) as described by (Schwyn and Neilands, 1987 ). From the prepared CAS solution, 0.5 ml was taken to which 0.5 ml of culture supernatant was added and incubated for 5 min. Then the mixture was measured at 630 nm and calculated for the siderophore production (Maindad et al., 2014 ; Fazary et al., 2016 ). The percent of siderophore was intended in terms of % of siderophore units by the following formula: Where Ar = absorbance of reference (CAS reagent); As = absorbance of the sample at 630 nm. Further, the qualitative confirmation was performed by CAS agar test, where the bacterial isolates streaked on the CAS plates show orange zone. 2.5. Screening of bacteria for calcareousness tolerance The succinate medium (SM) medium was to screen calcareous tolerant bacteria. The succinate medium concentration per liter: KH 2 PO 4 , 3.0 g; K 2 HPO 4 , 6.0 g; MgSO 4 .7H 2 O, 0.2 g; (NH 4 ) 2 SO 4 , 1.0 g; succinic acid, 4.0 g; peptone, 1.0 g; final pH 6.5. This medium was enriched with KHCO 3 (calcareous source) to mimic calcareous soil. The KHCO 3 were added at different concentrations viz ., 10, 15, 20, and 25 µM at room temperature. The production of siderophore by the isolates under calcareous stress was quantitatively determined using CAS (Schwyn and Neilands, 1987 ). Succinate medium (SM) KH 2 PO 4 3.0 g per litre; K 2 HPO 4 6.0 g per litre; MgSO 4 .7H 2 O 0.2 g per litre; (NH 4 ) 2 SO 4 1.0 g per litre; succinic acid 4.0 g per litre; peptone 1.0 g per litre; distilled water 1000 ml; final pH 6.5 Treatment 1 SM + 10 mM KHCO 3 Treatment 2 SM + 15 mM KHCO 3 Treatment 3 SM + 20 mM KHCO 3 Treatment 4 SM + 25 mM KHCO 3 2.6. Chemical Characterization of Siderophores The type of siderophore was determined by specific tests using culture supernatants prepared as described above. Hydroxamate type of siderophore was detected by tetrazolium test (Snow, 1970 ), catecholate type of siderophores was detected by Arnow’s test (Arnow, 1937 ); carboxylate type was detected using Vogel ( 1992 ). 2.7. Optimization for maximum siderophore production The bacterial isolates were allowed to grow in succinate broth under different fermentation conditions, such as pH (5, 6, 7, 8 and 10), temperature (27, 37 and 45 0 C), nitrogen sources (urea. ammonium sulphate (NH 2 SO 4 ) and sodium nitrate (NaNO 3 ), carbon sources (sucrose, glucose, fructose and lactose), and iron concentration (1, 2 and 3 ppm) for 48h to investigate the maximum level of siderophore production. For siderophores analysis, the supernatant was centrifuged at 5000 rpm for 10 min and cell-free supernatant was analyzed using CAS assay test. The production of siderophore was measured at 630 nm and calculated (Maindad et al., 2014 ; Fazary et al., 2016 ). 2.8. Antagonism tests in vitro 2.8.1. Growth of bacterial strain and fungal mycelium in dual culture The antimicrobial activity of every bacterial strain was surveyed by the dual culture method (Campanile et al., 2007 ) to screen antagonism. Petri dishes (9 cm) containing 20 ml of sterile PDA were inoculated with a loop of potential antagonists of bacterial strains and the 0.5 cm sterile plug of a 3 day-old pure culture pathogens S. rolfsi and M. phaseolina , which were collected from the department of plant pathology, Tamil Nadu Agricultural University, Coimbatore. The distance between the pathogen and antagonist was 4 cm. Each combination of pathogen/antagonist was repeated 3 times and as negative controls. All Petri dishes were incubated at 25 0 C in the dark and randomly distributed. The experiment was replicated three times. Radial growth was recorded by measuring colony diameter at 1-day intervals for the time required to reach the margin of the dish in controls. The Antagonism Index (AI) was assessed according to the following formula: AI = (RM - rm)/ RM * 100, where rm = ray of the colony towards the antagonist and RM = average of the three rays of the colony in the other directions. The zone of inhibition around the spots was recorded as a positive result. 2.8.2. Interactions between bacterial strains and antagonistic fungi in dual culture The antagonistic ability of the selected bacterial cultures against S. rolfsi and M. phaseolina was tested using the dual-culture method described by (Badalyan et al., 2002 ; Badalyan et al., 2004 ). A loop of bacterial cultures and a plug (0.5 cm diameter) of antagonistic fungus was cut from the margin of a 3 day-old culture and placed respectively on opposite sides (4 cm from the margin) of Petri dishes containing PDA. Each combination of pathogen/antagonist was repeated 3 times and plates were randomly incubated at 25 0 C for 3 days. As negative controls, 3 Petri dishes were inoculated with selected bacterial cultures and a water agar plug. Interactions were examined daily. Antagonism towards bacterial cultures was scored using the Badalyan et al. ( 2002 ) rating scale into 3 types (A, B, and C) and 4 subtypes (CA1, CA2, CB1, and CB2), where: A = deadlock with mycelial contact, B = deadlock at a distance, C = replacement, overgrowth without initial deadlock; CA1 and CA2 = partial and complete replacement after initial deadlock with mycelial contact, CB1 and CB2 = partial and complete replacement after an initial deadlock at a distance. The following scores were assigned to each type or subtype of reaction: A = 1.0; B = 2.0; C = 3.0; CA1 = 3.5; CB1 = 4.0; CA2 = 4.5; and CB2 = 5.0. The AI was calculated for each species using the formula: AI = SN x I, where N = number (frequency) of each type or subtype of reaction and I = the corresponding score. 2.9. Statistical analysis All the data were analyzed using SPSS software 23.0 version (SPSS IBM). The significant differences in the means were analyzed based on Tukey’s multiple comparison test (p < 0.05). 3. Results 3.1. Isolation and screening of siderophores producing bacteria A total of 33 bacterial isolates were obtained, purified, and cultured. The siderophore-producing bacterial isolates were screened using a CAS assay (both qualitatively and quantitatively). The cultures were grown in a succinate medium and incubated for 48 hours before being tested for CAS in a spectrophotometer. 17 of the thirty-three isolates tested positive for turbidity in the SA medium and turbidity in the CAS test. The presence of siderophores was confirmed on CAS agar plates by the presence of a distinctively orange-colored zone (Fig. 1 ) indicating siderophore production. 3.1.1. Quantitative Screening of Siderophore Producing Bacteria For quantitative estimation, CAS assay was employed and their cell concentration was measured at A630 nm. Out of thirty-three isolates, 17 were found to be positive for siderophore and selected for quantitative estimation of siderophore production. Thirteen isolates produced siderophore units in the range of 8.4–54.9%, while 4 isolates SID 13, SID 25, SID 30, and SID 33 produced significantly higher quantities of siderophores (< 65% siderophore units (SU) (Fig. 2 ). 3.1.2. Screening of bacteria for calcareousness tolerance Potassium bicarbonate (KHCO 3 ) is used in the culture medium to simulate calcareousness artificially and their influence was studied in terms of bacterial population and siderophore production. All the isolates followed similar trend, siderophore production increased with increasing the concentration of sodium bicarbonate. Among the four isolates, Bacillus licheniformis showed marked increase in bacterial colony forming units (cfu) and siderophore production with rising concentration of bicarbonate. At higher concentrations i.e . at 25 mM KHCO 3 , the siderophore production percentage ranges from 65.9 to 74.1% irrespective of the bacterial strains (Table.1). 3.2. Characterization of efficient siderophore-producing isolate Further, the isolates SID 13, SID 25, SID 30, and SID 33 were taken for morphological, molecular, and biochemical characterization. The results of biochemical characterization are given in Table.2. The molecular identification was confirmed by 16S rDNA sequencing of bacterial isolate SID 13 was showing similarity to B. licheniformis (98%); SID 25 was showing similarity to B. subtilis (100%); SID 30 was showing similarity to B. licheniformis (99.9%) and SID 33 was more close to O. grignonense with the percent identity of 93%. The evolutionary relationship of the identified 16S rDNA sequencing and the acquired accession numbers from NCBI were shown in Fig. 3 . 3.3. Siderophore Chemotyping The type of siderophore present in each medium filtrate was subjected to Arnow’s, Snow’s, and Vogel’s tests. Both B. licheniformis strains and O. grignonense were positive for all three tests, indicating the presence of catechol, carboxylate, and hydroxamate siderophores in the filtrate of the culture medium. B. subtilis filtrate was positive only for hydroxymate. (Table 3; Fig. 4 .). 3.4. FTIR analysis The infrared spectrum analyses of the partially purified SPB cultures extract pellet showed a broad peak at 3221, 3242, 3264 and 3265 cm − 1 indicating the presence of aromatic OH moiety of siderophores. The peak at 3170 cm − 1 is attributed to NH stretching. The appearance of a peak at 2950 cm − 1 showed the presence of saturated alkanes. The spectrum also provides evidence for the presence of amide linkage in the structure. The intense peak at 1640 cm − 1 typically indicated an amide C = O stretching suggesting a secondary amide functionality. A conjugation and intramolecular H bonding may have caused the lowering of the C = O stretch peak. The peak observed at 1451 and 1452 cm − 1 revealing the presence of one -C-H bending with functional group -CH 2 and one -N-O structure, which shows that similarity towards hydroxamate functional groups. Furthermore, a peak at around 1200 cm − 1 indicated a -C-O-C- bond of the ether linkage. Thus, the spectrum indicated the presence of catechol siderophores (Fig. 5 .). 3.5. Different culture conditions for optimum production of siderophores To understand the significant effect of various culture conditions that relates the bacterial growth and siderophore production, the cultures were grown under different growth conditions such as pH, temperature, carbon source, nitrogen source, and iron concentration. Hence we tried to optimize conditions for the maximum production of siderophore by the SPB strains. 3.5.1. Influence of pH The optimum siderophore production in all the four SPB strains was achieved at pH 8. The maximum amount of siderophore produced (84.8% SU) was found with SID 30 strain at pH 8. Irrespective of the strains the lowest siderophore yield was found at pH 10 in SID 13 with the value of 52.8% SU. This might be due to at alkaline pH of the medium decreases the solubility of iron thus making it unavailable to the growing bacteria creating an iron-depleted environment suitable for siderophore production (Fig. 6 .). 3.5.2. Influence of temperature Further, the culture conditions were changed with constant pH and different temperatures. Our study also showed higher production of siderophore accounting for ̴70% at 25°C in all the strains. Upon increasing the temperature levels the siderophore production showed a sheer decline to 37.2% at 45 0 C in SID 25 (Fig. 6 .). 3.5.3. Influence of nitrogen sources All the four, selected strains from this study were able to synthesize siderophore > 67% irrespective of applied nitrogen source. Different nitrogen sources influenced siderophore production significantly. The highest % SU was detected with ammonium sulfate (80.6%) as the nitrogen source in SID 30, whereas, the lowest siderophore production was registered with SID 25 (67.2%) with urea as a nitrogen source as shown in Fig. 6 . 3.5.4. Influence of carbon sources The SPB strains were assessed for their optimal requirement of carbon source for maximal production of the iron-chelating siderophores. Sucrose was found to be a favourable carbon source for all the four tested SPB (Fig. 6 ). The production of siderophore was comparatively higher ̴ 80.4% in B. licheniformis (showing an evolutionary relationship with the Bacillus sp. ). 3.5.5. Influence of iron concentrations The addition of FeSO 4 in the medium significantly affected the siderophore production. The addition of 2 PPM of FeSO 4 in the medium resulted in higher siderophore production up to 77% SU in SID 13. This might have induced an enhanced rate of siderophore production to bind with the available iron and provide it to the cell. Upon increasing iron concentration, there was a steep decline in the % SU to 61.3. This could be because once iron concentration in the medium reached above the threshold value required for siderophore production, it negatively regulates iron acquisition genes (Fig. 6 ). 3.6. Antagonistic potential of SPB in dual culture Varying degrees of mycelial growth inhibition of S. rolfsi and M. phaseolina were observed with antagonistic bacterial and fungal isolates. Trichoderma viride had the maximum inhibitory effect on mycelial growth of both M. phaseolina and S. rolfsi with a reduction of 69.3 and 65.1 respectively compared to control. The isolates B. licheniformis , B. subtilis , B. licheniformis , and O. grignonense expressed significantly lower mycelial growth inhibition with reductions in the range of 37.3–57.5% for M. phaseolina and 48.3–52.6% for S. rolfsi (P < 0.05, compared to controls and other antagonists) (Table.4.). The antagonistic index in the dual-culture method, based on the AI values for both the M. phaseolina and S.rolfsi in the presence of antagonistic isolates were divided into three groups: active ( T. viride ), moderate ( B. licheniformis and B. subtilis ) and weakly active ( O. grignonense ) only for S. rolfsi . The most important parameter determining antagonistic activity was the inhibiting speed of colony growth (Table.5 & Fig. 7 ). 4. Discussion Siderophores are low molecular weight compounds (between 500 and 1500 dalton), of high affinity and selectiveness to bind and complex Fe (III). As a part of a strategy to extract iron from the atmosphere because of the poor bioavailability of iron, these siderophores are produced both from plants and microbes (Hider and Kong, 2010 ; Ahmed and Holmström, 2014 ). In the last few years, several researchers have drawn attention to this particular function. They have wider applications in plant growth, biocontrol activity, and several other ecological factors. In this present study, the siderophore-producing bacteria were isolated from the soil samples and the optimal fermentation condition was configured to understand the culture medium capable of a high level of siderophore production. Similar results were reported by Ferreira et al. ( 2019 ) under alkaline conditions where they evaluated five bacterial strains for siderophore kinetics, percent siderophore production, type of siderophore produced, and iron-chelating capacity at pH 9.0. Ghosh et al. (2015) used both fungal strains ( T. viride -1, T. harzianum- 1, Candida famata -1) and bacterial strains ( B. subtilis- 1, B. megatericus , P. aeroginosa ) for siderophore production. The CAS or HDTMA forms a strong complex with a ferric ion to produce a blue color to the medium, when iron chelators like siderophores are added to the medium, the iron is separated from the dye complex and the colour gradually changes from blue to orange (Louden et al., 2011 ). Out of 17, 4 isolates (SID 13, SID 25, SID 30, and SID 33) produced higher siderophore units (SU) above 65% in CAS-liquid assay. When these siderophore producing isolates subjected to calcareous stress showed positive results even under 25 mM K HCO 3 concentration, without any decline in % siderophore units. Earlier results showed that E. coli, P. aeruginosa, S. aureus, S. agalactiae, E. faecalis and H. influenza growth significantly inhibited when subjected to NaHCO 3 (100 mmol l − 1 ) and suggesting that HCO3 − can suppress bacterial growth in general (Dobay et al., 2018 ) .As several researchers have also confirmed that high bicarbonate concentration directly caused iron deficiency chlorosis (Coulombe et al., 1984 ; Pearce et al., 1999 ), our strain proved to withstand at all the four levels of bicarbonate concentration showing its ability of tolerance against calcareousness along with higher siderophore production. Microbial siderophores are usually grouped as catecholates, hydroxamates, carboxylates, and mixed type since these compounds shows the highest affinity towards iron. Evolutionary relationship of our bacterial strains showed maximum relative percentage towards Bacillus sp. Earlier researchers also found that most of the siderophore producing bacteria are subsiding under the Bacilli sp ( Sivasakthi et al., 2013 ; Shaikh et al., 2016 ). Most of our isolates were tested positive for more than one type of siderophore. Earlier reports showed that several soil bacteria could produce more than 65 percent of SU and multiple types of siderophore (Hider and Kong, 2010 ; Ahmed and Holmström, 2015 ; Ferreira et al., 2019 ). The partial purified siderophores using Amberlite XAD-2 shows similar trends of Sayyed and Chincholkar ( 2006 ) who purified siderophores of Alcaligenes faecalis on Amberlite XAD-400 resins. Further, the FTIR spectrum of LSBS2 showed the adsorption bands at 3445, 2951, 1652, 1455, and 1143 cm − 1 , respectively, which indicates the presence of (-OH), aromatic (-CH), (-C = O), (-CH2) and (C-O-C) linkage. These functional groups are present in the catecholate type of siderophore so that the purification of siderophore production in FTIR analysis confirmed the presence of a catecholate type of siderophore that is specific to 2,3 dihydroxybenzoic acid (Nithyapriya et al., 2021 ). To optimize the bacterial strains capable of siderophores potential ability, the performance of the bacteria was optimized with the following characteristics: culture media composition (carbon and nitrogen sources), iron complexation capacity, pH range, and under different temperatures conditions. Though iron is the major factor involved in siderophore production, other cultural conditions also play a significant role in siderophore production. Tailor and Joshi ( 2012 ) reported that bacteria can grow optimally in the physiological environment. Storey et al. ( 2005 ) indicated that under normal conditions with Fiss-glucose medium, the hydroxamate siderophore was lower and, this can further be optimized to higher siderophore production with certain modifications in the growth medium. Because its solubility and availability are affected by the pH of the medium, pH plays an important role in microbial proliferation. We detected that the increased siderophore concentration was recorded when the pH was lower than 8. Given that Fe 2+ is soluble and Fe 3+ is insoluble at physiological pH (7.35–7.40) (Bou-Abdallah, 2010) alkaline pH decreases iron solubility, rendering it unavailable to bacteria, resulting in an iron-depleted environment ideal for siderophore synthesis. Gérard ( 2016 ) discovered that the insolubility of iron increases at high pH values, which supports our observations. At pH 8, iron becomes more insoluble in soil solution, which may have accelerated siderophore production. The present finding agrees with Calvente et al. ( 2001 ) who reported similar results as pH near 8 stimulates higher siderophore production. In some cases, it was reported that the highest iron-chelating capacity, at pH 9.0, was obtained by B. megaterium followed by B. subtilis and A. vinelandii (Ferreira et al., 2019 ) The percentage of siderophore production varied with incubation temperature, being optimum at 27 0 C, lesser at 35 0 C, and least at 45 0 C. The incubation temperature considerably influenced siderophore production; these findings are in accordance with Dave and Dube ( 2000 ) who have reported that maximum siderophore production occurred at 30 0 C. Percent siderophore units were recorded maximum at 30°C i.e. 83.9% by A. oryzae (Singh and Mishra, 2015 ). The P. fluorescens strain was also found to produce maximum siderophore at 29 0 C (Tailor and Joshi, 2012 ). Otherness Kumar et al. ( 2017 ) reported that 35°C (room temperature) showed optimum bacterial siderophore production in VITVK5 and VITVK6 strains. The optimization was carried out with the different sources of nitrogen such as ammonium sulfate, sodium nitrate, and urea. All the above mentioned isolates have produced siderophore more than 65% with all the nitrogen sources and the maximum was registered with ammonium sulfate, while Ochrobactrum sp. influenced to produce higher siderophore with as N source as shown in our results (Louden et al., 2011 ; Tailor and Joshi, 2012 ). The results were similar with Tailor and Joshi ( 2012 ) who also confirmed maximum siderophore yield up to 96% in P. fluorescence and P. putida in the presence of ammonium sulfate and urea. Based on previous reports we have chosen to evaluate four major carbon sources namely glucose, fructose, lactose, and sucrose. Among these, sucrose had a stimulating effect on the production of siderophore followed by glucose. The present findings prove that the presence of sugars such as sucrose in the growth media increased the growth of Nocardia levis MK-VL_113 for the elaboration of bioactive metabolites (Kavitha and Vijayalakshmi, 2009). Sucrose concentration at 2% roused the growth and siderophore production in Rhizobium strains (Sridevi and Mallaiah, 2008). A previous study of siderophore production by Rhodotorula sp. reported by Calvente et al. ( 2001 ) also shows similar results of enhanced siderophore production upon sucrose supplementation. Supplementing the growth media with carbon sources increases the growth and metabolism of bacteria and the siderophore production capability. The siderophore production by an organism depends on the availability of organic and inorganic nutrients in the medium (Neilands, 1981 ; Abd-Alla, 1998 ). Among various abiotic factors, the pH of the medium plays a major role in Fe availability. Notably with increasing concentration beyond a threshold level supresses the siderophore production. Our findings also showed that the percentage siderophore enhanced with increasing pH and Fe concentration up to 8 and 2 PPM respectively beyond that siderophore production started to decline, which might be due to native availability of iron. Tailor and Joshi ( 2012 ) showed similar results, where the concentration of siderophore produced from P. fluorescence decreased after 1µM. Muthuselvan et al. (2013) who also reported that at low concentration (1–3µM) of iron enhanced the siderophore production of Azotobacter sp. up to 82%. Excess iron concentration harmed siderophore production along with the morphology alterations and growth (Singh and Mishra, 2015 ). Identification and selection of effective antagonistic organisms is the first and foremost step in biological control (Kamakannan et al. , 2004). Our findings witness the significant antagonistic activities of B. licheniformis , B. subtilis , B. licheniformis , and O.grignonense against M. phaseolina and S.rolfsi in in-vitro dual cultures. Siderophores are also thought to facilitate biocontrol by sequestering iron from pathogens, thus limiting their growth (Chiarini et al., 1993 ; Champomier-Vergès et al., 1996 ). Siderophore positive P. fluorescens is known to control bacterial pathogens including bacterial soft rot of potato, the bacterial canker, and bacterial wilt of tomato (David et al., 2018 ). These results are also in agreement with Solanki et al. ( 2014 ) who also reported efficient siderophore production using Enterococcus sp. and its activity against plant pathogen R. solani . These beneficial effects of siderophore include both plant growth enhancement and biological control of phytopathogenic fungi (Ghazy and El-Nahrawy, 2021). Secondary metabolite like siderophore production is a key for plant growth-promoting bacteria by fulfilling the plants' iron requirements and protecting against plant pathogens. Nursery and field trials in cardamom with siderophore producing bacteria, by P. putida TAUC10, had higher ligand formation constants than those of the soil pathogens (Panchami et al., 2020 ). In the present study, 17 bacterial isolates were found to be positive for qualitative CAS agar assay. Upon qualitative and quantitative analysis, 4 isolates ( B. licheniformis , B. subtilis , B. licheniformis , and O. grignonense ) were found to produce above 65% siderophore units having higher potential use for iron-induced chlorosis amendment in calcareous soils. The morphological and molecular characterization of siderophore-producing bacteria depicts close resemblance to the bacterial species of Bacillus sp. and Ochrobactrum sp. Results of the influence of different culture conditions showed that the bacterial isolate had the efficiency of producing siderophore in higher concentration at pH 8, 37 0 C with sucrose as carbon source and Na 2 SO 4 as nitrogen source. The increase in iron concentration increased the production of siderophore, which saturated after a threshold limit. As these strains are capable of producing higher siderophore units even upto 25 mM calcareous level, it can be used a tool for overcoming iron related stress under calcareous soils (> 30% of world area), where iron deficiency is a major constrain. The present investigation also revealed that these bacterial isolates exhibited other plant growth-promoting traits viz . citrate utilization, catalase activity, IAA production and subdues the root and stem rot fungi in groundnut viz., S. rolfsi and M. phaseolina has added advantage. However, further research is needed to elucidate the tolerance limits for calcareousness and optimisation of siderophore under field conditions, which can lower the impact of ion-induced chlorosis. Declarations ACKNOWLEDGEMENT The financial help by Science and Engineering Research Board (SERB), Ministry of Science and Technology, Govt. of India, New Delhi, India, Grant/Award number: E28 ACC for the research is gratefully acknowledged. Competing interests Authors have declared that no competing interests exist Authors’ Contributions ‘V.S. Reddy Kiran Kalyan’ performed the laboratory experiment, analysis, statistical analysis, wrote the protocol, and drafted the manuscript. ‘S.Karthikeyan, S.Meena, D.Jawahar' designed the study, managed the analyses of the study, literature searches, and manuscript. References Abd-Alla, M. H (1998) Growth and siderophore production in vitro of Bradyrhizobium (Lupin) strains under iron limitation. Eur. J. Soil Biol 34(2): 99–104. https://doi.org/10.1016/S1164-5563(99)80007-7 Ahmed, E., Holmström, S. J. M (2014) Siderophores in environmental research: Roles and applications: Siderophores in environmental research. Microb. Biotechnol 7(3):196–208. https://doi.org/10.1111/1751-7915.12117 Ahmed, E., Holmström, S. J. M (2015) Microbe–mineral interactions: The impact of surface attachment on mineral weathering and element selectivity by microorganisms. Chem. Geol., 403: 13–23. https://doi.org/10.1016/j.chemgeo.2015.03.009 Ali, I., Sultan, T., Subhan, F., Haleem, K. S., Sultana, N., Tauseef, I (2018) PGPRs of plum ( Prunus domestica ) rhizosphere enhance plant growth and antagonise fungal activity in vitro . Acta Agriculturae Scandinavica, Section B — Soil & Plant Science 68(4): 367–378. https://doi.org/10.1080/09064710.2017.1410565 Altschul, S (1997) Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res 25(17); 3389–3402. https://doi.org/10.1093/nar/25.17.3389 Aneja . K (2007) Experiments in microbiology, Plant Pathology. Biotehnol., New Age Internat. Publ. Arnow, L. E (1937) Colorimetric determination of the components of 3,4-Dihydroxyphenyl alaninetyrosine mixtures. J. Biol. Chem 118(2): 531–537. https://doi.org/10.1016/S0021-9258(18)74509-2 Aznar, A., Dellagi, A (2015) New insights into the role of siderophores as triggers of plant immunity: What can we learn from animals? J. Exp. Bot 66(11): 3001–3010. https://doi.org/10.1093/jxb/erv155 B.A. Coulombe, R.L. Chaney, W.J. Wiebold (1984) Bicarbonate directly induces iron chlorosis in susceptible soybean cultivars. Soil Sci. Soc. Am. J. 48 (6): 1297-1301. https://doi.org/10.2136/sssaj1984.03615995004800060019x Badalyan, S. M., Garibyan, N. G., Innocenti, G (2002) Antagonistic activity of xylotrophic mushrooms against pathogenic fungi of cereals in dual culture. Phytopathol. Mediterr 41: 1000–1006. Badalyan, S., Innocenti, G., Garibyan, N (2004) Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments. Phytopathol. Mediterr 43(1): 44-48. https://doi.org/10.14601/Phytopathol_Mediterr-1733 Barhoumi, S., Ellouzi, H., Krouma, A (2021) Functional analysis of the genotypic differences in response to calcareous-induced iron deficiency in pea plants ( Pisum sativum L.). Research square. 1-23. https://doi.org/10.21203/rs.3.rs-783550/v1 Barker, A. V., Pilbeam, D. J (2015) Handbook of plant nutrition (2nd ed.). CRC Press. Bin, L. M., Weng, L., Bugter, M. H (2016) Effectiveness of FeEDDHA, FeEDDHMA, and FeHBED in preventing iron-deficiency chlorosis in soybean. J. Agric. Food. Chem 64 (44): 8273-8281. https://doi.org/10.1021/acs.jafc.6b01382 Blumer, C., Haas, D (2000) Mechanism, regulation, and ecological role of bacterial cyanide biosynthesis. Arch. Microbiol 173 (3): 170-177. https://doi.org/10.1007/s002039900127 Bou-Abdallah, F (2010) The iron redox and hydrolysis chemistry of the ferritins . Biochim. Biophys. Acta, (BBA) – Gen. Subj 1800 (8): 719-731 . https://doi.org/10.1016/j.bbagen.2010.03.021 Boukhalfa, H., Crumbliss, A.L (2002) Chemical aspects of siderophore mediated iron transport. Biometals 15: 325–339. https://doi.org/10.1023/A:1020218608266 . Braud, A., Jézéquel, K., Bazot, S., Lebeau, T (2009) Enhanced phytoextraction of an agricultural Cr and Pb-contaminated soil by bio augmentation with siderophore producing bacteria. Chemosphere 74 (2): 280-286. https://doi.org/10.1016/j.chemosphere.2008.09.013 Briat, J., Dubos, C., Gaymard, F (2015) Iron nutrition, biomass production, and plant product quality. Trends Plant Sci 20 (1): 33-40. https://doi.org/10.1016/j.tplants.2014.07.005 Broadley, M., Brown, P., Cakmak, I., Rengel, Z., Zhao, F (2012) Function of nutrients. Marschner's Mineral Nutrition of Higher Plants 191-248. https://doi.org/10.1016/b978-0-12-384905-2.00007-8 Budzikiewicz, H (1993) Secondary metabolites from fluorescent pseudomonads. FEMS Microbiol. Lett 104 (3-4): 209-228. https://doi.org/10.1111/j.1574-6968.1993.tb05868.x Calvente, V., De Orellano, M. E., Sansone, G., Benuzzi, D., Sanz de Tosetti, M. I (2001) Effect of nitrogen source and pH on siderophore production by Rhodotorula strains and their application to biocontrol of phytopathogenic moulds. J. Ind. Microbiol. Biotechnol 26 (4): 226-229. https://doi.org/10.1038/sj.jim.7000117 Campanile, G., Ruscelli, A., Luisi, N (2007) Antagonistic activity of endophytic fungi towards Diplodia corticola assessed by in vitro and in planta tests. Eur. J. Plant Pathol 117 (3): 237-246. https://doi.org/10.1007/s10658-006-9089-1 Challis, G. L (2005) A widely distributed bacterial pathway for Siderophore biosynthesis independent of Nonribosomal peptide Synthetases. ChemBioChem 6 (4): 601-611. https://doi.org/10.1002/cbic.200400283 Champomier-Vergès, M., Stintzi, A., Meyer, J (1996) Acquisition of iron by the non-siderophore-producing pseudomonas fragi. Microbio 142 (5): 1191-1199. https://doi.org/10.1099/13500872-142-5-1191 Chen, Y., Barak, P (1982) Iron nutrition of plants in calcareous soils. Adv. Agron 217-240. https://doi.org/10.1016/s0065-2113(08)60326-0 Chiarini L.,Tabacchioni S., Bevivino A (1993) "Interactions between rhizosphere microorganisms under iron limitation." Arch. Microbiol 160 (1):68-73. https://doi.org/10.1007/bf00258147 Chu, H., Fierer, N., Lauber, C. L., Caporaso, J. G., Knight, R., Grogan, P (2010) Soil bacterial diversity in the Arctic is not fundamentally different from that found in other biomes. Environ. Microbiol 12 (11): 2998-3006. https://doi.org/10.1111/j.1462-2920.2010.02277.x Costa, J. M (1994) Characterization of Siderophore production by the biological control agent Enterobacter cloacae . Mol. Plant-Microbe Interact 7 (4): 440. https://doi.org/10.1094/mpmi-7-0440 Crosa, J. H., Mey, A. R., Payne, S. M. (Eds.) (2004) Iron transport in bacteria. ASM Press. https://doi.org/10.1128/9781555816544 Dave, B. P., Dube, H. C (2000) Chemical characterization of fungal siderophores. Indian J. Exp. Biol. , 38 (1), 56–62. David, B. V., Chandrasehar, G., Selvam, P. N (2018) Pseudomonas fluorescens : A plant-growth-Promoting Rhizobacterium (PGPR) with potential role in biocontrol of pests of crops. Crop improvement through microbe. Biotechnol 221-243. https://doi.org/10.1016/b978-0-444-63987-5.00010-4 Di Gregorio, A (2005) Land cover classification system: classification concepts and user manual: LCCS. Vol. 2: Food & Agriculture Org. Dimkpa, C., Merten, D., Svatoš, A., Büchel, G., Kothe, E (2009) Siderophores mediate reduced and increased uptake of cadmium by Streptomyces tendae F4 and sunflower ( Helianthus annuus ), respectively. J. Appl. Microbiol 107 (5): 1687-1696. https://doi.org/10.1111/j.1365-2672.2009.04355.x Dobay, O., Laub, K., Stercz, B., Kéri, A., Balázs, B., Tóthpál, A., Kardos, S., Jaikumpun, P., Ruksakiet, K., Quinton, P. M., Zsembery, Á (2018) Bicarbonate Inhibits Bacterial Growth and Biofilm Formation of Prevalent Cystic Fibrosis Pathogens. Front. Microbiol 9, 2245. https://doi.org/10.3389/fmicb.2018.02245 El-Shabrawy, E., Shehata, H (2018) Controlling maize late-wilt and enhancing plant salinity tolerance by some Rhizobacterial strains. Egyptian J. Phytopathol 46 (1): 235-255. https://doi.org/10.21608/ejp.2018.87796 Fazary, A. E., Al-Shihri, A. S., Saleh, K. A., Alfaifi, M. Y., Alshehri, M. A., Elbehairi, S. E (2016) Di- and tri-valent metal ions interactions with four biodegradable Hydroxamate and Cataecholate Siderophores: New insights into their Complexation equilibria. J. Solution Chem 45 (5): 732-749. https://doi.org/10.1007/s10953-016-0475-9 Ferreira, C. M., Vilas-Boas, Â., Sousa, C. A., Soares, H. M., Soares, E. V (2019) Comparison of five bacterial strains producing siderophores with ability to chelate iron under alkaline conditions. AMB Express , 9 (1). https://doi.org/10.1186/s13568-019-0796-3 Gaonkar, T., Bhosle, S (2013) Effect of metals on a siderophore producing bacterial isolate and its implications on microbial assisted bioremediation of metal contaminated soils. Chemosphere 93 (9): 1835-1843. https://doi.org/10.1016/j.chemosphere.2013.06.036 García-Marco, S., Martínez, N., Yunta, F., Hernández-Apaolaza, L., Lucena, J. J (2006) Effectiveness of ethylenediamine – n (o-hydroxyphenylacetic) – N′ (p-hydroxyphenylacetic) acid (o,p-EDDHA) to supply iron to plants. Plant Soil , 279 (1-2): 31-40. https://doi.org/10.1007/s11104-005-8218-5 Gérard, F (2016) Clay minerals, iron/aluminum oxides, and their contribution to phosphate sorption in soils - A myth revisited. Geoderma 262 : 213-226. https://doi.org/10.1016/j.geoderma.2015.08.036 Ghazy, N., El-Nahrawy, S (2020) Siderophore production by Bacillus subtilis MF497446 and Pseudomonas koreensis MG209738 and their efficacy in controlling Cephalosporium maydis in maize plant. Arch. Microbiol 203 (3): 1195-1209. https://doi.org/10.1007/s00203-020-02113-5 Grimm, P. W., Allen, P. J (1954) Promotion by zinc of the formation of cytochromes in ustilago sphaerogena . Plant Physiol 29 (4): 369-377. https://doi.org/10.1104/pp.29.4.369 Grobelak, A., Hiller, J (2017) Bacterial siderophores promote plant growth: Screening of catechol and hydroxamate siderophores. Int. J. Phytorem 19 (9): 825-833. https://doi.org/10.1080/15226514.2017.1290581 Haas, D., Défago, G (2005) Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat. Rev. Microbiol 3 (4): 307-319. https://doi.org/10.1038/nrmicro1129 Hider, R. C., Kong, X. (2010). Chemistry and biology of siderophores. Nat. Prod. Rep., 27 (5), 637. https://doi.org/10.1039/b906679a Kabir, A. H., Paltridge, N., Stangoulis, J (2016) Chlorosis correction and agronomic biofortification in field peas through foliar application of iron fertilizers under FE deficiency. J. Plant Interact 11 (1): 1-4. https://doi.org/10.1080/17429145.2015.1125534 Kamalakannan, A., Mohan, L., Harish, S., Radjacommare, R., Amutha, G., Chitra, K., Karuppiah, R., Mareeswari, P., Rajinimala, N., Angayarkanni, T (2004) Biocontrol agents induce disease resistance in Phyllanthus niruri Linn against damping-off disease caused by Rhizoctonia solani . Phytopathol. Mediterr 43(2): 187–194. http://www.jstor.org/stable/26456702 Kavitha, A., Prabhakar, P., Vijayalakshmi, M., Venkateswarlu, Y (2009) Production of bioactive metabolites by Nocardia levismk -vl_113. Lett. Appl. Microbiol 49(4): 484-490. https://doi.org/10.1111/j.1472-765x.2009.02697.x Kumar, V., S. Menon, H. Agarwal, D. Gopalakrishnan (2017) "Characterization and optimization of bacterium isolated from soil samples for the production of siderophores." Resour.-Effic. Technol. 3 (4):434-439. doi: https://doi.org/10.1016/j.reffit.2017.04.004 . Lemanceau, P., Alabouvette, C (1993) Suppression of Fusarium wilts by fluorescent pseudomonads : mechanisms and applications. Biocontrol Sci. Technol 3(3): 219-234. https://doi.org/10.1080/09583159309355278 Lis, H., Shaked, Y., Kranzler, C., Keren, N., Morel, F. M (2014) Iron bioavailability to phytoplankton: An empirical approach. The ISME Journal 9(4): 1003-1013. https://doi.org/10.1038/ismej.2014.199 Louden, B. C., Haarmann, D., Lynne, A. M (2011) Use of blue agar CAS assay for Siderophore detection. J. Microbiol. Biol. Educ 12(1): 51-53. https://doi.org/10.1128/jmbe.v12i1.249 Lucena, J. J (2000) Effects of bicarbonate, nitrate and other environmental factors on iron deficiency chlorosis. A review. J. Plant Nutr 23(11-12): 1591-1606. https://doi.org/10.1080/01904160009382126 Maindad, D. V., Kasture, V. M., Chaudhari, H., Dhavale, D. D., Chopade, B. A., Sachdev, D. P. (2014) Characterization and fungal inhibition activity of siderophore from wheat rhizosphere associated Acinetobacter calcoaceticus strain HIRFA32. Indian J.Microbiol 54(3): 315-322. https://doi.org/10.1007/s12088-014-0446-z Manthey, J., D.E. Crowley, and D.G. Luster (eds) (1994) Biochemistry of metal micronutrients in the rhizosphere. CRC Press, Boca Raton, pp 295–307 Martins, F., Machado, S., Albergaria, T., Delerue-Matos, C (2017) LCA applied to nano scale zero valent iron synthesis. Int. J. Life Cycle Assess 22(5): 707-714. https://doi.org/10.1007/s11367-016-1258-7 Messenger, A. J., Barclay, R (1983) Bacteria, iron and pathogenicity. Biochem. Educ 11(2): 54-63. https://doi.org/10.1016/0307-4412(83)90043-2 Miao Sheng, M., Jia, H. K., Zhang, G. Y., Zeng, L. N., Zhang, T. T., Long, Y. H., Lan, J., Hu, Z. Q., Zeng, Z., Wang, B., Liu, H. M (2020) Siderophore production by rhizosphere biological control bacteria Brevibacillus brevis GZDF3 of Pinellia ternata and its antifungal effects on Candida albicans . J. Microbiol. Biotechnol 30(5): 689-699. https://doi.org/10.4014/jmb.1910.10066 Neilands, J (1995) Siderophores: Structure and function of microbial iron transport compounds. J. Biol. Chem 270(45): 26723-26726. https://doi.org/10.1074/jbc.270.45.26723 Neilands, J. B. (1981). undefined. Annu. Rev. Nutr 1(1): 27-46. https://doi.org/10.1146/annurev.nu.01.070181.000331 Nithyapriya, S., Lalitha, S., Sayyed, R. Z., Reddy, M. S., Dailin, D. J., El Enshasy, H. A., Luh Suriani, N., Herlambang, S (2021) Production, purification, and characterization of Bacillibactin Siderophore of bacillus subtilis and its application for improvement in plant growth and oil content in sesame. Sustainability , 13(10): 5394. https://doi.org/10.3390/su13105394 Panchami, P. S., Geetha Thanuja, K., Karthikeyan, S (2020) Isolation and characterization of Indigenous plant growth-promoting Rhizobacteria (PGPR) from cardamom rhizosphere. Curr. Microbiol 77(10): 2963-2981. https://doi.org/10.1007/s00284-020-02116-x Peralta-Yahya, P. P., Zhang, F., del Cardayre, S. B., Keasling, J. D (2012) Microbial engineering for the production of advanced biofuels. Nature, 488(7411): 320–328. https://doi.org/10.1038/nature11478 Pieterse, C. M. J., Van Pelt, J. A., Ton, J., Parchmann, S., Mueller, M. J., Buchala, A. J., Métraux, J.P., Van Loon, L. C (2000) Rhizobacteria-mediated induced systemic resistance (Isr) in Arabidopsis requires sensitivity to jasmonate and ethylene but is not accompanied by an increase in their production. Physiol. Mol. Plant Pathol 57(3): 123–134. https://doi.org/10.1006/pmpp.2000.0291 Prathap. M. (2015). A critical review on plant growth promoting Rhizobacteria. J. Plant Pathol. & Microbiol 06 (04). https://doi.org/10.4172/2157-7471.1000266 R.C. Pearce, Y.M. Li, L.P. Bush (1999) Calcium and bicarbonate effects on the growth and nutrient uptake of burley tobacco seedlings: hydroponic culture, J. Plant Nutr 22 (7): 1069-1078. https://doi.org/10.1080/01904169909365696 Rangani, J., Panda, A., Patel, M., Parida, A. K (2018) Regulation of ROS through proficient modulations of antioxidative defense system maintains the structural and functional integrity of photosynthetic apparatus and confers drought tolerance in the facultative halophyte Salvadora persica L. J. Photochem. Photobiol B 189: 214-233. https://doi.org/10.1016/j.jphotobiol.2018.10.021 Rungin, S., Indananda, C., Suttiviriya, P., Kruasuwan, W., Jaemsaeng, R., Thamchaipenet, A (2012) Plant growth enhancing effects by a siderophore-producing endophytic streptomycete isolated from a Thai Jasmine rice plant ( Oryza sativa L. CV. KDML105). Antonie van Leeuwenhoek, 102(3), 463-472. https://doi.org/10.1007/s10482-012-9778-z Saha, M., Sarkar, S., Sarkar, B., Sharma, B. K., Bhattacharjee, S., Tribedi, P (2015) Microbial siderophores and their potential applications: A review. Environ. Sci. Pollut. Res 23(5): 3984-3999. https://doi.org/10.1007/s11356-015-4294-0 Sambrook, J., Fritsch, E. F., Maniatis, T (1989) Molecular cloning: A laboratory manual. Sandy, M., Butler, A (2009) Microbial iron acquisition: Marine and terrestrial siderophores. Chem. Rev., 109(10), 4580–4595. https://doi.org/10.1021/cr9002787 Santoyo, G., Moreno-Hagelsieb, G., del Carmen Orozco-Mosqueda, Ma., Glick, B. R (2016) Plant growth-promoting bacterial endophytes. Microbiol. Res 183: 92–99. https://doi.org/10.1016/j.micres.2015.11.008 Sasirekha, B., Srividya, S (2016) Siderophore production by Pseudomonas aeruginosa FP6, a biocontrol strain for Rhizoctonia solani and Colletotrichum gloeosporioides causing diseases in chilli. Agric. Nat. Resour 50(4): 250–256. https://doi.org/10.1016/j.anres.2016.02.003 Sayyed, R., Chincholkar, S (2006) Purification of siderophores of Alcaligenes faecalis on amberlite xad. Bioresour. Technol 97(8): 1026–1029. https://doi.org/10.1016/j.biortech.2005.04.045 Schwyn, B., Neilands, J. B (1987) Universal chemical assay for the detection and determination of siderophores. Anal. Biochem 160(1): 47–56. https://doi.org/10.1016/0003-2697(87)90612-9 Shaikh, S.S., Wani, S.J. Sayyed, R.Z (2016) Statistical-based optimization and scale-up of siderophore production process on laboratory bioreactor. 3 Biotech 6: 69. https://doi.org/10.1007/s13205-016-0365-2 Singh, A., Mishra, A. K (2015) Influence of various levels of iron and other abiotic factors on siderophorogenesis in paddy field cyanobacterium Anabaena oryzae . Appl. Biochem. Biotechnol 176(2): 372–386. https://doi.org/10.1007/s12010-015-1581-7 Singh, B. K., Dawson, L. A., Macdonald, C. A., Buckland, S. M (2009) Impact of biotic and abiotic interaction on soil microbial communities and functions: A field study. Appl. Soil Ecol 41(3): 239–248. https://doi.org/10.1016/j.apsoil.2008.10.003 Sinha, A. K., Parli, B. V (2020) Siderophore production by bacteria isolated from mangrove sediments: A microcosm study. J. Exp. Mar. Biol. Ecol 524: 151290. https://doi.org/10.1016/j.jembe.2019.151290 Sivasakthi, S., D. Kanchana, G. Usharani, P.Saranraj (2013) "Production of plant growth promoting substance by Pseudomonas fluorescens and Bacillus subtilis isolates from paddy rhizosphere soil of Cuddalore District, Tamil Nadu, India." Int. J. Microbiol. Res 4 (3):227-233 https://doi.org/10.5829/idosi.ijmr.2013.4.3.75171 Snow, G. A. (1970). Mycobactins: Iron-chelating growth factors from mycobacteria. Bacteriol. Reviews 34(2): 99–125. https://doi.org/10.1128/br.34.2.99-125.1970 Solanki, M. K., Singh, R. K., Srivastava, S., Kumar, S., Kashyap, P. L., Srivastava, A. K., Arora, D. K (2014) Isolation and characterization of siderophore producing antagonistic rhizobacteria against Rhizoctonia solani : Biocontrol of Rhizoctonia solani . J. Basic Microbiol 54(6): 585–597. https://doi.org/10.1002/jobm.201200564 Sridevi, M., Mallaiah, K. V (2007) Production of hydroxamate-type of siderophores by rhizobium strains from sesbania sesban (L.) merr. Int. J. Soil Sci 3(1): 28–34. https://doi.org/10.3923/ijss.2008.28.34 Storey, J. D., Xiao, W., Leek, J. T., Tompkins, R. G., Davis, R. W (2005) Significance analysis of time course microarray experiments. Proceedings of the National Academy of Sciences, 102(36): 12837-12842. https://doi.org/10.1073/pnas.0504609102 Sulochana, M. B., Jayachandra, S. Y., Kumar, S. K., Dayanand, A (2013) Antifungal attributes of siderophore produced by the Pseudomonas aeruginosajas -25. J. Basic Microbiol 54(5): 418-424. https://doi.org/10.1002/jobm.201200770 Tailor, A.J.; Joshi, B (2012) Characterization and optimization of siderophore production from Pseudomonas fluorescens strain isolated from sugarcane rhizosphere. J. Environ. Res. Dev 6: 688–694. Tank, N., Rajendran, N., Patel, B., Saraf, M (2012) Evaluation and biochemical characterization of a distinctive pyoverdin from a pseudomonas isolated from chickpea rhizosphere. Braz. J. Microbiol 43(2): 639-648. https://doi.org/10.1590/s1517-83822012000200028 Tian, F., Ding, Y., Zhu, H., Yao, L., Du, B (2009) Genetic diversity of siderophore-producing bacteria of tobacco rhizosphere. Braz. J. Microbiol 40(2): 276-284. https://doi.org/10.1590/s1517-83822009000200013 Tripathi, D. K., Singh, S., Singh, S., Mishra, S., Chauhan, D. K., Dubey, N. K (2015) Micronutrients and their diverse role in agricultural crops: Advances and future prospective. Acta Physiologiae Plantarum 37(7). https://doi.org/10.1007/s11738-015-1870-3 Vellore JM (2001) Iron acquisition in Rhodococcus erythrolpolis :the isolation of mutant(s) that do not produce a siderophore. [Dissertation]. East Tennessee State University, Johnson City, USA [Unpublished doctoral dissertation]. (n.d.). Visca, P., Imperi, F., Lamont, I. L (2007) Pyoverdine siderophores: From biogenesis to biosignificance. Trends Microbiol 15(1): 22-30. https://doi.org/10.1016/j.tim.2006.11.004 Vogel, S (1992) Twist-to-Bend ratios and cross-sectional shapes of petioles and stems. J. Exp. Bot 43(11): 1527-1532. https://doi.org/10.1093/jxb/43.11.1527 Weller, S. C (2007) Cultural consensus theory: Applications and frequently asked questions. Field Methods 19(4)” 339-368. https://doi.org/10.1177/1525822x07303502 Zuo, Y., Zhang, F (2011) Soil and crop management strategies to prevent iron deficiency in crops. Plant Soil 339: 83–95. https://doi.org/10.1007/s11104-010-0566-0 Tables Table 1 Bacterial population and siderophore production (%) on different calcareousness levels Isolates code Bacterial population (log 10 cfu ) Siderophore production (%) 10mM KHCO 3 15mM KHCO 3 20mM KHCO 3 25mM KHCO 3 10mM 15mM 20mM 25mM B licheniformis (MW279241) 5.80 6.11 6.52 7.21 62.3 69.5 70.1 70.9 B subtilis (MW279240) 6.98 6.52 6.53 6.62 79.8 76.4 74.7 74.1 B licheniformis (MW279255) 6.47 6.06 6.20 6.91 59.1 61.7 63.9 65.9 O grignonense (MW279256) 6.68 6.63 6.72 6.61 70.4 69.9 72.2 72.9 Table 2 Characterization of siderophore producing bacterial isolates Morphological parameters Bacillus licheniformis Bacillus subtilis Bacillus licheniformis Ochrobactrum grignonense Gram reactivity + + + + Shape Rod Rod Rod Rod Colony color white white white White Elevation Raised Raised Raised Raised Opacity Translucent Translucent Translucent Translucent Biochemical characteristics test Citrate utilization test - + + + Catalase + + + + MR (methylene red) + - + - VP (Voges-Proskauer) + + + - Indole acetic acid - + + - Note: Positive and Negative show the results of biochemical results. Table 3 Chemotyping of the siderophore-type produced by the bacteria Bacteria Arnow a Snow b Vogel c Bacillus licheniformis + ++ + Bacillus subtilis - ++ - Bacillus licheniformis ++ ++ ++ Ochrobactrum grignonense ++ ++ + a Catechol, b hydroxamate, and c carboxylate type siderophores were identified using Arnow's, Snow's, and Vogel's tests, respectively. ++ Strong positive result; + positive result; - negative result Table 4 Effect of antagonistic isolates on the growth of MP and SR Antagonistic isolate Mycelial growth of pathogens (% reduction over control)* MP SR Bacillus licheniformis 57.5 b 52.6 c Bacillus subtilis 48.2 c 51.0 c Bacillus licheniformis 54.1 b 76.3 a Ochrobactrum grignonense 37.3 d 48.3 c T.Viride 69.3 a 65.1 b Control** 0.0 e 0.0 d * Mean of three replicates **Growth of Macrophomina phaseolina (MP) and Sclerotium rolfsi (SR) in the absence of antagonistic fungal isolates Table 5 Antagonism Index (AI) and type/subtype of interaction between antagonistic isolates and SR, MF scored on Badalyan’s scale Antagonistic isolate AI* Type/Subtype* MP SR MP SR Bacillus licheniformis 10 10 B B Bacillus subtilis 10 10 B B Bacillus licheniformis 10 10 B B Ochrobactrum grignonense 5 20 A CA1 T.Viride 5 5 A A * Mean of three replicates A = deadlock with mycelial contact; B = deadlock at a distance; CA1 = partial replacement after initial deadlock with mycelial contact Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 08 Jul, 2022 Reviewers invited by journal 25 Feb, 2022 Editor assigned by journal 24 Feb, 2022 First submitted to journal 23 Feb, 2022 Editorial decision: Major revisions 21 Feb, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1365991","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":86465325,"identity":"345ec59f-18c4-4988-8b6d-887f21ce9485","order_by":0,"name":"REDDY KIRAN KALYAN V S","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAUlEQVRIiWNgGAWjYFACNoYDQNKAgR3EqQBiZuYGIrUwgzhnQFoYCWthgGthbAOxCWgxOH8s8XBFzR1j/mYew8+F82qj+duBWn5UbMOt5UbagYNnjj0zkzjMYyw9c9vx3BmHGRsYe87cxqlFcgZ7w8EGtsM2DId5DKR5tx3LbQBqYWZsw6Ol/zhQy7/DNvJAW37zzjmWO5+QFn4GoMMa2w6bGRzmMZPmbajJ3UBQi0RawsHGvsPGhofZyqx5jh3I3QjUchCfX9j4jxl/bPh22HDe8ebNt3lq6nLnnT988MGPCtxakACHAZA4DGYeIEY9ELA/ABJ1RCoeBaNgFIyCkQQA+ftdyshtzecAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-9390-4970","institution":"Tamil Nadu Agricultural University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"REDDY","middleName":"KIRAN KALYAN V","lastName":"S","suffix":""},{"id":86465326,"identity":"b897842c-bba4-48b6-9547-b8996c7460ad","order_by":1,"name":"Meena S","email":"","orcid":"","institution":"TNAU: Tamil Nadu Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Meena","middleName":"","lastName":"S","suffix":""},{"id":86465327,"identity":"94cb0f13-1623-4a1d-a809-b42950390655","order_by":2,"name":"Karthikeyan S","email":"","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Karthikeyan","middleName":"","lastName":"S","suffix":""},{"id":86465328,"identity":"2b0244d7-3e58-40ec-adbb-070fafec211b","order_by":3,"name":"Jawahar D","email":"","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jawahar","middleName":"","lastName":"D","suffix":""}],"badges":[],"createdAt":"2022-02-16 14:14:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1365991/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1365991/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":18693963,"identity":"b787a2a8-364b-4881-bc71-7aaf41fbb487","added_by":"auto","created_at":"2022-02-28 16:39:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":332465,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe appearance of orange color and zone formation indicating siderophore production in CAS agar plate assay.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/dd2591d315c2b84f587d108d.png"},{"id":18693964,"identity":"f8ee9b7e-8495-4996-8613-dc5450f7f1ee","added_by":"auto","created_at":"2022-02-28 16:39:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":28092,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSiderophore production by the bacteria isolates\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/c6d8a8f639ceeb87997be8dc.png"},{"id":18693756,"identity":"41f1c824-16ec-460c-a65e-be4a76db177c","added_by":"auto","created_at":"2022-02-28 16:36:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":191993,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree based on the 16S rRNA gene sequence of siderophore producing rhizobacteria along with NCBI accession code\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/8127eb92ad5e1e38a11aff24.png"},{"id":18694252,"identity":"f194cd43-31c1-4e65-a2a8-59ee737025c1","added_by":"auto","created_at":"2022-02-28 16:42:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":232408,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of hydroxamate-type and catechol-type siderophore activity, using cell-free culture supernatants\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/b9ab4dbe9ea4ba51a3b90e82.png"},{"id":18693966,"identity":"d77962e8-01ac-4f56-81e3-095f125a4496","added_by":"auto","created_at":"2022-02-28 16:39:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":151130,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFTIR spectrum of siderophore positive bacterial extract (A – \u003cem\u003eBacillus licheniformis \u003c/em\u003e(SID 13); B – \u003cem\u003eBacillus subtilis \u003c/em\u003e(SID 25); C – \u003cem\u003eBacillus licheniformis \u003c/em\u003e(SID 30) and D – \u003cem\u003eOchrobactrum grignonense \u003c/em\u003e(SID 33))\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/31d4e7803008997d1cff15e2.png"},{"id":18694251,"identity":"52c45779-16fe-4a3c-8d8b-8ae1491387c1","added_by":"auto","created_at":"2022-02-28 16:42:27","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":263602,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of different a) pH, b) temperature, c) nitrogen source, d) carbon source and e) iron concentration on the production of bacterial siderophores\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/8b51f7249f6f2296fa08b820.png"},{"id":18693757,"identity":"ce9f86ca-91d5-41df-8d1e-d51e19e28e5b","added_by":"auto","created_at":"2022-02-28 16:36:28","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":490795,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea \u0026amp; b, Complete replacement with \u003cem\u003eT.viride\u003c/em\u003e mycelium on \u003cem\u003eM.phaseolina\u003c/em\u003e\u0026nbsp;and \u003cem\u003eS.rolfsi\u003c/em\u003e after 7 and 6 days of inoculation in dual culture respectively; c, partial replacement after initial deadlock at a distance between \u003cem\u003eB. licheniformis\u003c/em\u003e isolate against \u003cem\u003eM.phaseolina\u003c/em\u003e; d shows deadlock at a distance between \u003cem\u003eB. licheniformis\u003c/em\u003e isolate against \u003cem\u003eS.rolfsi\u003c/em\u003e in dual culture method.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/1c5afd81bdcd4b86c954217d.png"},{"id":18694253,"identity":"e6256c9a-bfd8-49cc-a1e6-e1d8cbb8920a","added_by":"auto","created_at":"2022-02-28 16:42:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3092037,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1365991/v1/b729cb21-55e0-46bd-9eee-ffee3d6eda92.pdf"}],"financialInterests":"","formattedTitle":"Isolation, screening, characterization, and optimization of bacterium isolated from calcareous soils for siderophore production","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eEven though Fe is one of the most predominant elements in the Earth's crust (Manthey et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e1994\u003c/span\u003e) its availability to plants and microorganism is insufficient. A transition metal can be found in two oxidation states, Fe (III) and Fe (II). It is a crucial limiting factor for plants and microorganisms as it occurs as Fe\u003csup\u003e3+\u003c/sup\u003e (ferric form) which is not soluble at physiological pH (Bou-Abdallah, 2010) which is insoluble in the form of iron (Zuo and Zhang, \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Saha \u003cem\u003eet al.\u003c/em\u003e, 2016). Iron is an essential element for plant growth and development (Barker and Pilbeam, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Though Fe is not a chlorophyll component, it is vital for photosynthesis and the functioning of the photosynthetic apparatus (Broadley et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Briat et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Rangani et al., \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It also controls the biosynthesis of antibiotics, porphyrins, pigments, toxins, siderophores, cytochromes, and aromatic compounds (Messenger and Barclay, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e1983\u003c/span\u003e). The iron deficiency of plants results in chlorosis, characterized by the yellow young leaves due to lack of iron for efficient chlorophyll production (Lucena, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Barhoumi et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). These effects of chlorosis in plants result in lower biomass and yield, decreased flowers and fruits, and in critical cases total crop fatigue (Tripathi et al., \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Kabir et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBecause of iron chemical composition, low solubility, low bioavailability, and dissolubility kinetics makes problematic in absorbing iron on calcareous soils. IDC is widespread in plants grown in alkaline and calcareous soils as low Fe (Fe\u003csup\u003e2+\u003c/sup\u003e) levels. Calcareous soils are estimated to cover about 30% of the world's cultivated soils (Chen and Barak, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1982\u003c/span\u003e; Di Gregorio, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Barker and Pilbeam, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) which underscores the importance of iron deficiency as a major global agricultural challenge. This significantly affects crop yields and hinders low bioavailability in soil (Martins et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Synthetic chelating agents \u003cem\u003eviz\u003c/em\u003e., \u003cem\u003eo,o\u003c/em\u003e-ethylenediamine - di (\u003cem\u003eo\u003c/em\u003e-hydroxyphenylacetate)-Fe(III) and \u003cem\u003eo\u003c/em\u003e,\u003cem\u003eo\u003c/em\u003e-EDDHA/Fe(III) chelate (Garc\u0026iacute;a-Marco et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Bin et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) have been commonly used to overcome chlorosis in calcareous soils, but their non-biodegradable nature poses a hazard to soil health. Since these are powerful chelating agents, the pursuit of environmental protection and the proper chelating of iron fertilizers has therefore become a major challenge.\u003c/p\u003e \u003cp\u003eMicrobes have developed many strategies to scrounge iron from their atmosphere in response to iron limitation. One mechanism of microorganisms and plants is to produce low molecular (500\u0026ndash;1000 Daltons) iron chelators termed siderophores (Greek \u003cem\u003esideros\u003c/em\u003e meaning iron and phores meaning bearer) to enhance the acquisition of iron from the soil environment, particularly under the Fe-limited circumstances, which selectively complex iron (III) with very high affinity (Sandy and Butler, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Lis \u003cem\u003eet al.\u003c/em\u003e, 2015). They exhibit strong interaction constants for iron complexation (Neilands, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Siderophores are usually classified into three major classes, such as hydroxamates, catecholates, and carboxylates based on their structural units (Hider and Kong, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Rungin et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Some bacteria possess more than one form of siderophores and multiple absorption pathways for iron acquisition. The main feature of the siderophores is the chelating of Fe (III) and accumulation of complex heavy metals such as Fe\u003csup\u003e3+\u003c/sup\u003e, Cu\u003csup\u003e2+\u003c/sup\u003e, Zn\u003csup\u003e2+\u003c/sup\u003e, Ni\u003csup\u003e2+\u003c/sup\u003e and Cd\u003csup\u003e2+\u003c/sup\u003e and the production and retention of toxic metals such as Cu\u003csup\u003e2+\u003c/sup\u003e, Zn\u003csup\u003e2+\u003c/sup\u003e, and Pb\u003csup\u003e2+\u003c/sup\u003e affecting metal mobility (Braud et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Dimkpa et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSiderophore first bonds to the ferric form of iron and then forms a siderophore-iron complex, which enters the cells through unique cell membrane siderophore receptors. Many siderophores produced by microorganisms are attributable to the low atmospheric abundance of Fe and are more selective to Fe (III) than divalent metals. Approximately 500 biomolecules have been listed under siderophores where many genes and regulators are involved in their synthesis, distribution, and re-import into cells (Challis, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Visca et al., \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Chu et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Previous studies reported the siderophore beneath iron-deprived conditions forms complex with iron (Boukhalfa and Crumbliss, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Tian et al., \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Prathap \u003cem\u003eet al.\u003c/em\u003e, 2015).\u003c/p\u003e \u003cp\u003eSeveral siderophore-producing rhizobacteria (SPR) have been assessed and reported as biocontrol agents against plant pathogens (Sulochana \u003cem\u003eet al.\u003c/em\u003e, 2014; Sasirekha \u003cem\u003eet al.\u003c/em\u003e, 2016), including the species of \u003cem\u003ePseudomonas\u003c/em\u003e (Weller, \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Ghazy and El-Nahrawy, 2021), \u003cem\u003eBacillus\u003c/em\u003e (Crosa et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Peralta-Yahya et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; miao Sheng \u003cem\u003eet al.\u003c/em\u003e, 2020; Ghazy and El-Nahrawy, 2021), and \u003cem\u003eEnterobacter\u003c/em\u003e (Costa and Loper, 1994; Grobelak and Hiller, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Sinha \u003cem\u003eet al.\u003c/em\u003e, 2020). These strains develop siderophores under iron-restricting conditions that chelate the available iron and deprive the respective phytopathogens of iron nutrients (Lemanceau \u003cem\u003eet al.\u003c/em\u003e, 1993; Ahmed and Holmstr\u0026ouml;m, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Santoyo et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), thus limiting the dissemination of phytopathogens and root colonization. SPR is also known to impart induced systemic resistance (ISR) to plants (Pieterse et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Aznar and Dellagi, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) and has been documented in biocontrol of \u003cem\u003eM\u003c/em\u003e. \u003cem\u003ePhaseolina, Rhizoctonia solani, Phytophthora nicotianae\u003c/em\u003e var. \u003cem\u003eParasitic, Pythium spp\u003c/em\u003e., and \u003cem\u003eFusarium spp\u003c/em\u003e. (Blumer and Haas, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Haas and D\u0026eacute;fago, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Singh et al., \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Ali et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; El-Shabrawy and Shehata, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). With this context, our research focuses on the isolation and characterization of calcareous soil siderophore-producing bacteria and the culture conditions for higher siderophore production have also been optimized.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1. Micro-organisms and culture conditions\u003c/h2\u003e\n \u003cp\u003eSoils were sampled from both rhizosphere and bulk soils of groundnut, grown under calcareous soils in June 2019 near the villages of Thondamuthur block of Coimbatore, Tamil Nadu, India (10\u0026deg;99\u0026prime;N, 76\u0026deg;79\u0026prime;E). These sites were located about at an altitude of 473 m above sea level. The annual average precipitation is 618 mm and an annual average temperature of 28.9\u0026deg;C. The bedrock in the area is charnockite and gneiss. The soil samples for this study were taken from the rhizosphere soil and kept cold (4\u0026deg;C) until further analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2. Isolation and identification of siderophore producing bacteria from soil\u003c/h2\u003e\n \u003cp\u003eThe aerobic and facultative anaerobic siderophore-producing microorganisms were isolated from the soil solution. The samples were serially diluted (to 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e) and inoculated in nutrient agar (NA) medium and incubated for 24 h at room temperature. The colonies were distinguished, sub-cultured, and purified (Gaonkar and Bhosle, \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). The purified colonies were further tested for the production of siderophore using CAS (Schwyn and Neilands, \u003cspan class=\"CitationRef\"\u003e1987\u003c/span\u003e). The positive colonies were purified by three times subculture method on CAS Agar plates and stored in 20% (v/v) glycerol at -20\u003csup\u003e0\u003c/sup\u003e C.\u003c/p\u003e\n \u003cdiv class=\"Section3\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.2.1. Identification of strains\u003c/h2\u003e\n \u003cp\u003eBacterial isolate showing efficient siderophore production was further characterized based on the morphological, biochemical, and molecular levels. Isolates were gram stained to understand the cell shape, size, arrangement, and gram nature. The purified isolates were subjected to biochemical characterization (Aneja, \u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e) for the detection of organisms up at the genus level. Further, the molecular characterization was carried out using fD1 (5\u0026apos; AGAGTTTGATCCTGGCTCAG 3\u0026apos;) and rP2 (5\u0026apos; ACGGCTACCTTGTTACGACTT 3\u0026apos;) primers. The reaction mixture in each tube consisted of 20 \u0026micro;l with DNA template 50 ng, 1x Taq buffer, 0.2 mM of each dNTP mixture, 1 \u0026micro;M of each primer, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, and 2U of Taq DNA polymerase (Bangalore Genei, India). PCR amplification was performed and products were separated by electrophoresis on 1% agarose gel (Sambrook et al., \u003cspan class=\"CitationRef\"\u003e1989\u003c/span\u003e). The 16S rRNA gene was sequenced in both directions and the obtained sequences were compared to sequences in the NCBI GenBank database using the BlastN (Altschul \u003cem\u003eet al.\u003c/em\u003e, 1997). The recovered sequences, as well as the closest identified relatives, were aligned in Molecular Evolutionary Genetics Analysis (MEGA) Software ver. 10.0. All the sequences were submitted to the GenBank and accession numbers were acquired.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.3. Partial purification of siderophore\u003c/h2\u003e\n \u003cp\u003eThe cultures were grown in Fiss-glucose minimal media (Vellore, \u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e) for 24 hours at 28\u0026deg;C on a rotary shaker. After incubation, the culture supernatant was collected by centrifuging at 7,000 rpm for 30 minutes. The supernatant was then acidified to pH 2.0 with 6 M HCl to make the siderophore less soluble in water and passed the acidified supernatant through a 30 x 5 cm column packed with Amberlite XAD-2 (Sigma, USA), which binds cyclic compounds were dissolved in distilled water and kept overnight for soaking. The loaded column was pre-washed twice with water, methanol, and water. The aqueous supernatant was allowed to slowly pass through the column at the rate of 5 mL min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Loading of supernatant was continued until the saturation of the column, which was indicated by the browning of the column. The column was then washed with five to ten-bed volumes of distilled water to remove all unbound components of the medium. The column was then equilibrated by changing the solvent to 50% methanol to facilitate the extraction of siderophores (Budzikiewicz, \u003cspan class=\"CitationRef\"\u003e1993\u003c/span\u003e). Different fractions were separately collected; filtrate, water wash, and eluted fractions were checked for CAS test. Fractions positive for siderophore were combined in a 100 ml boiling flask and the pH was adjusted to 3.0 with H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e and 50 percent ammonium sulfate solution was added to deproteinize and evaporated to dryness using a rotary evaporator. This aqueous phase was concentrated in a lyophilizer (Lark) and set aside in cold to crystallize. The filtrate was neutralized, reduced to dryness, extracted in dry hot methanol and were then separated on Whatman filter paper no. 44. The obtained purified siderophore crystals obtained were then subjected to Fourier transform infrared spectroscopy (FTIR)-ATR analysis (JASCO FT/IR-6800) for determination of the functional groups. The spectrum was recorded in the range from 400 to 4000 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The infrared spectrum wavelengths were determined based on their functional groups (Tank et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.4. Quantitative and qualitative estimation of siderophores\u003c/h2\u003e\n \u003cp\u003eThe purified bacterial isolates were grown in an iron-deficient succinate medium and incubated for 48 h with constant shaking at 120 rpm. All the isolates were screened for siderophore production \u003cem\u003eviz\u003c/em\u003e spectrophotometric means at A630 nm (Grimm and Allen, \u003cspan class=\"CitationRef\"\u003e1954\u003c/span\u003e) which was further confirmed by the Chrome Azurol sulphonate (CAS) agar test. The production of siderophore by the isolate was quantitatively determined using (CAS) as described by (Schwyn and Neilands, \u003cspan class=\"CitationRef\"\u003e1987\u003c/span\u003e). From the prepared CAS solution, 0.5 ml was taken to which 0.5 ml of culture supernatant was added and incubated for 5 min. Then the mixture was measured at 630 nm and calculated for the siderophore production (Maindad et al., \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e; Fazary et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e). The percent of siderophore was intended in terms of % of siderophore units by the following formula:\u003c/p\u003e\n \u003cdiv class=\"Equation\" id=\"Equa\"\u003e\n \u003cdiv class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAlMAAAA5CAIAAACd0zmqAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAABB2SURBVHhe7Z1rlSQ3DEaXQjAshXAIhMUQCmEQBmEQBEEQAiEQBsshuetPo/O1XXa7ex49M6X7o09bfkmyLFX1zjn75b+iKIqiOBNV+YqiKIpzUZWvKIqiOBdV+YqiKIpzUZWvKIqiOBdV+YqiKIpzUZWvKIqiOBdV+YqiKIpzUZWvKIqiOBdV+YqiKIpzUZWvKIqiOBdV+YqiKIpzUZWvKIqiOBdV+YqiKIpzUZWvKIqiOBdV+YqiKIpz8Qkr399///3XX39F4w35559/2Bqi/WH5/v27DMGiEBUn5stAdBQGOefnn3/+888/o128bz5DEJOpf//9919++SXu5ZcvNKPv9aFCxK5PRMcHBL+FDQ1cGh3FiVEwEOfRLo4gC1H2fvrpp69fv97hK+bi5G/fvkX7ddBROtFxPu60/N9//+WQ5DuedGYnTTQQB0QDX0L00vBewhaooaD57bff+P78ytcs+8HOUl3xC+nHxItfVb4F4aO3fcx6CDLzpmz+xx9/MIWLH+2Pg9La3RWIREc+ZIVbX/60786sZ2ooMmVF+/VRYonGBMyX94Avi5ultx1lfiBT3fo73z2WsysxjWZ8Ael6+MuYrL01CG4iPfWyv3BqTdjMa/7GGaKPCc80YUZVviXho6p8A8oPmhWiD0LWg+dE/jolHqJLt/Og8CIawltWPvbKLB2iI3799VcGqIaBpvAZ3UZ6mCksTn1RvPHaEyM2uMdyvVfluaIlzfEZRMf5qtlTWwtcENKXIBY9X+WDMKMq35Lw0RAhXMvo+Cy/EN5qC/nog1Y+/UCF2s+MfHIji7BatK+hV+SdxP1SGnKaLALRfh24CyoWSXQMKJO7x/L5aczAWpMwi7aZsx+l91iud8xoNGiiZTSeUDHYf/C5A5zyw9zGY7NMVb5C5CWEx8bkS3GTLUr6PIZrVkg/Aio/0vz5ka83mM2fu5RRr6bKF9QwozTarwBbYBd6UtX0C+1iO3mgc5cqXFdZ8kcpvoSoobfA/R+B77GcDbqXUBXnaDR0PK/9Q5DCSzw2y1TlK4TSkzhh5SNmFDY3zXo4esMgX6GwNI+OexlfYmZox8Of9ZyX1fClzFxA3eIu6Hu+oqjZoacl6IpZKokzQ/R0v0bH5hY4KkRL7rGc1bucSBNhNJ4OCeU2lejAYEq3ngKALzQRRvcTSFRxnU6xQ6jKLDjO1RayJTlcUBqOK4gYZHCiFOm0iImjRd2+HDDeI3pylj8S0sVJ+xS+I+kc3q2pAXxqTanRRRtoMMh23KXnKUlmT6YMozd9whRM7hbP6BTsjhBLc/28KqLzM2qPa3Z0W8iEUU5TcgjRE6wPbKR92dQHQ+fV3AIOY1LEiBYMHGuanPg67wqp14XrIXre1cjDWTRlOJ+KVQWknPZAD+i4UQYNm+LHiVGBkVcS0BlJdF+iAVff5JjOsC7yR65qyApSLPWRthrcxfDazEM0xYvQPnn7on3JoldyV163bwyVtIgvIVpyg+XJuLG0icbTW+p9Psqj0vlxeJkj8kQh7ewYPdIhVUHeJJJyx3SZ9Bfjgjlet9dXEDHuCaUDYBiDsShvDl0xqGmSukHGcZLqcZeUKfjUvWKwxqREsCaVQ12AyWPCZQoqxYRGdDQDfbrQ9YuhDZq5rCxCVWmYksR9y3c3GTzE06tKCnninY0jh8c3ukJywPzUFohbbwofD4dbzGJSaEwuzuHK7emrMdKu0ha+gQyhm9ici4cxilNTc5xFJHAEGS0cq0cO4NUY+rYQTuyeoStl1OXo3mGjjEJ53TskGtCh2Fb0zmARnT5fQnTEVQ1xOyHKIupivLRVE7psvDBzhqbI9ltBt8V2uulEQrQNzSJsov30u+gYKmnR2uHJDZYn2iAaDZdIgzuuMaSDPJjSJOisUmyJnSNRpIoQNeTNXMF37AxJDcGD1YMsRI1cigE5ngiWELzq+OKMZy5TMjVIPSS5lxeVdAW2uGJEvORC1wM842S2EiFtEHNoyHh39ewUfB23hUsY0kvfgpZS6AOzNCynu/9z2CzXiNnxuTw3Em6dPI/Qj6nbcbYF+FJax8mzcwW0UbfODlpqn1GfHTbn6sgynsdZKnt8kYuITL5wpggVpV12fjNQI883T1ZNR+Hnlw4wysPe0XjP2iM6+tkKyVpDfJ4rqAsJkabLpac0eT5ZmNnBdN1fTdGBIrnpMSWvc7QvUTzwGW0Dq7uutkx/fwGTZ12HXLd8REkzXckXmnnA9OJ0XQA+kTd9fpR0eW1Gqg5dKGS+4EuIGnKZWC8uUhlYjNcZi+48UpNO7pqEqJEFxsf7+h5AGR+Q8ixdUljXScjJwou6V6aZLe5tCGkjRJfp3iuox5aXB08K3I2QXl5+1wfnSKgQAq2cTfC93D+LLDkz2eW+LPjxuRW6eCJEjdkW4EsxLKQN90k36z0jhTtbOhRO7lXdlM7PQi7i82rGfwMUwGldntFor9Tez/gK1/VBKz+sS/6+hqAuNvUwHmGuRkZ7gm4iRykN+c5BSx/IEnCVvLnRviTjIdrG2NWWOY6rRdfIFcsPUZLNDdSUa7wLv+AyjpYvoDM+PC2RDoVOe9kvOPiQXsoXKydeNtCNXVAs+owMC3Cnu3yhYYguq0s3PqSX6zMmpMP4ZCcXzypNt6Yv5d4L0dx2T1juUl8EQnr5vOLr+PqOR4Kv6XNn/oHZFovpfny+o8tD1JhtAbOloHvaYGQ34H0ibdeqYgun7LdJfjg8Ji1I+B3evkPc4ZvEzCUogNrdCWr6aC+2qMufLBdofLe4o3jw58uRmzRML3kGOCRHRnsOSuqO61bKKJL5uPuCdF20L1GoHDpq7GrLrOLqsGtkKz5GpBCPP8AXpUJ8xCHlQcpfWaj0qLI4kvQOdNprO+Een8ln5HknKIye3Q30Ye70TQ1DtHddN9dPorsRosZMZ5dvejVE83VcPlsEQtoI0Xwdx/0wY+YfmG3h8k1XuDxEjYUVs6WE9wqSyPqR/+FIz9GWRN7oXjJk6XhM+cpyk9Xu8E1i5hJFGokr2g1NP7Q3n/Owzh/BD9HiXXg4Sp58RvuImzTUiwdcfaRIf0b7GiigVxcS5mbhd2TFbDuFyqGjxq62zPH1X3SN7Fo+QuCyB2QE6LfEPA+9Uui7aIpNd2QpDQC+h7Qh+4Wf90y+gPvJ4cWcJ5B4HGdYgDt9U8MQXa7TjT9ksX4S3Y0QNWY6L3SYeS9E83VcPlsEQtoI0Xwdx/3QrbnDbAuXb7rC5SFqLKyYLSVIST4g0bPj+0QajrYk/uNBx5jWlZ25cdF+HGRzKXnIrDBnAuGzK/YdCuMuPBz5ratqzq0aKgNffeGDDOBoLyFoiU9VPj7XVh+SNzral+hGHL77apZHkSTjfUmLNp+otizfQRu702l2xsh3s+cRz3d3JKbFzewgnnBcV/9opmLpRPDA3dQwRJfrdOMPWayfRHcjRI2ZzgsdZt4L0Xwdl88WgZA2QjRfx3E/dGvuMNvC5ZuucHmIGgsrZks55A7dBWd24gti5jYzfdas5+qwxl75oXMO6LVpJzu/Nujmtz75Ye3yOJiSL0CLuiXPjB4QJGh6WSfaR9yqoUrpzjtZBnC05zCSZTk11GA8n5wdil195XXkitl2i17J3SK2RjJ6NS3aVOy65Zvgne6QRv2k9OwK5as6dIeqicJDzeWzZWeganpc5ArpRHATSFghnZgmQrTMj4e4Pp0HEpwcI+a52B+IXL7p1RBd6jyzRY+ZgjEhbYT08gFoxyc7fljgT8ozExaucCtcHqLGworZUiP0ev3r1tkhZm6z1mfGYi6XiIAcH8BBP+WNRu1n51dFJ3j4+qJDWQeeDJ+tINY1XhdnMf1WDTPsd1K/Fodoz+EEpYPWVxhQtm8K17zR0b6E9dXbaU5zlMurOD/aT9z6W8J1y3eQYV00j3ooKURjwBNWFy66LeA5FLSgOLyZV9H9FLlChgX4AedJAKZlmc9rICQULvfqAqxGBPuhZnzA7OLp4IXPzegBvy1uS7dm6tZ5VUJw22c+8X09APw0Z5XY13Hcz51uwI5MTOcfEpMvn6ld1c4VLBgdl4Hk8hA1FlbMljoEK2Lo3BsPR+od2qJo7AJbKJg7o9Leq555bYirMbSETtAjhEQ/DtawRQlfDJAfPIeM3KQh6CUSor0kAzjaG2jKfQenYJhtl1HR+Yomws4JaaZnP9CThKeaNTdYPkM5zlOMUGKNRoMmwmgckS8QHhOeQzFbQqEIEDtHopEebXkkkPIMC2ALCQXHEB3Ny0xBvVRbzNbHRVKSAWRhbEQyG9yFdeJVwcdkRewOwm3x5wmXe6VEn5Be2j7zCePTJy7PMoOZnhkXvnXoikFNba3Ap1x0Nb4Ve0IxI4eHaPj3J99OZyRc7ie1sMIPUQ5nMIeSyndbayR08veD1HO3CDlhvPhCAYnPo91Iv0X7QRweRKJ49sui8R7GgOEIu/zr0DsboJy+CONbNQRNWdwp546D0JQuA28i3RbbYSm92JW3LBPLuKM87+YrK3apZs0LhKCyw3gx0Mzl6ERznbOwVlZpJE2XeIIGFsycCxoffRM0kgUVjqxwuLiOQeBNj92MGAcP+BSOOUY3lAJG2NoV5rvn2a7X8aIi96ZknNUprKcqN7w7kYxRkcfX+cQjDP8gUZfWT0nnPVj41sGK1LBjHUKiswLYK58WgchJE/iS+gMaSo5uIWr4sS6s6FYTWjO1wks6JmVAWBz3w5GGGQkCbXX7+AyRkQHQTZQHNrPzK5HHehhIfrnyRHQxOSPFDHJd6kUoKtgOnQOK7c6lyR0agpT0KF2QaSHarwmuyGDgInjqSDBEPuGT8SBzDj2Q0UWJwRAcolDkS4zY4LmWo6Lsibah89OVBrRE3UOzOzCgqwHYP06MbuPqjYpxBi5j8fFydkRfA7tU1AHd5G4WkUR08ccYma9eZqlCOG5yEn0DeIMddd7Aykw/PPgM8Q6mKG5iXGNm+1WfcL6Mwa7oa2eBBHmMaByu0+mQMBcvuVtQmHiL7muwl/yDpYof0DqJRkbDYO5CfmhFWynoIiR1PpyIgVkI3yfS04+J7xnM0OX3LuQYiUPUpdM8TBdvQz5qCAIjOhrdAaVdWMTILrzXeVYBcDhGibFzWnKfhiDJ5gXJM4r2K9CFQYeukqMcojsLeHhhixKgglCpLGNsk2dZjq7sCrN7i/EZLncoVzwfj78x2oriKgoeAinaxTXWtY2UTe9jL+MbVL53znktPwlV+YpnouCpyrcJrwF63J896POqQC9vLdF+BFX5qvJ9cqryFc9EwVOVb4cse7PfQpHT++3yj1Penqp8Vfk+OfqHWFGVr7gDBU9VvjXUPKoa73Nfn/4bo0P0L53rfyN8A6ryVeX7zHAb808tgDv52N9Yio9IRI8RHYXBIyZve+s/VtLfWFEdo/04qvJVEH9meMlTfDvRVxTF26L72P255luiDOBEx/moPFgURVGci6p8RVEUxbmoylcURVGci6p8RVEUxbmoylcURVGci6p8RVEUxbmoylcURVGci6p8RVEUxbmoylcURVGci6p8RVEUxbmoylcURVGci6p8RVEUxbmoylcURVGci6p8RVEUxbmoylcURVGcif/++x+0TtIf1x8vpwAAAABJRU5ErkJggg==\"\u003e\u003c/div\u003e\n \u003c/div\u003e\n \u003cp\u003eWhere Ar\u0026thinsp;=\u0026thinsp;absorbance of reference (CAS reagent); As =\u0026thinsp;absorbance of the sample at 630 nm. Further, the qualitative confirmation was performed by CAS agar test, where the bacterial isolates streaked on the CAS plates show orange zone.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.5. Screening of bacteria for calcareousness tolerance\u003c/h2\u003e\n \u003cp\u003eThe succinate medium (SM) medium was to screen calcareous tolerant bacteria. The succinate medium concentration per liter: KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 3.0 g; K\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e, 6.0 g; MgSO\u003csub\u003e4\u003c/sub\u003e.7H\u003csub\u003e2\u003c/sub\u003eO, 0.2 g; (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, 1.0 g; succinic acid, 4.0 g; peptone, 1.0 g; final pH 6.5. This medium was enriched with KHCO\u003csub\u003e3\u003c/sub\u003e (calcareous source) to mimic calcareous soil. The KHCO\u003csub\u003e3\u003c/sub\u003e were added at different concentrations \u003cem\u003eviz\u003c/em\u003e., 10, 15, 20, and 25 \u0026micro;M at room temperature. The production of siderophore by the isolates under calcareous stress was quantitatively determined using CAS (Schwyn and Neilands, \u003cspan class=\"CitationRef\"\u003e1987\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Taba\"\u003e\n \u003ccolgroup cols=\"2\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSuccinate medium (SM)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eKH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e 3.0 g per litre; K\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e 6.0 g per litre; MgSO\u003csub\u003e4\u003c/sub\u003e.7H\u003csub\u003e2\u003c/sub\u003eO 0.2 g per litre; (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e 1.0 g per litre; succinic acid 4.0 g per litre; peptone 1.0 g per litre; distilled water 1000 ml; final pH 6.5\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatment 1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSM\u0026thinsp;+\u0026thinsp;10 mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatment 2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSM\u0026thinsp;+\u0026thinsp;15 mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatment 3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSM\u0026thinsp;+\u0026thinsp;20 mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatment 4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSM\u0026thinsp;+\u0026thinsp;25 mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.6. Chemical Characterization of Siderophores\u003c/h2\u003e\n \u003cp\u003eThe type of siderophore was determined by specific tests using culture supernatants prepared as described above. Hydroxamate type of siderophore was detected by tetrazolium test (Snow, \u003cspan class=\"CitationRef\"\u003e1970\u003c/span\u003e), catecholate type of siderophores was detected by Arnow\u0026rsquo;s test (Arnow, \u003cspan class=\"CitationRef\"\u003e1937\u003c/span\u003e); carboxylate type was detected using Vogel (\u003cspan class=\"CitationRef\"\u003e1992\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003e2.7. Optimization for maximum siderophore production\u003c/h2\u003e\n \u003cp\u003eThe bacterial isolates were allowed to grow in succinate broth under different fermentation conditions, such as pH (5, 6, 7, 8 and 10), temperature (27, 37 and 45\u003csup\u003e0\u003c/sup\u003eC), nitrogen sources (urea. ammonium sulphate (NH\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e) and sodium nitrate (NaNO\u003csub\u003e3\u003c/sub\u003e), carbon sources (sucrose, glucose, fructose and lactose), and iron concentration (1, 2 and 3 ppm) for 48h to investigate the maximum level of siderophore production. For siderophores analysis, the supernatant was centrifuged at 5000 rpm for 10 min and cell-free supernatant was analyzed using CAS assay test. The production of siderophore was measured at 630 nm and calculated (Maindad et al., \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e; Fazary et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003e2.8. Antagonism tests in vitro\u003c/h2\u003e\n \u003cdiv class=\"Section3\" id=\"Sec12\"\u003e\n \u003ch2\u003e2.8.1. Growth of bacterial strain and fungal mycelium in dual culture\u003c/h2\u003e\n \u003cp\u003eThe antimicrobial activity of every bacterial strain was surveyed by the dual culture method (Campanile et al., \u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e) to screen antagonism. Petri dishes (9 cm) containing 20 ml of sterile PDA were inoculated with a loop of potential antagonists of bacterial strains and the 0.5 cm sterile plug of a 3 day-old pure culture pathogens \u003cem\u003eS. rolfsi\u003c/em\u003e and \u003cem\u003eM. phaseolina\u003c/em\u003e, which were collected from the department of plant pathology, Tamil Nadu Agricultural University, Coimbatore. The distance between the pathogen and antagonist was 4 cm. Each combination of pathogen/antagonist was repeated 3 times and as negative controls. All Petri dishes were incubated at 25\u003csup\u003e0\u003c/sup\u003eC in the dark and randomly distributed. The experiment was replicated three times. Radial growth was recorded by measuring colony diameter at 1-day intervals for the time required to reach the margin of the dish in controls. The Antagonism Index (AI) was assessed according to the following formula: AI = (RM - rm)/ RM * 100, where rm\u0026thinsp;=\u0026thinsp;ray of the colony towards the antagonist and RM\u0026thinsp;=\u0026thinsp;average of the three rays of the colony in the other directions. The zone of inhibition around the spots was recorded as a positive result.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec13\"\u003e\n \u003ch2\u003e2.8.2. Interactions between bacterial strains and antagonistic fungi in dual culture\u003c/h2\u003e\n \u003cp\u003eThe antagonistic ability of the selected bacterial cultures against \u003cem\u003eS. rolfsi\u003c/em\u003e and \u003cem\u003eM. phaseolina\u003c/em\u003e was tested using the dual-culture method described by (Badalyan et al., \u003cspan class=\"CitationRef\"\u003e2002\u003c/span\u003e; Badalyan et al., \u003cspan class=\"CitationRef\"\u003e2004\u003c/span\u003e). A loop of bacterial cultures and a plug (0.5 cm diameter) of antagonistic fungus was cut from the margin of a 3 day-old culture and placed respectively on opposite sides (4 cm from the margin) of Petri dishes containing PDA. Each combination of pathogen/antagonist was repeated 3 times and plates were randomly incubated at 25\u003csup\u003e0\u003c/sup\u003eC for 3 days. As negative controls, 3 Petri dishes were inoculated with selected bacterial cultures and a water agar plug. Interactions were examined daily. Antagonism towards bacterial cultures was scored using the Badalyan et al. (\u003cspan class=\"CitationRef\"\u003e2002\u003c/span\u003e) rating scale into 3 types (A, B, and C) and 4 subtypes (CA1, CA2, CB1, and CB2), where: A\u0026thinsp;=\u0026thinsp;deadlock with mycelial contact, B\u0026thinsp;=\u0026thinsp;deadlock at a distance, C\u0026thinsp;=\u0026thinsp;replacement, overgrowth without initial deadlock; CA1 and CA2\u0026thinsp;=\u0026thinsp;partial and complete replacement after initial deadlock with mycelial contact, CB1 and CB2\u0026thinsp;=\u0026thinsp;partial and complete replacement after an initial deadlock at a distance. The following scores were assigned to each type or subtype of reaction: A\u0026thinsp;=\u0026thinsp;1.0; B\u0026thinsp;=\u0026thinsp;2.0; C\u0026thinsp;=\u0026thinsp;3.0; CA1\u0026thinsp;=\u0026thinsp;3.5; CB1\u0026thinsp;=\u0026thinsp;4.0; CA2\u0026thinsp;=\u0026thinsp;4.5; and CB2\u0026thinsp;=\u0026thinsp;5.0. The AI was calculated for each species using the formula: AI\u0026thinsp;=\u0026thinsp;SN x I, where N\u0026thinsp;=\u0026thinsp;number (frequency) of each type or subtype of reaction and I\u0026thinsp;=\u0026thinsp;the corresponding score.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec14\"\u003e\n \u003ch2\u003e2.9. Statistical analysis\u003c/h2\u003e\n \u003cp\u003eAll the data were analyzed using SPSS software 23.0 version (SPSS IBM). The significant differences in the means were analyzed based on Tukey\u0026rsquo;s multiple comparison test (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv class=\"Section2\" id=\"Sec16\"\u003e\n \u003ch2\u003e3.1. Isolation and screening of siderophores producing bacteria\u003c/h2\u003e\n \u003cp\u003eA total of 33 bacterial isolates were obtained, purified, and cultured. The siderophore-producing bacterial isolates were screened using a CAS assay (both qualitatively and quantitatively). The cultures were grown in a succinate medium and incubated for 48 hours before being tested for CAS in a spectrophotometer. 17 of the thirty-three isolates tested positive for turbidity in the SA medium and turbidity in the CAS test. The presence of siderophores was confirmed on CAS agar plates by the presence of a distinctively orange-colored zone (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) indicating siderophore production.\u003c/p\u003e\n \u003cdiv class=\"Section3\" id=\"Sec17\"\u003e\n \u003ch2\u003e3.1.1. Quantitative Screening of Siderophore Producing Bacteria\u003c/h2\u003e\n \u003cp\u003eFor quantitative estimation, CAS assay was employed and their cell concentration was measured at A630 nm. Out of thirty-three isolates, 17 were found to be positive for siderophore and selected for quantitative estimation of siderophore production. Thirteen isolates produced siderophore units in the range of 8.4\u0026ndash;54.9%, while 4 isolates SID 13, SID 25, SID 30, and SID 33 produced significantly higher quantities of siderophores (\u0026lt;\u0026thinsp;65% siderophore units (SU) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec18\"\u003e\n \u003ch2\u003e3.1.2. Screening of bacteria for calcareousness tolerance\u003c/h2\u003e\n \u003cp\u003ePotassium bicarbonate (KHCO\u003csub\u003e3\u003c/sub\u003e) is used in the culture medium to simulate calcareousness artificially and their influence was studied in terms of bacterial population and siderophore production. All the isolates followed similar trend, siderophore production increased with increasing the concentration of sodium bicarbonate. Among the four isolates, \u003cem\u003eBacillus licheniformis\u003c/em\u003e showed marked increase in bacterial colony forming units (cfu) and siderophore production with rising concentration of bicarbonate. At higher concentrations \u003cem\u003ei.e\u003c/em\u003e. at 25 mM KHCO\u003csub\u003e3\u003c/sub\u003e, the siderophore production percentage ranges from 65.9 to 74.1% irrespective of the bacterial strains (Table.1).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec19\"\u003e\n \u003ch2\u003e3.2. Characterization of efficient siderophore-producing isolate\u003c/h2\u003e\n \u003cp\u003eFurther, the isolates SID 13, SID 25, SID 30, and SID 33 were taken for morphological, molecular, and biochemical characterization. The results of biochemical characterization are given in Table.2. The molecular identification was confirmed by 16S rDNA sequencing of bacterial isolate SID 13 was showing similarity to \u003cem\u003eB. licheniformis\u003c/em\u003e (98%); SID 25 was showing similarity to \u003cem\u003eB. subtilis\u003c/em\u003e (100%); SID 30 was showing similarity to \u003cem\u003eB. licheniformis\u003c/em\u003e (99.9%) and SID 33 was more close to \u003cem\u003eO. grignonense\u003c/em\u003e with the percent identity of 93%. The evolutionary relationship of the identified 16S rDNA sequencing and the acquired accession numbers from NCBI were shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec20\"\u003e\n \u003ch2\u003e3.3. Siderophore Chemotyping\u003c/h2\u003e\n \u003cp\u003eThe type of siderophore present in each medium filtrate was subjected to Arnow\u0026rsquo;s, Snow\u0026rsquo;s, and Vogel\u0026rsquo;s tests. Both \u003cem\u003eB. licheniformis\u003c/em\u003e strains and \u003cem\u003eO. grignonense\u003c/em\u003e were positive for all three tests, indicating the presence of catechol, carboxylate, and hydroxamate siderophores in the filtrate of the culture medium. \u003cem\u003eB. subtilis\u003c/em\u003e filtrate was positive only for hydroxymate. (Table 3; Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e.).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec21\"\u003e\n \u003ch2\u003e3.4. FTIR analysis\u003c/h2\u003e\n \u003cp\u003eThe infrared spectrum analyses of the partially purified SPB cultures extract pellet showed a broad peak at 3221, 3242, 3264 and 3265 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicating the presence of aromatic OH moiety of siderophores. The peak at 3170 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e is attributed to NH stretching. The appearance of a peak at 2950 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e showed the presence of saturated alkanes. The spectrum also provides evidence for the presence of amide linkage in the structure. The intense peak at 1640 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e typically indicated an amide C\u0026thinsp;=\u0026thinsp;O stretching suggesting a secondary amide functionality. A conjugation and intramolecular H bonding may have caused the lowering of the C\u0026thinsp;=\u0026thinsp;O stretch peak. The peak observed at 1451 and 1452 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e revealing the presence of one -C-H bending with functional group -CH\u003csub\u003e2\u003c/sub\u003e and one -N-O structure, which shows that similarity towards hydroxamate functional groups. Furthermore, a peak at around 1200 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicated a -C-O-C- bond of the ether linkage. Thus, the spectrum indicated the presence of catechol siderophores (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e.).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec22\"\u003e\n \u003ch2\u003e3.5. Different culture conditions for optimum production of siderophores\u003c/h2\u003e\n \u003cp\u003eTo understand the significant effect of various culture conditions that relates the bacterial growth and siderophore production, the cultures were grown under different growth conditions such as pH, temperature, carbon source, nitrogen source, and iron concentration. Hence we tried to optimize conditions for the maximum production of siderophore by the SPB strains.\u003c/p\u003e\n \u003cdiv class=\"Section3\" id=\"Sec23\"\u003e\n \u003ch2\u003e3.5.1. Influence of pH\u003c/h2\u003e\n \u003cp\u003eThe optimum siderophore production in all the four SPB strains was achieved at pH 8. The maximum amount of siderophore produced (84.8% SU) was found with SID 30 strain at pH 8. Irrespective of the strains the lowest siderophore yield was found at pH 10 in SID 13 with the value of 52.8% SU. This might be due to at alkaline pH of the medium decreases the solubility of iron thus making it unavailable to the growing bacteria creating an iron-depleted environment suitable for siderophore production (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e.).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec24\"\u003e\n \u003ch2\u003e3.5.2. Influence of temperature\u003c/h2\u003e\n \u003cp\u003eFurther, the culture conditions were changed with constant pH and different temperatures. Our study also showed higher production of siderophore accounting for ̴70% at 25\u0026deg;C in all the strains. Upon increasing the temperature levels the siderophore production showed a sheer decline to 37.2% at 45\u003csup\u003e0\u003c/sup\u003e C in SID 25 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e.).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec25\"\u003e\n \u003ch2\u003e3.5.3. Influence of nitrogen sources\u003c/h2\u003e\n \u003cp\u003eAll the four, selected strains from this study were able to synthesize siderophore\u0026thinsp;\u0026gt;\u0026thinsp;67% irrespective of applied nitrogen source. Different nitrogen sources influenced siderophore production significantly. The highest % SU was detected with ammonium sulfate (80.6%) as the nitrogen source in SID 30, whereas, the lowest siderophore production was registered with SID 25 (67.2%) with urea as a nitrogen source as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec26\"\u003e\n \u003ch2\u003e3.5.4. Influence of carbon sources\u003c/h2\u003e\n \u003cp\u003eThe SPB strains were assessed for their optimal requirement of carbon source for maximal production of the iron-chelating siderophores. Sucrose was found to be a favourable carbon source for all the four tested SPB (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). The production of siderophore was comparatively higher ̴ 80.4% in \u003cem\u003eB. licheniformis\u003c/em\u003e (showing an evolutionary relationship with the \u003cem\u003eBacillus sp.\u003c/em\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec27\"\u003e\n \u003ch2\u003e3.5.5. Influence of iron concentrations\u003c/h2\u003e\n \u003cp\u003eThe addition of FeSO\u003csub\u003e4\u003c/sub\u003e in the medium significantly affected the siderophore production. The addition of 2 PPM of FeSO\u003csub\u003e4\u003c/sub\u003e in the medium resulted in higher siderophore production up to 77% SU in SID 13. This might have induced an enhanced rate of siderophore production to bind with the available iron and provide it to the cell. Upon increasing iron concentration, there was a steep decline in the % SU to 61.3. This could be because once iron concentration in the medium reached above the threshold value required for siderophore production, it negatively regulates iron acquisition genes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec28\"\u003e\n \u003ch2\u003e3.6. Antagonistic potential of SPB in dual culture\u003c/h2\u003e\n \u003cp\u003eVarying degrees of mycelial growth inhibition of \u003cem\u003eS. rolfsi\u003c/em\u003e and \u003cem\u003eM. phaseolina\u003c/em\u003e were observed with antagonistic bacterial and fungal isolates. \u003cem\u003eTrichoderma viride\u003c/em\u003e had the maximum inhibitory effect on mycelial growth of both \u003cem\u003eM. phaseolina\u003c/em\u003e and \u003cem\u003eS. rolfsi\u003c/em\u003e with a reduction of 69.3 and 65.1 respectively compared to control. The isolates \u003cem\u003eB. licheniformis\u003c/em\u003e, \u003cem\u003eB. subtilis\u003c/em\u003e, \u003cem\u003eB. licheniformis\u003c/em\u003e, and \u003cem\u003eO. grignonense\u003c/em\u003e expressed significantly lower mycelial growth inhibition with reductions in the range of 37.3\u0026ndash;57.5% for \u003cem\u003eM. phaseolina\u003c/em\u003e and 48.3\u0026ndash;52.6% for \u003cem\u003eS. rolfsi\u003c/em\u003e (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, compared to controls and other antagonists) (Table.4.).\u003c/p\u003e\n \u003cp\u003eThe antagonistic index in the dual-culture method, based on the AI values for both the \u003cem\u003eM. phaseolina\u003c/em\u003e and \u003cem\u003eS.rolfsi\u003c/em\u003e in the presence of antagonistic isolates were divided into three groups: active (\u003cem\u003eT. viride\u003c/em\u003e), moderate (\u003cem\u003eB. licheniformis and B. subtilis\u003c/em\u003e) and weakly active (\u003cem\u003eO. grignonense\u003c/em\u003e) only for \u003cem\u003eS. rolfsi\u003c/em\u003e. The most important parameter determining antagonistic activity was the inhibiting speed of colony growth (Table.5 \u0026amp; Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eSiderophores are low molecular weight compounds (between 500 and 1500 dalton), of high affinity and selectiveness to bind and complex Fe (III). As a part of a strategy to extract iron from the atmosphere because of the poor bioavailability of iron, these siderophores are produced both from plants and microbes (Hider and Kong, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Ahmed and Holmstr\u0026ouml;m, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In the last few years, several researchers have drawn attention to this particular function. They have wider applications in plant growth, biocontrol activity, and several other ecological factors. In this present study, the siderophore-producing bacteria were isolated from the soil samples and the optimal fermentation condition was configured to understand the culture medium capable of a high level of siderophore production. Similar results were reported by Ferreira et al. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) under alkaline conditions where they evaluated five bacterial strains for siderophore kinetics, percent siderophore production, type of siderophore produced, and iron-chelating capacity at pH 9.0. Ghosh \u003cem\u003eet al.\u003c/em\u003e(2015) used both fungal strains (\u003cem\u003eT. viride\u003c/em\u003e-1, \u003cem\u003eT. harzianum-\u003c/em\u003e1, \u003cem\u003eCandida famata\u003c/em\u003e-1) and bacterial strains (\u003cem\u003eB. subtilis-\u003c/em\u003e1, \u003cem\u003eB. megatericus\u003c/em\u003e, \u003cem\u003eP. aeroginosa\u003c/em\u003e) for siderophore production. The CAS or HDTMA forms a strong complex with a ferric ion to produce a blue color to the medium, when iron chelators like siderophores are added to the medium, the iron is separated from the dye complex and the colour gradually changes from blue to orange (Louden et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOut of 17, 4 isolates (SID 13, SID 25, SID 30, and SID 33) produced higher siderophore units (SU) above 65% in CAS-liquid assay. When these siderophore producing isolates subjected to calcareous stress showed positive results even under 25 mM K HCO\u003csub\u003e3\u003c/sub\u003e concentration, without any decline in % siderophore units. Earlier results showed that \u003cem\u003eE. coli, P. aeruginosa, S. aureus, S. agalactiae, E. faecalis\u003c/em\u003e and \u003cem\u003eH. influenza\u003c/em\u003e growth significantly inhibited when subjected to NaHCO\u003csub\u003e3\u003c/sub\u003e (100 mmol l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and suggesting that HCO3\u0026thinsp;\u0026minus;\u0026thinsp;can suppress bacterial growth in general (Dobay et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) .As several researchers have also confirmed that high bicarbonate concentration directly caused iron deficiency chlorosis (Coulombe et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Pearce et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e1999\u003c/span\u003e), our strain proved to withstand at all the four levels of bicarbonate concentration showing its ability of tolerance against calcareousness along with higher siderophore production.\u003c/p\u003e \u003cp\u003eMicrobial siderophores are usually grouped as catecholates, hydroxamates, carboxylates, and mixed type since these compounds shows the highest affinity towards iron. Evolutionary relationship of our bacterial strains showed maximum relative percentage towards \u003cem\u003eBacillus sp.\u003c/em\u003e Earlier researchers also found that most of the siderophore producing bacteria are subsiding under the \u003cem\u003eBacilli sp (\u003c/em\u003eSivasakthi et al., \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Shaikh et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Most of our isolates were tested positive for more than one type of siderophore. Earlier reports showed that several soil bacteria could produce more than 65 percent of SU and multiple types of siderophore (Hider and Kong, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Ahmed and Holmstr\u0026ouml;m, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Ferreira et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe partial purified siderophores using Amberlite XAD-2 shows similar trends of Sayyed and Chincholkar (\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) who purified siderophores of \u003cem\u003eAlcaligenes faecalis\u003c/em\u003e on Amberlite XAD-400 resins. Further, the FTIR spectrum of LSBS2 showed the adsorption bands at 3445, 2951, 1652, 1455, and 1143 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, respectively, which indicates the presence of (-OH), aromatic (-CH), (-C\u0026thinsp;=\u0026thinsp;O), (-CH2) and (C-O-C) linkage. These functional groups are present in the catecholate type of siderophore so that the purification of siderophore production in FTIR analysis confirmed the presence of a catecholate type of siderophore that is specific to 2,3 dihydroxybenzoic acid (Nithyapriya et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo optimize the bacterial strains capable of siderophores potential ability, the performance of the bacteria was optimized with the following characteristics: culture media composition (carbon and nitrogen sources), iron complexation capacity, pH range, and under different temperatures conditions. Though iron is the major factor involved in siderophore production, other cultural conditions also play a significant role in siderophore production. Tailor and Joshi (\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) reported that bacteria can grow optimally in the physiological environment. Storey et al. (\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) indicated that under normal conditions with Fiss-glucose medium, the hydroxamate siderophore was lower and, this can further be optimized to higher siderophore production with certain modifications in the growth medium.\u003c/p\u003e \u003cp\u003eBecause its solubility and availability are affected by the pH of the medium, pH plays an important role in microbial proliferation. We detected that the increased siderophore concentration was recorded when the pH was lower than 8. Given that Fe\u003csup\u003e2+\u003c/sup\u003e is soluble and Fe\u003csup\u003e3+\u003c/sup\u003e is insoluble at physiological pH (7.35\u0026ndash;7.40) (Bou-Abdallah, 2010) alkaline pH decreases iron solubility, rendering it unavailable to bacteria, resulting in an iron-depleted environment ideal for siderophore synthesis. G\u0026eacute;rard (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) discovered that the insolubility of iron increases at high pH values, which supports our observations. At pH 8, iron becomes more insoluble in soil solution, which may have accelerated siderophore production. The present finding agrees with Calvente et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) who reported similar results as pH near 8 stimulates higher siderophore production. In some cases, it was reported that the highest iron-chelating capacity, at pH 9.0, was obtained by \u003cem\u003eB. megaterium\u003c/em\u003e followed by \u003cem\u003eB. subtilis\u003c/em\u003e and \u003cem\u003eA. vinelandii\u003c/em\u003e (Ferreira et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eThe percentage of siderophore production varied with incubation temperature, being optimum at 27\u003csup\u003e0\u003c/sup\u003eC, lesser at 35\u003csup\u003e0\u003c/sup\u003eC, and least at 45\u003csup\u003e0\u003c/sup\u003eC. The incubation temperature considerably influenced siderophore production; these findings are in accordance with Dave and Dube (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2000\u003c/span\u003e) who have reported that maximum siderophore production occurred at 30 \u003csup\u003e0\u003c/sup\u003eC. Percent siderophore units were recorded maximum at 30\u0026deg;C \u003cem\u003ei.e.\u003c/em\u003e 83.9% by \u003cem\u003eA. oryzae\u003c/em\u003e (Singh and Mishra, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The \u003cem\u003eP. fluorescens\u003c/em\u003e strain was also found to produce maximum siderophore at 29\u003csup\u003e0\u003c/sup\u003eC (Tailor and Joshi, \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Otherness Kumar et al. (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) reported that 35\u0026deg;C (room temperature) showed optimum bacterial siderophore production in VITVK5 and VITVK6 strains.\u003c/p\u003e \u003cp\u003eThe optimization was carried out with the different sources of nitrogen such as ammonium sulfate, sodium nitrate, and urea. All the above mentioned isolates have produced siderophore more than 65% with all the nitrogen sources and the maximum was registered with ammonium sulfate, while \u003cem\u003eOchrobactrum\u003c/em\u003e sp. influenced to produce higher siderophore with as N source as shown in our results (Louden et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Tailor and Joshi, \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The results were similar with Tailor and Joshi (\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) who also confirmed maximum siderophore yield up to 96% in \u003cem\u003eP. fluorescence\u003c/em\u003e and \u003cem\u003eP. putida\u003c/em\u003e in the presence of ammonium sulfate and urea.\u003c/p\u003e \u003cp\u003eBased on previous reports we have chosen to evaluate four major carbon sources namely glucose, fructose, lactose, and sucrose. Among these, sucrose had a stimulating effect on the production of siderophore followed by glucose. The present findings prove that the presence of sugars such as sucrose in the growth media increased the growth of \u003cem\u003eNocardia levis\u003c/em\u003e MK-VL_113 for the elaboration of bioactive metabolites (Kavitha and Vijayalakshmi, 2009). Sucrose concentration at 2% roused the growth and siderophore production in \u003cem\u003eRhizobium\u003c/em\u003e strains (Sridevi and Mallaiah, 2008). A previous study of siderophore production by \u003cem\u003eRhodotorula sp.\u003c/em\u003e reported by Calvente et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) also shows similar results of enhanced siderophore production upon sucrose supplementation. Supplementing the growth media with carbon sources increases the growth and metabolism of bacteria and the siderophore production capability. The siderophore production by an organism depends on the availability of organic and inorganic nutrients in the medium (Neilands, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e1981\u003c/span\u003e; Abd-Alla, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1998\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong various abiotic factors, the pH of the medium plays a major role in Fe availability. Notably with increasing concentration beyond a threshold level supresses the siderophore production. Our findings also showed that the percentage siderophore enhanced with increasing pH and Fe concentration up to 8 and 2 PPM respectively beyond that siderophore production started to decline, which might be due to native availability of iron. Tailor and Joshi (\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) showed similar results, where the concentration of siderophore produced from \u003cem\u003eP. fluorescence\u003c/em\u003e decreased after 1\u0026micro;M. Muthuselvan \u003cem\u003eet al.\u003c/em\u003e(2013) who also reported that at low concentration (1\u0026ndash;3\u0026micro;M) of iron enhanced the siderophore production of \u003cem\u003eAzotobacter\u003c/em\u003e sp. up to 82%. Excess iron concentration harmed siderophore production along with the morphology alterations and growth (Singh and Mishra, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIdentification and selection of effective antagonistic organisms is the first and foremost step in biological control (Kamakannan \u003cem\u003eet al.\u003c/em\u003e, 2004). Our findings witness the significant antagonistic activities of \u003cem\u003eB. licheniformis\u003c/em\u003e, \u003cem\u003eB. subtilis\u003c/em\u003e, \u003cem\u003eB. licheniformis\u003c/em\u003e, and \u003cem\u003eO.grignonense\u003c/em\u003e against \u003cem\u003eM. phaseolina\u003c/em\u003e and \u003cem\u003eS.rolfsi\u003c/em\u003e in \u003cem\u003ein-vitro\u003c/em\u003e dual cultures. Siderophores are also thought to facilitate biocontrol by sequestering iron from pathogens, thus limiting their growth (Chiarini et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Champomier-Verg\u0026egrave;s et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Siderophore positive \u003cem\u003eP. fluorescens\u003c/em\u003e is known to control bacterial pathogens including bacterial soft rot of potato, the bacterial canker, and bacterial wilt of tomato (David et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). These results are also in agreement with Solanki et al. (\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) who also reported efficient siderophore production using \u003cem\u003eEnterococcus sp.\u003c/em\u003e and its activity against plant pathogen \u003cem\u003eR. solani\u003c/em\u003e. These beneficial effects of siderophore include both plant growth enhancement and biological control of phytopathogenic fungi (Ghazy and El-Nahrawy, 2021). Secondary metabolite like siderophore production is a key for plant growth-promoting bacteria by fulfilling the plants' iron requirements and protecting against plant pathogens. Nursery and field trials in cardamom with siderophore producing bacteria, by \u003cem\u003eP. putida\u003c/em\u003e TAUC10, had higher ligand formation constants than those of the soil pathogens (Panchami et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the present study, 17 bacterial isolates were found to be positive for qualitative CAS agar assay. Upon qualitative and quantitative analysis, 4 isolates (\u003cem\u003eB. licheniformis\u003c/em\u003e, \u003cem\u003eB. subtilis\u003c/em\u003e, \u003cem\u003eB. licheniformis\u003c/em\u003e, and \u003cem\u003eO. grignonense\u003c/em\u003e) were found to produce above 65% siderophore units having higher potential use for iron-induced chlorosis amendment in calcareous soils. The morphological and molecular characterization of siderophore-producing bacteria depicts close resemblance to the bacterial species of \u003cem\u003eBacillus sp.\u003c/em\u003e and \u003cem\u003eOchrobactrum sp.\u003c/em\u003e Results of the influence of different culture conditions showed that the bacterial isolate had the efficiency of producing siderophore in higher concentration at pH 8, 37 \u003csup\u003e0\u003c/sup\u003eC with sucrose as carbon source and Na\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e as nitrogen source. The increase in iron concentration increased the production of siderophore, which saturated after a threshold limit. As these strains are capable of producing higher siderophore units even upto 25 mM calcareous level, it can be used a tool for overcoming iron related stress under calcareous soils (\u0026gt;\u0026thinsp;30% of world area), where iron deficiency is a major constrain. The present investigation also revealed that these bacterial isolates exhibited other plant growth-promoting traits \u003cem\u003eviz\u003c/em\u003e. citrate utilization, catalase activity, IAA production and subdues the root and stem rot fungi in groundnut \u003cem\u003eviz., S. rolfsi\u003c/em\u003e and \u003cem\u003eM. phaseolina\u003c/em\u003e has added advantage. However, further research is needed to elucidate the tolerance limits for calcareousness and optimisation of siderophore under field conditions, which can lower the impact of ion-induced chlorosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eACKNOWLEDGEMENT\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eThe financial help by Science and Engineering Research Board (SERB), Ministry of Science and Technology, Govt. of India, New Delhi, India, Grant/Award number: E28 ACC for the research is gratefully acknowledged.\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eAuthors have declared that no competing interests exist\u003c/p\u003e\n\u003ch2\u003eAuthors\u0026rsquo; Contributions\u003c/h2\u003e\n\u003cp\u003e\u0026lsquo;V.S. Reddy Kiran Kalyan\u0026rsquo; performed the laboratory experiment, analysis, statistical analysis, wrote the protocol, and drafted the manuscript. \u0026lsquo;S.Karthikeyan, S.Meena, D.Jawahar\u0026apos; designed the study, managed the analyses of the study, literature searches, and manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbd-Alla, M. H (1998) Growth and siderophore production in vitro of \u003cem\u003eBradyrhizobium\u003c/em\u003e (Lupin) strains under iron limitation.\u0026nbsp;Eur. J. Soil Biol\u0026nbsp;34(2): 99\u0026ndash;104.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/S1164-5563(99)80007-7\"\u003ehttps://doi.org/10.1016/S1164-5563(99)80007-7\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eAhmed, E., Holmstr\u0026ouml;m, S. J. M (2014) Siderophores in environmental research: Roles and applications: Siderophores in environmental research. Microb. Biotechnol 7(3):196\u0026ndash;208.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/1751-7915.12117\"\u003ehttps://doi.org/10.1111/1751-7915.12117\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eAhmed, E., Holmstr\u0026ouml;m, S. J. M (2015) Microbe\u0026ndash;mineral interactions: The impact of surface attachment on mineral weathering and element selectivity by microorganisms.\u0026nbsp;Chem. Geol., 403: 13\u0026ndash;23.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.chemgeo.2015.03.009\"\u003ehttps://doi.org/10.1016/j.chemgeo.2015.03.009\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eAli, I., Sultan, T., Subhan, F., Haleem, K. S., Sultana, N., Tauseef, I (2018) PGPRs of plum (\u003cem\u003ePrunus domestica\u003c/em\u003e) rhizosphere enhance plant growth and antagonise fungal activity \u003cem\u003ein vitro\u003c/em\u003e. Acta Agriculturae Scandinavica, Section B \u0026mdash; Soil \u0026amp; Plant Science 68(4): 367\u0026ndash;378.\u0026nbsp;\u003ca href=\"https://doi.org/10.1080/09064710.2017.1410565\"\u003ehttps://doi.org/10.1080/09064710.2017.1410565\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eAltschul, S (1997) Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res 25(17); 3389\u0026ndash;3402.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/nar/25.17.3389\"\u003ehttps://doi.org/10.1093/nar/25.17.3389\u003c/a\u003e\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eAneja . K (2007) Experiments in microbiology, Plant Pathology. Biotehnol., New Age Internat. Publ.\u003c/li\u003e\n \u003cli\u003eArnow, L. E (1937) Colorimetric determination of the components of 3,4-Dihydroxyphenyl alaninetyrosine mixtures.\u0026nbsp;J. Biol. Chem\u0026nbsp;118(2): 531\u0026ndash;537.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/S0021-9258(18)74509-2\"\u003ehttps://doi.org/10.1016/S0021-9258(18)74509-2\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eAznar, A., Dellagi, A (2015) New insights into the role of siderophores as triggers of plant immunity: What can we learn from animals?\u0026nbsp;J. Exp. Bot\u0026nbsp;66(11): 3001\u0026ndash;3010.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/jxb/erv155\"\u003ehttps://doi.org/10.1093/jxb/erv155\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eB.A. Coulombe, R.L. Chaney, W.J. Wiebold (1984) Bicarbonate directly induces iron chlorosis in susceptible soybean cultivars. Soil Sci. Soc. Am. J. 48 (6): 1297-1301.\u0026nbsp;https://doi.org/10.2136/sssaj1984.03615995004800060019x\u003c/li\u003e\n \u003cli\u003eBadalyan, S. M., Garibyan, N. G., Innocenti, G (2002) Antagonistic activity of xylotrophic mushrooms against pathogenic fungi of cereals in dual culture.\u0026nbsp;Phytopathol. Mediterr\u0026nbsp;41: 1000\u0026ndash;1006.\u003c/li\u003e\n \u003cli\u003eBadalyan, S., Innocenti, G., Garibyan, N (2004) Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments.\u0026nbsp;Phytopathol. Mediterr 43(1): 44-48.\u0026nbsp;\u003ca href=\"https://doi.org/10.14601/Phytopathol_Mediterr-1733\"\u003ehttps://doi.org/10.14601/Phytopathol_Mediterr-1733\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBarhoumi,\u0026nbsp;S., Ellouzi,\u0026nbsp;H., Krouma,\u0026nbsp;A (2021) Functional analysis of the genotypic differences in response to calcareous-induced iron deficiency in pea plants (\u003cem\u003ePisum sativum\u003c/em\u003e L.). Research square. 1-23.\u0026nbsp;\u003ca href=\"https://doi.org/10.21203/rs.3.rs-783550/v1\"\u003ehttps://doi.org/10.21203/rs.3.rs-783550/v1\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBarker, A. V., Pilbeam, D. J (2015) \u003cem\u003eHandbook of plant nutrition\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e(2nd\u0026nbsp;ed.). CRC Press.\u003c/li\u003e\n \u003cli\u003eBin, L. M., Weng, L., Bugter, M. H (2016) Effectiveness of FeEDDHA, FeEDDHMA, and FeHBED in preventing iron-deficiency chlorosis in soybean. J. Agric. Food. Chem \u003cem\u003e64\u003c/em\u003e(44): 8273-8281.\u0026nbsp;\u003ca href=\"https://doi.org/10.1021/acs.jafc.6b01382\"\u003ehttps://doi.org/10.1021/acs.jafc.6b01382\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBlumer, C., Haas, D (2000) Mechanism, regulation, and ecological role of bacterial cyanide biosynthesis. Arch. Microbiol \u003cem\u003e173\u003c/em\u003e(3): 170-177.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s002039900127\"\u003ehttps://doi.org/10.1007/s002039900127\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBou-Abdallah,\u0026nbsp;F (2010) The iron redox and hydrolysis chemistry of the ferritins\u003cem\u003e.\u0026nbsp;\u003c/em\u003eBiochim. Biophys. Acta,\u003cem\u003e\u0026nbsp;(BBA) \u0026ndash; Gen.\u0026nbsp;\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eSubj\u003cem\u003e\u0026nbsp;\u003cem\u003e1800\u003c/em\u003e\u003c/em\u003e(8):\u003cem\u003e\u0026nbsp;\u003c/em\u003e719-731\u003cem\u003e.\u0026nbsp;\u003c/em\u003e\u003ca href=\"https://doi.org/10.1016/j.bbagen.2010.03.021\"\u003ehttps://doi.org/10.1016/j.bbagen.2010.03.021\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBoukhalfa, H., Crumbliss, A.L (2002) Chemical aspects of siderophore mediated iron transport. Biometals 15:\u0026nbsp;325\u0026ndash;339.\u0026nbsp;\u003ca href=\"https://doi.org/10.1023/A:1020218608266\"\u003ehttps://doi.org/10.1023/A:1020218608266\u003c/a\u003e.\u003c/li\u003e\n \u003cli\u003eBraud, A., J\u0026eacute;z\u0026eacute;quel, K., Bazot, S., Lebeau, T (2009) Enhanced phytoextraction of an agricultural Cr and Pb-contaminated soil by bio augmentation with siderophore producing bacteria. \u003cem\u003eChemosphere\u003c/em\u003e \u003cem\u003e74\u003c/em\u003e(2): 280-286.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.chemosphere.2008.09.013\"\u003ehttps://doi.org/10.1016/j.chemosphere.2008.09.013\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBriat, J., Dubos, C., \u0026nbsp; Gaymard, F (2015) Iron nutrition, biomass production, and plant product quality. Trends Plant Sci \u003cem\u003e20\u003c/em\u003e(1): 33-40.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.tplants.2014.07.005\"\u003ehttps://doi.org/10.1016/j.tplants.2014.07.005\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBroadley, M., Brown, P., Cakmak, I., Rengel, Z., Zhao, F (2012) Function of nutrients. \u003cem\u003eMarschner\u0026apos;s Mineral Nutrition of Higher Plants\u003c/em\u003e 191-248.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/b978-0-12-384905-2.00007-8\"\u003ehttps://doi.org/10.1016/b978-0-12-384905-2.00007-8\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eBudzikiewicz, H (1993) Secondary metabolites from fluorescent pseudomonads. \u003cem\u003eFEMS\u0026nbsp;\u003c/em\u003eMicrobiol. Lett \u003cem\u003e104\u003c/em\u003e(3-4): 209-228.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/j.1574-6968.1993.tb05868.x\"\u003ehttps://doi.org/10.1111/j.1574-6968.1993.tb05868.x\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eCalvente, V., De Orellano, M. E., Sansone, G., Benuzzi, D., \u0026nbsp;Sanz de Tosetti, M. I (2001) Effect of nitrogen source and pH on siderophore production by \u003cem\u003eRhodotorula strains\u003c/em\u003e and their application to biocontrol of phytopathogenic moulds. J. Ind. Microbiol. Biotechnol \u003cem\u003e26\u003c/em\u003e(4): 226-229.\u0026nbsp;\u003ca href=\"https://doi.org/10.1038/sj.jim.7000117\"\u003ehttps://doi.org/10.1038/sj.jim.7000117\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eCampanile, G., Ruscelli, A., Luisi, N (2007) Antagonistic activity of endophytic fungi towards \u003cem\u003eDiplodia corticola\u003c/em\u003e assessed by in vitro and in planta tests.\u0026nbsp;Eur. J. Plant Pathol\u0026nbsp;\u003cem\u003e117\u003c/em\u003e(3): 237-246.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s10658-006-9089-1\"\u003ehttps://doi.org/10.1007/s10658-006-9089-1\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eChallis, G. L (2005) A widely distributed bacterial pathway for Siderophore biosynthesis independent of Nonribosomal peptide Synthetases. \u003cem\u003eChemBioChem\u003c/em\u003e \u003cem\u003e6\u003c/em\u003e(4): 601-611.\u0026nbsp;\u003ca href=\"https://doi.org/10.1002/cbic.200400283\"\u003ehttps://doi.org/10.1002/cbic.200400283\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eChampomier-Verg\u0026egrave;s, M., Stintzi, A., Meyer, J (1996) Acquisition of iron by the non-siderophore-producing pseudomonas fragi. \u003cem\u003eMicrobio\u003c/em\u003e \u003cem\u003e142\u003c/em\u003e(5): 1191-1199.\u0026nbsp;\u003ca href=\"https://doi.org/10.1099/13500872-142-5-1191\"\u003ehttps://doi.org/10.1099/13500872-142-5-1191\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eChen, Y., Barak, P (1982) Iron nutrition of plants in calcareous soils. Adv. Agron 217-240.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/s0065-2113(08)60326-0\"\u003ehttps://doi.org/10.1016/s0065-2113(08)60326-0\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eChiarini L.,Tabacchioni S., Bevivino A (1993) \u0026quot;Interactions between rhizosphere microorganisms under iron limitation.\u0026quot; Arch. Microbiol \u0026nbsp; 160 (1):68-73.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/bf00258147\"\u003ehttps://doi.org/10.1007/bf00258147\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eChu, H., Fierer, N., Lauber, C. L., Caporaso, J. G., Knight, R., \u0026nbsp; Grogan, P (2010) Soil bacterial diversity in the Arctic is not fundamentally different from that found in other biomes. Environ. Microbiol \u003cem\u003e12\u003c/em\u003e(11): 2998-3006.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/j.1462-2920.2010.02277.x\"\u003ehttps://doi.org/10.1111/j.1462-2920.2010.02277.x\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eCosta, J. M (1994) Characterization of Siderophore production by the biological control agent \u003cem\u003eEnterobacter cloacae\u003c/em\u003e. Mol. Plant-Microbe Interact \u003cem\u003e7\u003c/em\u003e(4): 440.\u0026nbsp;\u003ca href=\"https://doi.org/10.1094/mpmi-7-0440\"\u003ehttps://doi.org/10.1094/mpmi-7-0440\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eCrosa, J. H., Mey, A. R., Payne, S. M. (Eds.) (2004) Iron transport in bacteria. ASM Press.\u0026nbsp;\u003ca href=\"https://doi.org/10.1128/9781555816544\"\u003ehttps://doi.org/10.1128/9781555816544\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eDave, B. P., Dube, H. C (2000) Chemical characterization of fungal siderophores. \u003cem\u003eIndian J. Exp. Biol.\u003c/em\u003e, \u003cem\u003e38\u003c/em\u003e(1), 56\u0026ndash;62.\u003c/li\u003e\n \u003cli\u003eDavid, B. V., Chandrasehar, G., Selvam, P. N (2018) \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e : A plant-growth-Promoting Rhizobacterium (PGPR) with potential role in biocontrol of pests of crops. \u003cem\u003eCrop improvement through microbe. Biotechnol\u003c/em\u003e 221-243.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/b978-0-444-63987-5.00010-4\"\u003ehttps://doi.org/10.1016/b978-0-444-63987-5.00010-4\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eDi Gregorio, A (2005) Land cover classification system: classification concepts and user manual: LCCS. Vol. 2: Food \u0026amp; Agriculture Org.\u003c/li\u003e\n \u003cli\u003eDimkpa, C., Merten, D., Svato\u0026scaron;, A., B\u0026uuml;chel, G., Kothe, E (2009) Siderophores mediate reduced and increased uptake of cadmium by \u003cem\u003eStreptomyces tendae F4\u003c/em\u003e and sunflower (\u003cem\u003eHelianthus annuus\u003c/em\u003e), respectively. J. Appl. Microbiol \u003cem\u003e107\u003c/em\u003e(5): 1687-1696.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/j.1365-2672.2009.04355.x\"\u003ehttps://doi.org/10.1111/j.1365-2672.2009.04355.x\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eDobay, O., Laub, K., Stercz, B., K\u0026eacute;ri, A., Bal\u0026aacute;zs, B., T\u0026oacute;thp\u0026aacute;l, A., Kardos, S., Jaikumpun, P., Ruksakiet, K., Quinton, P. M., \u0026nbsp;Zsembery, \u0026Aacute; (2018) Bicarbonate Inhibits Bacterial Growth and Biofilm Formation of Prevalent Cystic Fibrosis Pathogens. Front. Microbiol 9, 2245.\u0026nbsp;\u003ca href=\"https://doi.org/10.3389/fmicb.2018.02245\"\u003ehttps://doi.org/10.3389/fmicb.2018.02245\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eEl-Shabrawy, E., \u0026nbsp; Shehata, H (2018) Controlling maize late-wilt and enhancing plant salinity tolerance by some Rhizobacterial strains. \u003cem\u003eEgyptian\u0026nbsp;\u003c/em\u003eJ. Phytopathol \u003cem\u003e46\u003c/em\u003e(1): 235-255.\u0026nbsp;\u003ca href=\"https://doi.org/10.21608/ejp.2018.87796\"\u003ehttps://doi.org/10.21608/ejp.2018.87796\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eFazary, A. E., Al-Shihri, A. S., Saleh, K. A., Alfaifi, M. Y., Alshehri, M. A., Elbehairi, S. E (2016) Di- and tri-valent metal ions interactions with four biodegradable Hydroxamate and Cataecholate Siderophores: New insights into their Complexation equilibria. J. Solution Chem \u003cem\u003e45\u003c/em\u003e(5): 732-749.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s10953-016-0475-9\"\u003ehttps://doi.org/10.1007/s10953-016-0475-9\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eFerreira, C. M., Vilas-Boas, \u0026Acirc;., Sousa, C. A., Soares, H. M., \u0026nbsp; Soares, E. V (2019) Comparison of five bacterial strains producing siderophores with ability to chelate iron under alkaline conditions. \u003cem\u003eAMB Express\u003c/em\u003e\u003cem\u003e, \u003cem\u003e9\u003c/em\u003e\u003c/em\u003e(1).\u0026nbsp;\u003ca href=\"https://doi.org/10.1186/s13568-019-0796-3\"\u003ehttps://doi.org/10.1186/s13568-019-0796-3\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eGaonkar, T., Bhosle, S (2013) Effect of metals on a siderophore producing bacterial isolate and its implications on microbial assisted bioremediation of metal contaminated soils. \u003cem\u003eChemosphere\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003cem\u003e93\u003c/em\u003e\u003c/em\u003e(9): 1835-1843.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.chemosphere.2013.06.036\"\u003ehttps://doi.org/10.1016/j.chemosphere.2013.06.036\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eGarc\u0026iacute;a-Marco, S., Mart\u0026iacute;nez, N., Yunta, F., Hern\u0026aacute;ndez-Apaolaza, L., Lucena, J. J (2006) Effectiveness of ethylenediamine \u0026ndash; n (o-hydroxyphenylacetic) \u0026ndash; N\u0026prime; (p-hydroxyphenylacetic) acid (o,p-EDDHA) to supply iron to plants. \u003cem\u003ePlant Soil\u003c/em\u003e\u003cem\u003e, \u003cem\u003e279\u003c/em\u003e\u003c/em\u003e(1-2): 31-40.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s11104-005-8218-5\"\u003ehttps://doi.org/10.1007/s11104-005-8218-5\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eG\u0026eacute;rard, F (2016) Clay minerals, iron/aluminum oxides, and their contribution to phosphate sorption in soils - A myth revisited. \u003cem\u003eGeoderma\u003c/em\u003e \u003cem\u003e262\u003c/em\u003e: 213-226.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.geoderma.2015.08.036\"\u003ehttps://doi.org/10.1016/j.geoderma.2015.08.036\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eGhazy, N., El-Nahrawy, S (2020) Siderophore production by \u003cem\u003eBacillus subtilis\u003c/em\u003e MF497446 and \u003cem\u003ePseudomonas koreensis\u003c/em\u003e MG209738 and their efficacy in controlling \u003cem\u003eCephalosporium maydis\u003c/em\u003e in maize plant. Arch. Microbiol \u003cem\u003e203\u003c/em\u003e(3): 1195-1209.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s00203-020-02113-5\"\u003ehttps://doi.org/10.1007/s00203-020-02113-5\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eGrimm, P. W., Allen, P. J (1954) Promotion by zinc of the formation of cytochromes in \u003cem\u003eustilago sphaerogena\u003c/em\u003e. Plant Physiol \u003cem\u003e29\u003c/em\u003e(4): 369-377.\u0026nbsp;\u003ca href=\"https://doi.org/10.1104/pp.29.4.369\"\u003ehttps://doi.org/10.1104/pp.29.4.369\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eGrobelak, A., Hiller, J (2017) Bacterial siderophores promote plant growth: Screening of catechol and hydroxamate siderophores. Int. J. Phytorem \u003cem\u003e19\u003c/em\u003e(9): 825-833.\u0026nbsp;\u003ca href=\"https://doi.org/10.1080/15226514.2017.1290581\"\u003ehttps://doi.org/10.1080/15226514.2017.1290581\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eHaas, D., \u0026nbsp;D\u0026eacute;fago, G (2005) Biological control of soil-borne pathogens by fluorescent pseudomonads.\u0026nbsp;Nat. Rev. Microbiol\u0026nbsp;\u003cem\u003e3\u003c/em\u003e(4): 307-319.\u0026nbsp;\u003ca href=\"https://doi.org/10.1038/nrmicro1129\"\u003ehttps://doi.org/10.1038/nrmicro1129\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eHider, R. C., Kong, X. (2010). Chemistry and biology of siderophores. Nat. Prod. Rep., \u003cem\u003e27\u003c/em\u003e(5), 637.\u0026nbsp;\u003ca href=\"https://doi.org/10.1039/b906679a\"\u003ehttps://doi.org/10.1039/b906679a\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eKabir, A. H., Paltridge, N., \u0026nbsp;Stangoulis, J (2016) Chlorosis correction and agronomic biofortification in field peas through foliar application of iron fertilizers under FE deficiency. J. Plant Interact \u003cem\u003e11\u003c/em\u003e(1): 1-4.\u0026nbsp;\u003ca href=\"https://doi.org/10.1080/17429145.2015.1125534\"\u003ehttps://doi.org/10.1080/17429145.2015.1125534\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eKamalakannan, A., Mohan, L., Harish, S., Radjacommare, R., Amutha, G., Chitra, K., Karuppiah, R., Mareeswari, P., Rajinimala, N., \u0026nbsp; Angayarkanni, T (2004) Biocontrol agents induce disease resistance in \u003cem\u003ePhyllanthus niruri\u003c/em\u003e Linn against damping-off disease caused by \u003cem\u003eRhizoctonia solani\u003c/em\u003e.\u0026nbsp;Phytopathol. Mediterr\u0026nbsp;43(2): 187\u0026ndash;194.\u0026nbsp;\u003ca href=\"http://www.jstor.org/stable/26456702\"\u003ehttp://www.jstor.org/stable/26456702\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eKavitha, A., Prabhakar, P., Vijayalakshmi, M., Venkateswarlu, Y (2009) Production of bioactive metabolites by \u003cem\u003eNocardia levismk\u003c/em\u003e-vl_113.\u0026nbsp;Lett. Appl. Microbiol\u0026nbsp;49(4): 484-490.\u0026nbsp;\u003ca href=\"https://doi.org/10.1111/j.1472-765x.2009.02697.x\"\u003ehttps://doi.org/10.1111/j.1472-765x.2009.02697.x\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eKumar, V., S. Menon, H. Agarwal, D. Gopalakrishnan (2017) \u0026quot;Characterization and optimization of bacterium isolated from soil samples for the production of siderophores.\u0026quot; \u0026nbsp;Resour.-Effic. Technol. 3 (4):434-439. doi:\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.reffit.2017.04.004\"\u003ehttps://doi.org/10.1016/j.reffit.2017.04.004\u003c/a\u003e.\u003c/li\u003e\n \u003cli\u003eLemanceau, P., Alabouvette, C (1993)\u0026nbsp;Suppression of Fusarium wilts by \u003cem\u003efluorescent pseudomonads\u003c/em\u003e: mechanisms and applications.\u0026nbsp;Biocontrol Sci. Technol 3(3): 219-234. \u0026nbsp;\u003ca href=\"https://doi.org/10.1080/09583159309355278\"\u003ehttps://doi.org/10.1080/09583159309355278\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eLis, H., Shaked, Y., Kranzler, C., Keren, N., Morel, F. M (2014) Iron bioavailability to phytoplankton: An empirical approach. The ISME Journal 9(4): 1003-1013.\u0026nbsp;\u003ca href=\"https://doi.org/10.1038/ismej.2014.199\"\u003ehttps://doi.org/10.1038/ismej.2014.199\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eLouden, B. C., Haarmann, D., Lynne, A. M (2011) Use of blue agar CAS assay for Siderophore detection. J. Microbiol. Biol. Educ 12(1): 51-53.\u0026nbsp;\u003ca href=\"https://doi.org/10.1128/jmbe.v12i1.249\"\u003ehttps://doi.org/10.1128/jmbe.v12i1.249\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eLucena, J. J (2000) Effects of bicarbonate, nitrate and other environmental factors on iron deficiency chlorosis. A review.\u0026nbsp;J. Plant Nutr\u0026nbsp;23(11-12): 1591-1606.\u0026nbsp;\u003ca href=\"https://doi.org/10.1080/01904160009382126\"\u003ehttps://doi.org/10.1080/01904160009382126\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eMaindad, D. V., Kasture, V. M., Chaudhari, H., Dhavale, D. D., Chopade, B. A., Sachdev, D. P. (2014) Characterization and fungal inhibition activity of siderophore from wheat rhizosphere associated \u003cem\u003eAcinetobacter calcoaceticus\u003c/em\u003e strain HIRFA32. Indian J.Microbiol 54(3): 315-322.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s12088-014-0446-z\"\u003ehttps://doi.org/10.1007/s12088-014-0446-z\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eManthey, J., D.E. Crowley, and D.G. Luster (eds) (1994) Biochemistry of metal micronutrients in the rhizosphere. CRC Press, Boca Raton, pp 295\u0026ndash;307\u003c/li\u003e\n \u003cli\u003eMartins, F., Machado, S., Albergaria, T., \u0026nbsp; Delerue-Matos, C (2017) LCA applied to nano scale zero valent iron synthesis. Int. J. Life Cycle\u0026nbsp;Assess\u0026nbsp;22(5): 707-714.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s11367-016-1258-7\"\u003ehttps://doi.org/10.1007/s11367-016-1258-7\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eMessenger, A. J., \u0026nbsp;Barclay, R (1983) Bacteria, iron and pathogenicity.\u0026nbsp;Biochem. Educ\u0026nbsp;11(2): 54-63.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/0307-4412(83)90043-2\"\u003ehttps://doi.org/10.1016/0307-4412(83)90043-2\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eMiao Sheng, M., Jia, H. K., Zhang, G. Y., Zeng, L. N., Zhang, T. T., Long, Y. H., Lan, J., Hu, Z. Q., Zeng, Z., Wang, B., Liu, H. M (2020) Siderophore production by rhizosphere biological control bacteria \u003cem\u003eBrevibacillus brevis\u003c/em\u003e GZDF3 of \u003cem\u003ePinellia ternata\u003c/em\u003e and its antifungal effects on \u003cem\u003eCandida albicans\u003c/em\u003e.\u0026nbsp;J. Microbiol. Biotechnol\u0026nbsp;30(5): 689-699.\u0026nbsp;\u003ca href=\"https://doi.org/10.4014/jmb.1910.10066\"\u003ehttps://doi.org/10.4014/jmb.1910.10066\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eNeilands, J (1995) Siderophores: Structure and function of microbial iron transport compounds.\u0026nbsp;J. Biol. Chem\u0026nbsp;270(45): 26723-26726.\u0026nbsp;\u003ca href=\"https://doi.org/10.1074/jbc.270.45.26723\"\u003ehttps://doi.org/10.1074/jbc.270.45.26723\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eNeilands, J. B. (1981). undefined. Annu. Rev. Nutr 1(1): 27-46.\u0026nbsp;\u003ca href=\"https://doi.org/10.1146/annurev.nu.01.070181.000331\"\u003ehttps://doi.org/10.1146/annurev.nu.01.070181.000331\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eNithyapriya, S., Lalitha, S., Sayyed, R. Z., Reddy, M. S., Dailin, D. J., El Enshasy, H. A., Luh Suriani, N., \u0026nbsp;Herlambang, S (2021) Production, purification, and characterization of \u003cem\u003eBacillibactin\u0026nbsp;\u003c/em\u003eSiderophore of \u003cem\u003ebacillus subtilis\u003c/em\u003e and its application for improvement in plant growth and oil content in sesame. \u003cem\u003eSustainability\u003c/em\u003e, 13(10): 5394.\u0026nbsp;\u003ca href=\"https://doi.org/10.3390/su13105394\"\u003ehttps://doi.org/10.3390/su13105394\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003ePanchami, P. S., Geetha Thanuja, K., \u0026nbsp; Karthikeyan, S (2020) Isolation and characterization of Indigenous plant growth-promoting Rhizobacteria (PGPR) from cardamom rhizosphere.\u0026nbsp;Curr. Microbiol\u0026nbsp;77(10): 2963-2981.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s00284-020-02116-x\"\u003ehttps://doi.org/10.1007/s00284-020-02116-x\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003ePeralta-Yahya, P. P., Zhang, F., del Cardayre, S. B., Keasling, J. D (2012) Microbial engineering for the production of advanced biofuels. Nature, 488(7411): 320\u0026ndash;328.\u0026nbsp;\u003ca href=\"https://doi.org/10.1038/nature11478\"\u003ehttps://doi.org/10.1038/nature11478\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003ePieterse, C. M. J., Van Pelt, J. A., Ton, J., Parchmann, S., Mueller, M. J., Buchala, A. J., M\u0026eacute;traux, J.P., Van Loon, L. C (2000) Rhizobacteria-mediated induced systemic resistance (Isr) in Arabidopsis requires sensitivity to jasmonate and ethylene but is not accompanied by an increase in their production. Physiol. Mol. Plant Pathol\u0026nbsp;57(3): 123\u0026ndash;134.\u0026nbsp;\u003ca href=\"https://doi.org/10.1006/pmpp.2000.0291\"\u003ehttps://doi.org/10.1006/pmpp.2000.0291\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003ePrathap. M. (2015). A critical review on plant growth promoting Rhizobacteria. \u003cem\u003eJ.\u0026nbsp;\u003c/em\u003ePlant Pathol.\u003cem\u003e\u0026nbsp;\u0026amp;\u0026nbsp;\u003c/em\u003eMicrobiol\u0026nbsp;\u003cem\u003e06\u003c/em\u003e(04).\u0026nbsp;\u003ca href=\"https://doi.org/10.4172/2157-7471.1000266\"\u003ehttps://doi.org/10.4172/2157-7471.1000266\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eR.C. Pearce, Y.M. Li, L.P. Bush (1999) Calcium and bicarbonate effects on the growth and nutrient uptake of burley tobacco seedlings: hydroponic culture, J. Plant Nutr 22 (7): 1069-1078.\u0026nbsp;https://doi.org/10.1080/01904169909365696\u003c/li\u003e\n \u003cli\u003eRangani, J., Panda, A., Patel, M., Parida, A. K (2018) Regulation of ROS through proficient modulations of antioxidative defense system maintains the structural and functional integrity of photosynthetic apparatus and confers drought tolerance in the facultative halophyte \u003cem\u003eSalvadora persica\u003c/em\u003e L.\u0026nbsp;J. Photochem. Photobiol B\u0026nbsp;189: 214-233.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.jphotobiol.2018.10.021\"\u003ehttps://doi.org/10.1016/j.jphotobiol.2018.10.021\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eRungin,\u0026nbsp;S., Indananda,\u0026nbsp;C., Suttiviriya,\u0026nbsp;P., Kruasuwan,\u0026nbsp;W., Jaemsaeng,\u0026nbsp;R., Thamchaipenet,\u0026nbsp;A (2012) Plant growth enhancing effects by a siderophore-producing endophytic streptomycete isolated from a Thai Jasmine rice plant (\u003cem\u003eOryza sativa\u003c/em\u003e L. CV. KDML105). Antonie van Leeuwenhoek, 102(3), 463-472.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s10482-012-9778-z\"\u003ehttps://doi.org/10.1007/s10482-012-9778-z\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSaha, M., Sarkar, S., Sarkar, B., Sharma, B. K., Bhattacharjee, S., Tribedi, P (2015) Microbial siderophores and their potential applications: A review.\u0026nbsp;Environ. Sci. Pollut.\u0026nbsp;Res\u0026nbsp;23(5): 3984-3999.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s11356-015-4294-0\"\u003ehttps://doi.org/10.1007/s11356-015-4294-0\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSambrook, J., Fritsch, E. F., Maniatis, T (1989) Molecular cloning: A laboratory manual.\u003c/li\u003e\n \u003cli\u003eSandy, M., Butler, A (2009) Microbial iron acquisition: Marine and terrestrial siderophores.\u0026nbsp;Chem. Rev., 109(10), 4580\u0026ndash;4595.\u0026nbsp;\u003ca href=\"https://doi.org/10.1021/cr9002787\"\u003ehttps://doi.org/10.1021/cr9002787\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSantoyo, G., Moreno-Hagelsieb, G., del Carmen Orozco-Mosqueda, Ma., Glick, B. R (2016) Plant growth-promoting bacterial endophytes. Microbiol. Res 183: 92\u0026ndash;99.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.micres.2015.11.008\"\u003ehttps://doi.org/10.1016/j.micres.2015.11.008\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSasirekha, B., Srividya, S (2016) Siderophore production by Pseudomonas aeruginosa FP6, a biocontrol strain for \u003cem\u003eRhizoctonia solani\u003c/em\u003e and \u003cem\u003eColletotrichum gloeosporioides\u003c/em\u003e causing diseases in chilli. Agric. Nat. Resour 50(4): 250\u0026ndash;256.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.anres.2016.02.003\"\u003ehttps://doi.org/10.1016/j.anres.2016.02.003\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSayyed, R., Chincholkar, S (2006) Purification of siderophores of \u003cem\u003eAlcaligenes faecalis\u003c/em\u003e on amberlite xad.\u0026nbsp;Bioresour. Technol\u0026nbsp;97(8): 1026\u0026ndash;1029.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.biortech.2005.04.045\"\u003ehttps://doi.org/10.1016/j.biortech.2005.04.045\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSchwyn, B., Neilands, J. B (1987) Universal chemical assay for the detection and determination of siderophores.\u0026nbsp;Anal. Biochem\u0026nbsp;160(1): 47\u0026ndash;56.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/0003-2697(87)90612-9\"\u003ehttps://doi.org/10.1016/0003-2697(87)90612-9\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eShaikh, S.S., Wani, S.J. Sayyed, R.Z (2016) Statistical-based optimization and scale-up of siderophore production process on laboratory bioreactor. 3\u003cem\u003e\u0026nbsp;\u003c/em\u003eBiotech\u003cem\u003e\u0026nbsp;\u003c/em\u003e6:\u0026nbsp;69. https://doi.org/10.1007/s13205-016-0365-2\u003c/li\u003e\n \u003cli\u003eSingh, A., Mishra, A. K (2015) Influence of various levels of iron and other abiotic factors on siderophorogenesis in paddy field cyanobacterium \u003cem\u003eAnabaena oryzae\u003c/em\u003e. Appl. Biochem. Biotechnol 176(2): 372\u0026ndash;386.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s12010-015-1581-7\"\u003ehttps://doi.org/10.1007/s12010-015-1581-7\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSingh, B. K., Dawson, L. A., Macdonald, C. A., Buckland, S. M (2009) Impact of biotic and abiotic interaction on soil microbial communities and functions: A field study. Appl. Soil Ecol 41(3): 239\u0026ndash;248.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.apsoil.2008.10.003\"\u003ehttps://doi.org/10.1016/j.apsoil.2008.10.003\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSinha, A. K., Parli, B. V (2020) Siderophore production by bacteria isolated from mangrove sediments: A microcosm study.\u0026nbsp;J. Exp. Mar. Biol. Ecol\u0026nbsp;524: 151290.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.jembe.2019.151290\"\u003ehttps://doi.org/10.1016/j.jembe.2019.151290\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSivasakthi, S., D. Kanchana, G. Usharani, P.Saranraj (2013) \u0026quot;Production of plant growth promoting substance by \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e and \u003cem\u003eBacillus subtilis\u003c/em\u003e isolates from paddy rhizosphere soil of Cuddalore District, Tamil Nadu, India.\u0026quot; \u0026nbsp;Int. J. Microbiol. Res\u0026nbsp;4 (3):227-233\u0026nbsp;\u003ca href=\"https://doi.org/10.5829/idosi.ijmr.2013.4.3.75171\"\u003ehttps://doi.org/10.5829/idosi.ijmr.2013.4.3.75171\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSnow, G. A. (1970). Mycobactins: Iron-chelating growth factors from mycobacteria.\u0026nbsp;Bacteriol.\u0026nbsp;Reviews\u0026nbsp;34(2): 99\u0026ndash;125.\u0026nbsp;\u003ca href=\"https://doi.org/10.1128/br.34.2.99-125.1970\"\u003ehttps://doi.org/10.1128/br.34.2.99-125.1970\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSolanki, M. K., Singh, R. K., Srivastava, S., Kumar, S., Kashyap, P. L., Srivastava, A. K., Arora, D. K (2014) Isolation and characterization of siderophore producing antagonistic rhizobacteria against \u003cem\u003eRhizoctonia solani\u003c/em\u003e: Biocontrol of \u003cem\u003eRhizoctonia solani\u003c/em\u003e.\u0026nbsp;J. Basic Microbiol\u0026nbsp;54(6): 585\u0026ndash;597.\u0026nbsp;\u003ca href=\"https://doi.org/10.1002/jobm.201200564\"\u003ehttps://doi.org/10.1002/jobm.201200564\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSridevi, M., Mallaiah, K. V (2007) Production of hydroxamate-type of siderophores by rhizobium strains from \u003cem\u003esesbania sesban\u003c/em\u003e (L.) merr.\u0026nbsp;Int. J. Soil Sci\u0026nbsp;3(1): 28\u0026ndash;34.\u0026nbsp;\u003ca href=\"https://doi.org/10.3923/ijss.2008.28.34\"\u003ehttps://doi.org/10.3923/ijss.2008.28.34\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eStorey, J. D., Xiao, W., Leek, J. T., Tompkins, R. G., Davis, R. W (2005) Significance analysis of time course microarray experiments. Proceedings of the National Academy of Sciences, 102(36): 12837-12842.\u0026nbsp;\u003ca href=\"https://doi.org/10.1073/pnas.0504609102\"\u003ehttps://doi.org/10.1073/pnas.0504609102\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eSulochana, M. B., Jayachandra, S. Y., Kumar, S. K., Dayanand, A (2013) Antifungal attributes of siderophore produced by the \u003cem\u003ePseudomonas aeruginosajas\u003c/em\u003e-25.\u0026nbsp;J. Basic Microbiol\u0026nbsp;54(5): 418-424.\u0026nbsp;\u003ca href=\"https://doi.org/10.1002/jobm.201200770\"\u003ehttps://doi.org/10.1002/jobm.201200770\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eTailor, A.J.; Joshi, B (2012) Characterization and optimization of siderophore production from \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e strain isolated from sugarcane rhizosphere. J. Environ. Res. Dev 6: 688\u0026ndash;694.\u003c/li\u003e\n \u003cli\u003eTank, N., Rajendran, N., Patel, B., Saraf, M (2012) Evaluation and biochemical characterization of a distinctive pyoverdin from a pseudomonas isolated from chickpea rhizosphere.\u0026nbsp;Braz. J. Microbiol\u0026nbsp;43(2): 639-648.\u0026nbsp;\u003ca href=\"https://doi.org/10.1590/s1517-83822012000200028\"\u003ehttps://doi.org/10.1590/s1517-83822012000200028\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eTian, F., Ding, Y., Zhu, H., Yao, L., Du, B (2009) Genetic diversity of siderophore-producing bacteria of tobacco rhizosphere.\u0026nbsp;Braz. J. Microbiol\u0026nbsp;40(2): 276-284.\u0026nbsp;\u003ca href=\"https://doi.org/10.1590/s1517-83822009000200013\"\u003ehttps://doi.org/10.1590/s1517-83822009000200013\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eTripathi, D. K., Singh, S., Singh, S., Mishra, S., Chauhan, D. K., Dubey, N. K (2015) Micronutrients and their diverse role in agricultural crops: Advances and future prospective. Acta Physiologiae Plantarum 37(7).\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s11738-015-1870-3\"\u003ehttps://doi.org/10.1007/s11738-015-1870-3\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eVellore JM (2001)\u003cem\u003e\u0026nbsp;\u003c/em\u003eIron acquisition in \u003cem\u003eRhodococcus erythrolpolis\u003c/em\u003e:the isolation of mutant(s) that do not produce a siderophore. [Dissertation]. East Tennessee State University, Johnson City, USA\u0026nbsp;[Unpublished doctoral dissertation]. (n.d.).\u003c/li\u003e\n \u003cli\u003eVisca, P., Imperi, F., Lamont, I. L (2007) Pyoverdine siderophores: From biogenesis to biosignificance.\u0026nbsp;Trends Microbiol\u0026nbsp;15(1): 22-30.\u0026nbsp;\u003ca href=\"https://doi.org/10.1016/j.tim.2006.11.004\"\u003ehttps://doi.org/10.1016/j.tim.2006.11.004\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eVogel, S (1992) Twist-to-Bend ratios and cross-sectional shapes of petioles and stems.\u0026nbsp;J. Exp. Bot\u0026nbsp;43(11): 1527-1532.\u0026nbsp;\u003ca href=\"https://doi.org/10.1093/jxb/43.11.1527\"\u003ehttps://doi.org/10.1093/jxb/43.11.1527\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eWeller, S. C (2007) Cultural consensus theory: Applications and frequently asked questions. Field Methods 19(4)\u0026rdquo; 339-368.\u0026nbsp;\u003ca href=\"https://doi.org/10.1177/1525822x07303502\"\u003ehttps://doi.org/10.1177/1525822x07303502\u003c/a\u003e\u003c/li\u003e\n \u003cli\u003eZuo, Y., Zhang, F (2011) Soil and crop management strategies to prevent iron deficiency in crops. Plant Soil 339:\u0026nbsp;83\u0026ndash;95.\u0026nbsp;\u003ca href=\"https://doi.org/10.1007/s11104-010-0566-0\"\u003ehttps://doi.org/10.1007/s11104-010-0566-0\u003c/a\u003e\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003e\u0026nbsp;Bacterial population and siderophore production (%) on different calcareousness levels\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIsolates code\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" width=\"41.83673469387755%\"\u003e\n \u003cp\u003e\u003cstrong\u003eBacterial population \u0026nbsp;(log\u003csub\u003e10\u003c/sub\u003ecfu )\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" width=\"39.795918367346935%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSiderophore production (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.987012987012987%\"\u003e\n \u003cp\u003e10mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.987012987012987%\"\u003e\n \u003cp\u003e15mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.987012987012987%\"\u003e\n \u003cp\u003e20mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.987012987012987%\"\u003e\n \u003cp\u003e25mM KHCO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.688311688311689%\"\u003e\n \u003cp\u003e10mM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.688311688311689%\"\u003e\n \u003cp\u003e15mM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.688311688311689%\"\u003e\n \u003cp\u003e20mM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.987012987012987%\"\u003e\n \u003cp\u003e25mM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.94736842105263%\"\u003e\n \u003cp\u003e\u003cem\u003eB licheniformis\u0026nbsp;\u003c/em\u003e(MW279241)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e5.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e7.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e62.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e69.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e70.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e70.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.94736842105263%\"\u003e\n \u003cp\u003e\u003cem\u003eB subtilis\u0026nbsp;\u003c/em\u003e(MW279240)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e79.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e76.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e74.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e74.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.94736842105263%\"\u003e\n \u003cp\u003e\u003cem\u003eB licheniformis\u0026nbsp;\u003c/em\u003e(MW279255)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e59.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e61.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e63.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e65.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.94736842105263%\"\u003e\n \u003cp\u003e\u003cem\u003eO grignonense\u0026nbsp;\u003c/em\u003e(MW279256)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e6.61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e70.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e69.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.473684210526315%\"\u003e\n \u003cp\u003e72.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.526315789473685%\"\u003e\n \u003cp\u003e72.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eCharacterization of siderophore producing bacterial isolates\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMorphological parameters\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.64798598949212%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eBacillus \u0026nbsp;licheniformis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eBacillus subtilis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eBacillus licheniformis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e\u003cem\u003e\u003cstrong\u003eOchrobactrum grignonense\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"30.64798598949212%\"\u003e\n \u003cp\u003eGram reactivity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eShape\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003eRod\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003eRod\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003eRod\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003eRod\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eColony color\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003ewhite\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003ewhite\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003ewhite\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003eWhite\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eElevation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003eRaised\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003eRaised\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003eRaised\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003eRaised\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eOpacity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003eTranslucent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003eTranslucent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003eTranslucent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003eTranslucent\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eBiochemical characteristics test\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eCitrate utilization test\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"30.64798598949212%\"\u003e\n \u003cp\u003eCatalase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eMR (methylene red)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eVP (Voges-Proskauer)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.64798598949212%\"\u003e\n \u003cp\u003eIndole acetic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.81260945709282%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.86339754816112%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cem\u003eNote:\u0026nbsp;\u003c/em\u003ePositive and Negative show the results of biochemical results.\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 3\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eChemotyping of the siderophore-type produced by the bacteria\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.81720430107527%\"\u003e\n \u003cp\u003e\u003cstrong\u003eBacteria\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.483870967741936%\"\u003e\n \u003cp\u003e\u003cstrong\u003eArnow\u003csup\u003ea\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.419354838709676%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSnow\u003csup\u003eb\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.27956989247312%\"\u003e\n \u003cp\u003e\u003cstrong\u003eVogel\u003c/strong\u003e\u003cstrong\u003e\u003csup\u003ec\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.81720430107527%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus \u0026nbsp;licheniformis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.483870967741936%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.419354838709676%\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.27956989247312%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.81720430107527%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus subtilis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.483870967741936%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.419354838709676%\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.27956989247312%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.81720430107527%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus licheniformis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.483870967741936%\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.419354838709676%\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.27956989247312%\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.81720430107527%\"\u003e\n \u003cp\u003e\u003cem\u003eOchrobactrum grignonense\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.483870967741936%\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.419354838709676%\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.27956989247312%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003csup\u003ea\u003c/sup\u003eCatechol, \u003csup\u003eb\u003c/sup\u003ehydroxamate, and \u003csup\u003ec\u003c/sup\u003ecarboxylate type siderophores were identified using Arnow\u0026apos;s, Snow\u0026apos;s, and Vogel\u0026apos;s tests, respectively. ++ Strong positive result; + positive result; - negative result\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 4\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eEffect of antagonistic isolates on the growth of MP and SR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"45.30938123752495%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntagonistic isolate\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"54.69061876247505%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMycelial growth of pathogens \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; (% reduction over control)*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"47.44525547445255%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.55474452554745%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"45.30938123752495%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus \u0026nbsp;licheniformis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"25.94810379241517%\"\u003e\n \u003cp\u003e57.5\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"28.74251497005988%\"\u003e\n \u003cp\u003e52.6\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"45.30938123752495%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus subtilis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"25.94810379241517%\"\u003e\n \u003cp\u003e48.2\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"28.74251497005988%\"\u003e\n \u003cp\u003e51.0\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"45.30938123752495%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus licheniformis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"25.94810379241517%\"\u003e\n \u003cp\u003e54.1\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"28.74251497005988%\"\u003e\n \u003cp\u003e76.3\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"45.30938123752495%\"\u003e\n \u003cp\u003e\u003cem\u003eOchrobactrum grignonense\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"25.94810379241517%\"\u003e\n \u003cp\u003e37.3\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"28.74251497005988%\"\u003e\n \u003cp\u003e48.3\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"45.30938123752495%\"\u003e\n \u003cp\u003e\u003cem\u003eT.Viride\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.94810379241517%\"\u003e\n \u003cp\u003e69.3\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.74251497005988%\"\u003e\n \u003cp\u003e65.1\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"45.30938123752495%\"\u003e\n \u003cp\u003eControl**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.94810379241517%\"\u003e\n \u003cp\u003e0.0\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.74251497005988%\"\u003e\n \u003cp\u003e0.0\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;* Mean of three replicates\u003c/p\u003e\n\u003cp\u003e**Growth of \u003cem\u003eMacrophomina phaseolina\u0026nbsp;\u003c/em\u003e\u003cem\u003e(MP) and Sclerotium rolfsi\u003c/em\u003e (SR) in the absence of antagonistic fungal isolates\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 5\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eAntagonism Index (AI) and type/subtype of interaction between antagonistic isolates and SR, MF scored on Badalyan\u0026rsquo;s scale\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"50.2212389380531%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntagonistic isolate\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"22.345132743362832%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAI*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"27.43362831858407%\"\u003e\n \u003cp\u003e\u003cstrong\u003eType/Subtype*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.88888888888889%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.11111111111111%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"50.2212389380531%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus \u0026nbsp;licheniformis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"11.946902654867257%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"10.398230088495575%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.938053097345133%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.495575221238939%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"50.2212389380531%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus subtilis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"11.946902654867257%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"10.398230088495575%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.938053097345133%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.495575221238939%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"50.2212389380531%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus licheniformis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"11.946902654867257%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"10.398230088495575%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.938053097345133%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.495575221238939%\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"50.2212389380531%\"\u003e\n \u003cp\u003e\u003cem\u003eOchrobactrum grignonense\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"11.946902654867257%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"10.398230088495575%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.938053097345133%\"\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.495575221238939%\"\u003e\n \u003cp\u003eCA1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"50.2212389380531%\"\u003e\n \u003cp\u003e\u003cem\u003eT.Viride\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.946902654867257%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.398230088495575%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.938053097345133%\"\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.495575221238939%\"\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e* Mean of three replicates\u003c/p\u003e\n\u003cp\u003eA = deadlock with mycelial contact; B = deadlock at a distance; CA1 = partial replacement after initial deadlock with mycelial contact\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"archives-of-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aomi","sideBox":"Learn more about [Archives of Microbiology](https://www.springer.com/journal/203)","snPcode":"203","submissionUrl":"https://submission.nature.com/new-submission/203/3","title":"Archives of Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Arachis hypogea, calcareous soils, iron, phytopathogenic and siderophores","lastPublishedDoi":"10.21203/rs.3.rs-1365991/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1365991/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe most effective agricultural practice to prevent iron deficiency in calcareous soils is fertilizing with synthetic chelates. These compounds are non-biodegradable, and persistent in the environment and hence there is a risk of leaching metals into the soil horizon. To tackle iron deficiency-induced chlorosis (IDC) in crops grown under calcareous soils, an environmentally friendly effective solutions are needed rather than chemical application as it affects the soil health further. Hence the present work aimed at isolating and screening calcareous soil-specific bacteria capable of producing the iron-chelating siderophores. Siderophore producing bacteria (SPB) was isolated from the rhizosphere of calcareous soil-grown groundnut (\u003cem\u003eArachis hypogea\u003c/em\u003e L.), of which seventeen bacterial isolates were positive for siderophore production assayed by Chrome Azurol Sulphonate. The performance of SPB isolates was compared for siderophore kinetics, level of siderophore production, type of siderophore produced (using Arnow and Csaky's tests), and iron-chelating capacity under 15mM KHCO\u003csub\u003e3\u003c/sub\u003e. Four best performing bacterial isolates were screened, with average siderophores yield ranging \u0026sim;60\u0026ndash;80% under pH 8, with sucrose as a carbon source and NH\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e as a nitrogen source at 37\u0026deg;C. The four efficient SPB were molecularly identified as \u003cem\u003eBacillus licheniformis\u003c/em\u003e, \u003cem\u003eBacillus subtilis\u003c/em\u003e, and \u003cem\u003eOchrobactrum grignonense\u003c/em\u003e based on 16S rDNA sequencing. The strains also showed a strong antagonistic effect against the phytopathogenic fungal strains \u003cem\u003eviz., Sclerotium rolfsi\u003c/em\u003e and \u003cem\u003eMacrophomina phaseolina in vitro.\u003c/em\u003e Our results indicate that the optimized conditions enhanced siderophores chelation and by suppressing the stem and root rot fungi which could help in cost effective and environmentally friendly manner.\u003c/p\u003e","manuscriptTitle":"Isolation, screening, characterization, and optimization of bacterium isolated from calcareous soils for siderophore production","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-02-28 16:36:25","doi":"10.21203/rs.3.rs-1365991/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2022-07-08T07:13:10+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-02-25T06:44:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-02-24T11:24:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Archives of Microbiology","date":"2022-02-23T08:07:29+00:00","index":"","fulltext":""},{"type":"decision","content":"Major revisions","date":"2022-02-21T06:27:15+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"archives-of-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aomi","sideBox":"Learn more about [Archives of Microbiology](https://www.springer.com/journal/203)","snPcode":"203","submissionUrl":"https://submission.nature.com/new-submission/203/3","title":"Archives of Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"adcee6af-8997-4ee1-9e10-925a60bbb954","owner":[],"postedDate":"February 28th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-11-07T05:30:25+00:00","versionOfRecord":[],"versionCreatedAt":"2022-02-28 16:36:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1365991","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1365991","identity":"rs-1365991","version":["v1"]},"buildId":"wLkW0s4AflPzk-lpfg-fK","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}