miR-140-5p is Associated with the NF-κB Signaling Pathway and Exerts an Interventional Effect on Cholangitis in Rats

miR-140-5p is Associated with the NF-κB Signaling Pathway and Exerts an Interventional Effect on Cholangitis in Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article miR-140-5p is Associated with the NF-κB Signaling Pathway and Exerts an Interventional Effect on Cholangitis in Rats Qingjian Wang, Ao Luo, Wenjuan Huang, Yuhan Zhao, Yalu Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8955884/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 16 You are reading this latest preprint version Abstract Background Cholangitis represents an anti-injury response of cholangiocytes to endogenous and exogenous stimuli. Under chronic inflammatory stimulation, bile duct fibrosis and pathological bile duct remodeling are common pathological alterations in biliary duct tissue, which simultaneously serve as high-risk factors for the development of cholestatic liver cirrhosis and cholangiocarcinoma. NF-κB is a core factor in inflammatory responses. Recent studies have revealed that the small non-coding RNA molecule miR-140-5p may regulate the progression of various inflammatory diseases by influencing NF-κB activity; however, the regulatory role of this molecular pathway in cholangitis remains unclear. Therefore, this study aims to investigate the roles of miR-140-5p and NF-κB in a rat cholangitis model. Methods Thirty healthy SD rats were randomly divided into five groups using a random number table: control group, LPS group, LPS + NC adenoviral vector group, LPS + miR-140-5p inhibitors group, and LPS + PDTC group, with 6 rats in each group. A rat cholangitis model was established by single injection of LPS (5µg/mL) into the common bile duct, with different inhibitors administered prior to modeling. Biliary duct tissues were collected from each group of rats, and ultrastructural changes in cholangiocytes were observed under electron microscopy; NF-κB protein expression levels in biliary duct tissues of rats from each group were measured using immunohistochemical method; Expression levels of interleukin-1β (IL-1β) and interleukin-18 (IL-18) in serum were determined by ELISA; qPCR was performed to detect mRNA expression levels of Toll-like receptor 4 (TLR4), NF-κB, tumor necrosis factor-α (TNF-α), and miRNA-140-5p in each group; TLR4, NF-κB, and TNF-α protein expression levels were examined by Western Blot. Results A rat cholangitis model was established via common bile duct injection of lipopolysaccharide (LPS). Compared with the control group, the LPS group exhibited significant inflammatory infiltration in biliary tissues. Transmission electron microscopy (TEM) revealed typical pathological manifestations in cholangiocytes (BDECs), including widened intercellular spaces, disrupted membrane structures, and mitochondrial and endoplasmic reticulum damage. Immunohistochemistry and molecular detection revealed that the LPS group exhibited enhanced positive expression of NF-κB protein, with significantly elevated serum levels of IL-1β and IL-18, as well as increased mRNA and protein expression of TLR4, NF-κB, and TNF-α ( p < 0.01). Using adenoviral vector transfection technology to regulate the transcription of miR-140-5p in rats, the LPS + NC adenoviral vector group and LPS + miR-140-5p inhibitors group were established. The results of all indicators in the LPS + NC adenoviral vector group showed no statistically significant difference compared to the LPS group (p > 0.05). Compared with the LPS group, the LPS + miR-140-5p inhibitors group exhibited significantly reduced serum IL-1β and IL-18 levels ( p < 0.01), markedly alleviated BDEC injury, and significantly down-regulated mRNA expression levels of TNF-α and TLR4 ( p < 0.05). Notably, relative to the LPS group, the LPS + miR-140-5p inhibitors group showed a significant decrease in NF-κB mRNA levels, although the reduction in NF-κB protein expression did not reach statistical significance (p > 0.05). In the LPS + PDTC group compared to the LPS group, serum IL-1β and IL-18 levels were significantly reduced ( p < 0.01), BDEC injury was markedly alleviated, and both mRNA and protein expression levels of TNF-α and TLR4 were significantly down-regulated ( p < 0.01). However, mRNA expression of miR-140-5p was significantly elevated ( p < 0.01). Conclusion miR-140-5p exhibits a positive correlation with the severity of cholangitis and the activation of the NF-κB pathway, and it may promote inflammation by positively regulating the NF-κB pathway. Following intervention with NF-κB inhibitors, the expression levels of the aforementioned inflammatory factors and pathway molecules significantly decreased compared to the LPS group ( p < 0.01 ). Moreover, NF-κB activation may transcriptionally inhibit miR-140-5p. When NF-κB activity is suppressed, it induces high expression of miR-140-5p. This feedback loop may participate in the self-regulatory process of inflammation, potentially providing a new target for blocking NF-κB-mediated inflammatory cascade amplification. Biological sciences/Cell biology Health sciences/Diseases Health sciences/Gastroenterology Biological sciences/Immunology Biological sciences/Molecular biology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Cholangitis is primarily characterized by intrahepatic and extrahepatic bile duct damage with persistent inflammatory infiltration [ 1 , 2 ] . It is mainly activated by endogenous damage-associated molecular patterns (DAMPs) released from injured cells or exogenous pathogen-associated molecular patterns (PAMPs) derived from the intestine or systemic circulation [ 3 ] . Activated cholangiocytes recruit immune cells, vascular cells, and mesenchymal cells through intercellular interactions, secreting chemokines, cytokines, and angiogenic factors that initiate and amplify cholestatic inflammation [ 4 – 6 ] . Prolonged exposure of bile duct epithelial cells (BDECs) to cytokine- and chemokine-enriched microenvironments generated by innate and adaptive immune cells contributes to the occurrence of cellular damage [ 7 , 8 ] . Sustained low-intensity inflammatory stimulation can induce pathological tissue repair, leading to excessive deposition of scar tissue around damaged bile ducts and triggering cholangiofibrosis. This consequently increases the risk of cholestasis, thereby becoming a significant risk factor for the development of bile duct stones and cholangiocarcinoma [ 9 ] . Toll-like receptor 4 (TLR4), as a canonical pathogen recognition receptor on the surface of cholangiocytes, undergoes receptor oligomerization and conformational changes upon recognition of PAMPs (such as LPS derived from Gram-negative bacteria). By recruiting adaptor proteins including myeloid differentiation primary response protein 88 (MyD88), interleukin-1 receptor-associated kinases (IRAKs), and TIR-domain-containing adapter-inducing interferon-β (TRIF) [ 10 ] , it transduces signals through either the MyD88-dependent or TRIF-mediated independent pathway [ 11 ] . This ultimately activates NF-κB, promotes the biosynthesis and release of pro-inflammatory cytokines, and drives the onset of cholangitis [12] . MicroRNAs (miRNAs) are a class of endogenous non-coding small RNA molecules, approximately 20–24 nucleotides in length, highly conserved throughout evolution [ 13 ] . They regulate post-transcriptional expression of target genes by specifically binding to the 3ʹ-UTRs or 5ʹ-UTRs of target mRNAs [14] . MiRNAs are widely involved in various physiological processes such as cell proliferation, apoptosis, and lipid metabolism [ 15 ] . Recent studies confirm their regulatory roles in the pathogenesis of hepatobiliary diseases through multiple metabolic pathways. For instance, miR-29a-3p suppresses hepatic stellate cell (HSC) activation and alleviates liver fibrosis in mice by inhibiting the expression of bromodomain-containing protein 4 (BRD4) [16] . miR-513 is capable of inhibiting the translation of the immune checkpoint molecule B7-H1 in bile duct cells, playing a pivotal regulatory role in primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC) [ 17 ] . miR-140-5p has been demonstrated to be significantly associated with inflammatory responses and cellular damage in various inflammatory and cell injury models, and can regulate inflammation and cellular injury by modulating downstream target genes and signaling pathways [ 18 , 19 ] . For instance, overexpression of miR-140-5p can aggravate insulin resistance via directly targeting GYS1 and PPP1CC in insulin-resistant HepG2 cells [20] .miR-140-5p promotes the secretion of pro-inflammatory factors and tissue damage in temporomandibular joint osteoarthritis mice by activating the NF-κB pathway through targeted suppression of Smad3, demonstrating its positive regulatory role in inflammation [ 21 ] . However, in certain models, miR-140-5p targets and binds to TLR4, inhibits the activation of the NF-κB signaling pathway, as validated in rat models of intervertebral disc inflammation and diabetic nephropathy [22,23] . Therefore, the inflammatory regulatory function of miR-140-5p exhibits significant tissue microenvironment specificity, with its specific effector mechanisms closely related to the regulatory patterns of target genes, pathway activation status, and cell type differences. Currently, NF-κB factors are known as the core molecules driving the onset and progression of cholangitis. Given that miR-140-5p modulates pathways including NF-κB in various cellular inflammation models, combined with the unique microenvironment of cholangitis, this study aims to investigate the regulatory mechanism of miR-140-5p on NF-κB and elucidate the role of the miR-140-5p/NF-κB axis in rat cholangitis models. Materials and Methods 1. Experimental Animals Thirty healthy adult male SD rats of SPF grade were provided by the Animal Experiment Center of Guangxi Medical University (Production License No.: SCXK (Gui) 2020-0003). The experiment was approved by the Ethics Committee of Guangxi University of Chinese Medicine (No. DW20221024-203). Rats were housed at the Scientific Experiment Center of Guangxi University of Chinese Medicine. Following a one-week acclimatization period, experiments were conducted in strict compliance with animal ethics protocols and aseptic techniques.All methods were performed in accordance with the relevant guidelines and regulations. 2. Animal Grouping and Modeling Rats were randomly allocated into five groups (n = 6): Control group, LPS group, LPS + NC adenoviral vector group, LPS + miR-140-5p inhibitor group, and LPS + PDTC group. Preoperative administration: Two days prior to modeling, the LPS + NC adenoviral vector group and LPS + miR-140-5p inhibitor group received a single tail vein injection of the corresponding adenoviral vector (2×10⁸ pfu/100µl). In the LPS + PDTC group, the NF-κB inhibitor PDTC (100 mg/kg) was administered via intraperitoneal injection one hour prior to modeling; the control group and LPS group received an equivalent volume of saline. Except for the control group, rats in other groups were injected with 0.9 mL of 5 µg/mL LPS into the common bile duct to establish an intrahepatic cholangitis model. Rats were fasted with water deprivation for 12 hours preoperatively, anesthetized via intraperitoneal injection of 2% sodium pentobarbital (0.3 mL/100g), and subjected to laparotomy under sterile conditions to expose the common bile duct. LPS was administered via percutaneous injection, with successful modeling confirmed by ensuring duct distension without collapse. Layered closure of the abdomen was performed, and vital signs were monitored postoperatively. The control group underwent identical surgical procedures, with equivalent saline injections administered preoperatively. 3. Blood Collection and Serum Separation Following successful modeling, rats were routinely housed for one week to stabilize the model condition. Daily observations and recordings were made regarding general conditions including food intake, activity levels, and mental status. Preoperatively, rats were fasted for 12 hours (with free access to water) and anesthetized via intraperitoneal injection of 2% sodium pentobarbital (0.3 mL/100g). Post-injection reactions were closely monitored until cessation of voluntary movement, sluggish or absent corneal reflex, and stable respiration were observed. Upon confirmation of adequate anesthesia, rats were immediately euthanized by cervical dislocation. After UV sterilization of the biosafety cabinet, the abdominal aorta was exposed aseptically via laparotomy. Whole blood (4 mL) was collected via puncture at a flow rate of 1 mL/min and allowed to stand at room temperature for 2 hours. Subsequently, samples were centrifuged at 4°C and 3000 rpm for 10 minutes using a cryogenic centrifuge (Model TGL-16M, Xiangyi Centrifuge Instrument Co., Ltd.). Aliquots of 400 µL serum were aspirated and stored at -80°C for ELISA detection of IL-1β and IL-18. 4. Tissue Sample Collection and Processing Following blood collection, laparotomy was repeated. Heparin was administered via the inferior vena cava to achieve systemic heparinization in rats. The liver and bile duct were dissected, with bile duct and hepatic portal tissues collected. Hepatic parenchyma was removed to preserve the biliary tree. Part of the biliary duct tissue was flash-frozen in liquid nitrogen and preserved at -80°C for qPCR and Western blot detection. Additionally, 5 pieces of biliary duct tissue (0.5 cm×0.5 cm×0.5 cm) were sectioned using a manual microtome (HistoCore BIOCUT, Leica, Germany), fixed in 4% neutral buffered formalin, and prepared for Transmission Electron Microscope observation and immunohistochemical detection of NF-κB expression in cells. 5. Preparation of TEM Specimens Fixed biliary duct tissue was rapidly processed on ice. Within 3 minutes, 1 mm×1 mm×1 mm fragments were sectioned using a manual microtome, transferred into EM fixative (Product No. G1102, Servicebio Co.) for trimming, sealed with parafilm, and stored at 4°C. Rinse three times with 0.1 M phosphate buffer (PB, pH 7.4) pre-cooled at 4°C (15 minutes each time, gently shake the centrifuge tube to ensure thorough rinsing); fix with 1% osmium tetroxide solution for 2 hours under dark conditions at 4°C; Rinse three times with PB of the same concentration pre-cooled at 4°C (15 minutes each time); Perform gradient dehydration using anhydrous ethanol (Cat#100092183, Sinopharm) and acetone (Cat#10000418, Sinopharm) at 4°C under dark conditions (20 minutes per step); After dehydration completion, gradient infiltration was performed with 812 embedding agent (Cat. No. 90529-77-4, SPI Supplies) at 4°C under light-protected conditions. 6. Experimental Detection Methods 6.1 Transmission Electron Microscopy Observation Biliary duct tissue morphological changes were analyzed using a Transmission Electron Microscope (Model HT7800/HT7700, Hitachi, Japan) by examining stained copper grid sections. 6.2 NF-κB Expression Detection via Immunohistochemistry Biliary duct tissues were fixed in 4% paraformaldehyde pre-cooled to 4°C for 24 hours, followed by gentle shaking on a shaker with 0.01 M PBS (pH 7.4) for 3 days (solution replaced every 8 hours to thoroughly remove fixative). After dehydration through a graded ethanol series, clearing in xylene, and embedding in paraffin, tissues were sectioned into 5 µm-thick continuous slices using a manual microtome. Sections were mounted on poly-L-lysine-coated anti-off slides, baked in a 60°C oven for 2 hours, and stored at room temperature for later use. Following deparaffinization and hydration, antigen retrieval was performed using 0.01 M EDTA buffer (pH 9.0) via microwave treatment (heated to boiling at medium-high power, then switched to low power to maintain gentle boiling for 15 minutes, and naturally cooled to room temperature). Washed 3 times with 0.01 M PBS for 5 minutes each time; Add 3% hydrogen peroxide solution and block endogenous peroxidase at room temperature under light-protected conditions for 15 minutes; Wash 3 times with 0.01 M PBS for 5 minutes each; Add 5% bovine serum albumin (BSA) blocking solution and incubate in a humid chamber at 37°C for 30 minutes. Discard the blocking solution (do not wash); Add NF-κB primary antibody (diluted according to experimental targets) and incubate overnight in a humid chamber at 4°C; Wash 3 times with 0.01 M PBS for 5 minutes each; Add diluted secondary antibody working solution (Boster Goat Anti-Mouse IgG, Cat. No. BA1050) and incubate in a humid chamber at 37°C for 30 minutes; Wash 3 times with 0.01 M PBS for 5 minutes each; DAB chromogen solution (Boster Biological Technology) was added dropwise, and color development was monitored under light avoidance at room temperature for 3–5 minutes; color development was terminated by thorough rinsing with tap water. Nuclei were counterstained with hematoxylin staining solution for 5 minutes, followed by bluing with tap water for 2 minutes. After dehydration through graded ethanol series and clearing with xylene, sections were mounted with neutral balsam. NF-κB positive expression was observed and analyzed under an optical microscope. 6.3 Detection of serum IL-1β and IL-18 levels by ELISA Operations were performed according to the kit instructions: concentrated washing buffer was diluted 1:20; substrates A and B were mixed in equal volumes. After thawing on ice, serum samples were centrifuged at 4°C and 4000g for 5 minutes using a high-speed centrifuge (Model TGL-16R, Zhujiang Heima). The supernatant was then collected. The microplate was equilibrated at room temperature for 20 minutes. Standard wells, sample wells (10 µL serum + 40 µL diluent), and blank wells were designated. 100 µL of HRP-labeled detection antibody was added to all wells except the blank wells, followed by incubation at 37°C for 60 minutes. After five washes, 50 µL each of substrate A and B solutions were added, and light-protected incubation was conducted for 15 minutes. After adding the stop solution, the optical density (OD) was measured at 450 nm using a microplate reader (Model 3530910449, Thermo Fisher Scientific). Concentrations were calculated using the standard curve method. 6.4 qPCR Detection of mRNA and miRNA Expression Levels 6.4.1 RNA Extraction and Quality Assessment Biliary duct tissue was homogenized with 1 mL TRIZOL reagent (Cat# XY-001, Xingyu Biology, Guangzhou). After chloroform addition for emulsification and centrifugation, the upper aqueous phase was collected. RNA was precipitated with isopropanol, washed with 75% ethanol, dissolved in DEPC-treated water, and stored at -80°C following concentration measurement using a NanoDrop2000 spectrophotometer (eppendorf). RNA purity and integrity were evaluated by UV spectrophotometry. 6.4.2 Genomic DNA Removal, cDNA Synthesis and Amplification RNA underwent genomic DNA removal via gDNA adsorption column, followed by heat denaturation at 65°C and ice bath. The reverse transcription reaction system was prepared on ice according to the manufacturer's protocol of the reverse transcription kit (Cat. No. R211-02, Novizan), with reverse transcription performed at 37°C for 42 minutes and 98°C for 5 minutes. The resulting cDNA was diluted 5-fold and stored at -20°C. Primers were synthesized by Sangon Biotech (sequences listed in Table 1 ). A 20 µL reaction system was prepared using AceQ qPCR SYBR Green Master Mix (Cat. No. Q121-02, Novizan) and amplified on a fluorescence quantitative PCR instrument (Model Q2000B, Hangzhou Langji). ACTIN served as the internal reference for TLR4, NF-κB, and TNF-α, while U6 was used as the internal reference for miR-140-5p. Data analysis was performed using the 2 −△△Ct method. Table 1 Primer Sequences Gene Name Primer Sequence ( 5’-3’) Fragment Length ( bp) ACTIN Forward: AGGGAAATCGTGCGTGACAT 150 Reverse: TNF-α Forward: ACCAGGAGAAAGTCAGCCTC 249 Reverse: GCTGGGTAGAGAACGGATGA NF-kB Forward: TGACGGGAGGGGAAGAAATC 211 Reverse: TGAACAAACACGGAAGCTGG TLR4 Forward: TCCAAAGAGTCTAGCCGTCT 229 Reverse: AAGCACACTGACCACCGATA MIR-140-5P RT CTCAACTGGTGTCGTGGAGTCGGCAATTCA GTTGAGCTACCATA 74 Forward: ACACTCCAGCTGGG CAGTGGTTTTACC Reverse: CTCAACTGGTGTCGTGGA U6 Forward: CTCGCTTCGGCAGCACA 113 Reverse: AACGCTTCACGAATTTGCGT 6.5 Western Blot Detection of Protein Expression Levels 6.5.1 Preparation of Lysis Buffer and Protein Quantification 50 mg of biliary duct tissue was added to 0.5 mL of pre-chilled RIPA lysis buffer (Catalog No. P0013, BiYunTian), 1 µL Cocktail (Catalog No. G2006-250UL, Servicebio), and 1 µL phosphatase inhibitor (Catalog No. P1045, BiYunTian). The mixture was homogenized at 12,000 rpm, followed by ice bath incubation for 30 minutes. After centrifugation at 4°C and 12,000 g for 10 minutes, the supernatant was collected. Protein concentrations were quantified using a BCA assay kit (Cat. No. P0011, BiYunTian), with absorbance measured at 562 nm using a microplate reader, and calculated via the standard curve method. 6.5.2 Electrophoresis, Transfer, and Incubation Prepared 5% stacking gel and 10% separating gel. Loaded 20 µg protein per lane along with Pre-stained Protein Marker (Cat. No. G2058-250UL, Servicebio). Performed vertical electrophoresis (Model VE180, Shanghai Techcomp) at 80 V initially, then increased to 120 V after the separation gel interface until electrophoresis completion. Gels were immersed in transfer buffer for 10 minutes. PVDF membranes (Cat. No. IPVH00010, MILLIPORE) were activated with methanol and assembled into transfer sandwiches. Proteins were transferred at 120V constant voltage for 60 minutes using a transfer electrophoresis tank (Model VE186, Shanghai Techcomp). Membranes were blocked with 5% skimmed milk in TBST buffer for 1h. After washing with TBST, diluted primary antibodies (TLR4, NF-κB, TNF-α, and internal reference Anti-GAPDH antibody, Cat# BF0198, Affinity, 1:1500) were added and incubated overnight at 4°C. Following membrane washing, secondary antibodies (1:5000) were incubated at room temperature for 1 hour. 6.5.3 Development and Analysis Chemiluminescent reagents (Cat# FP302, ABP Biosciences) Solutions A and B were mixed in equal volumes and applied to cover the membrane surface. Exposure and development were performed using a cassette (Model AX-II, Guangdong Yuehua), and band grayscale values were quantified using ImageJ software. 7. Statistical Methods Statistical analysis was performed using SPSS 26.0 software. Normally distributed measurement data are expressed as mean ± standard deviation (± s ). Multiple group comparisons were analyzed by one-way ANOVA (LSD test for pairwise comparisons when homogeneity of variance was met; Dunnett’s T3 test was used when variances were unequal). A P-value < 0.05 was considered statistically significant. Experimental Results 3.1 Morphological Changes in Intrahepatic Bile Duct Tissues of Rats Across Groups Tissue samples underwent double staining with uranyl acetate and lead citrate, and pathological features were observed using a transmission electron microscope. Histological analysis revealed normal tissue architecture in the control group rats (Fig. 1). Biliary duct tissues from the LPS group exhibited widened intercellular spaces, ruptured cell and mitochondrial membranes, irregular nuclear morphology, matrix dissolution, cristae fragmentation and disappearance, and significantly dilated endoplasmic reticulum (Fig. 1). Bile duct cells in the LPS + NC adenoviral vector group showed similar histopathological damage to those in the LPS group (Fig. 1). In contrast, rats treated with the miR-140-5p inhibitor and PDTC demonstrated significantly alleviated injury compared to the LPS group ( Fig. 1). Note A. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group Control group: Tight intercellular spaces, intact cell membrane structure, irregular nuclei, intact mitochondrial membrane, sparse matrix with reduced cristae; slightly dilated endoplasmic reticulum. LPS group: Widened intercellular spaces, damaged cell membrane and mitochondrial membrane, irregular nuclei, dissolved matrix, fractured and disappeared cristae, significantly dilated endoplasmic reticulum. In the LPS + NC adenoviral vector group, the bile duct cell junctions showed no widening, with no significant rupture observed on the cell membrane. The nuclei appeared relatively small. Mitochondria exhibited partial membrane rupture with substantial matrix dissolution and residual cristae fragments. The endoplasmic reticulum displayed marked dilation and vacuolation. In the LPS + miR-140-5p inhibitors group, bile duct cell junctions showed multiple areas of slight widening with minor membrane rupture. The nuclei appeared approximately oval-shaped. Most mitochondria maintained intact membranes, though the matrix density was slightly reduced. Cristae were partially fractured and disorganized, while the majority of the endoplasmic reticulum appeared moderately dilated. In the LPS + PDTC group, bile duct cells were arranged compactly with intact cell membrane structures. Nuclei appeared irregular with slightly dense heterochromatin. Most mitochondria maintained intact membranes, exhibiting slightly sparse matrices and shortened cristae. A minority of mitochondria showed membrane rupture, while the majority of endoplasmic reticulum appeared slightly dilated. 3.2 Expression levels of NF-κB in biliary duct tissues across experimental groups Immunohistochemistry results: Positive NF-κB staining manifested as brownish-yellow granules within intrahepatic bile duct tissues of rats, primarily localized at the cell membrane (Fig. 2 ). Compared with the control group, NF-κB protein positive expression was enhanced in the LPS group (Fig. 2 ). NF-κB protein expression in the LPS + NC adenoviral vector group showed no significant change compared with the LPS group (Fig. 2 ). NF-κB protein positive expression in the LPS + miR-140-5p inhibitor group exhibited a less pronounced decrease compared with the LPS group, but demonstrated an overall downward trend (Fig. 2 ). Note A. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group Control group: NF-κB protein showed weak positivity, approximately > 70%. LPS group: NF-κB protein exhibited strong positivity, approximately > 90%. LPS + NC adenoviral vector group: NF-κB protein demonstrated strong positivity, approximately > 90%. LPS + miR-140-5p inhibitor group: NF-κB protein displayed moderate positivity, approximately > 90%. LPS + PDTC group: NF-κB protein showed moderate positivity, approximately > 70%. 3.3 Expression Levels of IL-1β and IL-18 in Rat Serum Across Experimental Groups ELISA results indicated: Compared with the control group, the expression levels of pro-inflammatory cytokines (including IL-1β and IL-18) in LPS-treated rats were significantly increased ( p < 0.01, Fig. 3). Both inhibition of miR-140-5p and NF-κB significantly reduced the levels of inflammatory factors in rats ( p < 0.01, Fig. 3). Table 2 Expression levels of inflammatory factors IL-1β and IL-18 in rat serum ( ±s,n = 6) Group Number of cases IL-1β IL-18 Control group 6 23.44 ± 0.83 12.92 ± 0.59 LPS group 6 39.79 ± 0.95 △ 20.51 ± 0.79 △ LPS + NC adenoviral vector group 6 39.68 ± 0.75 △ 20.39 ± 0.85 △ LPS + miR-140-5p inhibitor group 6 34.37 ± 1.10 * 17.52 ± 0.6 * LPS + PDTC group 6 26.48 ± 0.75 ▽ 14.25 ± 0.94 ▽ Note Panel (a): Levels of IL-1β in each group (n = 6 ); Panel (b): Levels of IL-18 in different groups (n = 6 ); A. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group; Compared with the control group, △ P < 0.01 ; Compared with the LPS group, *P < 0.01, ▽ P < 0.01; Compared with the LPS + NC group: *P < 0.01 ; Compared with LPS + miR-140-5p inhibitor: ▽ P < 0.01. 3.4 Expression levels of TLR4, NF-κB, TNF-α mRNA, and miRNA-140-5p in intrahepatic bile duct tissues across experimental groups Compared with the control group, the LPS group demonstrated significantly elevated mRNA levels of TLR4, NF-κB, and TNF-α ( p < 0.01, Fig. 4), while miR-140-5p expression was reduced ( p < 0.01, Fig. 4). The LPS + NC adenoviral vector group exhibited results comparable to the LPS group (Fig. 4). Compared with the LPS group, the expression levels of TLR4, NF-κB, and TNF-α mRNA in the LPS + miR-140-5p inhibitor group significantly decreased ( p < 0.01, Fig. 4); Compared with the LPS group, the LPS + PDTC group also showed decreased levels of TLR4 and TNF-α mRNA; however, it is noteworthy that the expression level of miR-140-5p mRNA significantly increased in this group ( p < 0.01, Fig. 4). Table 3 Expression levels of TLR4, NF-κB, TNF-α, and miR-140-5p mRNA in rats from each group (2 −ΔΔCt method, ±s, n = 6) Group Number of cases TLR4 NF-κB TNF-α miR-140-5p Control group 6 1.39 ± 0.37 1.08 ± 0.42 2.18 ± 1.14 1.16 ± 0.17 LPS group 6 8.12 ± 1.37 △ 12.07 ± 2.06 △ 11.13 ± 1.77 △ 0.35 ± 0.07 △ LPS + NC adenoviral vector group 6 7.14 ± 1.27 △ 12.37 ± 1.39 △ 11.75 ± 2.84 △ 0.33 ± 0.08 △ LPS + miR-140-5p inhibitor group 6 3.60 ± 0.76 * 5.47 ± 1.14 * 7.60 ± 1.95 * 0.18 ± 0.03 * LPS + PDTC group 6 2.06 ± 0.48 ▽ 3.02 ± 1.19 ▽ 2.22 ± 0.41 ▽ 0.65 ± 0.19 ▽ Note A. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group(a). Expression levels of TLR4 mRNA in different groups (n = 6); (b). Expression levels of NF-κB mRNA in different groups (n = 6);(c). Levels of TNF-α miRNA in different groups (n = 6); (d). Levels of miR-140-5p in different groups (n = 6); Compared with the control group, △ P < 0.01 ; Compared with the LPS group, * P < 0.05, ▽ P < 0.01; Compared with LPS + miR-140-5p inhibitor: ▽ P < 0.05. 3.5 Expression levels of TLR4, NF-κB, and TNF-α proteins in intrahepatic bile duct tissues from various groups of rats Compared with the control group, the expression of inflammation-related proteins (TLR4, NF-κB, TNF-α) was significantly increased in rats of the LPS group ( p < 0.01, Fig. 5 ). The LPS + NC adenoviral vector group exhibited results similar to those of the LPS group (Fig. 5 ). However, after using the miR-140-5p inhibitor, the expression of TLR4 and TNF-α was significantly decreased ( p < 0.01), while the decrease in NF-κB expression was not statistically significant but showed an overall downward trend (Fig. 5 ). PDTC treatment further reduced the expression of TLR4 and TNF-α, demonstrating a more pronounced effect compared to the LPS + miR-140-5p inhibitor group ( p < 0.01, Fig. 5 ). Table 4 Expression levels of TLR4, NF-κB, and TNF-α proteins in different rat groups ((/β-actin) ±s, n = 6) Group Number of cases TLR4 NF-κB TNF-α Control group 6 0.15 ± 0.07 0.07 ± 0.01 0.11 ± 0.03 LPS group 6 1.20 ± 0.12 △ 0.86 ± 0.09 △ 0.88 ± 0.08 △ LPS + NC adenoviral vector group 6 1.09 ± 0.04 △ 0.86 ± 0.03 △ 0.70 ± 0.03 △ LPS + miR-140-5p inhibitor group 6 0.55 ± 0.11 * 0.74 ± 0.11 ** 0.55 ± 0.02 * LPS + PDTC group 6 0.21 ± 0.04 ▽ 0.18 ± 0.02 ▽ 0.19 ± 0.09 ▽ A. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group Compared with the control group, △ P < 0.01;Compared with the LPS group, *P < 0.01 , ▽ P < 0.01; Compared to LPS + miR-140-5p inhibitor group: ▽ P < 0.01. Note 2 Figure (d): β-actin was used as the internal reference protein; this study analyzed only data from lanes A, B, D, E, and H. Lane Numbers correspond to groups: A. Control group, B. LPS group, D. LPS + NC adenoviral vector group, E. LPS + miR-140-5p inhibitor group, H. LPS + PDTC group; Other lanes represent additional groups from concurrent experiments and were not included in this conclusion derivation. 3.3 Expression Levels of IL-1β and IL-18 in Rat Serum Across Experimental Groups ELISA results indicated: Compared with the control group, the expression levels of pro-inflammatory cytokines (including IL-1β and IL-18) in LPS-treated rats were significantly increased ( p < 0.01, Fig. 3). Both inhibition of miR-140-5p and NF-κB significantly reduced the levels of inflammatory factors in rats ( p < 0.01, Fig. 3). Table 2 Expression levels of inflammatory factors IL-1β and IL-18 in rat serum ( ±s,n = 6) Group Number of cases IL-1β IL-18 Control group 6 23.44 ± 0.83 12.92 ± 0.59 LPS group 6 39.79 ± 0.95 △ 20.51 ± 0.79 △ LPS + NC adenoviral vector group 6 39.68 ± 0.75 △ 20.39 ± 0.85 △ LPS + miR-140-5p inhibitor group 6 34.37 ± 1.10 * 17.52 ± 0.6 * LPS + PDTC group 6 26.48 ± 0.75 ▽ 14.25 ± 0.94 ▽ Note Panel (a): Levels of IL-1β in each group (n = 6 ); Panel (b): Levels of IL-18 in different groups (n = 6 ); A. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group; Compared with the control group, △ P < 0.01 ; Compared with the LPS group, *P < 0.01, ▽ P < 0.01; Compared with the LPS + NC group: *P < 0.01 ; Compared with LPS + miR-140-5p inhibitor: ▽ P < 0.01. 3.4 Expression levels of TLR4, NF-κB, TNF-α mRNA, and miRNA-140-5p in intrahepatic bile duct tissues across experimental groups Compared with the control group, the LPS group demonstrated significantly elevated mRNA levels of TLR4, NF-κB, and TNF-α ( p < 0.01, Fig. 4), while miR-140-5p expression was reduced ( p < 0.01, Fig. 4). The LPS + NC adenoviral vector group exhibited results comparable to the LPS group (Fig. 4). Compared with the LPS group, the expression levels of TLR4, NF-κB, and TNF-α mRNA in the LPS + miR-140-5p inhibitor group significantly decreased ( p < 0.01, Fig. 4); Compared with the LPS group, the LPS + PDTC group also showed decreased levels of TLR4 and TNF-α mRNA; however, it is noteworthy that the expression level of miR-140-5p mRNA significantly increased in this group ( p < 0.01, Fig. 4). Table 3 Expression levels of TLR4, NF-κB, TNF-α, and miR-140-5p mRNA in rats from each group (2 −ΔΔCt method, ±s, n = 6) Group Number of cases TLR4 NF-κB TNF-α miR-140-5p Control group 6 1.39 ± 0.37 1.08 ± 0.42 2.18 ± 1.14 1.16 ± 0.17 LPS group 6 8.12 ± 1.37 △ 12.07 ± 2.06 △ 11.13 ± 1.77 △ 0.35 ± 0.07 △ LPS + NC adenoviral vector group 6 7.14 ± 1.27 △ 12.37 ± 1.39 △ 11.75 ± 2.84 △ 0.33 ± 0.08 △ LPS + miR-140-5p inhibitor group 6 3.60 ± 0.76 * 5.47 ± 1.14 * 7.60 ± 1.95 * 0.18 ± 0.03 * LPS + PDTC group 6 2.06 ± 0.48 ▽ 3.02 ± 1.19 ▽ 2.22 ± 0.41 ▽ 0.65 ± 0.19 ▽ Note A. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group(a). Expression levels of TLR4 mRNA in different groups (n = 6); (b). Expression levels of NF-κB mRNA in different groups (n = 6);(c). Levels of TNF-α miRNA in different groups (n = 6); (d). Levels of miR-140-5p in different groups (n = 6); Compared with the control group, △ P < 0.01 ; Compared with the LPS group, * P < 0.05, ▽ P < 0.01; Compared with LPS + miR-140-5p inhibitor: ▽ P < 0.05. 3.5 Expression levels of TLR4, NF-κB, and TNF-α proteins in intrahepatic bile duct tissues from various groups of rats Compared with the control group, the expression of inflammation-related proteins (TLR4, NF-κB, TNF-α) was significantly increased in rats of the LPS group ( p < 0.01, Fig. 5 ). The LPS + NC adenoviral vector group exhibited results similar to those of the LPS group (Fig. 5 ). However, after using the miR-140-5p inhibitor, the expression of TLR4 and TNF-α was significantly decreased ( p < 0.01), while the decrease in NF-κB expression was not statistically significant but showed an overall downward trend (Fig. 5 ). PDTC treatment further reduced the expression of TLR4 and TNF-α, demonstrating a more pronounced effect compared to the LPS + miR-140-5p inhibitor group ( p < 0.01, Fig. 5 ). Table 4 Expression levels of TLR4, NF-κB, and TNF-α proteins in different rat groups ((/β-actin) ±s, n = 6) Group Number of cases TLR4 NF-κB TNF-α Control group 6 0.15 ± 0.07 0.07 ± 0.01 0.11 ± 0.03 LPS group 6 1.20 ± 0.12 △ 0.86 ± 0.09 △ 0.88 ± 0.08 △ LPS + NC adenoviral vector group 6 1.09 ± 0.04 △ 0.86 ± 0.03 △ 0.70 ± 0.03 △ LPS + miR-140-5p inhibitor group 6 0.55 ± 0.11 * 0.74 ± 0.11 ** 0.55 ± 0.02 * LPS + PDTC group 6 0.21 ± 0.04 ▽ 0.18 ± 0.02 ▽ 0.19 ± 0.09 ▽ A. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group Compared with the control group, △ P < 0.01;Compared with the LPS group, *P < 0.01 , ▽ P < 0.01; Compared to LPS + miR-140-5p inhibitor group: ▽ P < 0.01. Note 2 Figure (d): β-actin was used as the internal reference protein; this study analyzed only data from lanes A, B, D, E, and H. Lane Numbers correspond to groups: A. Control group, B. LPS group, D. LPS + NC adenoviral vector group, E. LPS + miR-140-5p inhibitor group, H. LPS + PDTC group; Other lanes represent additional groups from concurrent experiments and were not included in this conclusion derivation. Discussion Cholangitis is an inflammatory disease affecting intrahepatic and extrahepatic bile ducts, with its pathological core lying in structural damage and functional impairment triggered by abnormal activation of cholangiocytes (BDECs). When BDECs are activated by exogenous stimuli, they undergo pathological proliferation and secrete large amounts of inflammatory mediators (such as cytokines and chemokines), thereby recruiting and activating infiltrating immune cells [24] . Activated immune cells (e.g., neutrophils and macrophages) can directly attack BDECs, leading to cellular damage and compromising the structural integrity of the biliary ducts [12] . In this study, using an LPS-induced cholangitis model in rats, we demonstrated significant inflammatory infiltration in biliary duct tissues of the LPS group. Transmission Electron Microscope observations revealed characteristic pathological alterations in BDECs, including widened intercellular spaces, ruptured cell and mitochondrial membranes, irregular nuclear morphology, dissolved mitochondrial matrix, disrupted and vanished cristae structures, and dilated endoplasmic reticulum. Immunohistochemistry and molecular detection revealed increased positive expression of NF-κB protein, significantly elevated serum levels of IL-1β and IL-18, and enhanced mRNA and protein expression of TLR4, NF-κB, and TNF-α. These findings indicate that NF-κB plays a critical regulatory role in cholangitis-related inflammatory responses, whichHu [ 25 ] 、Zhang [ 26 ] is consistent with the research results reported by others, further corroborating the central position of NF-κB in the cholangitis inflammatory cascade. Intervention experiments with NF-κB inhibitors demonstrated significantly reduced expression levels of IL-1β, IL-18, TLR4, and TNF-α compared to the LPS group, directly confirming a positive correlation between NF-κB and cholangitis inflammatory responses in rats. As a highly conserved small non-coding RNA, the inflammatory regulatory function of miR-140-5p exhibits significant tissue microenvironment specificity, manifesting diametrically opposed effects across different models [ 27 ] . Some studies indicate that it can exert anti-inflammatory protective effects by directly targeting the TNF-α signaling pathway and TLR4 receptor, thereby inhibiting NF-κB nuclear translocation and the release of downstream pro-inflammatory factors such as IL-6 and IL-8, ultimately blocking the uncontrolled positive feedback loop of inflammation [ 28 ] . In osteoarthritis models, exogenous miR-140-5p mimic significantly promotes chondrocyte proliferation and autophagy by inhibiting NF-κB p65 protein activation, effectively delaying joint degeneration [29] In LPS-induced myocardial injury, this miRNA binds to TLR4 mRNA to promote its degradation, negatively regulates the over-activation of the TLR4/NF-κB pathway, and alleviates myocardial inflammatory responses [29,30] . This inter-tissue protective effect suggests that miRNA-140-5p may be a universal therapeutic target for regulating cellular inflammation-repair mechanisms. However, miRNA families exhibit heterogeneity in bile duct diseases and associated hepatic metabolic disorders; for instance, miR-381-3p promotes HSC activation and biliary liver fibrosis by regulating Klf6 [ 31 ] , while miR-140-5p directly targets glycogen synthase 1 (GYS1) and protein phosphatase 1 catalytic subunit gamma (PPP1CC) to downregulate their expression and aggravate insulin resistance in insulin-resistant HepG2 cells [20] ; Therefore, the regulatory role of miR-140-5p in cholangiopathy requires further validation. In this study, a cholangitis model was established by LPS injection into the common bile duct. After inhibiting miR-140-5p expression, serum IL-1β and IL-18 levels significantly decreased, and biliary duct tissue damage was markedly alleviated compared with the LPS group, suggesting that miR-140-5p expression levels may be positively correlated with the severity of cholangitis. Further validation through qPCR and Western blot experiments revealed that mRNA and protein expression levels of TNF-α, TLR4, and NF-κB in the miR-140-5p inhibitors group were significantly lower than those in the LPS group ( p < 0.05). This further suggests a positively correlated regulatory relationship between miR-140-5p and NF-κB signaling pathway activation. However, the specific regulatory mechanism (e.g., direct targeting or indirect mediation) requires further investigation through subsequent experiments ; However, the LPS + NC adenoviral vector group demonstrated similar results to the LPS group (p > 0.05), confirming the specific regulatory role of miR-140-5p and excluding interference from the adenoviral vector itself on experimental outcomes. Notably, the reduction in NF-κB protein expression was not significant after inhibition of miR-140-5p expression (p > 0.05), which may be related to experimental conditions such as an early time point of tissue harvesting or the inflammatory response being in a dynamic regulatory phase. Nevertheless, the overall downward trend remained consistent with the aforementioned regulatory relationships and phenotypic results. Significantly, LPS-induced inflammatory rats exhibited a substantial increase in miR-140-5p expression following NF-κB inhibitor intervention (p < 0.01), suggesting a potential negative feedback regulatory mechanism between them. When NF-κB transcriptional activity is inhibited, a negative feedback loop may upregulate miR-140-5p expression. Simultaneously, mRNA expression levels of TNF-α, TLR4, and NF-κB in the LPS group were significantly elevated compared to the control group ( p < 0.01), whereas the mRNA level of miR-140-5p exhibited a downward trend ( p < 0.01). This phenomenon may result from feedback inhibition of miR-140-5p transcription following LPS-induced NF-κB activation, leading to decreased miR-140-5p mRNA levels. This suggests that the feedback inhibition pathway may serve as a potential target for blocking NF-κB-mediated 'cascade amplification' of inflammation. Conclusion miR-140-5p shows a positive correlation with the severity of cholangitis and activation of the NF-κB pathway, and may promote inflammation by positively regulating the NF-κB pathway. Moreover, NF-κB activation may negatively inhibit miR-140-5p transcription to enhance inflammation. Conversely, when its activity is suppressed, it induces high expression of miR-140-5p. This regulatory loop participates in inflammatory self-regulation and provides a novel therapeutic target for blocking NF-κB-mediated inflammatory cascade amplification. Declarations Data Availability Statement The datasets generated for this study are available upon request to the corresponding author. Ethics Statement This work was approved by the Animal Ethics Committee of Guangxi University of Chinese Medicine (Approval No. 2019XLC003-2). Conflicts of Interest The authors declare that they have no competing interests Author Contributions Qingjian Wang designed the research. Ao Luo, Wenjuan Huang, and Yuhan Zhao performed the experiments.Wenjuan Huang analyzed the data and wrote the paper. Yalu Chen and Ao Luo contributed to review and editing. Funding This work was funded by the General Program of the National Natural Science Foundation of China (Grant 82474507), the Youth Science Fund Program of the Guangxi Natural Science Foundation (Grant 2024GXNSFBA010106), the Key Program of the Guangxi Natural Science Foundation (Grant 2024GXNSFDA010025), and the Guangxi Key Research and Development Program (Grant GuiKe AB24010130). References Zhuang Y, Ortega-Ribera M, Thevkar Nagesh P, et al. Bile acid-induced IRF3 phosphorylation mediates cell death, inflammatory responses, and fibrosis in cholestasis-induced liver and kidney injury via regulation of ZBP1. Hepatology. 2024;79(4):752-767. He Y, Fan Z, Sun W, Ouyang L, Wang C. Clinical features, treatment, and outcome of nivolumab-induced cholangitis. Immunopharmacol Immunotoxicol. 2024;46(6):757-762. Strazzabosco M, Fiorotto R, Cadamuro M, et al. Pathophysiologic implications of innate immunity and autoinflammation in the biliary epithelium. Biochim Biophys Acta Mol Basis Dis. 2018;1864(4 Pt B):1374-1379. Banales JM, Huebert RC, Karlsen T, Strazzabosco M, LaRusso NF, Gores GJ. Cholangiocyte pathobiology. Nat Rev Gastroenterol Hepatol. 2019;16(5):269-281. Duan S, Li X, Han J, et al. Transcriptotype-Driven Discovery of Apigenin as a Therapy against Cholestatic Liver Fibrosis: Through Inhibition of PANoptosis and Following Type-I Interferon Responses. Antioxidants (Basel). 2024;13(3):256. Published 2024 Feb 20. Pan W, Yong Y, Li Y, et al. Hepatocyte Mettl3 Deficiency Drives Primary Sclerosing Cholangitis and Liver Fibrosis via Cholangiocyte-Macrophage Crosstalk. Adv Sci (Weinh). Published online December 22, 2025. Fu HY, Xu JM, Ai X, et al. The Clostridium Metabolite P-Cresol Sulfate Relieves Inflammation of Primary Biliary Cholangitis by Regulating Kupffer Cells. Cells. 2022;11(23):3782. Published 2022 Nov 26. Chen J, Zhang S. The Role of Inflammation in Cholestatic Liver Injury. J Inflamm Res. 2023;16:4527-4540. Published 2023 Oct 13. Giordano DM, Pinto C, Maroni L, Benedetti A, Marzioni M. Inflammation and the Gut-Liver Axis in the Pathophysiology of Cholangiopathies. Int J Mol Sci. 2018;19(10):3003. Published 2018 Oct 1. O'Hara SP, Tabibian JH, Splinter PL, LaRusso NF. The dynamic biliary epithelia: molecules, pathways, and disease. J Hepatol. 2013;58(3):575-582. Liu X, Huang K, Zhang RJ, Mei D, Zhang B. Isochlorogenic Acid A Attenuates the Progression of Liver Fibrosis Through Regulating HMGB1/TLR4/NF-κB Signaling Pathway. Front Pharmacol. 2020;11:582. ]Jalan-Sakrikar N, Guicciardi ME, O'Hara SP, et al. Central role for cholangiocyte pathobiology in cholestatic liver diseases. Hepatology. 2025;82(4):834-854. Chen SY, Chen X, Zhu S, et al. miR-324-3p Suppresses Hepatic Stellate Cell Activation and Hepatic Fibrosis Via Regulating SMAD4 Signaling Pathway. Mol Biotechnol. 2025;67(2):673-688. Wu L, Zhao M, Chen X, Wang H. A miR-219-5p-bmal1b negative feedback loop contributes to circadian regulation in zebrafish. Commun Biol. 2024;7(1):1671. Published 2024 Dec 19. Bu X, Ding W, Guo S, et al. Differential expression of microRNAs in bile duct obstruction-induced liver fibrosis and the identification of a novel liver fibrosis marker miR-1295b-3p. Ann Transl Med. 2023;11(1):22. Lambrecht J, Verhulst S, Reynaert H, van Grunsven LA. The miRFIB-Score: A Serological miRNA-Based Scoring Algorithm for the Diagnosis of Significant Liver Fibrosis. Cells. 2019;8(9):1003. Published 2019 Aug 29. Gong AY, Zhou R, Hu G, et al. MicroRNA-513 regulates B7-H1 translation and is involved in IFN-gamma-induced B7-H1 expression in cholangiocytes. J Immunol. 2009;182(3):1325-1333. Wang H, Wu C, Kong D. miR-140-5p Overexpression Protects Against Lipopolysaccharide-Induced Necrotizing Pneumonia via Targeting Toll-Like Receptor 4. Cell Mol Bioeng. 2021;14(4):339-348. Published 2021 May 10. Xing J, Fan S, Liu H, Zhang S, Li N. CircZNF644 aggravates lipopolysaccharide-induced HK-2 cell impairment via the miR-140-5p/MLKL axis. J Bioenerg Biomembr. 2022;54(4):215-226. Li X, Ye Y, Wang B, Zhao S. miR-140-5p Aggravates Insulin Resistance via Directly Targeting GYS1 and PPP1CC in Insulin-Resistant HepG2 Cells. Diabetes Metab Syndr Obes. 2021 Jun 4;14:2515-2524. Li W, Zhao S, Yang H, et al. Potential Novel Prediction of TMJ-OA: MiR-140-5p Regulates Inflammation Through Smad/TGF-β Signaling. Front Pharmacol. 2019;10:15. Published 2019 Jan 23. Su J, Ren J, Chen H, Liu B. MicroRNA-140-5p ameliorates the high glucose-induced apoptosis and inflammation through suppressing TLR4/NF-κB signaling pathway in human renal tubular epithelial cells. Biosci Rep. 2020;40(3):BSR20192384. Zhang Q, Weng Y, Jiang Y, Zhao S, Zhou D, Xu N. Overexpression of miR-140-5p inhibits lipopolysaccharide-induced human intervertebral disc inflammation and degeneration by downregulating toll-like receptor 4. Oncol Rep. 2018;40(2):793-802. Pinto C, Giordano DM, Maroni L, Marzioni M. Role of inflammation and proinflammatory cytokines in cholangiocyte pathophysiology. Biochim Biophys Acta Mol Basis Dis. 2018;1864(4 Pt B):1270-1278. Hu S, Russell JO, Liu S, et al. β-Catenin-NF-κB-CFTR interactions in cholangiocytes regulate inflammation and fibrosis during ductular reaction. Elife. 2021;10:e71310. Published 2021 Oct 5. Zhang Z, Zhong X, Shen H, et al. Biliary NIK promotes ductular reaction and liver injury and fibrosis in mice. Nat Commun. 2022;13(1):5111. Published 2022 Aug 30. Pan W, Wang Y, Zhao C. miR-140-5p attenuates hepatic fibrosis by directly targeting TGFβR1. Scand J Gastroenterol. 2023;58(11):1335-1343. Chen X, Deng T, Huo T, Dong F, Deng J. MiR-140-5p/TLR4 /NF-κB signaling pathway: Crucial role in inflammatory response in 16HBE cells induced by dust fall PM2.5. Ecotoxicol Environ Saf. 2021;208:111414. Papathanasiou I, Balis C, Trachana V, Mourmoura E, Tsezou A. The synergistic function of miR-140-5p and miR-146a on TLR4-mediated cytokine secretion in osteoarthritic chondrocytes. Biochem Biophys Res Commun. 2020;522(3):783-791. Yang Y, Liu D, Xi Y, Li J, Liu B, Li J. Upregulation of miRNA-140-5p inhibits inflammatory cytokines in acute lung injury through the MyD88/NF-κB signaling pathway by targeting TLR4. Exp Ther Med. 2018;16(5):3913-3920. Gao Y, Chen Y, Mang Y, Zhang X, Li X, Zhang S. Cholangiocyte-derived exosomal miR-381-3p promotes hepatic stellate cell activation and cholestatic liver fibrosis via targeting Klf6. Regen Ther. 2025;30:769-777. Published 2025 Sep 26. Additional Declarations No competing interests reported. Supplementary Files Explanation20260303232653.pdf Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 02 Apr, 2026 Reviews received at journal 01 Apr, 2026 Reviews received at journal 01 Apr, 2026 Reviews received at journal 27 Mar, 2026 Reviewers agreed at journal 23 Mar, 2026 Reviewers agreed at journal 22 Mar, 2026 Reviewers agreed at journal 22 Mar, 2026 Reviewers agreed at journal 21 Mar, 2026 Reviewers agreed at journal 20 Mar, 2026 Reviewers agreed at journal 20 Mar, 2026 Reviewers agreed at journal 19 Mar, 2026 Reviewers invited by journal 18 Mar, 2026 Editor assigned by journal 17 Mar, 2026 Editor invited by journal 10 Mar, 2026 Submission checks completed at journal 09 Mar, 2026 First submitted to journal 04 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8955884","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":608913429,"identity":"97fbb688-d670-4897-baae-8f92057241cf","order_by":0,"name":"Qingjian Wang","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qingjian","middleName":"","lastName":"Wang","suffix":""},{"id":608913430,"identity":"c54c6f6f-4e65-4fc7-b252-3cc19ae21ef0","order_by":1,"name":"Ao Luo","email":"","orcid":"","institution":"Guangxi University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ao","middleName":"","lastName":"Luo","suffix":""},{"id":608913431,"identity":"f127027a-9aae-4c3b-80c7-d7b7f905d04d","order_by":2,"name":"Wenjuan Huang","email":"","orcid":"","institution":"Guangxi University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenjuan","middleName":"","lastName":"Huang","suffix":""},{"id":608913433,"identity":"41473530-48a8-4661-a0c4-7c97711572e1","order_by":3,"name":"Yuhan Zhao","email":"","orcid":"","institution":"Guangxi University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuhan","middleName":"","lastName":"Zhao","suffix":""},{"id":608913436,"identity":"60d546ce-21bd-4eb9-bc51-480f7fa4a26b","order_by":4,"name":"Yalu Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYDACCTBpwcDP3thwIKFCQk6eSC0SDJI9hxsPPDhjYWzYQKwWgxvpzQcftlUkMhwgoIN/dvOxxzw1EokbDiQ2HEicJ5HA2MD88NENfJbcOZZuzHNMInHmgYNALdsk8tgZ2IyNc/BoMZDIMZPmYZNI7DvYCNZSzNjAwyaNX0v+N2mefxKJDYcZgVrmABkHCGrJYZPmbZNInHAMpKWBCC0SN9LMJOf2SRjP7AFqSTgmYWzYTMAv/DOSn0m8+WYj2y///PHHHzV1cvLszQ8f49MCAkw8KFxmAspBgPEHEYpGwSgYBaNgBAMAbxRSDpPy8jYAAAAASUVORK5CYII=","orcid":"","institution":"The First Affiliated Hospital of Guangxi University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Yalu","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2026-02-24 10:09:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8955884/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8955884/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105055131,"identity":"4d6a5a5f-fe08-457e-b50e-64a525934d1f","added_by":"auto","created_at":"2026-03-20 11:26:22","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":175084,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological changes of bile duct cells in each group\u003c/p\u003e\n\u003cp\u003eNote:A. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group\u003c/p\u003e\n\u003cp\u003eControl group: Tight intercellular spaces, intact cell membrane structure, irregular nuclei, intact mitochondrial membrane, sparse matrix with reduced cristae; slightly dilated endoplasmic reticulum. LPS group: Widened intercellular spaces, damaged cell membrane and mitochondrial membrane, irregular nuclei, dissolved matrix, fractured and disappeared cristae, significantly dilated endoplasmic reticulum. In the LPS + NC adenoviral vector group, the bile duct cell junctions showed no widening, with no significant rupture observed on the cell membrane. The nuclei appeared relatively small. Mitochondria exhibited partial membrane rupture with substantial matrix dissolution and residual cristae fragments. The endoplasmic reticulum displayed marked dilation and vacuolation. In the LPS + miR-140-5p inhibitors group, bile duct cell junctions showed multiple areas of slight widening with minor membrane rupture. The nuclei appeared approximately oval-shaped. Most mitochondria maintained intact membranes, though the matrix density was slightly reduced. Cristae were partially fractured and disorganized, while the majority of the endoplasmic reticulum appeared moderately dilated. In the LPS + PDTC group, bile duct cells were arranged compactly with intact cell membrane structures. Nuclei appeared irregular with slightly dense heterochromatin. Most mitochondria maintained intact membranes, exhibiting slightly sparse matrices and shortened cristae. A minority of mitochondria showed membrane rupture, while the majority of endoplasmic reticulum appeared slightly dilated.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8955884/v1/7e8d72ec97f192629385d93b.jpg"},{"id":105055129,"identity":"2e40fe68-ebb8-4d58-9d44-be7d98a0b379","added_by":"auto","created_at":"2026-03-20 11:26:21","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":96172,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of NF-κB in intrahepatic bile duct tissues in rats\u003c/p\u003e\n\u003cp\u003eNote: A. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group\u003c/p\u003e\n\u003cp\u003eControl group: NF-κB protein showed weak positivity, approximately \u0026gt;70%. LPS group: NF-κB protein exhibited strong positivity, approximately \u0026gt;90%. LPS + NC adenoviral vector group: NF-κB protein demonstrated strong positivity, approximately \u0026gt;90%. LPS + miR-140-5p inhibitor group: NF-κB protein displayed moderate positivity, approximately \u0026gt;90%. LPS + PDTC group: NF-κB protein showed moderate positivity, approximately \u0026gt;70%.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8955884/v1/9e3cd09784be6fc14a6e480e.jpg"},{"id":105055099,"identity":"8d657cd9-2367-4b7b-ba1e-c9fe9106aa6a","added_by":"auto","created_at":"2026-03-20 11:26:17","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":56643,"visible":true,"origin":"","legend":"\u003cp\u003eNote: Panel (a): Levels of IL-1β in each group (n = 6 ); Panel (b): Levels of IL-18 in different groups (n = 6 );\u003c/p\u003e\n\u003cp\u003eA. Control group\u0026nbsp; B. LPS group\u0026nbsp; C. LPS + NC adenoviral vector group\u0026nbsp; D. LPS + miR-140-5p inhibitor group\u0026nbsp; E. LPS + PDTC group; Compared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e0.01 ; Compared with the LPS group, \u003cem\u003e*P\u0026lt;\u003c/em\u003e0.01，\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u0026lt;\u003c/em\u003e0.01; Compared with the LPS+NC group: \u003cem\u003e*P\u0026lt;0.01\u003c/em\u003e; Compared with LPS+miR-140-5p inhibitor: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u0026lt;\u003c/em\u003e0.01.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8955884/v1/e7574c33d072b7697c374cbe.jpg"},{"id":105055193,"identity":"1ead9d45-080e-48e9-a960-3c80aff11d1d","added_by":"auto","created_at":"2026-03-20 11:26:41","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":63544,"visible":true,"origin":"","legend":"\u003cp\u003eNote: A. Control group\u0026nbsp; B. LPS group\u0026nbsp; C. LPS + NC adenoviral vector group\u0026nbsp; D. LPS + miR-140-5p inhibitor group\u0026nbsp; E. LPS + PDTC group(a). Expression levels of TLR4 mRNA in different groups (n = 6); (b). Expression levels of NF-κB mRNA in different groups (n = 6);(c). Levels of TNF-α miRNA in different groups (n = 6); (d). Levels of miR-140-5p in different groups (n = 6); Compared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e0.01 ; Compared with the LPS group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05，\u003csup\u003e▽\u003c/sup\u003eP\u0026lt;0.01; Compared with LPS+miR-140-5p inhibitor: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8955884/v1/f20c01136d9ca0f576d30d79.jpg"},{"id":105055102,"identity":"47f7474a-3a17-4ede-a100-771c05a14bbc","added_by":"auto","created_at":"2026-03-20 11:26:20","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":79752,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cimg width=\"594\" height=\"389\" src=\"file:///C:/Users/pgs9865/AppData/Local/Temp/msohtmlclip1/01/clip_image001.gif\"/\u003eNote 1: (a) Expression levels of TLR4 protein in different groups (n = 6); (b) Expression levels of NF-κB protein in different groups (n = 6); (c) Levels of TNF-α protein in different groups (n = 6); (d) Electrophoretic bands of TLR4, NF-κB, and TNF-α proteins;\u003c/p\u003e\n\u003cp\u003eA. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group\u003c/p\u003e\n\u003cp\u003eCompared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;0.01；Compared with the LPS group, \u003cem\u003e*P\u0026lt;0.01\u003c/em\u003e，\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u0026lt;\u003c/em\u003e0.01; Compared to LPS + miR-140-5p inhibitor group: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u0026lt;\u003c/em\u003e0.01.\u003c/p\u003e\n\u003cp\u003eNote 2: Figure (d): β-actin was used as the internal reference protein; this study analyzed only data from lanes A, B, D, E, and H. Lane Numbers correspond to groups: A. Control group, B. LPS group, D. LPS + NC adenoviral vector group, E. LPS + miR-140-5p inhibitor group, H. LPS + PDTC group; Other lanes represent additional groups from concurrent experiments and were not included in this conclusion derivation.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8955884/v1/f280f53946d487041b28a350.jpg"},{"id":105562946,"identity":"36be5232-243a-49e7-adaf-3cd8c60685d2","added_by":"auto","created_at":"2026-03-27 12:45:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2000063,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8955884/v1/e4d6f05b-4301-42d9-8bb7-9fe704369f37.pdf"},{"id":105055178,"identity":"747f2256-e03c-404e-97d4-0f5cd82178f2","added_by":"auto","created_at":"2026-03-20 11:26:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":305432,"visible":true,"origin":"","legend":"","description":"","filename":"Explanation20260303232653.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8955884/v1/a87672733f4edcba01742cab.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"miR-140-5p is Associated with the NF-κB Signaling Pathway and Exerts an Interventional Effect on Cholangitis in Rats","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCholangitis is primarily characterized by intrahepatic and extrahepatic bile duct damage with persistent inflammatory infiltration\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. It is mainly activated by endogenous damage-associated molecular patterns (DAMPs) released from injured cells or exogenous pathogen-associated molecular patterns (PAMPs) derived from the intestine or systemic circulation\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Activated cholangiocytes recruit immune cells, vascular cells, and mesenchymal cells through intercellular interactions, secreting chemokines, cytokines, and angiogenic factors that initiate and amplify cholestatic inflammation\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e–\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Prolonged exposure of bile duct epithelial cells (BDECs) to cytokine- and chemokine-enriched microenvironments generated by innate and adaptive immune cells contributes to the occurrence of cellular damage\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Sustained low-intensity inflammatory stimulation can induce pathological tissue repair, leading to excessive deposition of scar tissue around damaged bile ducts and triggering cholangiofibrosis. This consequently increases the risk of cholestasis, thereby becoming a significant risk factor for the development of bile duct stones and cholangiocarcinoma\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eToll-like receptor 4 (TLR4), as a canonical pathogen recognition receptor on the surface of cholangiocytes, undergoes receptor oligomerization and conformational changes upon recognition of PAMPs (such as LPS derived from Gram-negative bacteria). By recruiting adaptor proteins including myeloid differentiation primary response protein 88 (MyD88), interleukin-1 receptor-associated kinases (IRAKs), and TIR-domain-containing adapter-inducing interferon-β (TRIF)\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, it transduces signals through either the MyD88-dependent or TRIF-mediated independent pathway\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. This ultimately activates NF-κB, promotes the biosynthesis and release of pro-inflammatory cytokines, and drives the onset of cholangitis\u003csup\u003e[12]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are a class of endogenous non-coding small RNA molecules, approximately 20–24 nucleotides in length, highly conserved throughout evolution\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. They regulate post-transcriptional expression of target genes by specifically binding to the 3ʹ-UTRs or 5ʹ-UTRs of target mRNAs\u003csup\u003e[14]\u003c/sup\u003e. MiRNAs are widely involved in various physiological processes such as cell proliferation, apoptosis, and lipid metabolism\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Recent studies confirm their regulatory roles in the pathogenesis of hepatobiliary diseases through multiple metabolic pathways. For instance, miR-29a-3p suppresses hepatic stellate cell (HSC) activation and alleviates liver fibrosis in mice by inhibiting the expression of bromodomain-containing protein 4 (BRD4)\u003csup\u003e[16]\u003c/sup\u003e. miR-513 is capable of inhibiting the translation of the immune checkpoint molecule B7-H1 in bile duct cells, playing a pivotal regulatory role in primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC)\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003emiR-140-5p has been demonstrated to be significantly associated with inflammatory responses and cellular damage in various inflammatory and cell injury models, and can regulate inflammation and cellular injury by modulating downstream target genes and signaling pathways\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. For instance, overexpression of miR-140-5p can aggravate insulin resistance via directly targeting GYS1 and PPP1CC in insulin-resistant HepG2 cells\u003csup\u003e[20]\u003c/sup\u003e.miR-140-5p promotes the secretion of pro-inflammatory factors and tissue damage in temporomandibular joint osteoarthritis mice by activating the NF-κB pathway through targeted suppression of Smad3, demonstrating its positive regulatory role in inflammation\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. However, in certain models, miR-140-5p targets and binds to TLR4, inhibits the activation of the NF-κB signaling pathway, as validated in rat models of intervertebral disc inflammation and diabetic nephropathy\u003csup\u003e[22,23]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTherefore, the inflammatory regulatory function of miR-140-5p exhibits significant tissue microenvironment specificity, with its specific effector mechanisms closely related to the regulatory patterns of target genes, pathway activation status, and cell type differences. Currently, NF-κB factors are known as the core molecules driving the onset and progression of cholangitis. Given that miR-140-5p modulates pathways including NF-κB in various cellular inflammation models, combined with the unique microenvironment of cholangitis, this study aims to investigate the regulatory mechanism of miR-140-5p on NF-κB and elucidate the role of the miR-140-5p/NF-κB axis in rat cholangitis models.\u003c/p\u003e "},{"header":"Materials and Methods","content":"\u003ch3\u003e1. Experimental Animals\u003c/h3\u003e\u003cp\u003eThirty healthy adult male SD rats of SPF grade were provided by the Animal Experiment Center of Guangxi Medical University (Production License No.: SCXK (Gui) 2020-0003). The experiment was approved by the Ethics Committee of Guangxi University of Chinese Medicine (No. DW20221024-203). Rats were housed at the Scientific Experiment Center of Guangxi University of Chinese Medicine. Following a one-week acclimatization period, experiments were conducted in strict compliance with animal ethics protocols and aseptic techniques.All methods were performed in accordance with the relevant guidelines and regulations.\u003c/p\u003e\u003ch3\u003e2. Animal Grouping and Modeling\u003c/h3\u003e\u003cp\u003eRats were randomly allocated into five groups (n = 6): Control group, LPS group, LPS + NC adenoviral vector group, LPS + miR-140-5p inhibitor group, and LPS + PDTC group. Preoperative administration: Two days prior to modeling, the LPS + NC adenoviral vector group and LPS + miR-140-5p inhibitor group received a single tail vein injection of the corresponding adenoviral vector (2×10⁸ pfu/100µl). In the LPS + PDTC group, the NF-κB inhibitor PDTC (100 mg/kg) was administered via intraperitoneal injection one hour prior to modeling; the control group and LPS group received an equivalent volume of saline.\u003c/p\u003e\u003cp\u003eExcept for the control group, rats in other groups were injected with 0.9 mL of 5 µg/mL LPS into the common bile duct to establish an intrahepatic cholangitis model. Rats were fasted with water deprivation for 12 hours preoperatively, anesthetized via intraperitoneal injection of 2% sodium pentobarbital (0.3 mL/100g), and subjected to laparotomy under sterile conditions to expose the common bile duct. LPS was administered via percutaneous injection, with successful modeling confirmed by ensuring duct distension without collapse. Layered closure of the abdomen was performed, and vital signs were monitored postoperatively. The control group underwent identical surgical procedures, with equivalent saline injections administered preoperatively.\u003c/p\u003e\u003ch3\u003e3. Blood Collection and Serum Separation\u003c/h3\u003e\u003cp\u003eFollowing successful modeling, rats were routinely housed for one week to stabilize the model condition. Daily observations and recordings were made regarding general conditions including food intake, activity levels, and mental status. Preoperatively, rats were fasted for 12 hours (with free access to water) and anesthetized via intraperitoneal injection of 2% sodium pentobarbital (0.3 mL/100g). Post-injection reactions were closely monitored until cessation of voluntary movement, sluggish or absent corneal reflex, and stable respiration were observed. Upon confirmation of adequate anesthesia, rats were immediately euthanized by cervical dislocation. After UV sterilization of the biosafety cabinet, the abdominal aorta was exposed aseptically via laparotomy. Whole blood (4 mL) was collected via puncture at a flow rate of 1 mL/min and allowed to stand at room temperature for 2 hours. Subsequently, samples were centrifuged at 4°C and 3000 rpm for 10 minutes using a cryogenic centrifuge (Model TGL-16M, Xiangyi Centrifuge Instrument Co., Ltd.). Aliquots of 400 µL serum were aspirated and stored at -80°C for ELISA detection of IL-1β and IL-18.\u003c/p\u003e\u003ch3\u003e4. Tissue Sample Collection and Processing\u003c/h3\u003e\u003cp\u003eFollowing blood collection, laparotomy was repeated. Heparin was administered via the inferior vena cava to achieve systemic heparinization in rats. The liver and bile duct were dissected, with bile duct and hepatic portal tissues collected. Hepatic parenchyma was removed to preserve the biliary tree. Part of the biliary duct tissue was flash-frozen in liquid nitrogen and preserved at -80°C for qPCR and Western blot detection. Additionally, 5 pieces of biliary duct tissue (0.5 cm×0.5 cm×0.5 cm) were sectioned using a manual microtome (HistoCore BIOCUT, Leica, Germany), fixed in 4% neutral buffered formalin, and prepared for Transmission Electron Microscope observation and immunohistochemical detection of NF-κB expression in cells.\u003c/p\u003e\u003ch3\u003e5. Preparation of TEM Specimens\u003c/h3\u003e\u003cp\u003eFixed biliary duct tissue was rapidly processed on ice. Within 3 minutes, 1 mm×1 mm×1 mm fragments were sectioned using a manual microtome, transferred into EM fixative (Product No. G1102, Servicebio Co.) for trimming, sealed with parafilm, and stored at 4°C. Rinse three times with 0.1 M phosphate buffer (PB, pH 7.4) pre-cooled at 4°C (15 minutes each time, gently shake the centrifuge tube to ensure thorough rinsing); fix with 1% osmium tetroxide solution for 2 hours under dark conditions at 4°C; Rinse three times with PB of the same concentration pre-cooled at 4°C (15 minutes each time); Perform gradient dehydration using anhydrous ethanol (Cat#100092183, Sinopharm) and acetone (Cat#10000418, Sinopharm) at 4°C under dark conditions (20 minutes per step); After dehydration completion, gradient infiltration was performed with 812 embedding agent (Cat. No. 90529-77-4, SPI Supplies) at 4°C under light-protected conditions.\u003c/p\u003e\u003ch3\u003e6. Experimental Detection Methods\u003c/h3\u003e\u003ch2\u003e6.1 Transmission Electron Microscopy Observation\u003c/h2\u003e\u003cp\u003eBiliary duct tissue morphological changes were analyzed using a Transmission Electron Microscope (Model HT7800/HT7700, Hitachi, Japan) by examining stained copper grid sections.\u003c/p\u003e\u003ch2\u003e6.2 NF-κB Expression Detection via Immunohistochemistry\u003c/h2\u003e\u003cp\u003eBiliary duct tissues were fixed in 4% paraformaldehyde pre-cooled to 4°C for 24 hours, followed by gentle shaking on a shaker with 0.01 M PBS (pH 7.4) for 3 days (solution replaced every 8 hours to thoroughly remove fixative). After dehydration through a graded ethanol series, clearing in xylene, and embedding in paraffin, tissues were sectioned into 5 µm-thick continuous slices using a manual microtome. Sections were mounted on poly-L-lysine-coated anti-off slides, baked in a 60°C oven for 2 hours, and stored at room temperature for later use. Following deparaffinization and hydration, antigen retrieval was performed using 0.01 M EDTA buffer (pH 9.0) via microwave treatment (heated to boiling at medium-high power, then switched to low power to maintain gentle boiling for 15 minutes, and naturally cooled to room temperature). Washed 3 times with 0.01 M PBS for 5 minutes each time; Add 3% hydrogen peroxide solution and block endogenous peroxidase at room temperature under light-protected conditions for 15 minutes; Wash 3 times with 0.01 M PBS for 5 minutes each; Add 5% bovine serum albumin (BSA) blocking solution and incubate in a humid chamber at 37°C for 30 minutes. Discard the blocking solution (do not wash); Add NF-κB primary antibody (diluted according to experimental targets) and incubate overnight in a humid chamber at 4°C; Wash 3 times with 0.01 M PBS for 5 minutes each; Add diluted secondary antibody working solution (Boster Goat Anti-Mouse IgG, Cat. No. BA1050) and incubate in a humid chamber at 37°C for 30 minutes; Wash 3 times with 0.01 M PBS for 5 minutes each; DAB chromogen solution (Boster Biological Technology) was added dropwise, and color development was monitored under light avoidance at room temperature for 3–5 minutes; color development was terminated by thorough rinsing with tap water. Nuclei were counterstained with hematoxylin staining solution for 5 minutes, followed by bluing with tap water for 2 minutes. After dehydration through graded ethanol series and clearing with xylene, sections were mounted with neutral balsam. NF-κB positive expression was observed and analyzed under an optical microscope.\u003c/p\u003e\u003ch2\u003e6.3 Detection of serum IL-1β and IL-18 levels by ELISA\u003c/h2\u003e\u003cp\u003eOperations were performed according to the kit instructions: concentrated washing buffer was diluted 1:20; substrates A and B were mixed in equal volumes. After thawing on ice, serum samples were centrifuged at 4°C and 4000g for 5 minutes using a high-speed centrifuge (Model TGL-16R, Zhujiang Heima). The supernatant was then collected. The microplate was equilibrated at room temperature for 20 minutes. Standard wells, sample wells (10 µL serum + 40 µL diluent), and blank wells were designated. 100 µL of HRP-labeled detection antibody was added to all wells except the blank wells, followed by incubation at 37°C for 60 minutes. After five washes, 50 µL each of substrate A and B solutions were added, and light-protected incubation was conducted for 15 minutes. After adding the stop solution, the optical density (OD) was measured at 450 nm using a microplate reader (Model 3530910449, Thermo Fisher Scientific). Concentrations were calculated using the standard curve method.\u003c/p\u003e\u003ch2\u003e6.4 qPCR Detection of mRNA and miRNA Expression Levels\u003c/h2\u003e\u003ch2\u003e6.4.1 RNA Extraction and Quality Assessment\u003c/h2\u003e\u003cp\u003eBiliary duct tissue was homogenized with 1 mL TRIZOL reagent (Cat# XY-001, Xingyu Biology, Guangzhou). After chloroform addition for emulsification and centrifugation, the upper aqueous phase was collected. RNA was precipitated with isopropanol, washed with 75% ethanol, dissolved in DEPC-treated water, and stored at -80°C following concentration measurement using a NanoDrop2000 spectrophotometer (eppendorf). RNA purity and integrity were evaluated by UV spectrophotometry.\u003c/p\u003e\u003ch2\u003e6.4.2 Genomic DNA Removal, cDNA Synthesis and Amplification\u003c/h2\u003e\u003cp\u003eRNA underwent genomic DNA removal via gDNA adsorption column, followed by heat denaturation at 65°C and ice bath. The reverse transcription reaction system was prepared on ice according to the manufacturer's protocol of the reverse transcription kit (Cat. No. R211-02, Novizan), with reverse transcription performed at 37°C for 42 minutes and 98°C for 5 minutes. The resulting cDNA was diluted 5-fold and stored at -20°C. Primers were synthesized by Sangon Biotech (sequences listed in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). A 20 µL reaction system was prepared using AceQ qPCR SYBR Green Master Mix (Cat. No. Q121-02, Novizan) and amplified on a fluorescence quantitative PCR instrument (Model Q2000B, Hangzhou Langji). ACTIN served as the internal reference for TLR4, NF-κB, and TNF-α, while U6 was used as the internal reference for miR-140-5p. Data analysis was performed using the 2\u003csup\u003e−△△Ct\u003c/sup\u003e method.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab1\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer Sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\"\u003e \u003cp\u003ePrimer Sequence ( 5’-3’)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eFragment Length ( bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" rowspan=\"2\"\u003e \u003cp\u003eACTIN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eForward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" rowspan=\"2\"\u003e \u003cp\u003eAGGGAAATCGTGCGTGACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" rowspan=\"2\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eReverse:\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" rowspan=\"2\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eForward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eACCAGGAGAAAGTCAGCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" rowspan=\"2\"\u003e \u003cp\u003e249\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eReverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eGCTGGGTAGAGAACGGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" rowspan=\"2\"\u003e \u003cp\u003eNF-kB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eForward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eTGACGGGAGGGGAAGAAATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" rowspan=\"2\"\u003e \u003cp\u003e211\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eReverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eTGAACAAACACGGAAGCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" rowspan=\"2\"\u003e \u003cp\u003eTLR4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eForward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eTCCAAAGAGTCTAGCCGTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" rowspan=\"2\"\u003e \u003cp\u003e229\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eReverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eAAGCACACTGACCACCGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" rowspan=\"3\"\u003e \u003cp\u003eMIR-140-5P\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eRT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eCTCAACTGGTGTCGTGGAGTCGGCAATTCA\u003c/p\u003e \u003cp\u003eGTTGAGCTACCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" rowspan=\"3\"\u003e \u003cp\u003e74\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eForward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eACACTCCAGCTGGG\u003c/p\u003e \u003cp\u003eCAGTGGTTTTACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eReverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eCTCAACTGGTGTCGTGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" rowspan=\"2\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eForward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eCTCGCTTCGGCAGCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" rowspan=\"2\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eReverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eAACGCTTCACGAATTTGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e\u003ch2\u003e6.5 Western Blot Detection of Protein Expression Levels\u003c/h2\u003e\u003ch2\u003e6.5.1 Preparation of Lysis Buffer and Protein Quantification\u003c/h2\u003e\u003cp\u003e50 mg of biliary duct tissue was added to 0.5 mL of pre-chilled RIPA lysis buffer (Catalog No. P0013, BiYunTian), 1 µL Cocktail (Catalog No. G2006-250UL, Servicebio), and 1 µL phosphatase inhibitor (Catalog No. P1045, BiYunTian). The mixture was homogenized at 12,000 rpm, followed by ice bath incubation for 30 minutes. After centrifugation at 4°C and 12,000 g for 10 minutes, the supernatant was collected. Protein concentrations were quantified using a BCA assay kit (Cat. No. P0011, BiYunTian), with absorbance measured at 562 nm using a microplate reader, and calculated via the standard curve method.\u003c/p\u003e\u003ch2\u003e6.5.2 Electrophoresis, Transfer, and Incubation\u003c/h2\u003e\u003cp\u003ePrepared 5% stacking gel and 10% separating gel. Loaded 20 µg protein per lane along with Pre-stained Protein Marker (Cat. No. G2058-250UL, Servicebio). Performed vertical electrophoresis (Model VE180, Shanghai Techcomp) at 80 V initially, then increased to 120 V after the separation gel interface until electrophoresis completion. Gels were immersed in transfer buffer for 10 minutes. PVDF membranes (Cat. No. IPVH00010, MILLIPORE) were activated with methanol and assembled into transfer sandwiches. Proteins were transferred at 120V constant voltage for 60 minutes using a transfer electrophoresis tank (Model VE186, Shanghai Techcomp). Membranes were blocked with 5% skimmed milk in TBST buffer for 1h. After washing with TBST, diluted primary antibodies (TLR4, NF-κB, TNF-α, and internal reference Anti-GAPDH antibody, Cat# BF0198, Affinity, 1:1500) were added and incubated overnight at 4°C. Following membrane washing, secondary antibodies (1:5000) were incubated at room temperature for 1 hour.\u003c/p\u003e\u003ch2\u003e6.5.3 Development and Analysis\u003c/h2\u003e\u003cp\u003eChemiluminescent reagents (Cat# FP302, ABP Biosciences) Solutions A and B were mixed in equal volumes and applied to cover the membrane surface. Exposure and development were performed using a cassette (Model AX-II, Guangdong Yuehua), and band grayscale values were quantified using ImageJ software.\u003c/p\u003e\u003ch3\u003e7. Statistical Methods\u003c/h3\u003e\u003cp\u003eStatistical analysis was performed using SPSS 26.0 software. Normally distributed measurement data are expressed as mean ± standard deviation (± s ). Multiple group comparisons were analyzed by one-way ANOVA (LSD test for pairwise comparisons when homogeneity of variance was met; Dunnett’s T3 test was used when variances were unequal). A P-value \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Experimental Results","content":"\u003ch2\u003e3.1 Morphological Changes in Intrahepatic Bile Duct Tissues of Rats Across Groups\u003c/h2\u003e\u003cp\u003eTissue samples underwent double staining with uranyl acetate and lead citrate, and pathological features were observed using a transmission electron microscope. Histological analysis revealed normal tissue architecture in the control group rats (Fig.\u0026nbsp;1). Biliary duct tissues from the LPS group exhibited widened intercellular spaces, ruptured cell and mitochondrial membranes, irregular nuclear morphology, matrix dissolution, cristae fragmentation and disappearance, and significantly dilated endoplasmic reticulum (Fig.\u0026nbsp;1). Bile duct cells in the LPS + NC adenoviral vector group showed similar histopathological damage to those in the LPS group (Fig.\u0026nbsp;1). In contrast, rats treated with the miR-140-5p inhibitor and PDTC demonstrated significantly alleviated injury compared to the LPS group ( Fig.\u0026nbsp;1).\u003c/p\u003e\u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eA. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group\u003c/p\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003eControl group: Tight intercellular spaces, intact cell membrane structure, irregular nuclei, intact mitochondrial membrane, sparse matrix with reduced cristae; slightly dilated endoplasmic reticulum. LPS group: Widened intercellular spaces, damaged cell membrane and mitochondrial membrane, irregular nuclei, dissolved matrix, fractured and disappeared cristae, significantly dilated endoplasmic reticulum. In the LPS + NC adenoviral vector group, the bile duct cell junctions showed no widening, with no significant rupture observed on the cell membrane. The nuclei appeared relatively small. Mitochondria exhibited partial membrane rupture with substantial matrix dissolution and residual cristae fragments. The endoplasmic reticulum displayed marked dilation and vacuolation. In the LPS + miR-140-5p inhibitors group, bile duct cell junctions showed multiple areas of slight widening with minor membrane rupture. The nuclei appeared approximately oval-shaped. Most mitochondria maintained intact membranes, though the matrix density was slightly reduced. Cristae were partially fractured and disorganized, while the majority of the endoplasmic reticulum appeared moderately dilated. In the LPS + PDTC group, bile duct cells were arranged compactly with intact cell membrane structures. Nuclei appeared irregular with slightly dense heterochromatin. Most mitochondria maintained intact membranes, exhibiting slightly sparse matrices and shortened cristae. A minority of mitochondria showed membrane rupture, while the majority of endoplasmic reticulum appeared slightly dilated.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e\u003ch2\u003e3.2 Expression levels of NF-κB in biliary duct tissues across experimental groups\u003c/h2\u003e\u003cp\u003eImmunohistochemistry results: Positive NF-κB staining manifested as brownish-yellow granules within intrahepatic bile duct tissues of rats, primarily localized at the cell membrane (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Compared with the control group, NF-κB protein positive expression was enhanced in the LPS group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). NF-κB protein expression in the LPS + NC adenoviral vector group showed no significant change compared with the LPS group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). NF-κB protein positive expression in the LPS + miR-140-5p inhibitor group exhibited a less pronounced decrease compared with the LPS group, but demonstrated an overall downward trend (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eA. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group\u003c/p\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003eControl group: NF-κB protein showed weak positivity, approximately \u0026gt; 70%. LPS group: NF-κB protein exhibited strong positivity, approximately \u0026gt; 90%. LPS + NC adenoviral vector group: NF-κB protein demonstrated strong positivity, approximately \u0026gt; 90%. LPS + miR-140-5p inhibitor group: NF-κB protein displayed moderate positivity, approximately \u0026gt; 90%. LPS + PDTC group: NF-κB protein showed moderate positivity, approximately \u0026gt; 70%.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Expression Levels of IL-1β and IL-18 in Rat Serum Across Experimental Groups\u003c/h2\u003e \u003cp\u003eELISA results indicated: Compared with the control group, the expression levels of pro-inflammatory cytokines (including IL-1β and IL-18) in LPS-treated rats were significantly increased ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;3). Both inhibition of miR-140-5p and NF-κB significantly reduced the levels of inflammatory factors in rats ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab2\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression levels of inflammatory factors IL-1β and IL-18 in rat serum ( \u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e±s,n = 6)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNumber of cases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eIL-18\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e23.44 ± 0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e12.92 ± 0.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e39.79 ± 0.95\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e20.51 ± 0.79\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + NC adenoviral vector group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e39.68 ± 0.75\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e20.39 ± 0.85\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + miR-140-5p inhibitor group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e34.37 ± 1.10\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e17.52 ± 0.6\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + PDTC group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e26.48 ± 0.75\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e14.25 ± 0.94\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003c/p\u003e\u003cp\u003ePanel (a): Levels of IL-1β in each group (n = 6 ); Panel (b): Levels of IL-18 in different groups (n = 6 );\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003eA. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group; Compared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01 ; Compared with the LPS group, \u003cem\u003e*P \u0026lt;\u003c/em\u003e 0.01, \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01; Compared with the LPS + NC group: \u003cem\u003e*P \u0026lt; 0.01\u003c/em\u003e; Compared with LPS + miR-140-5p inhibitor: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4 Expression levels of TLR4, NF-κB, TNF-α mRNA, and miRNA-140-5p in intrahepatic bile duct tissues across experimental groups\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCompared with the control group, the LPS group demonstrated significantly elevated mRNA levels of TLR4, NF-κB, and TNF-α (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4), while miR-140-5p expression was reduced (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4). The LPS + NC adenoviral vector group exhibited results comparable to the LPS group (Fig.\u0026nbsp;4). Compared with the LPS group, the expression levels of TLR4, NF-κB, and TNF-α mRNA in the LPS + miR-140-5p inhibitor group significantly decreased ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4); Compared with the LPS group, the LPS + PDTC group also showed decreased levels of TLR4 and TNF-α mRNA; however, it is noteworthy that the expression level of miR-140-5p mRNA significantly increased in this group ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab3\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression levels of TLR4, NF-κB, TNF-α, and miR-140-5p mRNA in rats from each group (2 \u003csup\u003e−ΔΔCt\u003c/sup\u003e method, \u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e±s, n = 6)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNumber of cases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTLR4\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNF-κB\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003emiR-140-5p\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.39 ± 0.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.08 ± 0.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e2.18 ± 1.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.16 ± 0.17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e8.12 ± 1.37\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e12.07 ± 2.06\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e11.13 ± 1.77\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.35 ± 0.07\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + NC adenoviral vector group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e7.14 ± 1.27\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e12.37 ± 1.39\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e11.75 ± 2.84\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.33 ± 0.08\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + miR-140-5p inhibitor group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e3.60 ± 0.76\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e5.47 ± 1.14\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e7.60 ± 1.95\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.18 ± 0.03\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + PDTC group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e2.06 ± 0.48\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e3.02 ± 1.19\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e2.22 ± 0.41\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.65 ± 0.19\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eA. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group(a). Expression levels of TLR4 mRNA in different groups (n = 6); (b). Expression levels of NF-κB mRNA in different groups (n = 6);(c). Levels of TNF-α miRNA in different groups (n = 6); (d). Levels of miR-140-5p in different groups (n = 6); Compared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01 ; Compared with the LPS group, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e▽\u003c/sup\u003eP \u0026lt; 0.01; Compared with LPS + miR-140-5p inhibitor: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003e3.5 Expression levels of TLR4, NF-κB, and TNF-α proteins in intrahepatic bile duct tissues from various groups of rats\u003c/b\u003e \u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003eCompared with the control group, the expression of inflammation-related proteins (TLR4, NF-κB, TNF-α) was significantly increased in rats of the LPS group (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). The LPS + NC adenoviral vector group exhibited results similar to those of the LPS group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). However, after using the miR-140-5p inhibitor, the expression of TLR4 and TNF-α was significantly decreased (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01), while the decrease in NF-κB expression was not statistically significant but showed an overall downward trend (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). PDTC treatment further reduced the expression of TLR4 and TNF-α, demonstrating a more pronounced effect compared to the LPS + miR-140-5p inhibitor group (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab4\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression levels of TLR4, NF-κB, and TNF-α proteins in different rat groups ((/β-actin) \u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e±s, n = 6)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNumber of cases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTLR4\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNF-κB\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.15 ± 0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.07 ± 0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.11 ± 0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.20 ± 0.12\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.86 ± 0.09\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.88 ± 0.08\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + NC adenoviral vector group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.09 ± 0.04\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.86 ± 0.03\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.70 ± 0.03\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + miR-140-5p inhibitor group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.55 ± 0.11\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.74 ± 0.11\u003cem\u003e**\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.55 ± 0.02\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + PDTC group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.21 ± 0.04\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.18 ± 0.02\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.19 ± 0.09\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003eA. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eCompared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01;Compared with the LPS group, \u003cem\u003e*P \u0026lt; 0.01\u003c/em\u003e, \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01; Compared to LPS + miR-140-5p inhibitor group: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNote 2\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eFigure (d): β-actin was used as the internal reference protein; this study analyzed only data from lanes A, B, D, E, and H. Lane Numbers correspond to groups: A. Control group, B. LPS group, D. LPS + NC adenoviral vector group, E. LPS + miR-140-5p inhibitor group, H. LPS + PDTC group; Other lanes represent additional groups from concurrent experiments and were not included in this conclusion derivation.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003c/div\u003e\u003ch2\u003e3.3 Expression Levels of IL-1β and IL-18 in Rat Serum Across Experimental Groups\u003c/h2\u003e\u003cp\u003eELISA results indicated: Compared with the control group, the expression levels of pro-inflammatory cytokines (including IL-1β and IL-18) in LPS-treated rats were significantly increased ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;3). Both inhibition of miR-140-5p and NF-κB significantly reduced the levels of inflammatory factors in rats ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;3).\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab2\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression levels of inflammatory factors IL-1β and IL-18 in rat serum ( \u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e±s,n = 6)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNumber of cases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eIL-18\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e23.44 ± 0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e12.92 ± 0.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e39.79 ± 0.95\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e20.51 ± 0.79\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + NC adenoviral vector group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e39.68 ± 0.75\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e20.39 ± 0.85\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + miR-140-5p inhibitor group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e34.37 ± 1.10\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e17.52 ± 0.6\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + PDTC group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e26.48 ± 0.75\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e14.25 ± 0.94\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e\u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003c/p\u003e\u003cp\u003ePanel (a): Levels of IL-1β in each group (n = 6 ); Panel (b): Levels of IL-18 in different groups (n = 6 );\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003eA. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group; Compared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01 ; Compared with the LPS group, \u003cem\u003e*P \u0026lt;\u003c/em\u003e 0.01, \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01; Compared with the LPS + NC group: \u003cem\u003e*P \u0026lt; 0.01\u003c/em\u003e; Compared with LPS + miR-140-5p inhibitor: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e\u003cp\u003e \u003cb\u003e3.4 Expression levels of TLR4, NF-κB, TNF-α mRNA, and miRNA-140-5p in intrahepatic bile duct tissues across experimental groups\u003c/b\u003e \u003c/p\u003e\u003cp\u003eCompared with the control group, the LPS group demonstrated significantly elevated mRNA levels of TLR4, NF-κB, and TNF-α (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4), while miR-140-5p expression was reduced (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4). The LPS + NC adenoviral vector group exhibited results comparable to the LPS group (Fig.\u0026nbsp;4). Compared with the LPS group, the expression levels of TLR4, NF-κB, and TNF-α mRNA in the LPS + miR-140-5p inhibitor group significantly decreased ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4); Compared with the LPS group, the LPS + PDTC group also showed decreased levels of TLR4 and TNF-α mRNA; however, it is noteworthy that the expression level of miR-140-5p mRNA significantly increased in this group ( \u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;4).\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab3\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression levels of TLR4, NF-κB, TNF-α, and miR-140-5p mRNA in rats from each group (2 \u003csup\u003e−ΔΔCt\u003c/sup\u003e method, \u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e±s, n = 6)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNumber of cases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTLR4\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNF-κB\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003emiR-140-5p\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.39 ± 0.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.08 ± 0.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e2.18 ± 1.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.16 ± 0.17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e8.12 ± 1.37\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e12.07 ± 2.06\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e11.13 ± 1.77\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.35 ± 0.07\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + NC adenoviral vector group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e7.14 ± 1.27\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e12.37 ± 1.39\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e11.75 ± 2.84\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.33 ± 0.08\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + miR-140-5p inhibitor group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e3.60 ± 0.76\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e5.47 ± 1.14\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e7.60 ± 1.95\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.18 ± 0.03\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + PDTC group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e2.06 ± 0.48\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e3.02 ± 1.19\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e2.22 ± 0.41\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.65 ± 0.19\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e\u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eA. Control group B. LPS group C. LPS + NC adenoviral vector group D. LPS + miR-140-5p inhibitor group E. LPS + PDTC group(a). Expression levels of TLR4 mRNA in different groups (n = 6); (b). Expression levels of NF-κB mRNA in different groups (n = 6);(c). Levels of TNF-α miRNA in different groups (n = 6); (d). Levels of miR-140-5p in different groups (n = 6); Compared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01 ; Compared with the LPS group, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e▽\u003c/sup\u003eP \u0026lt; 0.01; Compared with LPS + miR-140-5p inhibitor: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003e \u003cb\u003e3.5 Expression levels of TLR4, NF-κB, and TNF-α proteins in intrahepatic bile duct tissues from various groups of rats\u003c/b\u003e \u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e\u003cp\u003eCompared with the control group, the expression of inflammation-related proteins (TLR4, NF-κB, TNF-α) was significantly increased in rats of the LPS group (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). The LPS + NC adenoviral vector group exhibited results similar to those of the LPS group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). However, after using the miR-140-5p inhibitor, the expression of TLR4 and TNF-α was significantly decreased (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01), while the decrease in NF-κB expression was not statistically significant but showed an overall downward trend (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). PDTC treatment further reduced the expression of TLR4 and TNF-α, demonstrating a more pronounced effect compared to the LPS + miR-140-5p inhibitor group (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab4\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression levels of TLR4, NF-κB, and TNF-α proteins in different rat groups ((/β-actin) \u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e±s, n = 6)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNumber of cases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTLR4\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eNF-κB\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.15 ± 0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.07 ± 0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.11 ± 0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.20 ± 0.12\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.86 ± 0.09\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.88 ± 0.08\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + NC adenoviral vector group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e1.09 ± 0.04\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.86 ± 0.03\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.70 ± 0.03\u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + miR-140-5p inhibitor group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.55 ± 0.11\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.74 ± 0.11\u003cem\u003e**\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.55 ± 0.02\u003cem\u003e*\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eLPS + PDTC group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.21 ± 0.04\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.18 ± 0.02\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\"\u003e \u003cp\u003e0.19 ± 0.09\u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e\u003cul\u003e \u003cli\u003e \u003cp\u003eA. Control group; B. LPS group; C. LPS + NC adenoviral vector group; D. LPS + miR-140-5p inhibitor group; E. LPS + PDTC group\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eCompared with the control group, \u003csup\u003e\u003cem\u003e△\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01;Compared with the LPS group, \u003cem\u003e*P \u0026lt; 0.01\u003c/em\u003e, \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01; Compared to LPS + miR-140-5p inhibitor group: \u003csup\u003e\u003cem\u003e▽\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e\u003cp\u003e \u003cstrong\u003eNote 2\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eFigure (d): β-actin was used as the internal reference protein; this study analyzed only data from lanes A, B, D, E, and H. Lane Numbers correspond to groups: A. Control group, B. LPS group, D. LPS + NC adenoviral vector group, E. LPS + miR-140-5p inhibitor group, H. LPS + PDTC group; Other lanes represent additional groups from concurrent experiments and were not included in this conclusion derivation.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cul\u003e \u003cli\u003e \u003cp\u003eCholangitis is an inflammatory disease affecting intrahepatic and extrahepatic bile ducts, with its pathological core lying in structural damage and functional impairment triggered by abnormal activation of cholangiocytes (BDECs).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eWhen BDECs are activated by exogenous stimuli, they undergo pathological proliferation and secrete large amounts of inflammatory mediators (such as cytokines and chemokines), thereby recruiting and activating infiltrating immune cells\u003csup\u003e[24]\u003c/sup\u003e. Activated immune cells (e.g., neutrophils and macrophages) can directly attack BDECs, leading to cellular damage and compromising the structural integrity of the biliary ducts\u003csup\u003e[12]\u003c/sup\u003e. In this study, using an LPS-induced cholangitis model in rats, we demonstrated significant inflammatory infiltration in biliary duct tissues of the LPS group. Transmission Electron Microscope observations revealed characteristic pathological alterations in BDECs, including widened intercellular spaces, ruptured cell and mitochondrial membranes, irregular nuclear morphology, dissolved mitochondrial matrix, disrupted and vanished cristae structures, and dilated endoplasmic reticulum. Immunohistochemistry and molecular detection revealed increased positive expression of NF-κB protein, significantly elevated serum levels of IL-1β and IL-18, and enhanced mRNA and protein expression of TLR4, NF-κB, and TNF-α. These findings indicate that NF-κB plays a critical regulatory role in cholangitis-related inflammatory responses, whichHu\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e、Zhang\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003eis consistent with the research results reported by others, further corroborating the central position of NF-κB in the cholangitis inflammatory cascade. Intervention experiments with NF-κB inhibitors demonstrated significantly reduced expression levels of IL-1β, IL-18, TLR4, and TNF-α compared to the LPS group, directly confirming a positive correlation between NF-κB and cholangitis inflammatory responses in rats.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e\u003cp\u003eAs a highly conserved small non-coding RNA, the inflammatory regulatory function of miR-140-5p exhibits significant tissue microenvironment specificity, manifesting diametrically opposed effects across different models\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Some studies indicate that it can exert anti-inflammatory protective effects by directly targeting the TNF-α signaling pathway and TLR4 receptor, thereby inhibiting NF-κB nuclear translocation and the release of downstream pro-inflammatory factors such as IL-6 and IL-8, ultimately blocking the uncontrolled positive feedback loop of inflammation\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. In osteoarthritis models, exogenous miR-140-5p mimic significantly promotes chondrocyte proliferation and autophagy by inhibiting NF-κB p65 protein activation, effectively delaying joint degeneration \u003csup\u003e[29]\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eIn LPS-induced myocardial injury, this miRNA binds to TLR4 mRNA to promote its degradation, negatively regulates the over-activation of the TLR4/NF-κB pathway, and alleviates myocardial inflammatory responses \u003csup\u003e[29,30]\u003c/sup\u003e. This inter-tissue protective effect suggests that miRNA-140-5p may be a universal therapeutic target for regulating cellular inflammation-repair mechanisms. However, miRNA families exhibit heterogeneity in bile duct diseases and associated hepatic metabolic disorders; for instance, miR-381-3p promotes HSC activation and biliary liver fibrosis by regulating Klf6 \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e, while miR-140-5p directly targets glycogen synthase 1 (GYS1) and protein phosphatase 1 catalytic subunit gamma (PPP1CC) to downregulate their expression and aggravate insulin resistance in insulin-resistant HepG2 cells\u003csup\u003e[20]\u003c/sup\u003e; Therefore, the regulatory role of miR-140-5p in cholangiopathy requires further validation. In this study, a cholangitis model was established by LPS injection into the common bile duct. After inhibiting miR-140-5p expression, serum IL-1β and IL-18 levels significantly decreased, and biliary duct tissue damage was markedly alleviated compared with the LPS group, suggesting that miR-140-5p expression levels may be positively correlated with the severity of cholangitis. Further validation through qPCR and Western blot experiments revealed that mRNA and protein expression levels of TNF-α, TLR4, and NF-κB in the miR-140-5p inhibitors group were significantly lower than those in the LPS group (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.05). This further suggests a positively correlated regulatory relationship between miR-140-5p and NF-κB signaling pathway activation. However, the specific regulatory mechanism (e.g., direct targeting or indirect mediation) requires further investigation through subsequent experiments ; However, the LPS + NC adenoviral vector group demonstrated similar results to the LPS group (p \u0026gt; 0.05), confirming the specific regulatory role of miR-140-5p and excluding interference from the adenoviral vector itself on experimental outcomes. Notably, the reduction in NF-κB protein expression was not significant after inhibition of miR-140-5p expression \u003cem\u003e(p\u003c/em\u003e \u0026gt; 0.05), which may be related to experimental conditions such as an early time point of tissue harvesting or the inflammatory response being in a dynamic regulatory phase. Nevertheless, the overall downward trend remained consistent with the aforementioned regulatory relationships and phenotypic results.\u003c/p\u003e\u003cp\u003eSignificantly, LPS-induced inflammatory rats exhibited a substantial increase in miR-140-5p expression following NF-κB inhibitor intervention \u003cem\u003e(p\u003c/em\u003e \u0026lt; 0.01), suggesting a potential negative feedback regulatory mechanism between them. When NF-κB transcriptional activity is inhibited, a negative feedback loop may upregulate miR-140-5p expression. Simultaneously, mRNA expression levels of TNF-α, TLR4, and NF-κB in the LPS group were significantly elevated compared to the control group (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01), whereas the mRNA level of miR-140-5p exhibited a downward trend (\u003cem\u003ep \u0026lt;\u003c/em\u003e 0.01). This phenomenon may result from feedback inhibition of miR-140-5p transcription following LPS-induced NF-κB activation, leading to decreased miR-140-5p mRNA levels. This suggests that the feedback inhibition pathway may serve as a potential target for blocking NF-κB-mediated 'cascade amplification' of inflammation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003emiR-140-5p shows a positive correlation with the severity of cholangitis and activation of the NF-κB pathway, and may promote inflammation by positively regulating the NF-κB pathway. Moreover, NF-κB activation may negatively inhibit miR-140-5p transcription to enhance inflammation. Conversely, when its activity is suppressed, it induces high expression of miR-140-5p. This regulatory loop participates in inflammatory self-regulation and provides a novel therapeutic target for blocking NF-κB-mediated inflammatory cascade amplification.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated for this study are available upon request to the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was approved by the Animal Ethics Committee of Guangxi University of Chinese Medicine\u0026nbsp;(Approval No. 2019XLC003-2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQingjian Wang designed the research. Ao Luo, Wenjuan Huang, and Yuhan Zhao performed the experiments.Wenjuan Huang analyzed the data and wrote the paper. Yalu Chen and Ao Luo contributed to review and editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the General Program of the National Natural Science Foundation of China (Grant 82474507), the Youth Science Fund Program of the Guangxi Natural Science Foundation (Grant 2024GXNSFBA010106), the Key Program of the Guangxi Natural Science Foundation (Grant 2024GXNSFDA010025), and the Guangxi Key Research and Development Program (Grant GuiKe AB24010130).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZhuang Y, Ortega-Ribera M, Thevkar Nagesh P, et al. Bile acid-induced IRF3 phosphorylation mediates cell death, inflammatory responses, and fibrosis in cholestasis-induced liver and kidney injury via regulation of ZBP1. Hepatology. 2024;79(4):752-767. \u003c/li\u003e\n\u003cli\u003eHe Y, Fan Z, Sun W, Ouyang L, Wang C. Clinical features, treatment, and outcome of nivolumab-induced cholangitis. Immunopharmacol Immunotoxicol. 2024;46(6):757-762. \u003c/li\u003e\n\u003cli\u003eStrazzabosco M, Fiorotto R, Cadamuro M, et al. Pathophysiologic implications of innate immunity and autoinflammation in the biliary epithelium. Biochim Biophys Acta Mol Basis Dis. 2018;1864(4 Pt B):1374-1379. \u003c/li\u003e\n\u003cli\u003eBanales JM, Huebert RC, Karlsen T, Strazzabosco M, LaRusso NF, Gores GJ. Cholangiocyte pathobiology. Nat Rev Gastroenterol Hepatol. 2019;16(5):269-281.\u003c/li\u003e\n\u003cli\u003eDuan S, Li X, Han J, et al. Transcriptotype-Driven Discovery of Apigenin as a Therapy against Cholestatic Liver Fibrosis: Through Inhibition of PANoptosis and Following Type-I Interferon Responses. Antioxidants (Basel). 2024;13(3):256. Published 2024 Feb 20. \u003c/li\u003e\n\u003cli\u003ePan W, Yong Y, Li Y, et al. Hepatocyte Mettl3 Deficiency Drives Primary Sclerosing Cholangitis and Liver Fibrosis via Cholangiocyte-Macrophage Crosstalk. Adv Sci (Weinh). Published online December 22, 2025.\u003c/li\u003e\n\u003cli\u003eFu HY, Xu JM, Ai X, et al. The Clostridium Metabolite P-Cresol Sulfate Relieves Inflammation of Primary Biliary Cholangitis by Regulating Kupffer Cells. Cells. 2022;11(23):3782. Published 2022 Nov 26. \u003c/li\u003e\n\u003cli\u003eChen J, Zhang S. The Role of Inflammation in Cholestatic Liver Injury. J Inflamm Res. 2023;16:4527-4540. Published 2023 Oct 13. \u003c/li\u003e\n\u003cli\u003eGiordano DM, Pinto C, Maroni L, Benedetti A, Marzioni M. Inflammation and the Gut-Liver Axis in the Pathophysiology of Cholangiopathies. Int J Mol Sci. 2018;19(10):3003. Published 2018 Oct 1.\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Hara SP, Tabibian JH, Splinter PL, LaRusso NF. The dynamic biliary epithelia: molecules, pathways, and disease. J Hepatol. 2013;58(3):575-582. \u003c/li\u003e\n\u003cli\u003eLiu X, Huang K, Zhang RJ, Mei D, Zhang B. Isochlorogenic Acid A Attenuates the Progression of Liver Fibrosis Through Regulating HMGB1/TLR4/NF-\u0026kappa;B Signaling Pathway. Front Pharmacol. 2020;11:582.\u003c/li\u003e\n\u003cli\u003e]Jalan-Sakrikar N, Guicciardi ME, O\u0026apos;Hara SP, et al. Central role for cholangiocyte pathobiology in cholestatic liver diseases. Hepatology. 2025;82(4):834-854.\u003c/li\u003e\n\u003cli\u003eChen SY, Chen X, Zhu S, et al. miR-324-3p Suppresses Hepatic Stellate Cell Activation and Hepatic Fibrosis Via Regulating SMAD4 Signaling Pathway. Mol Biotechnol. 2025;67(2):673-688.\u003c/li\u003e\n\u003cli\u003eWu L, Zhao M, Chen X, Wang H. A miR-219-5p-bmal1b negative feedback loop contributes to circadian regulation in zebrafish. Commun Biol. 2024;7(1):1671. Published 2024 Dec 19. \u003c/li\u003e\n\u003cli\u003eBu X, Ding W, Guo S, et al. Differential expression of microRNAs in bile duct obstruction-induced liver fibrosis and the identification of a novel liver fibrosis marker miR-1295b-3p. Ann Transl Med. 2023;11(1):22. \u003c/li\u003e\n\u003cli\u003eLambrecht J, Verhulst S, Reynaert H, van Grunsven LA. The miRFIB-Score: A Serological miRNA-Based Scoring Algorithm for the Diagnosis of Significant Liver Fibrosis. Cells. 2019;8(9):1003. Published 2019 Aug 29. \u003c/li\u003e\n\u003cli\u003eGong AY, Zhou R, Hu G, et al. MicroRNA-513 regulates B7-H1 translation and is involved in IFN-gamma-induced B7-H1 expression in cholangiocytes. J Immunol. 2009;182(3):1325-1333. \u003c/li\u003e\n\u003cli\u003eWang H, Wu C, Kong D. miR-140-5p Overexpression Protects Against Lipopolysaccharide-Induced Necrotizing Pneumonia via Targeting Toll-Like Receptor 4. Cell Mol Bioeng. 2021;14(4):339-348. Published 2021 May 10.\u003c/li\u003e\n\u003cli\u003eXing J, Fan S, Liu H, Zhang S, Li N. CircZNF644 aggravates lipopolysaccharide-induced HK-2 cell impairment via the miR-140-5p/MLKL axis. J Bioenerg Biomembr. 2022;54(4):215-226. \u003c/li\u003e\n\u003cli\u003eLi X, Ye Y, Wang B, Zhao S. miR-140-5p Aggravates Insulin Resistance via Directly Targeting GYS1 and PPP1CC in Insulin-Resistant HepG2 Cells. Diabetes Metab Syndr Obes. 2021 Jun 4;14:2515-2524. \u003c/li\u003e\n\u003cli\u003eLi W, Zhao S, Yang H, et al. Potential Novel Prediction of TMJ-OA: MiR-140-5p Regulates Inflammation Through Smad/TGF-\u0026beta; Signaling. Front Pharmacol. 2019;10:15. Published 2019 Jan 23. \u003c/li\u003e\n\u003cli\u003eSu J, Ren J, Chen H, Liu B. MicroRNA-140-5p ameliorates the high glucose-induced apoptosis and inflammation through suppressing TLR4/NF-\u0026kappa;B signaling pathway in human renal tubular epithelial cells. Biosci Rep. 2020;40(3):BSR20192384. \u003c/li\u003e\n\u003cli\u003eZhang Q, Weng Y, Jiang Y, Zhao S, Zhou D, Xu N. Overexpression of miR-140-5p inhibits lipopolysaccharide-induced human intervertebral disc inflammation and degeneration by downregulating toll-like receptor 4. Oncol Rep. 2018;40(2):793-802. \u003c/li\u003e\n\u003cli\u003ePinto C, Giordano DM, Maroni L, Marzioni M. Role of inflammation and proinflammatory cytokines in cholangiocyte pathophysiology. Biochim Biophys Acta Mol Basis Dis. 2018;1864(4 Pt B):1270-1278. \u003c/li\u003e\n\u003cli\u003eHu S, Russell JO, Liu S, et al. \u0026beta;-Catenin-NF-\u0026kappa;B-CFTR interactions in cholangiocytes regulate inflammation and fibrosis during ductular reaction. Elife. 2021;10:e71310. Published 2021 Oct 5. \u003c/li\u003e\n\u003cli\u003eZhang Z, Zhong X, Shen H, et al. Biliary NIK promotes ductular reaction and liver injury and fibrosis in mice. Nat Commun. 2022;13(1):5111. Published 2022 Aug 30.\u003c/li\u003e\n\u003cli\u003ePan W, Wang Y, Zhao C. miR-140-5p attenuates hepatic fibrosis by directly targeting TGF\u0026beta;R1. Scand J Gastroenterol. 2023;58(11):1335-1343. \u003c/li\u003e\n\u003cli\u003eChen X, Deng T, Huo T, Dong F, Deng J. MiR-140-5p/TLR4 /NF-\u0026kappa;B signaling pathway: Crucial role in inflammatory response in 16HBE cells induced by dust fall PM2.5. Ecotoxicol Environ Saf. 2021;208:111414. \u003c/li\u003e\n\u003cli\u003ePapathanasiou I, Balis C, Trachana V, Mourmoura E, Tsezou A. The synergistic function of miR-140-5p and miR-146a on TLR4-mediated cytokine secretion in osteoarthritic chondrocytes. Biochem Biophys Res Commun. 2020;522(3):783-791. \u003c/li\u003e\n\u003cli\u003eYang Y, Liu D, Xi Y, Li J, Liu B, Li J. Upregulation of miRNA-140-5p inhibits inflammatory cytokines in acute lung injury through the MyD88/NF-\u0026kappa;B signaling pathway by targeting TLR4. Exp Ther Med. 2018;16(5):3913-3920. \u003c/li\u003e\n\u003cli\u003eGao Y, Chen Y, Mang Y, Zhang X, Li X, Zhang S. Cholangiocyte-derived exosomal miR-381-3p promotes hepatic stellate cell activation and cholestatic liver fibrosis via targeting Klf6. Regen Ther. 2025;30:769-777. Published 2025 Sep 26.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8955884/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8955884/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eCholangitis represents an anti-injury response of cholangiocytes to endogenous and exogenous stimuli. Under chronic inflammatory stimulation, bile duct fibrosis and pathological bile duct remodeling are common pathological alterations in biliary duct tissue, which simultaneously serve as high-risk factors for the development of cholestatic liver cirrhosis and cholangiocarcinoma. NF-κB is a core factor in inflammatory responses. Recent studies have revealed that the small non-coding RNA molecule miR-140-5p may regulate the progression of various inflammatory diseases by influencing NF-κB activity; however, the regulatory role of this molecular pathway in cholangitis remains unclear. Therefore, this study aims to investigate the roles of miR-140-5p and NF-κB in a rat cholangitis model.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThirty healthy SD rats were randomly divided into five groups using a random number table: control group, LPS group, LPS\u0026thinsp;+\u0026thinsp;NC adenoviral vector group, LPS\u0026thinsp;+\u0026thinsp;miR-140-5p inhibitors group, and LPS\u0026thinsp;+\u0026thinsp;PDTC group, with 6 rats in each group. A rat cholangitis model was established by single injection of LPS (5\u0026micro;g/mL) into the common bile duct, with different inhibitors administered prior to modeling. Biliary duct tissues were collected from each group of rats, and ultrastructural changes in cholangiocytes were observed under electron microscopy; NF-κB protein expression levels in biliary duct tissues of rats from each group were measured using immunohistochemical method; Expression levels of interleukin-1β (IL-1β) and interleukin-18 (IL-18) in serum were determined by ELISA; qPCR was performed to detect mRNA expression levels of Toll-like receptor 4 (TLR4), NF-κB, tumor necrosis factor-α (TNF-α), and miRNA-140-5p in each group; TLR4, NF-κB, and TNF-α protein expression levels were examined by Western Blot.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eA rat cholangitis model was established via common bile duct injection of lipopolysaccharide (LPS). Compared with the control group, the LPS group exhibited significant inflammatory infiltration in biliary tissues. Transmission electron microscopy (TEM) revealed typical pathological manifestations in cholangiocytes (BDECs), including widened intercellular spaces, disrupted membrane structures, and mitochondrial and endoplasmic reticulum damage. Immunohistochemistry and molecular detection revealed that the LPS group exhibited enhanced positive expression of NF-κB protein, with significantly elevated serum levels of IL-1β and IL-18, as well as increased mRNA and protein expression of TLR4, NF-κB, and TNF-α ( \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01). Using adenoviral vector transfection technology to regulate the transcription of miR-140-5p in rats, the LPS\u0026thinsp;+\u0026thinsp;NC adenoviral vector group and LPS\u0026thinsp;+\u0026thinsp;miR-140-5p inhibitors group were established. The results of all indicators in the LPS\u0026thinsp;+\u0026thinsp;NC adenoviral vector group showed no statistically significant difference compared to the LPS group (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Compared with the LPS group, the LPS\u0026thinsp;+\u0026thinsp;miR-140-5p inhibitors group exhibited significantly reduced serum IL-1β and IL-18 levels (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01), markedly alleviated BDEC injury, and significantly down-regulated mRNA expression levels of TNF-α and TLR4 (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). Notably, relative to the LPS group, the LPS\u0026thinsp;+\u0026thinsp;miR-140-5p inhibitors group showed a significant decrease in NF-κB mRNA levels, although the reduction in NF-κB protein expression did not reach statistical significance (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). In the LPS\u0026thinsp;+\u0026thinsp;PDTC group compared to the LPS group, serum IL-1β and IL-18 levels were significantly reduced (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01), BDEC injury was markedly alleviated, and both mRNA and protein expression levels of TNF-α and TLR4 were significantly down-regulated (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01). However, mRNA expression of miR-140-5p was significantly elevated (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003emiR-140-5p exhibits a positive correlation with the severity of cholangitis and the activation of the NF-κB pathway, and it may promote inflammation by positively regulating the NF-κB pathway. Following intervention with NF-κB inhibitors, the expression levels of the aforementioned inflammatory factors and pathway molecules significantly decreased compared to the LPS group ( \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01 ). Moreover, NF-κB activation may transcriptionally inhibit miR-140-5p. When NF-κB activity is suppressed, it induces high expression of miR-140-5p. This feedback loop may participate in the self-regulatory process of inflammation, potentially providing a new target for blocking NF-κB-mediated inflammatory cascade amplification.\u003c/p\u003e","manuscriptTitle":"miR-140-5p is Associated with the NF-κB Signaling Pathway and Exerts an Interventional Effect on Cholangitis in Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-20 11:24:15","doi":"10.21203/rs.3.rs-8955884/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-02T10:04:57+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-01T15:51:09+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-01T07:55:12+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-27T14:13:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"310504471775885348814369202408453198474","date":"2026-03-23T12:05:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"54565975938862524668406213284817754690","date":"2026-03-22T13:14:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"23977504812206159905574651464683804041","date":"2026-03-22T04:36:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"97508907399079769434254269254977865156","date":"2026-03-21T14:46:16+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"198998846759397999553898885648248787265","date":"2026-03-21T02:22:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"44743164039883497638448570559145996950","date":"2026-03-20T07:13:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"308168334058744529435064379830256914920","date":"2026-03-19T13:08:41+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-18T06:29:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-17T08:10:50+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-10T11:07:12+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-09T16:54:47+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-03-04T17:22:55+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0cacefd0-1e10-49a3-8dc3-985c80bab4c2","owner":[],"postedDate":"March 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":64794616,"name":"Biological sciences/Cell biology"},{"id":64794617,"name":"Health sciences/Diseases"},{"id":64794618,"name":"Health sciences/Gastroenterology"},{"id":64794619,"name":"Biological sciences/Immunology"},{"id":64794620,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-05-16T03:23:14+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-20 11:24:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8955884","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8955884","identity":"rs-8955884","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}