Targeting TBC1D15 Reverses TMZ-resistance in Glioblastoma by Modulating Lysosomal Ca²⁺/TFEB/Cx43 Axis via Mitochondria-Lysosome Contact

Targeting TBC1D15 Reverses TMZ-resistance in Glioblastoma by Modulating Lysosomal Ca²⁺/TFEB/Cx43 Axis via Mitochondria-Lysosome Contact | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Targeting TBC1D15 Reverses TMZ-resistance in Glioblastoma by Modulating Lysosomal Ca²⁺/TFEB/Cx43 Axis via Mitochondria-Lysosome Contact Liping Jiang, Zhihan Chen, Yunyan Du, Manya Jiang, Rong Chen, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7218795/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Glioblastoma multiforme (GBM) is among the most malignant central nervous system tumors with a poor prognosis. Resistance to temozolomide (TMZ), the first-line chemotherapy drug, is the primary obstacle to treatment efficacy in GBM patients. Our study identified TBC1D15 as an oncogene in GBM and a potential therapeutic target for TMZ resistance. TBC1D15 is overexpressed in recurrent GBM (rGBM) and TMZ-resistant cells. Knockdown of TBC1D15 significantly sensitized TMZ-resistant cells to TMZ. Further investigation revealed that TBC1D15 knockdown prolonged mitochondria-lysosome contact (MLC), altered lysosomal Ca 2+ kinetics, inhibited TFEB nuclear translocation, thereby downregulating Cx43 expression, ultimately reversing GBM resistance to TMZ. Additionally, through high-throughput compound library screening integrated with 3D protein structure analysis, we identified dutasteride, an FDA-approved drug, as a specific inhibitor of TBC1D15. Dutasteride increased GBM sensitivity to TMZ both in vitro and in vivo. The combination of dutasteride and TMZ represented a promising treatment strategy for GBM, offering a potential therapeutic approach to overcome TMZ resistance. Health sciences/Diseases/Cancer/CNS cancer Biological sciences/Cancer/CNS cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 BACKGROUND Gliomas are the most common malignant tumors of the central nervous system (CNS), with glioblastoma multiforme (GBM), classified as a grade IV glioma, being the most prevalent and aggressive malignant brain tumor, accounting for approximately 57% of all gliomas and 48% of all primary CNS malignant tumors [1] . Clinical data show that the median survival time for GBM patients after standard treatment is only about 15 months, while tumor treating fields (TTFields) therapy in combination with standard care can extend median survival to approximately 20 months; the 5-year survival rate remains below 10% [2, 3] . Notably, approximately 40% of GBM patients develop resistance to temozolomide (TMZ) during chemotherapy, leading to treatment failure and tumor recurrence. TMZ is the first-line chemotherapy drug for GBM. It exerts its cytotoxic effect by inducing methylation of the O⁶ position of guanine, forming O6-methylguanine (O6MeG) [4] , thereby triggering tumor cell apoptosis. O6-methylguanine-DNA methyltransferase (MGMT) is the enzyme responsible for repairing O6MeG in the human body. Previous studies have generally regarded high MGMT expression (typically associated with an unmethylated MGMT promoter) as the core mechanism underlying GBM resistance [5-7] . However, emerging evidence indicates that some GBM patients with a methylated MGMT promoter remain resistant to TMZ, especially in recurrent GBM patients [8] . This suggests the existence of more diverse and complex resistance mechanisms, such as abnormal protein expression, enhanced DNA damage repair, promotion of drug efflux, tumor microenvironment, and glioblastoma stem cells [9-14] . Therefore, elucidating the multifaceted mechanisms of TMZ resistance in GBM and identifying novel therapeutic targets to overcome it are critical for developing more effective treatment strategies. TBC1 domain family member 15 (TBC1D15) belongs to the TBC (Tre-2/Bub2/Cdc16) domain family and acts as a GTPase-activating protein (GAP) for Rab7 [15] . Additionally, it regulates the dynamic process of mitochondria-lysosome contact (MLC), playing a crucial role in cellular homeostasis regulation [16, 17] . It has been reported that, by influencing MLC, TBC1D15 is associated with Parkinson's disease, seizures, myocardial ischemia/reperfusion injury, and Ca²⁺ transport from lysosomes to mitochondria [18-22] . Our findings demonstrate that TBC1D15-induced alterations in lysosomal calcium signaling impair TFEB entry into the nucleus. Notably, databases show that TBC1D15 is abnormally overexpressed in recurrent glioblastoma (rGBM), but whether it contributes to TMZ resistance remains unreported. Gap junction protein 43 (connexin 43, Cx43) is the most widely distributed member of its multigene family. Although some studies have shown that Cx43 expression decreases with increasing GBM grade, others demonstrate its upregulation in TMZ-resistant GBM [23, 24] and promote TMZ efflux, counteracting apoptosis pathways, through MGMT-independent mechanisms [25, 26] . Our previous work also demonstrated that Cx43 is upregulated in exosomes derived from TMZ-resistant GBM cells and promotes both TMZ resistance and angiogenesis [27, 28] . However, the exact mechanism by which Cx43 is upregulated in drug-resistant GBM and influences GBM drug resistance remains unclear. We hypothesize that TBC1D15 downregulates Cx43 by prolonging MLC-mediated lysosomal Ca 2+ dynamics and reducing TFEB nuclear translocation, thereby increasing GBM sensitivity to TMZ. This study established that TBC1D15 drives GBM chemotherapy resistance. Targeting TBC1D15 suppressed the malignant progression of GBM by impairing TFEB-promoted Cx43 transcription through prolonging MLC and disrupting lysosomal Ca 2+ dynamics. These findings highlight the potential role of TBC1D15 as a drug target for GBM therapy. RESULTS TBC1D15 is highly expressed in TMZ-resistant GBM cells and tissues and correlates with malignancy The expression of TBC1 domain family member 15 (TBC1D15) is associated with the malignancy of glioblastoma multiforme (GBM). We first analyzed TBC1D15 mRNA expression levels in primary GBM and recurrent GBM (rGBM) patients using the CGGA database. Bioinformatics analysis revealed that rGBM patients exhibited significantly higher TBC1D15 mRNA expression levels (Figure 1A). Survival analysis further indicated that higher TBC1D15 expression served as an adverse prognostic factor for GBM patients (Figure 1B). To investigate the underlying resistance mechanisms, we established TMZ-resistant U251MG and LN229 cell lines (U251R and LN229R) using a concentration gradient method (Figure 1C). We also detected TMZ-sensitive and resistant GBM cells, as well as tumor tissues from GBM and rGBM patients, via Western blot and immunohistochemistry (IHC) experiments. The results showed that TMZ-resistant cells and rGBM patients had elevated TBC1D15 expression levels (Figures 1D, E). Additionally, we knocked down TBC1D15 in U251R cells and conducted a proteomic profiling analysis. Among the over 3,000 proteins identified, 756 proteins showed differential expression (Figure 1F). KEGG and GO enrichment analyses of these differentially expressed proteins subsequently revealed that TBC1D15 is closely associated with apoptosis, lysosomal membrane, and calcium ion transport into mitochondria (Figure 1G). Inhibition of TBC1D15 suppresses TMZ resistance and malignant progression of GBM in vitro and in vivo To elucidate the mechanism underlying TBC1D15-mediated TMZ resistance in GBM, we established stable TBC1D15-knockdown U251R and LN229R cell lines (U251R/TBC1D15KD, LN229R/TBC1D15KD) (Supplementary Figure 1A, Figure 2A), and quantified TMZ sensitivity via CCK-8 assays. TBC1D15 knockdown significantly reduced TMZ IC 50 values (Figure 2B). Colony formation assay revealed that inhibition of TBC1D15 attenuated the proliferative capacity of GBM cells (Figure 2C). Wound healing assays and Transwell assays indicated that TBC1D15 depletion suppressed the migration capacity of GBM cells (Figures 2D, E). Given that KEGG and GO enrichment results linked TBC1D15 to apoptosis, we assessed the apoptotic changes of GBM cells post-knockdown. Results showed that under the same TMZ concentration, inhibiting TBC1D15 activated the apoptosis pathway more effectively (Figure 2F). In murine subcutaneous tumor models, TBC1D15 knockdown enhanced the sensitivity of GBM cells to TMZ, as evidenced by the reduced tumor volume and increased Cleaved Caspase-3 expression in tumors (Figure 2G, H). Collectively, these findings indicated that inhibiting TBC1D15 reverses GBM resistance to TMZ and malignant progression. Inhibition of TBC1D15 suppresses the malignant progression of drug-resistant GBM by reducing Cx43 expression Building on our prior findings that exosomal Cx43 elevation in TMZ-resistant GBM cells enhances resistance and angiogenesis in sensitive cells, proteomics revealed Cx43 downregulation upon TBC1D15 knockdown (Figure 3A). These findings led us to hypothesize that TBC1D15 may influence the malignant progression of GBM cells by affecting Cx43. To test this, we overexpressed Cx43 (Cx43OE) in TBC1D15-knockdown cells (Figure 3B) and assessed malignant phenotypes. CCK-8 assays indicated that Cx43OE partially restored the IC 50 of TMZ-sensitive GBM cells in TBC1D15-knockdown cells (Figure 3C). Similarly, colony formation assays indicated that Cx43OE partially restored the proliferation capacity of TBC1D15-knockdown GBM cells (Figure 3D), and wound healing assay as well as Transwell assay results confirmed partial rescue of migratory ability (Figure 3E, F). Western blot analysis of apoptosis-related proteins revealed reduced apoptosis (Figure 3G). Collectively, these results demonstrate that inhibition of TBC1D15 attenuates GBM malignancy through Cx43-mediated mechanisms, at least partially. TBC1D15 inhibition reduces Cx43 expression via transcriptional regulation To investigate the mechanism underlying the downregulation of Cx43 expression by TBC1D15 knockdown, we first analyzed the correlation between TBC1D15 and the Cx43 gene (GJA1). The results showed that TBC1D15 expression was positively correlated with GJA1 expression (Figure 4A). Consistently, GJA1 is highly expressed in rGBM patients, and survival analysis also showed that high levels of GJA1 are an adverse prognostic factor for GBM patients (Supplementary Figure 2A). Furthermore, knockdown of TBC1D15 led to a downregulation of Cx43 mRNA levels (Figure 4B). Since our previous studies demonstrated that the transcription factor EB (TFEB) binds to the upstream region of the GJA1 promoter, we confirmed this binding using CHIP experiments. (Figure 4D) Additionally, IF results demonstrated that nuclear translocation of TFEB promotes Cx43 expression (Figure 4C). We next investigated the effects of TBC1D15 knockdown on TFEB. While total TFEB expression showed no significant change upon TBC1D15 knockdown, subcellular fractionation revealed that nuclear localization of TFEB was reduced (Figure 4E), a finding that aligns with the IF results demonstrating impaired nuclear translocation (Figure 4F). TFEB nuclear localization is primarily regulated by mTOR and calcineurin (CaN), so we performed Western blot analysis of mTOR and CaN expression. The results showed that the mTOR activation remained unchanged after inhibiting TBC1D15, whereas CaN expression was downregulated (Figure 4G). These findings indicate that TBC1D15 knockdown reduces Cx43 transcription by inhibiting TFEB nuclear translocation. Inhibition of TBC1D15 modulates lysosomal Ca 2+ dynamics by prolonging MLC, thereby altering the nuclear localization of TFEB CaN is a calcium-dependent phosphatase whose activity requires Ca 2+ . Lysosomal Ca²⁺ efflux through TRPML1 channels induces CaN activation. Prior studies indicated that TBC1D15 knockdown extended MLC duration, promoting TRPML1-dependent Ca²⁺ transfer to mitochondria, through VDAC1 and MCU channels, ultimately elevating mitochondrial Ca²⁺ levels. Therefore, we hypothesized that TBC1D15 knockdown may reduce lysosomal Ca²⁺ efflux to the cytosol, dampening CaN activation and suppressing TFEB nuclear translocation. To test this, we first performed live imaging of GBM cells co-stained with MitoTracker and LysoTracker. Confocal microscopy analysis revealed that TBC1D15 inhibition significantly prolonged MLC duration in GBM cells (Figure 5A). Subsequently, we measured cytosolic Ca²⁺ dynamics using Fluo-4 AM. Cells treated with ML-SA1 (a TRPML1 agonist) showed no significant change in cytosolic Ca²⁺ levels upon TBC1D15 knockdown (Figure 5B). In contrast, Rhod-2 AM staining demonstrated that ML-SA1 treatment induced significantly higher mitochondrial Ca²⁺ accumulation in TBC1D15-knockdown cells. (Figure 5C). These results confirmed that TBC1D15 knockdown enhances lysosomal Ca²⁺ flux transfer into mitochondria without altering cytosolic Ca² ⁺ . To determine whether this Ca²⁺ redistribution affects CaN-mediated TFEB translocation, shNC and TBC1D15KD cells were subjected to (1) DMSO (vehicle control), (2) ML-SA1 (to activate lysosomal Ca²⁺ release), and (3) Ionomycin (a Ca²⁺ ionophore), which bypasses lysosomal Ca²⁺ release and directly elevates cytosolic Ca²⁺ level. TFEB nuclear translocation was assessed by Western blotting and immunofluorescence. The results showed that Ionomycin rescued nuclear translocation of TFEB in both shNC and TBC1D15KD groups, whereas ML-SA1 promoted nuclear translocationof TFEB in the shNC cells exclusively but not the TBC1D15KD cells (Figure 5D, E). These findings indicated that TBC1D15 knockdown impairs CaN activation and suppresses TFEB nuclear entry by prolonging MLC, thereby diverting lysosomal Ca²⁺ toward mitochondria. Dutasteride inhibits the malignant progression of GBM in vitro and in vivo by suppressing TBC1D15 Our studies revealed that TBC1D15 is upregulated in TMZ-resistant GBM tissues and cells. Mechanistically, TBC1D15 knockdown promotes lysosomal Ca²⁺ flux transport into mitochondria, attenuates CaN activation, thus impairing TFEB nuclear translocation, ultimately reducing Cx43 transcription and sensitizing GBM cells to TMZ. Therefore, we aimed to identify a drug that can specifically inhibit TBC1D15. We obtained the structural information of the TBC1D15 protein from the UniProt database and predicted its active pockets using the Cavity Plus website (Figure 6A). Subsequently, we performed virtual screening of FDA-approved drugs via AutoDock Vina, and selected the top four candidates by binding energy for functional validation. Key findings demonstrate that dutasteride synergized with TMZ to overcome chemoresistance in CCK-8 assays (Figure 6C), with molecular docking predicting hydrogen bonding between dutasteride and Arg403 of TBC1D15 (Figure 6A). Cellular Thermal Shift Assay (CETSA) confirmed the binding between dutasteride and TBC1D15 (Figure 6B). Critically, dutasteride recapitulated the molecular consequences of TBC1D15 knockdown through coordinated downregulation of Cx43 expression, induction of pro-apoptotic proteins (Figure 6F, G), and suppression of TFEB nuclear translocation(Figure 6H, I) . In vivo experiments demonstrated that the combination of dutasteride and TMZ effectively reduced tumor volume and enhanced the expression of cleaved caspase-3 in xenograft models (Figure 6D, E). These findings establish that dutasteride overcomes TMZ resistance in GBM by inhibiting TBC1D15 both in vivo and in vitro. DISCUSSION Since the FDA approved TMZ as a first-line GBM chemotherapy drug in 2005, treatment progress has been slow. Currently, in addition to standard treatment regimens, only bevacizumab, lomustine, BRAF inhibitors, and tumor-targeting electric fields have been approved by the FDA. After standard treatment, the median survival time for GBM patients is approximately 15 months, with a 5-year survival rate of about 9.8%. Combining TTFields with standard therapy extends median overall survival to 20.9 months, and chemotherapy remains one of the key adjunctive treatments for GBM. However, a significant number of patients develop resistance to TMZ chemotherapy, and the lack of other effective chemotherapy drugs further complicates the treatment of GBM. Conducting in-depth research into the mechanisms of chemotherapy resistance in GBM, identifying new potential therapeutic targets and drugs, and implementing personalized treatment strategies tailored to individual patients are critical to improving treatment outcomes. In this study, we identify TBC1D15 as a potential novel oncogene in GBM. Targeting and inhibiting TBC1D15 may benefit patients with TMZ-resistant GBM during treatment. As a member of the TBC protein family, TBC1D15 contains a conserved TBC domain and functions as a GTPase-activating protein (GAP) for RAB7, catalyzing the hydrolysis of RAB7-GTP to RAB7-GDP [15] . The mitochondrial-lysosomal contact (MLC) phenomenon, discovered by Wong et al [16, 17] , is mediated by RAB7-GTP docking. Fis1 recruits cytoplasmic TBC1D15 to the MLC sites, where it hydrolyzes RAB7-GTP to RAB7-GDP, triggering MLC dissociation. Additionally, TBC1D15 plays a role in various diseases, such as acute myocardial infarction, myocardial ischemia/reperfusion, Parkinson's disease, epilepsy, and others. MLC sites facilitate the exchange of molecules and ions between mitochondria and lysosomes. For example, when MLC occurs, Ca²⁺ can traverse lysosomal TRPML1 channels, mitochondrial outer membrane VDAC1, and inner membrane MCU channels to increase mitochondrial Ca²⁺ concentration [22] . A few studies have reported that TBC1D15 is an oncogene in tumors. For example, the interaction between TBC1D15 and NOTCH proteins promotes the self-renewal of tumor-initiating cells (TICs), and interfering with the TBC1D15-NOTCH1 interaction reduces TIC growth and may improve cancer treatment outcomes [29] . Additionally, a study identified characteristic miRNAs for the early detection of laryngeal squamous cell carcinoma and suggested that TBC1D15 may be one of the downstream proteins regulated by these miRNAs [30] , but its role in TMZ resistance in GBM has not been reported. This study found that TBC1D15 influences lysosomal Ca 2+ dynamics by regulating MLC, thereby reducing TFEB nuclear translocation, lowering Cx43 expression, and affecting the resistance of drug-resistant GBM cells to TMZ. TFEB is a basic helix-loop-helix/leucine zipper (bHLH-Zip) type transcription factor belonging to the MiT/TFE family (including MiTF, TFE3, and TFE2). It is a master regulatory protein in the autophagy-lysosome pathway and is involved in cellular metabolism and stress responses. The subcellular localization of TFEB is phosphorylation-dependent: mTORC1 phosphorylates TFEB at the S122, S142, and Ser211 sites, promoting TFEB binding with 14-3-3 proteins and retention in the cytoplasm [31] . During nutrient deprivation, oxidative stress, or mitochondrial damage, TFEB is dephosphorylated and enters the nucleus to drive target gene transcription. TFEB dephosphorylation is primarily mediated by CaN and occurs downstream of mTORC1. CaN consists of a catalytic subunit and a calcium-dependent subunit, and its activity is influenced by Ca 2+ concentration [32] . Previous studies have shown that CaN can respond to calcium signals from the lysosomal TRPML1 channel, leading to TFEB dephosphorylation and promoting its nuclear translocation [33, 34] . In this study, TBC1D15 knockdown prolonged MLC, promoted mitochondrial calcium uptake into lysosomes, impaired CaN activation, and consequently decreased TFEB nuclear translocation. These findings align with Barazzuol et al. [35] , who reported that α-synuclein reduces MLC and decreases mitochondrial Ca 2+ uptake, thereby increasing TFEB nuclear translocation. Reduced TFEB nuclear translocation leads to downregulation of its downstream target gene expression, including GJA1 (encoding Cx43) [36] . Putative TFEB binding sites upstream of the GJA1 promoter were identified using UCSC and JASPAR databases. Cx43 may play a dual role in glioma development and metastasis: On the one hand, Cx43 expression decreases with increasing glioma grade, while increased Cx43 expression on cancer cells enhances their permeability to chemotherapeutic drugs [37] . On the other hand, some studies have shown that Cx43 mediates tumor microtubule (TM)-related multicellular communication by forming gap junctions in brain tumor cells; knocking down Cx43 reduces the proportion of TM-connected cells, thereby decreasing tumor growth and resistance to radiotherapy [38] ; downregulating Cx43 blocks the serial connection between astrocytes and glioma cells, increasing their sensitivity to TMZ [39] ; our study and others have shown that Cx43 is highly expressed in GBM cells resistant to TMZ, and inhibiting Cx43 (such as α-CT1) can enhance GBM sensitivity to TMZ [24, 28, 40] . Based on the mechanisms mentioned above, identifying new strategies targeting TBC1D15 or its downstream pathways is key to overcoming drug resistance. Previous studies have shown that gender significantly influences the incidence and prognosis of GBM, with male incidence rates being 1.6 times higher than those of females. An epidemiological surveillance study indicated that female GBM patients have longer survival times than males, though this survival advantage disappears after menopause [41] . Postmenopausal women also exhibit a higher GBM risk than premenopausal women. Some attribute this to estrogen’s protective effect against GBM, while others suggest estrogen exposure mitigates androgen-related adverse effects [42] . Regardless, upregulation of the androgen receptor (AR) does promote GBM development, and testosterone levels are elevated in GBM patients [43, 44] . Dutasteride is a potent, selective dual-action 5α-reductase inhibitor that inhibits both isoenzymes (Type I and Type II) of 5α-reductase, thereby preventing the conversion of testosterone into dihydrotestosterone (DHT), reducing DHT levels in prostate tissue and serum. In 2007, the US FDA approved dutasteride for the treatment of androgenetic alopecia (AGA). Clinical studies have shown its efficacy to be superior to finasteride and significantly improved treatment outcomes for AGA in patients who did not respond clinically to finasteride [45, 46] . Another study evaluated the preventive effect of dutasteride on prostate cancer (PCa) in patients with high-grade prostatic intraepithelial neoplasia (HGPIN), but the results showed that continuous use of dutasteride for 3 years did not reduce the detection rate of PCa, nor did it increase the detection rate of PCa in HGPIN patients [47, 48] . Notably, clinical use of dutasteride as adjuvant tumor therapy remains unexplored. In conclusion, our study demonstrated that TBC1D15 serves as an oncogene in GBM. Targeting TBC1D15 interfered with the lysosomal Ca 2+ dynamics and reduced the nuclear translocation of TFEB, leading to the downregulation of Cx43. Thus, improve the sensitivity of GBM to TMZ. The combination of dutasteride and TMZ can inhibit GBM in vitro and vivo, with the inhibitory effect associated with its impact on the TBC1D15 protein. This provides new experimental evidence and translational insights for utilizing the “old drug” dutasteride to target the TBC1D15 pathway and overcome TMZ resistance in GBM. MATERIALS AND METHODS Clinical glioma patient samples This study enrolled 4 patients with recurrent GBM who received TMZ treatment before their second surgery and 12 patients with primary GBM who did not receive TMZ treatment. Tissue samples were stored in liquid nitrogen. All samples used in the experiment were obtained with informed consent from the patients and were approved by the Ethics Committee of The First Affiliated Hospital of Nanchang University. (IIT2025260) Cell culture and establishment of TMZ-resistant cell lines Human glioma cell lines U251MG and LN229 (purchased from ATCC) were cultured at 37 °C in a humidified incubator containing 5% CO₂, using DMEM medium (11995, Solarbio, Beijing, China) supplemented with 10% fetal bovine serum (FSD500, ExCell Bio, Suzhou, China). Stable TMZ-resistant U251MG and LN229 glioma cells were generated through gradient induction and named U251R cells and LN229R cells, respectively. TMZ (S1237, Selleck, Shanghai, China) was dissolved in DMSO and stored at -80 °C. U251MG cells and LN229 cells were exposed to TMZ, with the concentration gradually increased. Cells were exposed to each dose for three generations, with the entire induction process lasting 6 months. H&E and Immunohistochemistry (IHC) Staining Tissues were fixed, paraffin-embedded, sectioned, deparaffinized, and subsequently immersed in xylene three times for 10 min each, graded in ethanol (100%, 95%, 85%, 70%), and phosphate-buffered saline (PBS, P1020, Solarbio, Beijing, China), hydrated for 5 min each for H&E staining. For IHC, EDTA was used for antigen repair, and 0.3% hydrogen peroxide was used to block endogenous peroxidase. Goat serum (AR0009, Boster, Wuhan, China) was used for containment at 37 °C for 30 min. Anti-TBC1D15 (ab121396, 1:50 dilution, Abcam, Cambridge, UK) and anti-Cleaved Caspase-3 (TA7022, 1:100 dilution, Abmart, Shanghai, China) antibodies were incubated with the tissues at 4 ℃ overnight. Horseradish peroxidase (HRP)-labeled goat anti-mouse/rabbit IgG (H + L) (SA00001-1/SA00001-2, Proteintech, Wuhan, China) was blended into paraffin sections for secondary antibody conjugation, and DAB (DA1010, Solarbio, Beijing, China) was used for color development. Nuclei were stained with hematoxylin for 3 min. samples were washed in graded ethanol (70%, 85%, 95%, 100%) and xylene solutions and sealed with neutral resin. Immunohistochemical staining was assessed using inverted fluorescence microscopy (Model DMi8, Leica Microsystems, Wetzlar, Germany). Western blot (WB) analysis Proteins were extracted from cells and patient tissues using RIPA lysis buffer (P0013B, Beyotime, Shanghai, China), and protein concentrations were quantified using the BCA protein assay kit (P0010, Beyotime, Shanghai, China). Proteins were separated by SDS-PAGE and transferred to a 0.45 μm PVDF membrane (IPVH00010, Millipore, Schwalbach, Germany). The membrane was incubated at room temperature for 1 h in 5% non-fat milk-containing TBS-Tween 20 (TBST) blocking solution, followed by incubation with the primary antibody at 4 °C overnight. The secondary antibody (SA00001-1/SA00001-2, 1:5000 dilution, Proteintech, Wuhan, China) was then incubated at room temperature for 1 h. Finally, the membranes were exposed to an enhanced chemiluminescence (PK10001, Proteintech, Wuhan, China) reagent for imaging and analyzed using ImageJ software. The primary antibodies used were TBC1D15 (ab121396, 1:1000 dilution, Abcam, Cambridge, UK); Cx43 (sc-59949, 1:250 dilution, Santa Cruz, CA, USA); Bax (T40051, 1:1000 dilution, Abmart, Shanghai, China); TFEB (13116, 1:1000 dilution, Cell Signaling Technology, Boston, USA); Bcl-2 (381702, 1:1000 dilution, Zenbio, Chengdu, China); Caspase-3 (TA6311, 1:1000 dilution, Abmart, Shanghai, China); Cleaved caspase-3 (TA7022, 1:1000 dilution, Abmart, Shanghai, China); CaN (YA2508, 1:1000 dilution, MCE, NJ, USA); mTOR ( 66888-1-Ig, 1:1000 dilution, Proteintech, Wuhan, China); p-mTOR (67778-1-Ig, 1:1000 dilution, Proteintech, Wuhan, China); β -Tubulin (10094-1-AP, 1:2000 dilution, Proteintech, Shanghai, China); and GAPDH (60004-1-Ig, 1:50,000 dilution, Proteintech, Wuhan, China). RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was extracted from GBM cells using TRIzol reagent (15596018CN, Invitrogen, CA, USA) according to the manufacturer's instructions. The concentration of total RNA was quantified using an Evolution 350 spectrophotometer (840-310800, Thermo Fisher Scientific, MA, USA). Reverse transcription was performed using the PrimeScript reverse transcription kit (containing gDNA removal agent) (RR047A, TaKaRa, Kusatsu, Japan). QPCR experiments were conducted using the TB Green® Premix Ex Taq quantitative PCR kit (Tli RNaseH Plus) (RR420A, TaKaRa, Kusatsu, Japan). For each sample, gene expression levels were normalized using GAPDH as an internal reference and calculated using the 2 −ΔΔct formula. The primers used were as follows (Table 1): Table 1. Sequences for GJA1 (Gene name of Cx43) Primer names Sequence GJA1 promoter forward primer 5'-CTCTCGCCTATGTCTCCTCCTG-3' GJA1 promoter reverse primer 5'-TCACTTGCTTGCTTGTTGTAATTGC-3' Live cell time-lapse imaging Live cells were imaged using an Olympus confocal microscope (FV4000, Olympus Corporation, Tokyo, Japan). For mitochondria-lysosome contact, cells were incubated with Lyso-Tracker Green DND-26 (lysosomes, green) (40738ES50, Yeasen, Shanghai, China) for 2 h and with Mito-Tracker Red (mitochondria, red) (40741ES50, Yeasen, Shanghai, China) for 30 min at concentrations of 50 nM and 100 nM, respectively, following the manufacturer's instructions. Images were recorded at 561 nm for Mito-Tracker Red and at 488 nm for Lyso-Tracker Green DND-26. Image analysis was performed using Olympus software. For Ca²⁺ detection, cells were treated with Fluo-4 AM (40704ES50, Yeasen, Shanghai, China) or Rhod-2 AM (40776ES50, Yeasen, Shanghai, China) for 15 min at a concentration of 0.5 μM. Cells were then washed with HBSS and incubated in a cell culture incubator for an additional 30 min. ML-SA1 was then added, and cells were immediately placed under a microscope for live-cell time-lapse imaging. Plasmids and viral transfections Lentiviruses carrying shRNA-TBC1D15 or shRNA-NC and human full-length GJA1 or empty plasmid were purchased from Genechem (Shanghai, China) and were used for stable knockdown of TBC1D15 and overexpression of Cx43, respectively, while the empty plasmid served as a control. U251R cells and LN229R cells were treated with lentiviral particles as controls. U251R cells and LN229R cells were treated with lentiviral particles for 72 h and selected using puromycin (2 μg/mL). To overexpress Cx43, cells were transfected with the overexpression plasmid or empty plasmid using the Lipofectamine 3000 kit (L3000015, Invitrogen, CA, USA). The primers used are shown in the table below (Table 2): Table 2. Sequences for shRNA NO. 5’ STEM Loop STEM 3’ shTBC1D15 -1-F CCGG GCGATCCCTCTACACATCAAC CTCGAG GTTGATGTGTAGAGGGATCGC TTTTTG shTBC1D15 -1-R AATTCAAAAA GCGATCCCTCTACACATCAAC CTCGAG GTTGATGTGTAGAGGGATCGC shTBC1D15 -2-F CCGG GCAAGCATGGAAATTTCTTCT CTCGAG AGAAGAAATTTCCATGCTTGC TTTTTG shTBC1D15 -2-R AATTCAAAAA GCAAGCATGGAAATTTCTTCT CTCGAG AGAAGAAATTTCCATGCTTGC shTBC1D15 -3-F CCGG GAAATCCATCAGCCAGGAACA CTCGAG TGTTCCTGGCTGATGGATTTC TTTTTG shTBC1D15 -3-R AATTCAAAAA GAAATCCATCAGCCAGGAACA CTCGAG TGTTCCTGGCTGATGGATTTC CCK-8 assay and drug treatment CCK-8 reagent (40203ES76, Yeasen, Shanghai, China) was used to assess the viability of GBM cells. GBM cells were seeded at a density of 3×10³ cells per well in a 96-well plate and incubated with 100 μL of DMEM containing 10% FBS. Cells were allowed to adhere under conditions of 37 °C for 12 h, followed by treatment with different concentrations of TMZ or DMSO. After 72 h of culture, 10 μL of CCK-8 solution was added to each well, and measurements were taken after 2 h. Absorbance (OD value) was measured at 450 nm using a microplate reader (VLBLATGD2, Thermo Fisher Scientific, MA, USA). Colony Formation Assay Colony formation assays were used to assess the proliferative capacity of cells. Log-phase GBM cells were digested with trypsin, resuspended, and seeded in 6-well plates (3 × 10³ cells/well). The cells were cultured in a humidified incubator at 37°C with 5% CO₂ for 10 days, with medium changes every 3 days. The cells were gently washed with PBS, fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.1% crystal violet (Y268091, Beyotime, Shanghai, China) solution for 20 minutes. Photographs were taken, and the cells were counted using ImageJ software. Wound healing and Transwell assay Cell migration ability was measured using a wound healing assay. Cells were seeded in 6-well plates and cultured to 100% confluence, then scratched using a 200 μL pipette tip. Cells were cultured in serum-free DMEM for further studies. Images were captured at 0 h, 24 h, and 48 h using an inverted microscope (Model DMi8, Leica Microsystems, Wetzlar, Germany), and the wound area was analyzed using ImageJ software. Perform Transwell migration assays using Transwell chambers (353095, Falcon, MA, USA) in 24-well plates (3738, Corning, MA, USA). Suspend cells in 200 μL serum-free DMEM (2.5 × 10⁵) and place them in the upper chamber. Then, 600 μL of DMEM containing 10% FBS was added to the lower chamber. After incubating at 37 °C for 24 h, cells were fixed with paraformaldehyde, stained with 0.1% crystal violet solution for 20 min, and counted under an inverted microscope. The average cell count from five randomly selected fields of view under the inverted microscope was calculated and analyzed using ImageJ software. Immunofluorescence Assay Cells cultured in confocal culture dishes were fixed with 4% paraformaldehyde and treated with 0.3% Triton X-100 (ST1723, Beyotime, Shanghai, China) for 15 min, then blocked with goat serum at 37°C for 30 min. The primary antibody was incubated at 4°C overnight, followed by incubation with a fluorescent secondary antibody (SA00013-2, Proteintech, Wuhan, China) at 37°C for 1 hour. Finally, the cells were stained with DAPI (AR1176, Boster, Wuhan, China) containing an anti-quenching reagent. Microscopic images were obtained using a Nikon confocal microscope (A1 HD25, Nikon, Tokyo, Japan) (three fields of view from three independent experiments per group) and further analyzed using ImageJ. Chromatin Immunoprecipitation (ChIP) Kit Chromatin immunoprecipitation (ChIP) was performed using a ChIP kit (9003S, Cell Signaling Technology, Boston, USA) according to the manufacturer’s protocol. Cells were lysed, chromatin was collected, and enzymatically fragmented. Chromatin was immunoprecipitated using a ChIP-grade antibody against TFEB (13116, 1:50 dilution, Cell Signaling Technology, Boston, USA). After immunoprecipitation, reverse the protein-DNA crosslinks, purify the DNA, amplify by PCR, and perform agarose gel electrophoresis. The table below lists the primers used (Table 3): Table 2. ChIP sequences for GJA1 (Gene name of Cx43) Primer names Sequence GJA1 promoter forward primer 5'-GGAGCATCACTGAAGCCTGT-3' GJA1 promoter reverse primer 5'-CCTCTTCAGGGCTCTCTGCATT-3' Cellular Thermal Shift Assay （CETSA） Drug binding activity to target proteins was detected using a Cellular Thermal Shift Assay. U251R cells in the logarithmic growth phase (1×10⁶ cells/well) were seeded into a 6-well plate and incubated with DMSO or dutasteride at 37°C for 3 h. Cells were digested and centrifuged, then resuspended in 1.5 mL PBS (containing protease and phosphatase inhibitors). Cells were repeatedly freeze-thawed in liquid nitrogen to lyse them, at least three times, followed by centrifugation at 4°C and 15,000 g for 20 min to collect the protein supernatant. Protein concentration was determined using the BCA method, and DMSO or dutasteride was added again and incubated at 4°C for 2 h. The protein was aliquoted and heated at temperature gradients (37, 42, 47, 52, 57, and 62°C) for 3 min each, followed by centrifugation at 4°C, 15,000 g for 40 min, and the protein supernatant was used for Western blotting. The band gray values were analyzed using ImageJ, calculating the half-denaturation temperature (Tm) and ΔTm (the difference between Tm in the drug-treated group and the DMSO control group), with ΔTm > 1 °C indicating a binding effect between the drug and the target protein. The experiment was repeated three times, and the data were presented as the mean ± standard deviation. Molecular Docking Molecular docking was performed using AutoDock Vina 1.1.2 [49] . The TBC1D15 structural model was prepared by adding hydrogen atoms and assigning charges with AutoDock Tools. Dutasteride and other FDA-approved compounds were energy-minimized using the UFF force field. Docking simulations utilized a 25 × 25 × 25 Å grid box centered on the predicted ligand-binding site with exhaustiveness set to 32. Binding poses were ranked by calculated binding affinity (ΔG). Tumorigenicity assay Male BALB/c nude mice (4 weeks old, 5 per group) were provided by Jiangsu Jituo Pharmaceutical Biotechnology Co., Ltd. U251R/shNC or U251R/shTBC1D15 cells were digested with pancreatic enzymes and resuspended in PBS, adjusted to a density of 2 × 10⁷ cells/mL. Subcutaneous injections were then performed, with each mouse receiving 100 μL in the right axillary region. Tumor volume was assessed weekly, and treatment was initiated when tumor size reached approximately 100 mm³. At this point, mice were randomly assigned to receive intraperitoneal injections of TMZ (20 mg/kg) or the small-molecule drug (10 mg/kg) every 3 days for a total of 7 doses. After the experiment, animals were euthanized, tumors were excised, and weighed. Animal experiments were conducted on the animal platform at the Biomedical Testing Center of Nanchang University. The animal experiment protocol was approved by the Nanchang University Animal Ethics Committee (NCULAE-20250422001). Statistical analysis GraphPad Prism 9.0 was used for all statistical analyses. Mean ± standard deviation (SD) was used to represent the data. One-way analysis of variance and Bonferroni’s multiple comparisons test were utilized for the comparison of means between more than two groups, whereas the two-tailed unpaired Student’s t-test was employed to compare means between two groups. Analysis of survival was conducted with Kaplan-Meier analysis. The log-rank test was used to compare the survival curves of the mouse models. All functional in vitro experiments are representative of a minimum of three replicates. All experiments were conducted three times. At P <0.05, differences were considered significant. DECLARATIONS ACKNOWLEDGEMENT The authors are deeply grateful to Prof. Liping Jiang for her invaluable guidance and meticulous revision of the manuscript throughout this research. We are especially grateful to the Key Laboratory of Drug Targets and Drug Screening of Jiangxi Province for providing experimental facilities. CONFLICT OF INTEREST The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. AUTHOR CONTRIBUTIONS LPJ, XJH, and ZHC conceived the research concept and design. LPJ, ZHC, YYD, MYJ, RC, ZMH, LKY, CXW, and QQZ implemented the methodological development and drafted, reviewed, and revised the manuscript. EMZ provides tissue samples and clinical information on GBM. All the authors read and authorized the final version of the paper. ETHICS This study was conducted in strict accordance with international ethical standards: Human participants and tissues: Approved by the Ethics Committee of The First Affiliated Hospital of Nanchang University (Approval No. IIT2025260). All procedures followed the Declaration of Helsinki, with written informed consent obtained from participants. Animal research: Approved by the Institutional Animal Care and Use Committee of the Laboratory Animal Science Center, Nanchang University (Approval No. NCULAE-20250422001). Animal experiments complied with ARRIVE Guidelines 2.0 and NIH Office of Laboratory Animal Welfare standards. FUNDING This work was supported by the National Natural Science Foundation of China (Grant No. 82460719). DATA AVAILABILITY All data in our study are available from the corresponding author upon reasonable request. All data generated or analyzed during this study are included in this published article. Additional datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. REFERENCES TAN A C, ASHLEY D M, LóPEZ G Y, et al. Management of glioblastoma: State of the art and future directions [J]. CA Cancer J Clin, 2020, 70(4): 299-312. STUPP R, TAILLIBERT S, KANNER A, et al. Effect of Tumor-Treating Fields Plus Maintenance Temozolomide vs Maintenance Temozolomide Alone on Survival in Patients With Glioblastoma: A Randomized Clinical Trial [J]. Jama, 2017, 318(23): 2306-16. BIRZU C, FRENCH P, CACCESE M, et al. Recurrent Glioblastoma: From Molecular Landscape to New Treatment Perspectives [J]. Cancers (Basel), 2020, 13(1). SARKARIA J N, KITANGE G J, JAMES C D, et al. Mechanisms of chemoresistance to alkylating agents in malignant glioma [J]. Clin Cancer Res, 2008, 14(10): 2900-8. HEGI M E, LIU L, HERMAN J G, et al. Correlation of O6-methylguanine methyltransferase (MGMT) promoter methylation with clinical outcomes in glioblastoma and clinical strategies to modulate MGMT activity [J]. J Clin Oncol, 2008, 26(25): 4189-99. CABRINI G, FABBRI E, LO NIGRO C, et al. Regulation of expression of O6-methylguanine-DNA methyltransferase and the treatment of glioblastoma (Review) [J]. Int J Oncol, 2015, 47(2): 417-28. PANDITH A A, QASIM I, ZAHOOR W, et al. Concordant association validates MGMT methylation and protein expression as favorable prognostic factors in glioma patients on alkylating chemotherapy (Temozolomide) [J]. Sci Rep, 2018, 8(1): 6704. WELLER M, STUPP R, REIFENBERGER G, et al. MGMT promoter methylation in malignant gliomas: ready for personalized medicine? [J]. Nat Rev Neurol, 2010, 6(1): 39-51. YUE Q, WANG Z, SHEN Y, et al. Histone H3K9 Lactylation Confers Temozolomide Resistance in Glioblastoma via LUC7L2-Mediated MLH1 Intron Retention [J]. Adv Sci (Weinh), 2024, 11(19): e2309290. SUN J, ZHAO W, ZHANG L, et al. Centromere protein U mediates the ubiquitination and degradation of RPS3 to facilitate temozolomide resistance in glioblastoma [J]. Drug Resist Updat, 2025, 80: 101214. YANG E, WANG L, JIN W, et al. PTRF/Cavin-1 enhances chemo-resistance and promotes temozolomide efflux through extracellular vesicles in glioblastoma [J]. Theranostics, 2022, 12(9): 4330-47. JING X, YANG F, SHAO C, et al. Role of hypoxia in cancer therapy by regulating the tumor microenvironment [J]. Mol Cancer, 2019, 18(1): 157. PRAGER B C, BHARGAVA S, MAHADEV V, et al. Glioblastoma Stem Cells: Driving Resilience through Chaos [J]. Trends Cancer, 2020, 6(3): 223-35. TOMAR M S, KUMAR A, SRIVASTAVA C, et al. Elucidating the mechanisms of Temozolomide resistance in gliomas and the strategies to overcome the resistance [J]. Biochim Biophys Acta Rev Cancer, 2021, 1876(2): 188616. ZHANG X M, WALSH B, MITCHELL C A, et al. TBC domain family, member 15 is a novel mammalian Rab GTPase-activating protein with substrate preference for Rab7 [J]. Biochem Biophys Res Commun, 2005, 335(1): 154-61. WONG Y C, YSSELSTEIN D, KRAINC D. Mitochondria–lysosome contacts regulate mitochondrial fission via RAB7 GTP hydrolysis [J]. Nature, 2018, 554(7692): 382-6. WONG Y C, KIM S, PENG W, et al. Regulation and Function of Mitochondria–Lysosome Membrane Contact Sites in Cellular Homeostasis [J]. Trends in Cell Biology, 2019, 29(6): 500-13. KIM S, WONG Y C, GAO F, et al. Dysregulation of mitochondria-lysosome contacts by GBA1 dysfunction in dopaminergic neuronal models of Parkinson's disease [J]. Nat Commun, 2021, 12(1): 1807. CISNEROS J, BELTON T B, SHUM G C, et al. Mitochondria-lysosome contact site dynamics and misregulation in neurodegenerative diseases [J]. Trends Neurosci, 2022, 45(4): 312-22. YU W, SUN S, XU H, et al. TBC1D15/RAB7-regulated mitochondria-lysosome interaction confers cardioprotection against acute myocardial infarction-induced cardiac injury [J]. Theranostics, 2020, 10(24): 11244-63. SUN S, YU W, XU H, et al. TBC1D15-Drp1 interaction-mediated mitochondrial homeostasis confers cardioprotection against myocardial ischemia/reperfusion injury [J]. Metabolism, 2022, 134: 155239. PENG W, WONG Y C, KRAINC D. Mitochondria-lysosome contacts regulate mitochondrial Ca 2+ dynamics via lysosomal TRPML1 [J]. Proceedings of the National Academy of Sciences, 2020, 117(32): 19266-75. LAI S-W, HUANG B-R, LIU Y-S, et al. Differential Characterization of Temozolomide-Resistant Human Glioma Cells [J]. International Journal of Molecular Sciences, 2018, 19(1): 127. MURPHY S F, VARGHESE R T, LAMOUILLE S, et al. Connexin 43 Inhibition Sensitizes Chemoresistant Glioblastoma Cells to Temozolomide [J]. Cancer Res, 2016, 76(1): 139-49. GIELEN P R, AFTAB Q, MA N, et al. Connexin43 confers Temozolomide resistance in human glioma cells by modulating the mitochondrial apoptosis pathway [J]. Neuropharmacology, 2013, 75: 539-48. PRIDHAM K J, SHAH F, HUTCHINGS K R, et al. Connexin 43 confers chemoresistance through activating PI3K [J]. Oncogenesis, 2022, 11(1). YANG Z J, BI Q C, GAN L J, et al. Exosomes Derived from Glioma Cells under Hypoxia Promote Angiogenesis through Up-regulated Exosomal Connexin 43 [J]. Int J Med Sci, 2022, 19(7): 1205-15. YANG Z J, ZHANG L L, BI Q C, et al. Exosomal connexin 43 regulates the resistance of glioma cells to temozolomide [J]. Oncol Rep, 2021, 45(4). CHOI H Y, ZHU Y, ZHAO X, et al. NOTCH localizes to mitochondria through the TBC1D15-FIS1 interaction and is stabilized via blockade of E3 ligase and CDK8 recruitment to reprogram tumor-initiating cells [J]. Exp Mol Med, 2024, 56(2): 461-77. FALCO M, TAMMARO C, COSSU A M, et al. Identification and bioinformatic characterization of a serum miRNA signature for early detection of laryngeal squamous cell carcinoma [J]. J Transl Med, 2024, 22(1): 647. MARTINA J A, CHEN Y, GUCEK M, et al. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB [J]. Autophagy, 2012, 8(6): 903-14. CREAMER T P. Calcineurin [J]. Cell Commun Signal, 2020, 18(1): 137. ZHANG X, CHENG X, YU L, et al. MCOLN1 is a ROS sensor in lysosomes that regulates autophagy [J]. Nat Commun, 2016, 7: 12109. MEDINA D L, DI PAOLA S, PELUSO I, et al. Lysosomal calcium signalling regulates autophagy through calcineurin and TFEB [J]. Nat Cell Biol, 2015, 17(3): 288-99. GIAMOGANTE F, BARAZZUOL L, MAIORCA F, et al. A SPLICS reporter reveals α-synuclein regulation of lysosome-mitochondria contacts which affects TFEB nuclear translocation [J]. Nature Communications, 2024, 15(1): 1516. YANG Z J, ZHANG W F, JIN Q Q, et al. Lactate Contributes to Remote Ischemic Preconditioning-Mediated Protection Against Myocardial Ischemia Reperfusion Injury by Facilitating Autophagy via the AMP-Activated Protein Kinase-Mammalian Target of Rapamycin-Transcription Factor EB-Connexin 43 Axis [J]. Am J Pathol, 2024, 194(10): 1857-78. HUANG R P, HOSSAIN M Z, HUANG R, et al. Connexin 43 (cx43) enhances chemotherapy-induced apoptosis in human glioblastoma cells [J]. Int J Cancer, 2001, 92(1): 130-8. OSSWALD M, JUNG E, SAHM F, et al. Brain tumour cells interconnect to a functional and resistant network [J]. Nature, 2015, 528(7580): 93-8. SONG Y, HUANG Q, PU Q, et al. Gastrodin Liposomes Block Crosstalk between Astrocytes and Glioma Cells via Downregulating Cx43 to Improve Antiglioblastoma Efficacy of Temozolomide [J]. Bioconjug Chem, 2024, 35(9): 1380-90. CHE J, DEPALMA T J, SIVAKUMAR H, et al. αCT1 peptide sensitizes glioma cells to temozolomide in a glioblastoma organoid platform [J]. Biotechnol Bioeng, 2023, 120(4): 1108-19. THAKKAR J P, DOLECEK T A, HORBINSKI C, et al. Epidemiologic and molecular prognostic review of glioblastoma [J]. Cancer Epidemiol Biomarkers Prev, 2014, 23(10): 1985-96. CARRANO A, JUAREZ J J, INCONTRI D, et al. Sex-Specific Differences in Glioblastoma [J]. Cells, 2021, 10(7). BAO D, CHENG C, LAN X, et al. Regulation of p53wt glioma cell proliferation by androgen receptor-mediated inhibition of small VCP/p97-interacting protein expression [J]. Oncotarget, 2017, 8(14): 23142-54. RODRíGUEZ-LOZANO D C, PIñA-MEDINA A G, HANSBERG-PASTOR V, et al. Testosterone Promotes Glioblastoma Cell Proliferation, Migration, and Invasion Through Androgen Receptor Activation [J]. Front Endocrinol (Lausanne), 2019, 10: 16. DHURAT R, SHARMA A, RUDNICKA L, et al. 5-Alpha reductase inhibitors in androgenetic alopecia: Shifting paradigms, current concepts, comparative efficacy, and safety [J]. Dermatol Ther, 2020, 33(3): e13379. JUNG J Y, YEON J H, CHOI J W, et al. Effect of dutasteride 0.5 mg/d in men with androgenetic alopecia recalcitrant to finasteride [J]. Int J Dermatol, 2014, 53(11): 1351-7. MILONAS D, AUSKALNIS S, SKULCIUS G, et al. Dutasteride for the prevention of prostate cancer in men with high-grade prostatic intraepithelial neoplasia: results of a phase III randomized open-label 3-year trial [J]. World J Urol, 2017, 35(5): 721-8. CUI K, LI X, DU Y, et al. Chemoprevention of prostate cancer in men with high-grade prostatic intraepithelial neoplasia (HGPIN): a systematic review and adjusted indirect treatment comparison [J]. Oncotarget, 2017, 8(22): 36674-84. TROTT O, OLSON A J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading [J]. J Comput Chem, 2010, 31(2): 455-61. Additional Declarations (Not answered) Supplementary Files SupplementaryFigurelegends.docx Supplementary Figure legends SupplementaryFigure1.tif Supplementary Figure 1 SupplementaryFigure2.tif Supplementary Figure 2 Fullanduncroppedwesternblot.docx Full and uncropped western blot Top4FDAdrugsbindingwithTBC1D15.docx Top 4 FDA_drugs binding with TBC1D15 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7218795","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":504836661,"identity":"de522431-ab27-45f5-b02f-5eaf5f103830","order_by":0,"name":"Liping Jiang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYBACPgaGhANAWg7CZSNCCxtUizFJWsAgsYF4LdINDw/83FGbvp39jAHDh7LDDPyzGwhokTmQcLD3zPHcnT05Bowzzh1mkLhzgIAWiYSEA7xtx3I33OAxYOZtO8xgIJFAWMvBv23H0g1AWv4Sq+Uwb1tNAlgLI1FagH45LNt2wHDDmbSCgz3n0nkkbhDQwi/dk/zxbVudvMHxwxsf/CizluOfQUALgwQPSMVhMPsAEPMQUA/Swg5SWEdY4SgYBaNgFIxcAABBAkU0anhIoAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-1429-4164","institution":"Nanchang University","correspondingAuthor":true,"prefix":"","firstName":"Liping","middleName":"","lastName":"Jiang","suffix":""},{"id":504836662,"identity":"9bbe58a5-34be-4668-83c4-920782fa2bea","order_by":1,"name":"Zhihan Chen","email":"","orcid":"https://orcid.org/0009-0005-9306-3506","institution":"Jiangxi Medical College, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Zhihan","middleName":"","lastName":"Chen","suffix":""},{"id":504836663,"identity":"c22816e2-a9d3-4945-acfb-177c8bcf57c1","order_by":2,"name":"Yunyan Du","email":"","orcid":"https://orcid.org/0000-0002-2448-9520","institution":"Jiangxi Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yunyan","middleName":"","lastName":"Du","suffix":""},{"id":504836664,"identity":"c220ae9b-ded7-4c4d-97b8-c44dc2602d30","order_by":3,"name":"Manya Jiang","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Manya","middleName":"","lastName":"Jiang","suffix":""},{"id":504836665,"identity":"1057496c-a46c-4941-82bd-28cc33c2b669","order_by":4,"name":"Rong Chen","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Rong","middleName":"","lastName":"Chen","suffix":""},{"id":504836666,"identity":"4e9d9057-959c-4ad1-a825-211a972883e6","order_by":5,"name":"Erming Zeng","email":"","orcid":"","institution":"First Affiliated Hospital, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Erming","middleName":"","lastName":"Zeng","suffix":""},{"id":504836667,"identity":"6353c6c4-60a9-433f-bf20-f508ef6cb0d3","order_by":6,"name":"Liangjing Xu","email":"","orcid":"","institution":"Shanghai Putuo District People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Liangjing","middleName":"","lastName":"Xu","suffix":""},{"id":504836668,"identity":"8bb456b0-7893-4808-99e9-cc04d6d96943","order_by":7,"name":"Ziming He","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Ziming","middleName":"","lastName":"He","suffix":""},{"id":504836669,"identity":"4aea488a-6402-42ed-ab21-937091faa2c5","order_by":8,"name":"Lukai Yang","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Lukai","middleName":"","lastName":"Yang","suffix":""},{"id":504836670,"identity":"c0161a93-232d-4432-9b98-b1185d14ba12","order_by":9,"name":"Chenxi Wang","email":"","orcid":"","institution":"Jiangxi Medical College, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Chenxi","middleName":"","lastName":"Wang","suffix":""},{"id":504836671,"identity":"adf541b2-8b67-42f3-8bf0-2e04895e9780","order_by":10,"name":"Qianqian Zhang","email":"","orcid":"","institution":"Jiangxi Medical College, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Qianqian","middleName":"","lastName":"Zhang","suffix":""},{"id":504836672,"identity":"c4db209f-21e6-41af-af22-4158a829d2b4","order_by":11,"name":"Xiao-Jian Han","email":"","orcid":"https://orcid.org/0000-0002-1156-8115","institution":"Jiangxi Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiao-Jian","middleName":"","lastName":"Han","suffix":""}],"badges":[],"createdAt":"2025-07-26 06:05:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7218795/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7218795/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90463452,"identity":"1ce7ea14-bd22-401b-a7cf-2cdcd2c1043a","added_by":"auto","created_at":"2025-09-03 05:04:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3930619,"visible":true,"origin":"","legend":"\u003cp\u003e\u003ca href=\"#figure1\"\u003eTBC1D15 is highly expressed in TMZ-resistant GBM cells and tissues and correlates with malignancy.\u003c/a\u003e (A) Bioinformatics analysis of\u0026nbsp;the\u0026nbsp;CGGA database\u0026nbsp;revealed\u0026nbsp;significantly higher\u0026nbsp;TBC1D15\u0026nbsp;mRNA expression\u0026nbsp;in recurrent GBM (rGBM) compared to primary GBM. (B) Survival analysis revealed that high TBC1D15 expression\u0026nbsp;is associated with\u0026nbsp;a poor prognosis\u0026nbsp;in\u0026nbsp;GBM patients. (C) CCK-8 assay showed changes in IC\u003csub\u003e50\u003c/sub\u003e values in resistant cells compared to their parental lines. (D) Western blot analysis\u0026nbsp;showed\u0026nbsp;upregulated TBC1D15 protein expression\u0026nbsp;in\u0026nbsp;TMZ-resistant\u0026nbsp;U251R and LN229R\u0026nbsp;cells\u0026nbsp;compared to\u0026nbsp;TMZ-sensitive\u0026nbsp;U251MG and LN229\u0026nbsp;cells. (E) IHC confirmed\u0026nbsp;higher TBC1D15 protein expression\u0026nbsp;in tumor tissues from\u0026nbsp;rGBM patients\u0026nbsp;compared to\u0026nbsp;primary GBM patients. (F) Proteomic\u0026nbsp;profiling identified differentially expressed proteins\u0026nbsp;between\u0026nbsp;U251R cells\u0026nbsp;transfected with\u0026nbsp;shNC\u0026nbsp;and\u0026nbsp;shTBC1D15. (G) KEGG and GO enrichment analyses\u0026nbsp;of differentially expressed proteins revealed\u0026nbsp;TBC1D15-associated pathways. (*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, n=3)\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/ab58c9ce00046e71126eb10f.png"},{"id":90463462,"identity":"1194e39a-3548-469c-8e4f-8e2ab58cc254","added_by":"auto","created_at":"2025-09-03 05:04:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":12552603,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of TBC1D15 suppresses TMZ resistance and malignant progression of GBM in vitro and in vivo. (A) Validation of stable TBC1D15 knockdown in TMZ-resistant U251R and LN229R cells (shTBC1D15). (B) Significantly reduced TMZ IC50 in shTBC1D15 cells vs. shNC by CCK-8 assay. (C) Impaired proliferative capacity of shTBC1D15 cells in colony formation assays. (D) Suppressed horizontal migration capacity in shTBC1D15 cells by wound healing assay. (E) Impaired vertical migration capacity in shTBC1D15 cells by Transwell assay. (F) Enhanced TMZ-induced apoptosis in shTBC1D15 cells by Western blot analysis of apoptosis-related proteins. (**\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, n=3). (G) In vivo experiments to validate the role of TBC1D15 in GBM malignant progression. (***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, n=5). (H) Elevated apoptosis in shTBC1D15 tumor tissues by H\u0026amp;E and IHC.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/aacdb0be615beed9149d4b3f.png"},{"id":90463470,"identity":"7f748831-f723-42a4-9939-21feb9a6cf78","added_by":"auto","created_at":"2025-09-03 05:04:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":12823172,"visible":true,"origin":"","legend":"\u003cp\u003e\u003ca href=\"#figure3\"\u003eInhibition of TBC1D15 suppresses the malignant progression of drug-resistant GBM by reducing Cx43 expression.\u003c/a\u003e (A) Proteomic profiling of shTBC1D15 cells identified downregulated Cx43 expression. (B) Western blot validation of Cx43 overexpression in TBC1D15-knockdown cells. (C) CCK-8 assay to detect changes in IC\u003csub\u003e50\u003c/sub\u003e of Cx43OE cells. (D) Colony formation assay to detect the proliferation ability of Cx43OE cells. (E) Transwell assay to detect the longitudinal migration ability of Cx43OE cells. (F) Wound healing assay to assess the lateral migration ability of Cx43OE cells. (G) Western blot analysis to assess changes in apoptosis levels in Cx43OE cells. (*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, n=3).\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/7f757d5289712bca045c3db4.png"},{"id":90464930,"identity":"e86217d4-9671-44d7-ac70-67b8081e7674","added_by":"auto","created_at":"2025-09-03 05:12:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":12001780,"visible":true,"origin":"","legend":"\u003cp\u003eTBC1D15 inhibition reduces Cx43 expression via transcriptional regulation. (A) GJA1 gene expression is positively correlated with TBC1D15 gene expression. (B) qPCR validation showed downregulation of Cx43 mRNA levels in shTBC1D15 cells. (C) IF confirmed that TFEB nuclear translocation promotes Cx43 expression. (D) CHIP experiments validate the binding of TFEB to the upstream region of the Cx43 promoter. (E) Western blot detected the level of TFEB nuclear translocation. (F) IF detected the level of TFEB nuclear translocation. (G) Western blot detected the level of mTOR activation and CaN expression. (*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, n=3).\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/38bdd6f8350b0c31a5289d01.png"},{"id":90463471,"identity":"9a641e80-0f52-4425-9b08-02bd86eeb0b3","added_by":"auto","created_at":"2025-09-03 05:04:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":10397829,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of TBC1D15 alters TFEB nuclear localization by prolonging MLC lysosomal calcium ion dynamics.(A) ShTBC1D15 induced prolonged MLC duration in GBM cells. (B) Cytosolic Ca²⁺ dynamics monitored by Fluo-4 AM probe. (C) Mitochondrial Ca²⁺ dynamics measured with Rhod-2 AM. (D) Western blot analysis of TFEB TFEB subcellular distribution treated with ionomycin or ML-SA1. (E) IF analysis of TFEB TFEB nuclear/cytoplasmic ratio treated with ionomycin or ML-SA1. (*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, n=3).\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/2d8a4e221456169430de41ab.png"},{"id":90463454,"identity":"b76a8324-aea4-4e1f-afbb-05103a53ba47","added_by":"auto","created_at":"2025-09-03 05:04:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":7178774,"visible":true,"origin":"","legend":"\u003cp\u003eDutasteride inhibits the malignant progression of GBM in vivo and in vitro by suppressing TBC1D15. (A) Predicted ligand-binding pocket of TBC1D15 and docking pose of dutasteride. (B) Drug-target interaction validated by CETSA. (C) Dose- and time-dependent effects of dutasteride on TMZ chemosensitivity. (D) In vivo efficacy of dutasteride + TMZ combination therapy (n=5 mice/group). (E) IHC detection of apoptotic proteins in xenografts (n=5 mice/group). (F) TBC1D15 and Cx43 expression after dutasteride treatment. (G) Western blot detection of apoptotic levels in GBM cells treated with Dutasteride combined with TMZ. (H) Cytosolic/nuclear fractionation analysis of TFEB translocation. (I) IF quantification of TFEB nuclear-to-cytoplasmic ratio. (*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, n=3).\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/9954405597367aefa46f674d.png"},{"id":90463456,"identity":"452498e6-743a-487d-9393-7d3044c4e663","added_by":"auto","created_at":"2025-09-03 05:04:22","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1239237,"visible":true,"origin":"","legend":"\u003cp\u003eModel summarising the role of TBC1D15 in temozolomide-resistant glioblastoma. The proposed model demonstrates that TBC1D15 inhibition prolongs mitochondria-lysosome contact (MLC) duration, thereby disrupting lysosomal Ca²⁺ dynamics to suppress TFEB nuclear translocation and ultimately downregulate Cx43 expression. Through preclinical models, this study characterizes dutasteride's capacity to reverse temozolomide resistance in GBM.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/44f5f425fcce5af3b0758213.png"},{"id":91879436,"identity":"658877d1-d4ed-48b0-97f6-2d4e7bfdfca1","added_by":"auto","created_at":"2025-09-22 14:52:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":55714854,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/a16a213d-b7a1-4465-b2d9-27fc72e83505.pdf"},{"id":90464925,"identity":"6ab99f3a-2c01-4757-8385-f9f60ce2a958","added_by":"auto","created_at":"2025-09-03 05:12:21","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":19045,"visible":true,"origin":"","legend":"Supplementary Figure legends","description":"","filename":"SupplementaryFigurelegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/bb5f4f6019d85fa1eacae9cb.docx"},{"id":90464929,"identity":"14adfe09-527d-499b-a4ed-6b5fea395534","added_by":"auto","created_at":"2025-09-03 05:12:22","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2323924,"visible":true,"origin":"","legend":"Supplementary Figure 1","description":"","filename":"SupplementaryFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/dd851deb5f0ed859dc5f8f71.tif"},{"id":90463458,"identity":"5d35092c-a524-430e-acc9-b13a68f8fbc3","added_by":"auto","created_at":"2025-09-03 05:04:22","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1122132,"visible":true,"origin":"","legend":"Supplementary Figure 2","description":"","filename":"SupplementaryFigure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/e0616fb88255c76514030ae5.tif"},{"id":90463468,"identity":"a4f48556-c9cb-4990-86d2-57519ecdd0fe","added_by":"auto","created_at":"2025-09-03 05:04:22","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":4362777,"visible":true,"origin":"","legend":"Full and uncropped western blot","description":"","filename":"Fullanduncroppedwesternblot.docx","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/8762e47cfce909c2cdf936c9.docx"},{"id":90463467,"identity":"5ad57d44-da43-4faa-8a40-7000ef45c7bb","added_by":"auto","created_at":"2025-09-03 05:04:22","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":19413,"visible":true,"origin":"","legend":"Top 4 FDA_drugs binding with TBC1D15","description":"","filename":"Top4FDAdrugsbindingwithTBC1D15.docx","url":"https://assets-eu.researchsquare.com/files/rs-7218795/v1/936148a0bc78f8eac1b2ab39.docx"}],"financialInterests":"(Not answered)","formattedTitle":"Targeting TBC1D15 Reverses TMZ-resistance in Glioblastoma by Modulating Lysosomal Ca²⁺/TFEB/Cx43 Axis via Mitochondria-Lysosome Contact","fulltext":[{"header":"BACKGROUND","content":"\u003cp\u003eGliomas are the most common malignant tumors of the central nervous system (CNS), with glioblastoma multiforme (GBM),\u0026nbsp;classified as a grade IV glioma, being the most prevalent and aggressive malignant brain tumor, accounting for approximately 57% of all gliomas and 48% of all primary CNS malignant tumors \u003csup\u003e[1]\u003c/sup\u003e. Clinical data show that the median survival time for GBM patients after standard treatment is only about 15 months, while tumor treating fields (TTFields) therapy in combination with standard care can extend median survival to approximately 20 months; the 5-year survival rate remains below 10% \u003csup\u003e[2, 3]\u003c/sup\u003e. Notably, approximately 40% of GBM patients develop resistance to temozolomide (TMZ) during chemotherapy, leading to treatment failure and tumor recurrence.\u003c/p\u003e\n\u003cp\u003eTMZ is the first-line chemotherapy drug for GBM. It exerts its cytotoxic effect by inducing methylation of the O⁶ position of guanine, forming O6-methylguanine (O6MeG)\u003csup\u003e[4]\u003c/sup\u003e, thereby triggering tumor cell apoptosis. O6-methylguanine-DNA methyltransferase (MGMT) is the enzyme responsible for repairing O6MeG in the human body. Previous studies have generally regarded high MGMT expression (typically associated with an unmethylated MGMT promoter) as the core mechanism underlying GBM resistance \u003csup\u003e[5-7]\u003c/sup\u003e. However, emerging evidence indicates that some GBM patients with a methylated MGMT promoter remain resistant to TMZ, especially in recurrent GBM patients\u003csup\u003e[8]\u003c/sup\u003e. This suggests the existence of more diverse and complex resistance mechanisms, such as abnormal protein expression, enhanced DNA damage repair, promotion of drug efflux, tumor microenvironment, and glioblastoma stem cells \u003csup\u003e[9-14]\u003c/sup\u003e. Therefore, elucidating the multifaceted mechanisms of TMZ resistance in GBM and identifying novel therapeutic targets to overcome it are critical for developing more effective treatment strategies.\u003c/p\u003e\n\u003cp\u003eTBC1 domain family member 15 (TBC1D15) belongs to the TBC (Tre-2/Bub2/Cdc16) domain family and acts as a GTPase-activating protein (GAP) for Rab7 \u003csup\u003e[15]\u003c/sup\u003e. Additionally, it regulates the dynamic process of mitochondria-lysosome contact (MLC), playing a crucial role in cellular homeostasis regulation\u003csup\u003e[16, 17]\u003c/sup\u003e. It has been reported that, by influencing MLC, TBC1D15 is associated with Parkinson's disease, seizures, myocardial ischemia/reperfusion injury, and Ca²⁺ transport from lysosomes to mitochondria\u003csup\u003e[18-22]\u003c/sup\u003e. Our findings demonstrate that TBC1D15-induced alterations in lysosomal calcium signaling impair TFEB entry into the nucleus. Notably, databases show that TBC1D15 is abnormally overexpressed in recurrent glioblastoma (rGBM), but whether it contributes to TMZ resistance remains unreported.\u003c/p\u003e\n\u003cp\u003eGap junction protein 43 (connexin 43, Cx43) is the most widely distributed member of its multigene family. Although some studies have shown that Cx43 expression decreases with increasing GBM grade, others demonstrate its upregulation in TMZ-resistant GBM \u003csup\u003e[23, 24]\u003c/sup\u003e and promote TMZ efflux, counteracting apoptosis pathways, through MGMT-independent mechanisms \u003csup\u003e[25, 26]\u003c/sup\u003e. Our previous work also demonstrated that Cx43 is upregulated in exosomes derived from TMZ-resistant GBM cells and promotes both TMZ resistance and angiogenesis\u003csup\u003e[27, 28]\u003c/sup\u003e. However, the exact mechanism by which Cx43 is upregulated in drug-resistant GBM and influences GBM drug resistance remains unclear. We hypothesize that TBC1D15 downregulates Cx43 by prolonging MLC-mediated lysosomal Ca\u003csup\u003e2+\u003c/sup\u003e dynamics and reducing TFEB nuclear translocation, thereby increasing GBM sensitivity to TMZ.\u003c/p\u003e\n\u003cp\u003eThis study established that TBC1D15 drives\u0026nbsp;GBM chemotherapy resistance. Targeting TBC1D15 suppressed the malignant progression of GBM by impairing TFEB-promoted Cx43 transcription through prolonging MLC and disrupting lysosomal Ca\u003csup\u003e2+\u003c/sup\u003e dynamics. These findings highlight the potential role of TBC1D15 as a drug target for GBM therapy.\u003c/p\u003e"},{"header":" RESULTS","content":"\u003cp\u003e\u003cstrong\u003eTBC1D15 is highly expressed in TMZ-resistant GBM cells and tissues and correlates with malignancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of TBC1 domain family member 15 (TBC1D15) is associated with the malignancy of glioblastoma multiforme (GBM). We first analyzed TBC1D15 mRNA expression levels in primary GBM and recurrent GBM (rGBM) patients using the CGGA database. Bioinformatics analysis revealed that rGBM patients exhibited significantly higher TBC1D15 mRNA expression levels (Figure 1A). Survival analysis further indicated that higher TBC1D15 expression served as an adverse prognostic factor for GBM patients (Figure 1B). To investigate the underlying resistance mechanisms, we established TMZ-resistant U251MG and LN229 cell lines (U251R and LN229R) using a concentration gradient method (Figure 1C). We also detected TMZ-sensitive and resistant GBM cells, as well as tumor tissues from GBM and rGBM patients, via Western blot and immunohistochemistry (IHC) experiments. The results showed that TMZ-resistant cells and rGBM patients had elevated TBC1D15 expression levels (Figures 1D, E). Additionally, we knocked down TBC1D15 in U251R cells and conducted a proteomic profiling analysis. Among the over 3,000 proteins identified, 756 proteins showed differential expression (Figure 1F). KEGG and GO enrichment analyses of these differentially expressed proteins subsequently revealed that TBC1D15 is closely associated with apoptosis, lysosomal membrane, and calcium ion transport into mitochondria (Figure 1G).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition of TBC1D15 suppresses TMZ resistance and malignant progression of GBM in vitro and in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo elucidate the mechanism underlying TBC1D15-mediated TMZ resistance in GBM, we established stable TBC1D15-knockdown U251R and LN229R cell lines (U251R/TBC1D15KD, LN229R/TBC1D15KD) (Supplementary Figure 1A, Figure 2A), and quantified TMZ sensitivity via CCK-8 assays. TBC1D15 knockdown significantly reduced TMZ IC\u003csub\u003e50\u003c/sub\u003e values (Figure 2B). Colony formation assay revealed that inhibition of TBC1D15 attenuated the proliferative capacity of GBM cells (Figure 2C). Wound healing assays and Transwell assays indicated that TBC1D15 depletion suppressed the migration capacity of GBM cells (Figures 2D, E). Given that KEGG and GO enrichment results linked TBC1D15 to apoptosis, we assessed the apoptotic changes of GBM cells post-knockdown. Results showed that under the same TMZ concentration, inhibiting TBC1D15 activated the apoptosis pathway more effectively (Figure 2F). In murine subcutaneous tumor models, TBC1D15 knockdown enhanced the sensitivity of GBM cells to TMZ, as evidenced by the reduced tumor volume and increased Cleaved Caspase-3 expression in tumors (Figure 2G, H). Collectively, these findings indicated that inhibiting TBC1D15 reverses GBM resistance to TMZ and malignant progression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition of TBC1D15 suppresses the malignant progression of drug-resistant GBM by reducing Cx43 expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBuilding on our prior findings that exosomal Cx43 elevation in TMZ-resistant GBM cells enhances resistance and angiogenesis in sensitive cells, proteomics revealed Cx43 downregulation upon TBC1D15 knockdown (Figure 3A). These findings led us to hypothesize that TBC1D15 may influence the malignant progression of GBM cells by affecting Cx43. To test this, we overexpressed Cx43 (Cx43OE) in TBC1D15-knockdown cells (Figure 3B) and assessed malignant phenotypes. CCK-8 assays indicated that Cx43OE partially restored the IC\u003csub\u003e50\u003c/sub\u003e of TMZ-sensitive GBM cells in TBC1D15-knockdown cells (Figure 3C). Similarly, colony formation assays indicated that Cx43OE partially restored the proliferation capacity of TBC1D15-knockdown GBM cells (Figure 3D), and wound healing assay as well as Transwell assay results confirmed partial rescue of migratory ability (Figure 3E, F). Western blot analysis of apoptosis-related proteins revealed reduced apoptosis (Figure 3G). Collectively, these results demonstrate that inhibition of TBC1D15 attenuates GBM malignancy through Cx43-mediated mechanisms, at least partially.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTBC1D15 inhibition reduces Cx43 expression via transcriptional regulation \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the mechanism underlying the downregulation of Cx43 expression by TBC1D15 knockdown, we first analyzed the correlation between TBC1D15 and the Cx43 gene (GJA1). The results showed that TBC1D15 expression was positively correlated with GJA1 expression (Figure 4A). Consistently, GJA1 is highly expressed in rGBM patients, and survival analysis also showed that high levels of GJA1 are an adverse prognostic factor for GBM patients (Supplementary Figure 2A). Furthermore, knockdown of TBC1D15 led to a downregulation of Cx43 mRNA levels (Figure 4B). Since our previous studies demonstrated that the transcription factor EB (TFEB) binds to the upstream region of the GJA1 promoter, we confirmed this binding using CHIP experiments. (Figure 4D) Additionally, IF results demonstrated that nuclear translocation of TFEB promotes Cx43 expression (Figure 4C). We next investigated the effects of TBC1D15 knockdown on TFEB. While total TFEB expression showed no significant change upon TBC1D15 knockdown, subcellular fractionation revealed that nuclear localization of TFEB was reduced (Figure 4E), a finding that aligns with the IF results demonstrating impaired nuclear translocation (Figure 4F). TFEB nuclear localization is primarily regulated by mTOR and calcineurin (CaN), so we performed Western blot analysis of mTOR and CaN expression. The results showed that the mTOR activation remained unchanged after inhibiting TBC1D15, whereas CaN expression was downregulated (Figure 4G). These findings indicate that TBC1D15 knockdown reduces Cx43 transcription by inhibiting TFEB nuclear translocation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e Inhibition of TBC1D15 modulates lysosomal Ca\u003csup\u003e2+\u003c/sup\u003e dynamics by prolonging MLC, thereby altering the nuclear localization of TFEB\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCaN is a calcium-dependent phosphatase whose activity requires Ca\u003csup\u003e2+\u003c/sup\u003e. Lysosomal Ca\u0026sup2;⁺ efflux through TRPML1 channels induces CaN activation. Prior studies indicated that TBC1D15 knockdown extended MLC duration, promoting TRPML1-dependent Ca\u0026sup2;⁺ transfer to mitochondria, through VDAC1 and MCU channels, ultimately elevating mitochondrial Ca\u0026sup2;⁺ levels. Therefore, we hypothesized that TBC1D15 knockdown may reduce lysosomal Ca\u0026sup2;⁺ efflux to the cytosol, dampening CaN activation and suppressing TFEB nuclear translocation.\u003c/p\u003e\n\u003cp\u003eTo test this, we first performed live imaging of GBM cells co-stained with MitoTracker and LysoTracker. Confocal microscopy analysis revealed that TBC1D15 inhibition significantly prolonged MLC duration in GBM cells (Figure 5A). Subsequently, we measured cytosolic Ca\u0026sup2;⁺ dynamics using Fluo-4 AM. Cells treated with ML-SA1 (a TRPML1 agonist) showed no significant change in cytosolic Ca\u0026sup2;⁺ levels upon TBC1D15 knockdown (Figure 5B). In contrast, Rhod-2 AM staining demonstrated that ML-SA1 treatment induced significantly higher mitochondrial Ca\u0026sup2;⁺ accumulation in TBC1D15-knockdown cells. (Figure 5C). These results confirmed that TBC1D15 knockdown enhances lysosomal Ca\u0026sup2;⁺ flux transfer into mitochondria without altering cytosolic Ca\u0026sup2;\u003cstrong\u003e⁺\u003c/strong\u003e. To determine whether this Ca\u0026sup2;⁺ redistribution affects CaN-mediated TFEB translocation, shNC and TBC1D15KD cells were subjected to (1) DMSO (vehicle control), (2) ML-SA1 (to activate lysosomal Ca\u0026sup2;⁺ release), and (3) Ionomycin (a Ca\u0026sup2;⁺ ionophore), which bypasses lysosomal Ca\u0026sup2;⁺ release and directly elevates cytosolic Ca\u0026sup2;⁺ level. TFEB nuclear translocation was assessed by Western blotting and immunofluorescence. The results showed that Ionomycin rescued nuclear translocation of TFEB in both shNC and TBC1D15KD groups, whereas ML-SA1 promoted nuclear translocationof TFEB in the shNC cells exclusively but not the TBC1D15KD cells (Figure 5D, E). These findings indicated that TBC1D15 knockdown impairs CaN activation and suppresses TFEB nuclear entry by prolonging MLC, thereby diverting lysosomal Ca\u0026sup2;⁺ toward mitochondria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDutasteride inhibits the malignant progression of GBM in vitro and in vivo by suppressing TBC1D15\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur studies revealed that TBC1D15 is upregulated in TMZ-resistant GBM tissues and cells. Mechanistically, TBC1D15 knockdown promotes lysosomal Ca\u0026sup2;⁺ flux transport into mitochondria, attenuates CaN activation, thus impairing TFEB nuclear translocation, ultimately reducing Cx43 transcription and sensitizing GBM cells to TMZ. Therefore, we aimed to identify a drug that can specifically inhibit TBC1D15. We obtained the structural information of the TBC1D15 protein from the UniProt database and predicted its active pockets using the Cavity Plus website (Figure 6A). Subsequently, we performed virtual screening of FDA-approved drugs via AutoDock Vina, and selected the top four candidates by binding energy for functional validation. Key findings demonstrate that dutasteride synergized with TMZ to overcome chemoresistance in CCK-8 assays (Figure 6C), with molecular docking predicting hydrogen bonding between dutasteride and Arg403 of TBC1D15 (Figure 6A). Cellular Thermal Shift Assay (CETSA) confirmed the binding between dutasteride and TBC1D15 (Figure 6B). Critically, dutasteride recapitulated the molecular consequences of TBC1D15 knockdown through coordinated downregulation of Cx43 expression, induction of pro-apoptotic proteins (Figure 6F, G), and suppression of TFEB nuclear translocation(Figure 6H, I)\u003cstrong\u003e.\u003c/strong\u003e In vivo experiments demonstrated that the combination of dutasteride and TMZ effectively reduced tumor volume and enhanced the expression of cleaved caspase-3 in xenograft models (Figure 6D, E). These findings establish that dutasteride overcomes TMZ resistance in GBM by inhibiting TBC1D15 both in vivo and in vitro.\u003c/p\u003e"},{"header":" DISCUSSION","content":"\u003cp\u003eSince the FDA approved TMZ as a first-line GBM chemotherapy drug in 2005, treatment progress has been slow. Currently, in addition to standard treatment regimens, only bevacizumab, lomustine, BRAF inhibitors, and tumor-targeting electric fields have been approved by the FDA. After standard treatment, the median survival time for GBM patients is approximately 15 months, with a 5-year survival rate of about 9.8%. Combining TTFields with standard therapy extends median overall survival to 20.9 months, and chemotherapy remains one of the key adjunctive treatments for GBM. However, a significant number of patients develop resistance to TMZ chemotherapy, and the lack of other effective chemotherapy drugs further complicates the treatment of GBM. Conducting in-depth research into the mechanisms of chemotherapy resistance in GBM, identifying new potential therapeutic targets and drugs, and implementing personalized treatment strategies tailored to individual patients are critical to improving treatment outcomes.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;In this study, we identify TBC1D15 as a potential novel oncogene in GBM. Targeting and inhibiting TBC1D15 may benefit patients with TMZ-resistant GBM during treatment. As a member of the TBC protein family, TBC1D15 contains a conserved TBC domain and functions as a GTPase-activating protein (GAP) for RAB7, catalyzing the hydrolysis of RAB7-GTP to RAB7-GDP\u003csup\u003e[15]\u003c/sup\u003e.\u0026nbsp;The mitochondrial-lysosomal contact (MLC) phenomenon, discovered by Wong et al\u003csup\u003e[16, 17]\u003c/sup\u003e, is mediated by RAB7-GTP docking. Fis1 recruits cytoplasmic TBC1D15 to the MLC sites,\u0026nbsp;where it hydrolyzes RAB7-GTP to RAB7-GDP, triggering MLC dissociation. Additionally, TBC1D15 plays a role in various diseases, such as acute myocardial infarction, myocardial ischemia/reperfusion, Parkinson's disease, epilepsy, and others. MLC sites facilitate the exchange of molecules and ions between mitochondria and lysosomes. For example, when MLC occurs, \u0026nbsp;Ca²⁺ can traverse lysosomal TRPML1 channels, mitochondrial outer membrane VDAC1, and inner membrane MCU channels to increase mitochondrial Ca²⁺ concentration \u003csup\u003e[22]\u003c/sup\u003e. A few studies have reported that TBC1D15 is an oncogene in tumors. For example, the interaction between TBC1D15 and NOTCH proteins promotes the self-renewal of tumor-initiating cells (TICs), and interfering with the TBC1D15-NOTCH1 interaction reduces TIC growth and may improve cancer treatment outcomes \u003csup\u003e[29]\u003c/sup\u003e. Additionally, a study identified characteristic miRNAs for the early detection of laryngeal squamous cell carcinoma and suggested that TBC1D15 may be one of the downstream proteins regulated by these miRNAs\u003csup\u003e[30]\u003c/sup\u003e, but its role in TMZ resistance in GBM has not been reported. This study found that TBC1D15 influences lysosomal Ca\u003csup\u003e2+\u003c/sup\u003e dynamics by regulating MLC, thereby reducing TFEB nuclear translocation, lowering Cx43 expression, and affecting the resistance of drug-resistant GBM cells to TMZ.\u003c/p\u003e\n\u003cp\u003eTFEB is a basic helix-loop-helix/leucine zipper (bHLH-Zip) type transcription factor belonging to the MiT/TFE family (including MiTF, TFE3, and TFE2). It is a master regulatory protein in the autophagy-lysosome pathway and is involved in cellular metabolism and stress responses. The subcellular localization of TFEB is phosphorylation-dependent: \u0026nbsp;mTORC1 phosphorylates TFEB at the S122, S142, and Ser211 sites, promoting TFEB binding with 14-3-3 proteins and retention in the cytoplasm\u003csup\u003e[31]\u003c/sup\u003e. During nutrient deprivation, oxidative stress, or mitochondrial damage, TFEB is dephosphorylated and enters the nucleus to drive target gene transcription. TFEB dephosphorylation is primarily mediated by CaN and occurs downstream of mTORC1. CaN consists of a catalytic subunit and a calcium-dependent subunit, and its activity is influenced by Ca\u003csup\u003e2+\u003c/sup\u003e concentration\u003csup\u003e[32]\u003c/sup\u003e. Previous studies have shown that CaN can respond to calcium signals from the lysosomal TRPML1 channel, leading to TFEB dephosphorylation and promoting its nuclear translocation \u003csup\u003e[33, 34]\u003c/sup\u003e. In this study, TBC1D15 knockdown prolonged MLC, promoted mitochondrial calcium uptake into lysosomes,\u0026nbsp;impaired CaN activation, and consequently decreased TFEB nuclear translocation. These findings align with Barazzuol et al. \u003csup\u003e[35]\u003c/sup\u003e, who reported that α-synuclein reduces MLC and decreases mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e uptake, thereby increasing TFEB nuclear translocation.\u003c/p\u003e\n\u003cp\u003eReduced TFEB nuclear translocation leads to downregulation of its downstream target gene expression, including GJA1\u0026nbsp;(encoding Cx43)\u003csup\u003e[36]\u003c/sup\u003e. Putative TFEB binding sites upstream of the GJA1 promoter were identified using UCSC and JASPAR databases. Cx43 may play a dual role in glioma development and metastasis: On the one hand, Cx43 expression decreases with increasing glioma grade, while increased Cx43 expression on cancer cells enhances their permeability to chemotherapeutic drugs \u003csup\u003e[37]\u003c/sup\u003e. On the other hand, some studies have shown that Cx43 mediates tumor microtubule (TM)-related multicellular communication by forming gap junctions in brain tumor cells; knocking down Cx43 reduces the proportion of TM-connected cells, thereby decreasing tumor growth and resistance to radiotherapy \u003csup\u003e[38]\u003c/sup\u003e; downregulating Cx43 blocks the serial connection between astrocytes and glioma cells, increasing their sensitivity to TMZ\u003csup\u003e[39]\u003c/sup\u003e; our study and others have shown that Cx43 is highly expressed in GBM cells resistant to TMZ, and inhibiting Cx43 (such as α-CT1) can enhance GBM sensitivity to TMZ\u003csup\u003e[24, 28, 40]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eBased on the mechanisms mentioned above, identifying new strategies targeting TBC1D15 or its downstream pathways is key to overcoming drug resistance. Previous studies have shown that gender significantly influences the incidence and prognosis of GBM, with male incidence rates being 1.6 times higher than those of females. An epidemiological surveillance study indicated that female GBM patients have longer survival times than males,\u0026nbsp;though this survival advantage disappears after menopause\u003csup\u003e[41]\u003c/sup\u003e. Postmenopausal women also exhibit a higher GBM risk than premenopausal women. Some attribute this to estrogen’s protective effect against GBM, while others suggest estrogen exposure mitigates androgen-related adverse effects\u003csup\u003e[42]\u003c/sup\u003e. Regardless, upregulation of the androgen receptor (AR) does promote GBM development, and testosterone levels are elevated in GBM patients\u003csup\u003e[43, 44]\u003c/sup\u003e. Dutasteride is a potent, selective dual-action 5α-reductase inhibitor that inhibits both isoenzymes (Type I and Type II) of 5α-reductase, thereby preventing the conversion of testosterone into dihydrotestosterone (DHT), reducing DHT levels in prostate tissue and serum. In 2007, the US FDA approved dutasteride for the treatment of androgenetic alopecia (AGA). Clinical studies have shown its efficacy to be superior to finasteride and significantly improved treatment outcomes for AGA in patients who did not respond clinically to finasteride\u003csup\u003e[45, 46]\u003c/sup\u003e. Another study evaluated the preventive effect of dutasteride on prostate cancer (PCa) in patients with high-grade prostatic intraepithelial neoplasia (HGPIN), but the results showed that continuous use of dutasteride for 3 years did not reduce the detection rate of PCa, nor did it increase the detection rate of PCa in HGPIN patients \u003csup\u003e[47, 48]\u003c/sup\u003e. Notably, clinical use of dutasteride as adjuvant tumor therapy remains unexplored.\u003c/p\u003e\n\u003cp\u003eIn conclusion, our study demonstrated that TBC1D15 serves as an oncogene in GBM. Targeting TBC1D15 interfered with the lysosomal Ca\u003csup\u003e2+\u003c/sup\u003e dynamics and reduced the nuclear translocation of TFEB, leading to the downregulation of Cx43. Thus, improve the sensitivity of GBM to TMZ. The combination of dutasteride and TMZ can inhibit GBM in vitro and vivo, with the inhibitory effect associated with its impact on the TBC1D15 protein. This provides new experimental evidence and translational insights for utilizing the “old drug” dutasteride to target the TBC1D15 pathway and overcome TMZ resistance in GBM.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003eClinical glioma patient samples\u003c/p\u003e\n\u003cp\u003eThis study enrolled 4 patients with recurrent GBM who received TMZ treatment before their second surgery and 12 patients with primary GBM who did not receive TMZ treatment. Tissue samples were stored in liquid nitrogen. All samples used in the experiment were obtained with informed consent from the patients and were approved by the Ethics Committee of The First Affiliated Hospital of Nanchang University. (IIT2025260)\u003c/p\u003e\n\u003cp\u003eCell culture and establishment of TMZ-resistant cell lines\u003c/p\u003e\n\u003cp\u003eHuman glioma cell lines U251MG and LN229 (purchased from ATCC) were cultured at 37 \u0026deg;C in a humidified incubator containing 5% CO₂, using DMEM medium (11995, Solarbio, Beijing, China) supplemented with 10% fetal bovine serum (FSD500, ExCell Bio, Suzhou, China). Stable TMZ-resistant U251MG and LN229 glioma cells were generated through gradient induction and named U251R cells and LN229R cells, respectively. TMZ (S1237, Selleck, Shanghai, China) was dissolved in DMSO and stored at -80 \u0026deg;C. U251MG cells and LN229 cells were exposed to TMZ, with the concentration gradually increased. Cells were exposed to each dose for three generations, with the entire induction process lasting 6 months.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;H\u0026amp;E and Immunohistochemistry (IHC) Staining\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Tissues were fixed, paraffin-embedded, sectioned, deparaffinized, and subsequently immersed in xylene three times for 10 min each, graded in ethanol (100%, 95%, 85%, 70%), and phosphate-buffered saline (PBS, P1020, Solarbio, Beijing, China), hydrated for 5 min each for H\u0026amp;E staining. For IHC, EDTA was used for antigen repair, and 0.3% hydrogen peroxide was used to block endogenous peroxidase. Goat serum (AR0009, Boster, Wuhan, China) was used for containment at 37 \u0026deg;C for 30 min. Anti-TBC1D15 (ab121396, 1:50 dilution, Abcam, Cambridge, UK) and anti-Cleaved Caspase-3 (TA7022, 1:100 dilution, Abmart, Shanghai, China) antibodies were incubated with the tissues at 4 ℃ overnight. Horseradish peroxidase (HRP)-labeled goat anti-mouse/rabbit IgG (H + L) (SA00001-1/SA00001-2, Proteintech, Wuhan, China) was blended into paraffin sections for secondary antibody conjugation, and DAB (DA1010, Solarbio, Beijing, China) was used for color development. Nuclei were stained with hematoxylin for 3 min. samples were washed in graded ethanol (70%, 85%, 95%, 100%) and xylene solutions and sealed with neutral resin. Immunohistochemical staining was assessed using inverted fluorescence microscopy (Model\u0026nbsp;DMi8,\u0026nbsp;Leica Microsystems, Wetzlar, Germany).\u003c/p\u003e\n\u003cp\u003eWestern blot (WB) analysis\u003c/p\u003e\n\u003cp\u003eProteins were extracted from cells and patient tissues using RIPA lysis buffer (P0013B, Beyotime, Shanghai, China), and protein concentrations were quantified using the BCA protein assay kit (P0010, Beyotime, Shanghai, China). Proteins were separated by SDS-PAGE and transferred to a 0.45 \u0026mu;m PVDF membrane (IPVH00010, Millipore, Schwalbach, Germany). The membrane was incubated at room temperature for 1 h in 5% non-fat milk-containing TBS-Tween 20 (TBST) blocking solution, followed by incubation with the primary antibody at 4 \u0026deg;C overnight. The secondary antibody (SA00001-1/SA00001-2, 1:5000 dilution, Proteintech, Wuhan, China) was then incubated at room temperature for 1 h. Finally, the membranes were exposed to an enhanced chemiluminescence (PK10001, Proteintech, Wuhan, China) reagent for imaging and analyzed using ImageJ software. The primary antibodies used were TBC1D15 (ab121396, 1:1000 dilution, Abcam, Cambridge, UK); Cx43 (sc-59949, 1:250 dilution, Santa Cruz, CA, USA); Bax (T40051, 1:1000 dilution, Abmart, Shanghai, China); TFEB (13116, 1:1000 dilution, Cell Signaling Technology, Boston, USA); Bcl-2 (381702, 1:1000 dilution, Zenbio, Chengdu, China); Caspase-3 (TA6311, 1:1000 dilution, Abmart, Shanghai, China); Cleaved caspase-3 (TA7022, 1:1000 dilution, Abmart, Shanghai, China); CaN (YA2508, 1:1000 dilution, \u0026nbsp; MCE, NJ, USA); mTOR ( 66888-1-Ig, 1:1000 dilution, Proteintech, Wuhan, China); p-mTOR (67778-1-Ig, 1:1000 dilution, Proteintech, Wuhan, China); \u003cem\u003e\u0026beta;\u003c/em\u003e-Tubulin (10094-1-AP, 1:2000 dilution, Proteintech, Shanghai, China); and GAPDH (60004-1-Ig, 1:50,000 dilution, Proteintech, Wuhan, China).\u003c/p\u003e\n\u003cp\u003eRNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from GBM cells using TRIzol reagent (15596018CN, Invitrogen, CA, USA) according to the manufacturer\u0026apos;s instructions. The concentration of total RNA was quantified using an Evolution 350 spectrophotometer (840-310800, Thermo Fisher Scientific, MA, USA). Reverse transcription was performed using the PrimeScript reverse transcription kit (containing gDNA removal agent) (RR047A, TaKaRa, Kusatsu, Japan). QPCR experiments were conducted using the TB Green\u0026reg; Premix Ex Taq quantitative PCR kit (Tli RNaseH Plus) (RR420A, TaKaRa, Kusatsu, Japan). For each sample, gene expression levels were normalized using \u003cem\u003eGAPDH\u003c/em\u003e as an internal reference and calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;ct\u003c/sup\u003e formula. The primers used were as follows (Table 1):\u003c/p\u003e\n\u003cp\u003eTable 1. Sequences for \u003cem\u003eGJA1\u003c/em\u003e(Gene name of Cx43)\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"567\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.6763%;\"\u003e\n \u003cp\u003ePrimer names\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57.3237%;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.6763%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003cem\u003eGJA1\u003c/em\u003e promoter forward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57.3237%;\"\u003e\n \u003cp\u003e5\u0026apos;-CTCTCGCCTATGTCTCCTCCTG-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 42.6763%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003cem\u003eGJA1\u0026nbsp;\u003c/em\u003epromoter reverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57.3237%;\"\u003e\n \u003cp\u003e5\u0026apos;-TCACTTGCTTGCTTGTTGTAATTGC-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;Live cell time-lapse imaging\u003c/p\u003e\n\u003cp\u003eLive cells were imaged using an Olympus confocal microscope (FV4000, Olympus Corporation, Tokyo, Japan). For mitochondria-lysosome contact, cells were incubated with Lyso-Tracker Green DND-26 (lysosomes, green) (40738ES50, Yeasen, Shanghai, China) for 2 h and with Mito-Tracker Red (mitochondria, red) (40741ES50, Yeasen, Shanghai, China) for 30 min at concentrations of 50 nM and 100 nM, respectively, following the manufacturer\u0026apos;s instructions. Images were recorded at 561 nm for Mito-Tracker Red and at 488 nm for Lyso-Tracker Green DND-26. Image analysis was performed using Olympus software. For Ca\u0026sup2;⁺ detection, cells were treated with Fluo-4 AM (40704ES50, Yeasen, Shanghai, China) or Rhod-2 AM (40776ES50, Yeasen, Shanghai, China) for 15 min at a concentration of 0.5 \u0026mu;M. Cells were then washed with HBSS and incubated in a cell culture incubator for an additional 30 min. ML-SA1 was then added, and cells were immediately placed under a microscope for live-cell time-lapse imaging.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Plasmids and viral transfections\u003c/p\u003e\n\u003cp\u003eLentiviruses carrying shRNA-TBC1D15 or shRNA-NC and human full-length GJA1 or empty plasmid were purchased from Genechem (Shanghai, China) and were used for stable knockdown of TBC1D15 and overexpression of Cx43, respectively, while the empty plasmid served as a control. U251R cells and LN229R cells were treated with lentiviral particles as controls. U251R cells and LN229R cells were treated with lentiviral particles for 72 h and selected using puromycin (2 \u0026mu;g/mL). To overexpress Cx43, cells were transfected with the overexpression plasmid or empty plasmid using the Lipofectamine 3000 kit (L3000015, Invitrogen, CA, USA). The primers used are shown in the table below (Table 2):\u003c/p\u003e\n\u003cp\u003eTable 2. Sequences for shRNA\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"567\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNO.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u0026rsquo;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 160px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSTEM\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLoop\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSTEM\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e3\u0026rsquo;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003eshTBC1D15 -1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eCCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 160px;\"\u003e\n \u003cp\u003eGCGATCCCTCTACACATCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003eCTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003eGTTGATGTGTAGAGGGATCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003eTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003eshTBC1D15 -1-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eAATTCAAAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 160px;\"\u003e\n \u003cp\u003eGCGATCCCTCTACACATCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003eCTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003eGTTGATGTGTAGAGGGATCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003eshTBC1D15 -2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eCCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 160px;\"\u003e\n \u003cp\u003eGCAAGCATGGAAATTTCTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003eCTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003eAGAAGAAATTTCCATGCTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003eTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003eshTBC1D15 -2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eAATTCAAAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 160px;\"\u003e\n \u003cp\u003eGCAAGCATGGAAATTTCTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003eCTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003eAGAAGAAATTTCCATGCTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003eshTBC1D15 -3-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eCCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 160px;\"\u003e\n \u003cp\u003eGAAATCCATCAGCCAGGAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003eCTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003eTGTTCCTGGCTGATGGATTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003eTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003eshTBC1D15 -3-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eAATTCAAAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 160px;\"\u003e\n \u003cp\u003eGAAATCCATCAGCCAGGAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003eCTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003eTGTTCCTGGCTGATGGATTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;CCK-8 assay and drug treatment\u003c/p\u003e\n\u003cp\u003eCCK-8 reagent (40203ES76, Yeasen, Shanghai, China) was used to assess the viability of GBM cells. GBM cells were seeded at a density of 3\u0026times;10\u0026sup3; cells per well in a 96-well plate and incubated with 100 \u0026mu;L of DMEM containing 10% FBS. Cells were allowed to adhere under conditions of 37 \u0026deg;C for 12 h, followed by treatment with different concentrations of TMZ or DMSO. After 72 h of culture, 10 \u0026mu;L of CCK-8 solution was added to each well, and measurements were taken after 2 h. Absorbance (OD value) was measured at 450 nm using a microplate reader (VLBLATGD2, Thermo Fisher Scientific, MA, USA).\u003c/p\u003e\n\u003cp\u003eColony Formation Assay\u003c/p\u003e\n\u003cp\u003eColony formation assays were used to assess the proliferative capacity of cells. Log-phase GBM cells were digested with trypsin, resuspended, and seeded in 6-well plates (3 \u0026times; 10\u0026sup3; cells/well). The cells were cultured in a humidified incubator at 37\u0026deg;C with 5% CO₂ for 10 days, with medium changes every 3 days. The cells were gently washed with PBS, fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.1% crystal violet (Y268091, Beyotime, Shanghai, China) solution for 20 minutes. Photographs were taken, and the cells were counted using ImageJ software.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Wound healing and Transwell assay\u003c/p\u003e\n\u003cp\u003eCell migration ability was measured using a wound healing assay. Cells were seeded in 6-well plates and cultured to 100% confluence, then scratched using a 200 \u0026mu;L pipette tip. Cells were cultured in serum-free DMEM for further studies. Images were captured at 0 h, 24 h, and 48 h using an inverted microscope (Model\u0026nbsp;DMi8,\u0026nbsp;Leica Microsystems, Wetzlar, Germany), and the wound area was analyzed using ImageJ software.\u003c/p\u003e\n\u003cp\u003ePerform Transwell migration assays using Transwell chambers (353095, Falcon, MA, USA) in 24-well plates (3738, Corning, MA, USA). Suspend cells in 200 \u0026mu;L serum-free DMEM (2.5 \u0026times; 10⁵) and place them in the upper chamber. Then, 600 \u0026mu;L of DMEM containing 10% FBS was added to the lower chamber. After incubating at 37 \u0026deg;C for 24 h, cells were fixed with paraformaldehyde, stained with 0.1% crystal violet solution for 20 min, and counted under an inverted microscope. The average cell count from five randomly selected fields of view under the inverted microscope was calculated and analyzed using ImageJ software.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Immunofluorescence Assay\u003c/p\u003e\n\u003cp\u003eCells cultured in confocal culture dishes were fixed with 4% paraformaldehyde and treated with 0.3% Triton X-100 (ST1723, Beyotime, Shanghai, China) for 15 min, then blocked with goat serum at 37\u0026deg;C for 30 min. The primary antibody was incubated at 4\u0026deg;C overnight, followed by incubation with a fluorescent secondary antibody (SA00013-2, Proteintech, Wuhan, China) at 37\u0026deg;C for 1 hour. Finally, the cells were stained with DAPI (AR1176, Boster, Wuhan, China) containing an anti-quenching reagent. Microscopic images were obtained using a Nikon confocal microscope (A1 HD25, Nikon, Tokyo, Japan) (three fields of view from three independent experiments per group) and further analyzed using ImageJ.\u003c/p\u003e\n\u003cp\u003eChromatin Immunoprecipitation (ChIP) Kit\u003c/p\u003e\n\u003cp\u003eChromatin immunoprecipitation (ChIP) was performed using a ChIP kit (9003S, Cell Signaling Technology, Boston, USA) according to the manufacturer\u0026rsquo;s protocol. Cells were lysed, chromatin was collected, and enzymatically fragmented. Chromatin was immunoprecipitated using a ChIP-grade antibody against TFEB (13116, 1:50 dilution, Cell Signaling Technology, Boston, USA). After immunoprecipitation, reverse the protein-DNA crosslinks, purify the DNA, amplify by PCR, and perform agarose gel electrophoresis. The table below lists the primers used (Table 3):\u003c/p\u003e\n\u003cp\u003eTable 2. ChIP sequences for \u003cem\u003eGJA1\u003c/em\u003e(Gene name of Cx43)\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"567\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 265px;\"\u003e\n \u003cp\u003e\u0026nbsp;Primer names\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 288px;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 265px;\"\u003e\n \u003cp\u003e\u003cem\u003eGJA1\u003c/em\u003e promoter forward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 288px;\"\u003e\n \u003cp\u003e\u0026nbsp;5\u0026apos;-GGAGCATCACTGAAGCCTGT-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 265px;\"\u003e\n \u003cp\u003e\u003cem\u003eGJA1\u003c/em\u003e promoter reverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 288px;\"\u003e\n \u003cp\u003e\u0026nbsp;5\u0026apos;-CCTCTTCAGGGCTCTCTGCATT-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eCellular Thermal Shift Assay （CETSA）\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Drug binding activity to target proteins was detected using a Cellular Thermal Shift Assay. U251R cells in the logarithmic growth phase (1\u0026times;10⁶ cells/well) were seeded into a 6-well plate and incubated with DMSO or dutasteride at 37\u0026deg;C for 3 h. Cells were digested and centrifuged, then resuspended in 1.5 mL PBS (containing protease and phosphatase inhibitors). Cells were repeatedly freeze-thawed in liquid nitrogen to lyse them, at least three times, followed by centrifugation at 4\u0026deg;C and 15,000 g for 20 min to collect the protein supernatant. Protein concentration was determined using the BCA method, and DMSO or dutasteride was added again and incubated at 4\u0026deg;C for 2 h. The protein was aliquoted and heated at temperature gradients (37, 42, 47, 52, 57, and 62\u0026deg;C) for 3 min each, followed by centrifugation at 4\u0026deg;C, 15,000 g for 40 min, and the protein supernatant was used for Western blotting. The band gray values were analyzed using ImageJ, calculating the half-denaturation temperature (Tm) and \u0026Delta;Tm (the difference between Tm in the drug-treated group and the DMSO control group), with \u0026Delta;Tm \u0026gt; 1 \u0026deg;C indicating a binding effect between the drug and the target protein. The experiment was repeated three times, and the data were presented as the mean \u0026plusmn; standard deviation.\u003c/p\u003e\n\u003cp\u003eMolecular Docking\u003c/p\u003e\n\u003cp\u003eMolecular docking was performed using AutoDock Vina 1.1.2\u003csup\u003e[49]\u003c/sup\u003e.\u0026nbsp;The TBC1D15 structural model was prepared by adding hydrogen atoms and assigning charges with AutoDock Tools. Dutasteride and other FDA-approved compounds were energy-minimized using the UFF force field. Docking simulations utilized a 25 \u0026times; 25 \u0026times; 25 \u0026Aring; grid box centered on the predicted ligand-binding site with exhaustiveness set to 32. Binding poses were ranked by calculated binding affinity (\u0026Delta;G).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Tumorigenicity assay\u003c/p\u003e\n\u003cp\u003eMale BALB/c nude mice (4 weeks old, 5 per group) were provided by Jiangsu Jituo Pharmaceutical Biotechnology Co., Ltd. U251R/shNC or U251R/shTBC1D15 cells were digested with pancreatic enzymes and resuspended in PBS, adjusted to a density of 2 \u0026times; 10⁷ cells/mL. Subcutaneous injections were then performed, with each mouse receiving 100 \u0026mu;L in the right axillary region. Tumor volume was assessed weekly, and treatment was initiated when tumor size reached approximately 100 mm\u0026sup3;. At this point, mice were randomly assigned to receive intraperitoneal injections of TMZ (20 mg/kg) or the small-molecule drug (10 mg/kg) every 3 days for a total of 7 doses. After the experiment, animals were euthanized, tumors were excised, and weighed. Animal experiments were conducted on the animal platform at the Biomedical Testing Center of Nanchang University. The animal experiment protocol was approved by the Nanchang University Animal Ethics Committee (NCULAE-20250422001).\u003c/p\u003e\n\u003cp\u003eStatistical analysis\u003c/p\u003e\n\u003cp\u003eGraphPad Prism 9.0 was used for all statistical analyses. Mean \u0026plusmn; standard deviation (SD) was used to represent the data. One-way analysis of variance and Bonferroni\u0026rsquo;s multiple comparisons test were utilized for the comparison of means between more than two groups, whereas the two-tailed unpaired Student\u0026rsquo;s t-test was employed to compare means between two groups. Analysis of survival was conducted with Kaplan-Meier analysis. The log-rank test was used to compare the survival curves of the mouse models. All functional in vitro experiments are representative of a minimum of three replicates. All experiments were conducted three times. At P \u0026lt;0.05, differences were considered significant.\u003c/p\u003e"},{"header":"DECLARATIONS","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The authors are deeply grateful to Prof. Liping Jiang for her invaluable guidance and meticulous revision of the manuscript throughout this research. We are especially grateful to the Key Laboratory of Drug Targets and Drug Screening of Jiangxi Province for providing experimental facilities.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLPJ, XJH, and ZHC conceived the research concept and design. LPJ, ZHC, YYD, MYJ, RC, ZMH, LKY, CXW, and QQZ implemented the methodological development and drafted, reviewed, and revised the manuscript. EMZ provides tissue samples and clinical information on GBM. All the authors read and authorized the final version of the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted in strict accordance with international ethical standards: \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHuman participants and tissues: Approved by the Ethics Committee of The First Affiliated Hospital of Nanchang University (Approval No. IIT2025260). All procedures followed the Declaration of Helsinki, with written informed consent obtained from participants. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnimal research: Approved by the Institutional Animal Care and Use Committee of the Laboratory Animal Science Center, Nanchang University (Approval No. NCULAE-20250422001). Animal experiments complied with ARRIVE Guidelines 2.0 and NIH Office of Laboratory Animal Welfare standards.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (Grant No. 82460719).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;All data in our study are available from the corresponding author upon reasonable request. All data generated or analyzed during this study are included in this published article. Additional datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"REFERENCES","content":"\u003col\u003e\n\u003cli\u003eTAN A C, ASHLEY D M, L\u0026oacute;PEZ G Y, et al. Management of glioblastoma: State of the art and future directions [J]. CA Cancer J Clin, 2020, 70(4): 299-312.\u003c/li\u003e\n\u003cli\u003eSTUPP R, TAILLIBERT S, KANNER A, et al. Effect of Tumor-Treating Fields Plus Maintenance Temozolomide vs Maintenance Temozolomide Alone on Survival in Patients With Glioblastoma: A Randomized Clinical Trial [J]. Jama, 2017, 318(23): 2306-16.\u003c/li\u003e\n\u003cli\u003eBIRZU C, FRENCH P, CACCESE M, et al. Recurrent Glioblastoma: From Molecular Landscape to New Treatment Perspectives [J]. Cancers (Basel), 2020, 13(1).\u003c/li\u003e\n\u003cli\u003eSARKARIA J N, KITANGE G J, JAMES C D, et al. Mechanisms of chemoresistance to alkylating agents in malignant glioma [J]. Clin Cancer Res, 2008, 14(10): 2900-8.\u003c/li\u003e\n\u003cli\u003eHEGI M E, LIU L, HERMAN J G, et al. Correlation of O6-methylguanine methyltransferase (MGMT) promoter methylation with clinical outcomes in glioblastoma and clinical strategies to modulate MGMT activity [J]. J Clin Oncol, 2008, 26(25): 4189-99.\u003c/li\u003e\n\u003cli\u003eCABRINI G, FABBRI E, LO NIGRO C, et al. Regulation of expression of O6-methylguanine-DNA methyltransferase and the treatment of glioblastoma (Review) [J]. Int J Oncol, 2015, 47(2): 417-28.\u003c/li\u003e\n\u003cli\u003ePANDITH A A, QASIM I, ZAHOOR W, et al. Concordant association validates MGMT methylation and protein expression as favorable prognostic factors in glioma patients on alkylating chemotherapy (Temozolomide) [J]. Sci Rep, 2018, 8(1): 6704.\u003c/li\u003e\n\u003cli\u003eWELLER M, STUPP R, REIFENBERGER G, et al. MGMT promoter methylation in malignant gliomas: ready for personalized medicine? [J]. Nat Rev Neurol, 2010, 6(1): 39-51.\u003c/li\u003e\n\u003cli\u003eYUE Q, WANG Z, SHEN Y, et al. Histone H3K9 Lactylation Confers Temozolomide Resistance in Glioblastoma via LUC7L2-Mediated MLH1 Intron Retention [J]. Adv Sci (Weinh), 2024, 11(19): e2309290.\u003c/li\u003e\n\u003cli\u003eSUN J, ZHAO W, ZHANG L, et al. Centromere protein U mediates the ubiquitination and degradation of RPS3 to facilitate temozolomide resistance in glioblastoma [J]. Drug Resist Updat, 2025, 80: 101214.\u003c/li\u003e\n\u003cli\u003eYANG E, WANG L, JIN W, et al. PTRF/Cavin-1 enhances chemo-resistance and promotes temozolomide efflux through extracellular vesicles in glioblastoma [J]. Theranostics, 2022, 12(9): 4330-47.\u003c/li\u003e\n\u003cli\u003eJING X, YANG F, SHAO C, et al. Role of hypoxia in cancer therapy by regulating the tumor microenvironment [J]. Mol Cancer, 2019, 18(1): 157.\u003c/li\u003e\n\u003cli\u003ePRAGER B C, BHARGAVA S, MAHADEV V, et al. Glioblastoma Stem Cells: Driving Resilience through Chaos [J]. Trends Cancer, 2020, 6(3): 223-35.\u003c/li\u003e\n\u003cli\u003eTOMAR M S, KUMAR A, SRIVASTAVA C, et al. Elucidating the mechanisms of Temozolomide resistance in gliomas and the strategies to overcome the resistance [J]. Biochim Biophys Acta Rev Cancer, 2021, 1876(2): 188616.\u003c/li\u003e\n\u003cli\u003eZHANG X M, WALSH B, MITCHELL C A, et al. TBC domain family, member 15 is a novel mammalian Rab GTPase-activating protein with substrate preference for Rab7 [J]. Biochem Biophys Res Commun, 2005, 335(1): 154-61.\u003c/li\u003e\n\u003cli\u003eWONG Y C, YSSELSTEIN D, KRAINC D. Mitochondria\u0026ndash;lysosome contacts regulate mitochondrial fission via RAB7 GTP hydrolysis [J]. Nature, 2018, 554(7692): 382-6.\u003c/li\u003e\n\u003cli\u003eWONG Y C, KIM S, PENG W, et al. Regulation and Function of Mitochondria\u0026ndash;Lysosome Membrane Contact Sites in Cellular Homeostasis [J]. Trends in Cell Biology, 2019, 29(6): 500-13.\u003c/li\u003e\n\u003cli\u003eKIM S, WONG Y C, GAO F, et al. Dysregulation of mitochondria-lysosome contacts by GBA1 dysfunction in dopaminergic neuronal models of Parkinson\u0026apos;s disease [J]. Nat Commun, 2021, 12(1): 1807.\u003c/li\u003e\n\u003cli\u003eCISNEROS J, BELTON T B, SHUM G C, et al. Mitochondria-lysosome contact site dynamics and misregulation in neurodegenerative diseases [J]. Trends Neurosci, 2022, 45(4): 312-22.\u003c/li\u003e\n\u003cli\u003eYU W, SUN S, XU H, et al. TBC1D15/RAB7-regulated mitochondria-lysosome interaction confers cardioprotection against acute myocardial infarction-induced cardiac injury [J]. Theranostics, 2020, 10(24): 11244-63.\u003c/li\u003e\n\u003cli\u003eSUN S, YU W, XU H, et al. TBC1D15-Drp1 interaction-mediated mitochondrial homeostasis confers cardioprotection against myocardial ischemia/reperfusion injury [J]. Metabolism, 2022, 134: 155239.\u003c/li\u003e\n\u003cli\u003ePENG W, WONG Y C, KRAINC D. Mitochondria-lysosome contacts regulate mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e dynamics via lysosomal TRPML1 [J]. Proceedings of the National Academy of Sciences, 2020, 117(32): 19266-75.\u003c/li\u003e\n\u003cli\u003eLAI S-W, HUANG B-R, LIU Y-S, et al. Differential Characterization of Temozolomide-Resistant Human Glioma Cells [J]. International Journal of Molecular Sciences, 2018, 19(1): 127.\u003c/li\u003e\n\u003cli\u003eMURPHY S F, VARGHESE R T, LAMOUILLE S, et al. Connexin 43 Inhibition Sensitizes Chemoresistant Glioblastoma Cells to Temozolomide [J]. Cancer Res, 2016, 76(1): 139-49.\u003c/li\u003e\n\u003cli\u003eGIELEN P R, AFTAB Q, MA N, et al. Connexin43 confers Temozolomide resistance in human glioma cells by modulating the mitochondrial apoptosis pathway [J]. Neuropharmacology, 2013, 75: 539-48.\u003c/li\u003e\n\u003cli\u003ePRIDHAM K J, SHAH F, HUTCHINGS K R, et al. Connexin 43 confers chemoresistance through activating PI3K [J]. Oncogenesis, 2022, 11(1).\u003c/li\u003e\n\u003cli\u003eYANG Z J, BI Q C, GAN L J, et al. Exosomes Derived from Glioma Cells under Hypoxia Promote Angiogenesis through Up-regulated Exosomal Connexin 43 [J]. Int J Med Sci, 2022, 19(7): 1205-15.\u003c/li\u003e\n\u003cli\u003eYANG Z J, ZHANG L L, BI Q C, et al. Exosomal connexin 43 regulates the resistance of glioma cells to temozolomide [J]. Oncol Rep, 2021, 45(4).\u003c/li\u003e\n\u003cli\u003eCHOI H Y, ZHU Y, ZHAO X, et al. NOTCH localizes to mitochondria through the TBC1D15-FIS1 interaction and is stabilized via blockade of E3 ligase and CDK8 recruitment to reprogram tumor-initiating cells [J]. Exp Mol Med, 2024, 56(2): 461-77.\u003c/li\u003e\n\u003cli\u003eFALCO M, TAMMARO C, COSSU A M, et al. Identification and bioinformatic characterization of a serum miRNA signature for early detection of laryngeal squamous cell carcinoma [J]. J Transl Med, 2024, 22(1): 647.\u003c/li\u003e\n\u003cli\u003eMARTINA J A, CHEN Y, GUCEK M, et al. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB [J]. Autophagy, 2012, 8(6): 903-14.\u003c/li\u003e\n\u003cli\u003eCREAMER T P. Calcineurin [J]. Cell Commun Signal, 2020, 18(1): 137.\u003c/li\u003e\n\u003cli\u003eZHANG X, CHENG X, YU L, et al. MCOLN1 is a ROS sensor in lysosomes that regulates autophagy [J]. Nat Commun, 2016, 7: 12109.\u003c/li\u003e\n\u003cli\u003eMEDINA D L, DI PAOLA S, PELUSO I, et al. Lysosomal calcium signalling regulates autophagy through calcineurin and TFEB [J]. Nat Cell Biol, 2015, 17(3): 288-99.\u003c/li\u003e\n\u003cli\u003eGIAMOGANTE F, BARAZZUOL L, MAIORCA F, et al. A SPLICS reporter reveals \u0026alpha;-synuclein regulation of lysosome-mitochondria contacts which affects TFEB nuclear translocation [J]. Nature Communications, 2024, 15(1): 1516.\u003c/li\u003e\n\u003cli\u003eYANG Z J, ZHANG W F, JIN Q Q, et al. Lactate Contributes to Remote Ischemic Preconditioning-Mediated Protection Against Myocardial Ischemia Reperfusion Injury by Facilitating Autophagy via the AMP-Activated Protein Kinase-Mammalian Target of Rapamycin-Transcription Factor EB-Connexin 43 Axis [J]. Am J Pathol, 2024, 194(10): 1857-78.\u003c/li\u003e\n\u003cli\u003eHUANG R P, HOSSAIN M Z, HUANG R, et al. Connexin 43 (cx43) enhances chemotherapy-induced apoptosis in human glioblastoma cells [J]. Int J Cancer, 2001, 92(1): 130-8.\u003c/li\u003e\n\u003cli\u003eOSSWALD M, JUNG E, SAHM F, et al. Brain tumour cells interconnect to a functional and resistant network [J]. Nature, 2015, 528(7580): 93-8.\u003c/li\u003e\n\u003cli\u003eSONG Y, HUANG Q, PU Q, et al. Gastrodin Liposomes Block Crosstalk between Astrocytes and Glioma Cells via Downregulating Cx43 to Improve Antiglioblastoma Efficacy of Temozolomide [J]. Bioconjug Chem, 2024, 35(9): 1380-90.\u003c/li\u003e\n\u003cli\u003eCHE J, DEPALMA T J, SIVAKUMAR H, et al. \u0026alpha;CT1 peptide sensitizes glioma cells to temozolomide in a glioblastoma organoid platform [J]. Biotechnol Bioeng, 2023, 120(4): 1108-19.\u003c/li\u003e\n\u003cli\u003eTHAKKAR J P, DOLECEK T A, HORBINSKI C, et al. Epidemiologic and molecular prognostic review of glioblastoma [J]. Cancer Epidemiol Biomarkers Prev, 2014, 23(10): 1985-96.\u003c/li\u003e\n\u003cli\u003eCARRANO A, JUAREZ J J, INCONTRI D, et al. Sex-Specific Differences in Glioblastoma [J]. Cells, 2021, 10(7).\u003c/li\u003e\n\u003cli\u003eBAO D, CHENG C, LAN X, et al. Regulation of p53wt glioma cell proliferation by androgen receptor-mediated inhibition of small VCP/p97-interacting protein expression [J]. Oncotarget, 2017, 8(14): 23142-54.\u003c/li\u003e\n\u003cli\u003eRODR\u0026iacute;GUEZ-LOZANO D C, PI\u0026ntilde;A-MEDINA A G, HANSBERG-PASTOR V, et al. Testosterone Promotes Glioblastoma Cell Proliferation, Migration, and Invasion Through Androgen Receptor Activation [J]. Front Endocrinol (Lausanne), 2019, 10: 16.\u003c/li\u003e\n\u003cli\u003eDHURAT R, SHARMA A, RUDNICKA L, et al. 5-Alpha reductase inhibitors in androgenetic alopecia: Shifting paradigms, current concepts, comparative efficacy, and safety [J]. Dermatol Ther, 2020, 33(3): e13379.\u003c/li\u003e\n\u003cli\u003eJUNG J Y, YEON J H, CHOI J W, et al. Effect of dutasteride 0.5 mg/d in men with androgenetic alopecia recalcitrant to finasteride [J]. Int J Dermatol, 2014, 53(11): 1351-7.\u003c/li\u003e\n\u003cli\u003eMILONAS D, AUSKALNIS S, SKULCIUS G, et al. Dutasteride for the prevention of prostate cancer in men with high-grade prostatic intraepithelial neoplasia: results of a phase III randomized open-label 3-year trial [J]. World J Urol, 2017, 35(5): 721-8.\u003c/li\u003e\n\u003cli\u003eCUI K, LI X, DU Y, et al. Chemoprevention of prostate cancer in men with high-grade prostatic intraepithelial neoplasia (HGPIN): a systematic review and adjusted indirect treatment comparison [J]. Oncotarget, 2017, 8(22): 36674-84.\u003c/li\u003e\n\u003cli\u003eTROTT O, OLSON A J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading [J]. J Comput Chem, 2010, 31(2): 455-61.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7218795/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7218795/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGlioblastoma multiforme (GBM) is among the most malignant central nervous system tumors with a poor prognosis. Resistance to temozolomide (TMZ), the first-line chemotherapy drug, is the primary obstacle to treatment efficacy in GBM patients. Our study identified TBC1D15 as an oncogene in GBM and a potential therapeutic target for TMZ resistance. TBC1D15 is overexpressed in recurrent GBM (rGBM) and TMZ-resistant cells. Knockdown of TBC1D15 significantly sensitized TMZ-resistant cells to TMZ. Further investigation revealed that TBC1D15 knockdown prolonged mitochondria-lysosome contact (MLC), altered lysosomal Ca\u003csup\u003e2+\u003c/sup\u003e kinetics, inhibited TFEB nuclear translocation, thereby downregulating Cx43 expression, ultimately reversing GBM resistance to TMZ. Additionally, through high-throughput compound library screening integrated with 3D protein structure analysis, we identified dutasteride, an FDA-approved drug, as a specific inhibitor of TBC1D15. Dutasteride increased GBM sensitivity to TMZ both in vitro and in vivo. The combination of dutasteride and TMZ represented a promising treatment strategy for GBM, offering a potential therapeutic approach to overcome TMZ resistance.\u003c/p\u003e","manuscriptTitle":"Targeting TBC1D15 Reverses TMZ-resistance in Glioblastoma by Modulating Lysosomal Ca²⁺/TFEB/Cx43 Axis via Mitochondria-Lysosome Contact","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 05:04:16","doi":"10.21203/rs.3.rs-7218795/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b977e44f-7d1f-40f5-97e4-c5f0e5a330b4","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":53626258,"name":"Health sciences/Diseases/Cancer/CNS cancer"},{"id":53626259,"name":"Biological sciences/Cancer/CNS cancer"}],"tags":[],"updatedAt":"2025-09-22T14:43:57+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-03 05:04:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7218795","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7218795","identity":"rs-7218795","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}