Conformation-based detection of tau seeds with a novel VHH

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract In Alzheimer’s disease (AD) and related tauopathies, progressive pathology has been linked to prion mechanisms whereby ordered tau assemblies, or “seeds,” form in one cell and transit to neighboring or connected cells where they serve as templates for their own replication. While post-translational modifications of pathological tau have been useful to mark pathology, effective methods to accurately detect and target pathogenic seed conformations remain limited. We report a novel discovery and characterization paradigm to identify camelid variable heavy domain of heavy chain (VHH) sequences with desired properties. From a published synthetic VHH yeast display library, we screened for clones capable of immunoprecipitating tau seeds from human tauopathy brain homogenates and identified two seed-selective anti-tau VHHs – VHH(510) and VHH(50) – that target pathological tau. These VHHs preferentially target tau seeds present in AD, corticobasal degeneration (CBD), and PS19 tauopathy mouse brains. We enhanced their stability through framework mutations (M), while maintaining their seed-binding characteristics. We characterized VHH(510M) in detail, determining that it bound the carboxy terminus of tau with robust avidity for seeds, and low affinity for monomer. When used to stain mouse and human brain tissues, VHH(510M) revealed pathological tau accumulation that was often independent of AT8-positive lesions. The distinct staining pattern observed with anti-tau VHH(510M) underscores the potential of VHH-based reagents for PET imaging and histopathology. Adaptation of VHH(510M) could also improve therapy and diagnosis for diverse tauopathies.
Full text 168,509 characters · extracted from preprint-html · click to expand
Conformation-based detection of tau seeds with a novel VHH | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Conformation-based detection of tau seeds with a novel VHH ANKIT GUPTA, Richard Liu, Devin Keely, Victoria Sunderman, Yogesh Tak, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8274351/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 9 You are reading this latest preprint version Abstract In Alzheimer’s disease (AD) and related tauopathies, progressive pathology has been linked to prion mechanisms whereby ordered tau assemblies, or “seeds,” form in one cell and transit to neighboring or connected cells where they serve as templates for their own replication. While post-translational modifications of pathological tau have been useful to mark pathology, effective methods to accurately detect and target pathogenic seed conformations remain limited. We report a novel discovery and characterization paradigm to identify camelid variable heavy domain of heavy chain (VHH) sequences with desired properties. From a published synthetic VHH yeast display library, we screened for clones capable of immunoprecipitating tau seeds from human tauopathy brain homogenates and identified two seed-selective anti-tau VHHs – VHH(510) and VHH(50) – that target pathological tau. These VHHs preferentially target tau seeds present in AD, corticobasal degeneration (CBD), and PS19 tauopathy mouse brains. We enhanced their stability through framework mutations (M), while maintaining their seed-binding characteristics. We characterized VHH(510M) in detail, determining that it bound the carboxy terminus of tau with robust avidity for seeds, and low affinity for monomer. When used to stain mouse and human brain tissues, VHH(510M) revealed pathological tau accumulation that was often independent of AT8-positive lesions. The distinct staining pattern observed with anti-tau VHH(510M) underscores the potential of VHH-based reagents for PET imaging and histopathology. Adaptation of VHH(510M) could also improve therapy and diagnosis for diverse tauopathies. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Tau assembly into amyloid fibrils causes neurodegeneration and cognitive decline, and underlies a spectrum of neurodegenerative disorders collectively termed tauopathies, including Alzheimer's disease (AD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and Pick's disease (PiD)( 1 ). Each disorder features unique conformations of assembled tau ( 2 , 3 ). Previously, we proposed that distinct fibrillar tau assemblies, or strains, function as prions, and produce progressive pathology by serving as self-propagating templates upon which native tau assembles into amyloid fibrils ( 4 – 6 ). The propagation of tau seeds between neurons is considered a key driver of disease progression ( 7 , 8 ). Consequently, the targeting of tau seeds represents a promising strategy for early disease detection and intervention. Various approaches to inhibit tau pathology have been proposed ( 9 – 11 ). Multiple antibodies target different regions or post-translational modifications of tau, including the N- and C-terminus, proline-rich domain, repeat domain, and phosphorylated or acetylated epitopes ( 12 – 16 ). However, despite reported benefits in mouse models, none have yet demonstrated efficacy in patients. This likely derives from conformational heterogeneity of tauopathies, variability of disease in mice vs. humans, and poor brain delivery. Reagents that preferentially bind human brain-derived tau seeds might better target disease-associated structures( 3 , 17 , 18 ). In this context, camelid variable domain of heavy chain (VHH) or single domain antibodies (sdAb) have received attention for their small size, stability, ease of production, and specificity ( 19 , 20 ), and many have been proposed for tau ( 21 – 26 ). However, current anti-tau VHHs generated to date target recombinant tau monomer or heparin-induced fibrils, whose structures differ from those observed in disease ( 2 , 27 ). Despite progress, our understanding of the biochemical and structural properties of tau seeds remains limited, and isolating large quantities of highly purified patient-derived tau seeds is impractical for large screening campaigns. To address this challenge, we devised a two-stage VHH screening strategy, coupling yeast display with mammalian cell-based seeding assays. We have characterized a resultant VHH with detailed biophysical, biochemical, and immunofluorescence studies. Results Two-step VHH screening to identify tau seed-binding clones We used a hybrid screening strategy to identify VHHs that preferentially recognized pathogenic tau seeds from AD brains (Fig. 1 ). Tau monomer is dynamic, and interconverts among an ensemble of conformations. Therefore, we first enriched VHH clones from a fully synthetic yeast display library (~ 1×10 8 clones) that bound full-length 2N4R tau monomer. We performed five rounds of selection—two rounds of Magnetic-Activated Cell Sorting (MACS) followed by three rounds of Fluorescence-Activated Cell Sorting (FACS)—progressively lowering the tau concentration from 500 nM to 10 nM to isolate ~ 900 binders (Fig. 1 A, Figure S1 ). We screened these arrayed clones for seed-binding by immunoprecipitation (IP) from patient-derived lysates (Fig. 1 B). We used clarified homogenates of the frontal cortex from two AD cases (AD 1, AD 2), two CBD cases (CBD 1, CBD 2), and a P301S mouse model, each known to harbor distinct conformations of pathogenic tau seeds. After incubation with VHHs, we eluted bound material and measured seeding activity in v2L tau biosensor cells ( 28 , 29 ). We quantified seeding as the percentage of FRET-positive cells in the v2L tau biosensor line ( 29 ). This allowed prioritization of ~ 300 clones that bound tau seeds (see the correlation plots in Fig. 2 , Figure S2). Selected VHHs preferentially bind AD and CBD-derived tau seeds To assess the selectivity for human brain-derived seeds, we tested each clone via immunoprecipitation coupled with cell-based seeding assays (IP/seeding) against multiple tau sources: two independent Alzheimer's disease (AD) cases (AD 1, AD 2), two Corticobasal degeneration (CBD) cases (CBD 1, CBD 2), one P301S mouse brain lysate, and heparin-induced recombinant 2N4R fibrils (Rec 2N4R) (Fig. 2 ; Figure S2). Upon comparing the seed binding ability of top VHH clones, we observed a strong correlation between two AD samples and separately between two CBD samples, but a weak correlation between patient-derived tau seeds and seeds extracted from P301S tauopathy (PS19) mouse brain, and negligible correlation with recombinant fibrils (Fig. 2 ). This indicated that the selection process identified VHHs selective for human tau seeds. Sequence analysis of the best seed-binding clones revealed > 15 unique VHHs, including VHH(510) and VHH(50), which we further characterized. Framework optimization improves VHH expression and stability To purify VHHs for functional and structural assays, we subcloned and expressed them in E. coli ; however, many clones aggregated at high concentrations during expression and purification (Figures S3 and S4), limiting yields. Following a strategy described previously ( 30 ), we introduced framework mutations that increased VHH stability without altering the antigen-binding complementarity-determining regions (CDRs). The stabilized mutant (M) variants were termed VHH(510M) and VHH(50M). SDS-PAGE analyses confirmed that VHH(510M) and VHH(50M) expressed at higher levels and exhibited diminished aggregation when compared to their original counterparts VHH(510) and VHH(50) (Figure S3 and S4). After affinity purification using Amsphere™ A3 beads (Figure S5) and size-exclusion chromatography (SEC), we measured the secondary structure of both mutant VHHs by circular dichroism (CD). Both stabilized VHHs retained a typical β-sheet signature (Figure S6A) and were stable up to 55°C (Figure S6B). When tested by IP/seeding (Figure S7), the framework-optimized VHHs preserved the seed-binding capabilities of their wild-type counterparts. Anti-tau VHHs have low affinity for tau monomer Next, we carried out on-yeast EC 50 measurements for VHH(510) and VHH(50) to quantify their monomer affinity (Figure S8A), as described previously ( 31 ). VHH(510) and VHH(50) bound tau monomer above micromolar affinity, with VHH(510) having notably weaker affinity (higher EC 50 ). To further validate these findings, we performed affinity measurements for stabilized mutant (M) variant VHHs ((VHH(510) and VHH(50)), using flow-induced dispersion analysis (FIDA). In line with EC 50 measurements, both VHHs exhibited weak affinity for tau monomer (Figure S8B): VHH(510M) demonstrated a K D of > 4 µM, comparatively higher than what we observed for VHH(50M), with a K D of ~ 0.1 µM. Overall, these results suggest that VHH(510M) has low affinity for tau monomer. Anti-tau VHHs immunoprecipitate seeds from AD and CBD brains We further characterized the binding properties of the VHH(510M) and VHH(50M) by IP/seeding of brain homogenates from cases of Alzheimer's disease (AD), Corticobasal degeneration (CBD), P301S mouse brain, and human control using Amsphere™ A3 beads (Fig. 3 ). Both VHHs immunoprecipitated tau seeds from AD and CBD brains, and the eluted seeds were detectable on v2L tau biosensor cells (Fig. 3 A, B). Both VHHs also bound P301S brain seeds but we detected no seeding activity from control brain samples (Fig. 3 C, D). Overall, our measurements indicated that VHH(510M) and VHH(50M) had comparable binding activities against pathogenic tau seeds from human brain. Anti-tau VHH(510M) selectively binds to AD and CBD brains . To further test seed vs. monomer binding under non-denaturing conditions, we performed dot-blot analyses with VHH(510M) and VHH(50M), analyzing AD, P301S, and control brain samples (Fig. 4 ). We applied brain homogenates onto membranes, exposed them to anti-tau VHHs and HJ8.5 antibody, which binds monomer with high affinity ( 11 ). VHH(510M) exhibited strong binding to tauopathy brain homogenates and weak binding to control brains (Fig. 4 A and 4 B; left panel), whereas VHH(50M) equally bound AD and control brain homogenates (Fig. 4 A and 4 B; middle panel). In contrast, HJ8.5 exhibited comparatively poor binding to AD brain and high binding to control brain extracts (Fig. 4 A and 4 B; right panel). These results indicated that only VHH(510M) has selectivity for pathogenic tau seeds, whereas VHH(50M) exhibits a comparatively higher affinity for tau monomer. VHH(510M) binds to the carboxy-terminus of tau We next used solution-state NMR to identify the binding site for VHH(510M) on tau. We incubated the purified VHH(510M) with 15 N labeled full-length tau 2N4R at a 1:1 molar ratio, recorded the 1 H, 15 N- heteronuclear single quantum coherence (HSQC) spectra of full-length 2N4R tau as described previously ( 32 ), and assigned well-resolved HSQC cross-peaks based on previously published assignments (BMRB Entry 50701). The superimposed two-dimensional 1 H, 15 N-HSQC spectra of tau alone vs. with VHH(510M) (Fig. 5 A) showed broadening or disappearance of cross-peaks corresponding to residues near the tau C-terminus: Gly427, Asp430, Ala434, Ser435, leu436, Ala437, Leu441 (also see schematic in Fig. 5 B). These data show that VHH(510M) binds to the tau C-terminus. VHH(510M) stains tau inclusions in P301S mice and human AD brains Finally we used VHH(510M) to stain fixed tissues from a P301S (PS19) mice ( 33 ) and AD brains, in comparison with AT8, an anti-phospho-tau antibody. We analyzed PS19 mice brains at various ages (3 to 12 months) with fluorescently conjugated VHH(510M). PS19 mice do not develop consistent AT8 pathology until ~ 6 months of age ( 28 ). However, VHH(510M) stained tau inclusions in P301S mice as early as 3 months, including the neocortex, amygdala, hippocampus, and brain stem(Fig. 6 , S9, and S10). VHH(510M) staining largely included areas positive for AT8, but detected additional unique inclusions in various brain regions not revealed by AT8. In AD brain VHH(510M) similarly co-localized with AT8 in many tau inclusions and labeled additional distinct tau inclusions in both AD and CBD brains that were not stained by AT8 (Fig. 7 ). Discussion Trans-cellular propagation of unique conformations of tau assemblies appears to be central to Alzheimer's disease (AD) and other tauopathies ( 4 – 6 ). Thus, agents that specifically target and neutralize tau seeds, particularly those present in the early stages of the disease, could significantly improve both early detection and therapy. Two major challenges complicate the development of effective binding agents. First, it is difficult to produce conformations of desired amyloid structure at scale and reproducibility sufficient for high throughput discovery. Second, it has not been possible to include seed binding directly within the selection paradigm. This study thus represents a significant advance, as we report a novel VHH discovery strategy that has revealed an agent with selectivity for pathological tau assemblies, incorporating human brain-derived seed binding into the selection process. The use of a pure in vitro system highlights the power of this approach, as it can incorporate established yeast expression libraries (as we have done here) or those selected in vivo and subcloned. In this case, we report a novel VHH which reveals ultra-high selectivity for pathological tau structures, and novel patterns of tau deposition in vivo . This agent, and its derivatives, could thus significantly improve diagnosis and therapy of tauopathy, while the approaches described could be applied much more broadly in the amyloid field. A discovery paradigm to selectively target brain-derived tau seeds It is very difficult to incorporate disease-relevant tau seeds into primary vaccine campaigns to produce seed selective monoclonal antibodies with anything other than moderate throughput. Moreover, processing of complex protein assemblies by antigen presenting cells cannot maintain the amyloid structure. This work advances discovery methods by demonstrating the feasibility of screening tau binding agents against soluble clarified brain lysates from AD or CBD brains. This allowed us to identify an anti-tau VHH with high avidity for pathogenic aggregates and low affinity for tau monomer. This property is crucial for successful diagnosis and therapy, as the goal is to selectively target pathogenic tau. Because the discovery paradigm exploits brain-derived seeding activity within a high throughput context, it can be adapted across tauopathies, and, in theory, to any disorder for which it is possible to incorporate cell-based or in vitro screening for bound seeds. This work augments prior efforts to isolate conformation-specific antibodies and nanobodies ( 11 , 18 , 26 , 26 , 34 , 34 , 35 ), underscoring how epitope choice is critical for discrimination of pathological from native tau. VHH(510M) selectively targets pathological tau seeds vs. monomer It has been difficult to engineer tau binding agents with high selectivity for tau seeds vs. monomer. Thus, VHH(510M) represents a potentially useful tool for the field, as it binds tau seeds with high avidity, and has low affinity for tau monomer. Using IP and dot-blot against multiple tauopathy brain homogenates we found that VHH(510M) bound pathogenic tau seeds from AD and CBD brain but not to native tau present in control brain. Finally, immunohistochemistry indicated that VHH(510M) stained tau inclusions in both PS19 and AD brains. The distinct staining pattern observed versus AT8, and the ability to detect early pathology in PS19 mice, indicates an advantage of conformation vs. post-translational modification as a detection method. Potential applications and advantages of VHH-based reagents Due to their small size, high stability, and ease of genetic manipulation, VHHs hold considerable promise for next-generation immunotherapies and in vivo imaging tools ( 20 ). These could be delivered intracerebrally or peripherally, fused to blood-brain barrier shuttle peptides or packaged within viral vectors, allowing for specific targeting of intracellular tau species. The selectivity of VHH(510M) for inclusions in both mouse and human tauopathy tissue suggests that it binds pathological assemblies in complex environments. This property may be exploited to visualize early-stage tau lesions via PET imaging or to track the spread of disease-relevant aggregates longitudinally in animal models. Furthermore, the capacity to distinguish pathogenic tau seeds from monomeric tau would be expected to minimize off-target depletion of physiological tau, which is important for neuronal function. Targeting other amyloidogenic proteins Many neurodegenerative diseases, including Parkinson’s disease and amyotrophic lateral sclerosis, are associated with prion-like spread of aggregates derived from α-synuclein and TDP-43, respectively. Each protein may exist in structural forms that differ significantly from recombinant assemblies, suggesting that our approach could be generalized to discover VHHs targeting more physiologically relevant conformations. Indeed, early detection and selective neutralization of these misfolded species might represent a powerful strategy for slowing or preventing disease progression. Conclusion We have identified VHH that preferentially bind pathological tau seeds in AD and CBD, with demonstrated utility in cell-based assays, biochemical immunoprecipitations, and histological detection of pathological inclusions. These tools provide new avenues to develop diagnostic probes and disease-modifying therapies that minimize off-target effects on normal tau. Future studies will focus on optimizing VHH engineering for in vivo delivery, expanding the breadth of targets, and determining if selective interference with pathogenic tau seeds might modify disease trajectory in animal models and ultimately in human clinical settings ( 22 , 26 , 35 ). Materials and Methods Library expansion and VHH expression The "Yeast surface display nanobody library (NbLib)" generated by McMahon et al. ( 31 ) was procured from Kerafast (Catalog number: EF0014-FP). Upon receipt, the yeast library was thawed and expanded in ‘Yglc4.5 –Trp’ media, as previously described ( 31 ). Cell viability was assessed, and the presence of contamination was ruled out. Finally, we prepared multiple glycerol stocks at > 10-fold higher cell viability than the number of clones to ensure no loss in library diversity, and the aliquots were frozen at -80ºC for VHH screening. VHH expression check Aliquots of the VHH library were thawed at 30°C, each containing approximately 5 × 10¹⁰ cells, and were recovered by growing in 1 liter of “–Trp + glucose” media at 30°C and 220 rpm for 24 hours. The following day, the total number of yeast cells in the overnight culture was counted by measuring the OD 600 (where OD 600 of 1 ≈ 1.5 × 10 7 yeast cells). 1 × 10¹⁰ cells from the “–Trp + glucose” culture were collected and washed once with “–Trp + galactose” media, and transferred into 1 liter of “–Trp + galactose” media. The yeast were grown at 25°C and 220 rpm for 72 hours, and checked for VHH expression at 24, 48, and 72 hours. In parallel, 1 × 10 10 cells from the primary culture were transferred into “–Trp + glucose” media as a negative control for VHH expression. At each time point, 1 × 10⁶ cells from both the glucose and galactose cultures were collected, washed twice with 100 µl of selection buffer, and incubated with 5 µg of anti-HA antibody labeled with Alexa Fluor™ 647 for 30 minutes at 4°C. The cells were then washed twice with selection buffer to remove unbound antibody and analyzed on a BD LSRFortessa™ Cell Analyzer to determine the percentage of yeast cells expressing nanobodies in both “–Trp + glucose” and “–Trp + galactose” media. Preparation of labeled tau for VHH screening The pET28b plasmid encoding full-length 2N4R tau protein sequence was a kind gift from Dr. David Eisenberg (UCLA). Full-length tau monomer was purified as described previously ( 36 ), with minor modifications. A pET28b-tau plasmid was transformed into BL21(DE3) competent E. coli cells and colonies were screened for protein expression. The colony with the highest protein expression was grown overnight into 50 ml 1× Terrific Broth (TB) media at 37°C at 220 rpm. The next day, the primary culture was transferred in 1 liter 1× TB media at 37°C at 220 rpm and protein expression was induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 4 hour at 37°C. Cells were harvested by centrifugation at 6000× g for 20 min at 4°C, resuspended in tau lysis buffer (50 mM Tris pH 7.5 containing 500 mM NaCl, 1 mM β-mercaptoethanol, 20 mM imidazole, and 1 mM phenylmethylsulfonyl fluoride (PMSF), with cOmplete™ EDTA-free Protease Inhibitor Cocktail), and lysed using GEA PandaPLUS Lab Homogenizer 2000. The cell lysate was centrifuged at 20,000× g for 40 min at 4°C and the supernatant was filtered and loaded on pre-equilibrated Ni-NTA Agarose beads. The column was washed with lysis buffer and protein was eluted with lysis buffer containing a gradient of 20 mM to 500 mM imidazole. Clean fractions for Ni-NTA purification were concentrated and buffer exchanged into 50 mM MES, 50 mM NaCl, 1 mM β-mercaptoethanol (pH 6) by PD-10 column (Cytiva Life Sciences, cat. no 17-0851-01) and loaded onto a 5 ml HiTrap SP-HP column (Cytiva Life Sciences, Cat. No. 17115201) for cation exchange purification. Pure fractions from cation-exchange chromatography were pooled, concentrated and injected onto a HiLoad 16/600 Superdex 75 pg column (Cytiva Life Sciences, cat. No. 28989333) for size-exclusion chromatography (SEC). The fractions from SEC containing clean protein were pooled and labeled with Alexa Fluor™ 647, Alexa Fluor™ 488, and FITC fluorophore using Alexa Fluor™ 647 NHS Ester (Succinimidyl ester), Alexa Fluor™ 488 NHS Ester (Succinimidyl ester), and NHS-Fluorescein (5/6-carboxyfluorescein succinimidyl ester), respectively. For labeling, the purified protein was incubated with a 20-fold molar excess of dye overnight at 4°C, on a rotary shaker. The reaction was quenched by adding 0.1 ml of freshly prepared 1.5 M hydroxylamine (pH 8.5), and the free dye was removed by PD-10 desalting column. The labeled protein was quantified and stored in -80°C for further use. Magnetic Assisted Cell Sorting (MACS) Two glycerol stocks of the VHH library containing ~ 5 x 10 9 cells were thawed and inoculated into 1 liter “–Trp + glucose” media and grown for 24 hours, at 30°C with shaking at 230 rpm. The OD 600 was recorded (here, OD 600 = 1 is ~ 1 x 10 7 cells/ml), and enough yeast for 100-fold library diversity/previous round coverage were inoculated into 1 liter “–Trp + galactose” media and induced for 48 hour at 25°C, 250 rpm. The VHH expression was checked as described above, and yeast were used for MACS. For the first round of Magnetic Assisted Cell Sorting (MACS), yeast cells were washed twice with selection buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM maltose, 0.1% BSA) and were incubated with 500 µl Anti-Cy5/Anti-Alexa Fluor™ 647 Microbeads (Miltenyi CAT NO. 130-091-395) with constant mixing for 2 hour at 4°C. The yeast cells were then centrifuged to remove the unbound magnetic beads, and the yeast cells were washed with selection buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM maltose, 0.1% BSA) to remove loosely bound magnetic beads. The cells were then passed over a pre-equilibrated LD column (Miltenyi CAT NO. 130-042-901) for negative selection. This step removes all the yeast cells that non-specifically bind to Anti-Cy5/Anti-Alexa Fluor™ 647 Microbeads. The yeast cells passed through LD column were collected and washed once with selection buffer. The cells were then resuspended and incubated with 500 nM 2N4R tau labeled with Alexa Fluor™ 647 with constant mixing for 1 hour at 4°C. The yeast cells were then washed twice with selection buffer to remove unbound protein, and the resuspended cells were again incubated with 500 µl Anti-Cy5/Anti-Alexa Fluor™ 647 MicroBeads (Miltenyi Cat no. 130-091-395) for 1 hour, at 4°C with constant mixing. This allows for the formation of a yeast-tau-microbead complex that can be selected with MACS. The cells were then washed twice with the selection buffer to remove unbound microbeads and passed through LS column (Miltenyi Cat no. 130-042-401) for positive selection. The unbound yeast cells were discarded and the yeast cells collected on LS column were collected and grown in “–Trp + glucose” media for the next rounds of screening. We collected a small amount of yeast cells at each step and plated them on “–Trp + glucose agar” and YPD-agar plate; this is done to count the number of yeast cells after each step and to confirm that there is no contamination throughout the process. For the second round of MACS, we followed a similar process to the one we used for MACS1. Here, we expanded the yeast cells collected from MACS1 into 1 liter of “–Trp + glucose” media for 24 hours and then transferred ~ 10 9 yeast cells into 1 liter of “–Trp + galactose” media, grown for 48 h at 25°C, 250 rpm to induce VHH expression. For the second round of MACS, yeast cells were washed twice with selection buffer and the yeast cells were incubated with 500 µl Anti-FITC microbeads (Miltenyi cat no. 130-042-901) for negative selection. The unbound cells were then incubated with 250 nM 2N4R tau labeled with FITC with constant mixing for 1 hour at 4°C. The yeast cells were then washed and incubated with 500 µl Anti-FITC microbeads (Miltenyi cat no. 130-042-901). The yeast cells were then passed through LS column (Miltenyi cat no. 130-042-401) for positive selection. The unbound yeast cells were discarded, and the yeast cells collected on LS column were grown in “–Trp + glucose” media for the subsequent rounds of screening. Fluorescence Activated Cell Sorting (FACS) Yeast from MACS2 were grown, and VHH expression was induced as before. After VHH expression was verified, 1 x 10 7 yeast cells were washed in selection buffer and incubated with 100 nM tau 2N4R- Alexa Fluor™ 647 with constant mixing for 1 hour at 4° C. The yeast cells were washed twice with selection buffer to remove unbound tau. The yeast cells bound with tau were then resuspended and incubated with 25 µg of Alexa Fluor™ 488-conjugated anti-HA tag antibody (Cell Signaling Technology cat. no. 2350S). After incubation, yeast cells were washed twice to remove unbound antibody, resuspended in selection buffer and filtered before running on FACSAria SORP 4-laser sorter (BD Biosciences). Yeast cells showing maximal binding to tau 2N4R- Alexa Fluor™ 647 and anti-HA tag antibody- Alexa Fluor™ 488 were sorted and collected in “–Trp + glucose” media. Here, we collected ~ 0.05% of total cells. Collected yeast cells were revived by growing for 24 hours, at 30°C with shaking at 230 rpm. These cells were then used for the next round of screening. The cells collected after 1st round of FACS were expanded in 1 liter “–Trp + glucose” media and VHH expression was induced in “–Trp + galactose” media. The VHH expression was confirmed as described above and cells were used for the 2nd round of FACS. Here, we used 30 nM of 2N4R tau labeled with FITC that was used for screening. The tau-binding positive yeast cells were selected and used for the third and final round of FACS. For the final round of FACS, we used 10 nM of 2N4R tau labeled with Alexa Fluor™ 488 for the screening. After five rounds of screening, a total of ~ 1,000 individual yeast single colonies were collected onto “–Trp + glucose” agar plates and grown for 3–5 days at 30°C until colonies were visible. These colonies were then screened further to check for their seed binding. VHH sequence verification and cloning in E. coli for recombinant protein production Individual yeast colonies were grown in 5 ml “–Trp + glucose” media and DNA was extracted using Zymoprep Yeast Plasmid Miniprep II (cat no D2004). The VHH sequence was then amplified using the following primers: Forward primer: GTTTAACTTTAAGAAGGAGATATACCATGCAGGTGCAGCTGCAGGAAAG Reverse primer: GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTTAGCAGCTGCTCACGGTCACCTG. The PCR product was checked on agarose gel and used for sequencing as well as for cloning in E. coli for recombinant protein production. For sequencing, a portion of the amplified product was purified with ExoSAP-IT™ (Cat no. 78201.1.ML), and the sequence was determined by Sanger sequencing. For cloning into E. coli , the PCR product was cleaned using Zymo Genomic DNA Clean and Concentrator (Cat no. D4011). The purified product was then assembled into a pre-digested pET28b vector (digested with NcoI and XhoI restriction enzymes) using NEBuilder® HiFi DNA assembly cloning kit. The assembled product was then transformed into NEB® 5-alpha Competent E. coli (High Efficiency) cells from NEB. The single colonies were used to purify the plasmid, and the plasmid was sent for sequencing. Once, the VHH sequence was confirmed, the plasmid was transformed into BL21(DE3) competent cells (prod. no. C2527) for recombinant VHH expression. Purification using A3 resin The pET28b plasmid containing the VHH sequence was transformed into BL21(DE3) cells and single colonies were selected and screened for protein expression. The colony having high protein expression was grown overnight in Luria-Bertani broth at 37°C. The saturated culture was then transferred into 1 liter Auto-Induction Medium (cat no GCM17.0500 BOCA Scientific) and grown at 37°C for 8 hours, followed by 16 h growth at 24°C to induce protein expression. The bacterial culture was spun down, and the cell pellet was resuspended into VHH lysis buffer (1x PBS pH 7.2, 2% glycerol, 2 mM EDTA, protease inhibitor cocktail). The resuspended cells were lysed by GEA PandaPLUS Lab Homogenizer 2000 until clarified. The clarified lysate was spun down to remove cell debris, filtered through 0.45 µm filter, and purified using Amsphere A3 resin (JSR Life Sciences). The clarified cell lysate was loaded onto pre-equilibrated Amsphere A3 resin. The beads were washed with 10 CV (column volumes) of 1x PBS, followed by 10 CV of 1 M NaCl in 1x PBS, 10 CV of 2 M NaCl in 1x PBS, and finally with 10 CV of 5 M NaCl in 1x PBS to remove non-specifically bound impurities. The nanobodies were then eluted using 2 CV of 100 mM Glycine pH 3.0 followed by a second elution using 2 CV of 250 mM Glycine pH 2.5. All of the elutions were collected in a tube containing 0.25 CV 1M Tris-HCl pH 8.0 and 0.25 CV 10% glycerol to neutralize the elutions, preventing VHH precipitation. The VHHs were further purified using size-exclusion chromatography to perform buffer exchange (1x PBS containing 2% glycerol) and to remove residual protein impurities. Purified fractions were checked on SDS-PAGE, filtered using 0.22 µm filter (to remove insoluble aggregates if there are any), and stored at 4°C for further use. Brain lysate preparation Flash-frozen human or mouse brain was suspended in 1x TBS containing 1x cOmplete protease inhibitor cocktail (Roche) at a final concentration of 10% w/v. The tissues were homogenized using probe homogenizer with Power Gen 125 tissue homogenizer (Fischer 734 Scientific). The brain lysate was then sonicated for 5 min at 4°C at an amplitude of 65 in a bath-sonicator, with a “30 sec on and 30 sec off” interval at to avoid heating of the sample. The sonicated sample was then centrifuged at 20,000x g, at 4°C for 20 min, and the supernatant was collected in protein low-binding tubes. The brain lysate was then quantified using Pierce™ 660nm protein assay reagent (cat. no 22660) and used for experiments. Immunoprecipitation using Amsphere™ A3 resin Purified VHHs were concentrated using Amicon ultra centrifugal filter, 3 kDa MWCO (Cat. no UFC9003). The VHHs were then filtered using Ultrafree-MC 0.22 µm pore size filters (0.5 ml volume, cat. no UFC30GV0S) to remove any aggregated protein. The VHHs were then spun at 20,000 x g for 20 min at 4°C to remove any residual aggregated VHH (if any) and supernatant protein was quantified using DeNovix DS-11 FX + spectrophotometer. In parallel, the clarified brain lysate was prepared and the total protein concentration was quantified (as described above) before using it for IP. VHHs and lysate were mixed in a 96-well clear round bottom plate (Corning, cat. no 3788), and incubated overnight at 4°C, with shaking at 1,000 rpm. The following day, 30 µl pre-equilibrated Amsphere A3 beads (prod. no 10000204-330) (bead equilibration process: washing twice with 1x PBS, followed by washing twice with 1x PBST, followed by washing twice with 1x PBST supplemented with 2% BSA, and twice with TBS + PIC) were added to the “lysate + VHH” reaction mixture. The reaction mixture was incubated for 1 hour, at 4°C, with shaking at 1,000 rpm to allow the formation of a “bead-VHH-seed complex.” The reaction mixture was then centrifuged at 10,000 x g for 3 minutes and unbound supernatant was removed and saved for transfection into tau biosensor cells. The beads were then washed twice with 1x PBST, followed by four times wash with TBS + PIC to remove non-specifically bound proteins. Finally, the seeds were eluted by adding 50 µl “Pierce IgG elution buffer” pH 2.5 (cat. no 21004) to the beads. The elution was neutralized by the addition of 1:5 part of 1 M Tris-HCl pH 8.0, and transfected into tau RD(P301S) v2L-biosensors, as described previously ( 29 ). Cells were allowed to grow for 48 hours at 37°C. After 48 hour, the cells were checked for formation of tau puncta in the cells by fluorescence microscopy. The cells were then fixed with 2% PFA, resuspended in 1x PBS, and analyzed on LSR-Fortessa flow cytometer for FRET analysis. The acquired data was processed using FlowJo software, and FRET-positive cells were counted and plotted for various samples, as described previously ( 37 ). Dot blot against brain lysates Clarified brain lysate from two AD cases, one P301S mouse, and one healthy control case were applied onto a polyvinylidene difluoride membrane (Immobilon® -FL PVDF Membrane, Millipore Sigma) using a dot blot apparatus (Bio-Dot Apparatus, BIO-RAD). The membrane was subsequently blocked for 30 min at room temperature in 5% w/v skimmed milk prepared in 1x TBST. The membrane was then incubated overnight at room temperature with 0.001 µg/ml anti-tau VHHs ((510M) or (50M)) and HJ8.5 antibody diluted in 5% w/v skimmed milk prepared in 1x TBST. The membrane was then washed twice with 1x TBST and then incubated with 1:2,000 dilution of MonoRab™ Rabbit Anti-Camelid VHH [HRP] or Goat anti-Mouse IgG (H + L) Secondary Antibody [HRP], respectively, for 60 min at room temperature. After incubation, the blot was washed twice with 1x TBST for 10 min to wash unbound secondary antibody. Finally, the blot was scanned, and spots were detected using the Thermo Scientific SuperSignal™ West Femto Maximum Sensitivity Substrate kit, Thermo Scientific. Specific protein signal from the membranes was visualized using a Chemi Doc (Syngene G: BOX Chemi XRQ gel doc system) and images were captured with GeneSys Image Capture Software. The signal intensity at 1.25 µg of total protein, based on integrated optical densities were quantified using Fiji (version 1.54f). The raw intensities for each sample were then normalized with the corresponding Ponceau intensity and compared across the samples. On-yeast EC 50 measurement The individual yeast colonies were grown in “–Trp + glucose” media and VHH expression was induced with “–Trp + galactose” media. A total of 1 x 10 6 cells were washed with selection buffer and incubated with various concentrations of fluorescently labeled tau 2N4R tau (2N4R labeled with Alexa Fluor™ 647) with shaking for 1 hour at 4°C. Each sample was also incubated with 2 µg fluorophore-conjugated anti-HA Alexa Fluor™ 488 antibody with shaking for 1 hour at 4°C. The samples were then washed twice with selection buffer and all the samples were then analyzed on LSRFortessa. The percentage of double positive yeast cells (yeast cells that show binding to anti-HA Alexa Fluor™ 488 antibody as well as 2N4R- Alexa Fluor™ 647) at each concentration of tau monomer was plotted and compared for both the VHH clones. The titration curve was then fitted to a sigmoidal function to derive EC 50 value. FIDA measurements Flow Induced Dispersion Analysis (FIDA) measurement for anti-tau VHH(510M) and VHH(50M) were performed on Fida 1 (Fida Biosystems, Denmark) using a dynamic coated 75 µm capillary with 100 cm length (Fida Biosystems, Denmark). Here, 50 nM of Alexa Fluor™ 647-labeled anti-tau VHHs were incubated with varying concentrations of full-length 2N4R tau. Each sample was then analyzed on the Fida instrument, and the hydrodynamic radius of the complex was measured at each concentration using the 640 nm detector. The parameters of the analysis were: Tray Vial Pressure (mbar) Time (s) Outlet Measure Comments 2 1 3500 120 Variable No Buffer Rinse and Equilibration 1 Analyte 3500 20 Variable No Fill with analyte 1 Indicator 50 10 Variable No Inject indicator 1 Analyte 400 180 Variable Yes Mobilize and measure 2 2 3500 120 Variable No Water Rinse All the trays and capillary were set at 25°C, and the kinetic measurements were performed at 25°C. CD measurements Circular dichroism (CD) measurements were performed using a Jasco J-815 spectropolarimeter (Serial No. B064061168) at the Macromolecular Biophysics Resource at UT Southwestern Medical Center in Dallas. Measurements were collected using a 1 mm pathlength quartz cuvette under standard sensitivity settings. A final concentration of 1.0 mg/ml of anti-tau VHH(510M) in 1x PBS containing 2% glycerol was used for all the measurements. The far-UV CD spectra were recorded at 25°C at a data pitch of 0.1 nm, with a scanning speed of 50 nm/min. The CD thermal melts were recorded from 4°C to 95°C by measuring the change in secondary structure at 215 nm (θ 215 ), using a CDF-426S temperature control accessory (S/N A00861183). The temperature was controlled with a precision of ± 0.10°C, with a hold time of 5 seconds at each target temperature before data acquisition. The change in ME 215 was then plotted against temperature and fitted to a sigmoidal function for calculation of the mid-point of thermal denaturation (T m ). Preparation of N tau BL21(DE3) cells transformed with pET28b plasmid containing tau 2N4R sequence were grown in minimal M9 media for protein production ( 38 ). The single colony expressing tau protein was grown overnight in M9 media. The following day, the saturated culture was transferred to 1liter M9 media, and protein production was induced with 1 mM IPTG for 4 hours, at 37°C. The bacterial culture was centrifuged at 6,000 × g for 30 minutes, lysed, and purified as described above. The pellet was resuspended in 15 N lysis buffer (50 mM MES pH 6, 10 mM EDTA, 10 mM DTT, 0.1 mM PMSF, with cOmplete™ EDTA-free Protease Inhibitor Cocktail), and lysed using GEA PandaPLUS Lab Homogenizer 2000. The lysate was centrifuged at 15,000 × g for 30 minutes, and the supernatant was filtered using a 0.45 µm filter. This clarified lysate was loaded onto a 5 ml HiTrap SP-HP column (Cytiva Life Sciences, cat. No. 17115201), and the protein was purified against a NaCl gradient. The fractions were checked on SDS-PAGE and all the fractions containing pure protein were pooled, concentrated, and injected onto HiLoad 16/600 Superdex 75 pg column (Cytiva Life Sciences, cat. No. 28989333) for SEC. The fractions from SEC containing clean protein were pooled and sent for mass-spectrometric analysis to confirm the degree of isotopic labeling. The 15 N protein was then stored at -80°C for NMR experiments. NMR NMR spectra were acquired on an Agilent DD2 spectrometer operating at 800 MHz. 1 H- 15 N HSQC spectra were recorded at 4°C with samples dissolved in 50 mM sodium phosphate buffer pH 6.5 containing 1 mM DTT and 10% D 2 O. A total of 50 µM 2N4R tau protein and 50 µM anti-tau VHH(510M) was used for all the NMR measurements. All data were processed with NMRpipe ( 39 ) and analyzed with NMRView ( 40 ). Isolation of mouse brain P301S and WT mice at various ages were anesthetized with isoflurane and perfused with cold 1x PBS. Brains were hemi-dissected. The right hemisphere was frozen in liquid nitrogen and stored at − 80°C for subsequent biochemical assays while the left hemispheres were drop-fixed in phosphate-buffered 4% paraformaldehyde (FD NeuroTechnologies, Colombia, MD, USA) overnight at 4°C. Left hemispheres were then placed in 10% sucrose in PBS for 24 hours at 4°C, followed by 24 hours in 20% sucrose in PBS at 4°C, and finally stored in 30% sucrose in PBS at 4°C until sectioning. Immunohistochemistry of mouse brain A sliding-base freezing microtome (Thermo-Fisher Scientific, Waltham, MA, USA) was used to collect 30 µm free-floating coronal sections from fixed mouse brains. The sections were stored in cryoprotectant at 4 until immunohistochemistry (IHC) was performed. Slices were washed three times with 1x PBS for 5 minutes, and all subsequent washing steps followed the same procedure. The sections were incubated in 1x PBS containing 0.25% Triton X-100 for 45 minutes at room temperature for permeabilization. Next, they were blocked in an NGS blocking buffer (1x PBST + 5% BSA + 10% NGS) for 1 hour at room temperature. Sections were then incubated with 1 drop of avidin block per 3 ml of IHC blocking buffer for 30 minutes, followed by washing. They were subsequently incubated with 1 drop of biotin block per 3 ml in IHC blocking buffer for 30 minutes, and washed again (Avidin/Biotin Blocking Kit, SP-2001). The washed sections were then incubated with biotinylated AT8 antibody (1:1,000, Thermo Scientific) for 4 hours at 25°C. The sections were washed and incubated with streptavidin-Alexa Fluor™ 488 conjugate for 1 hour at 25°C. The AT8-stained sections were washed and incubated with a final concentration of 2 ng/µl Alexa Fluor™ 647-conjugated anti-tau VHH(510M). The next day, the sections were washed and stained with 1:1,000 DAPI for 20 minutes. Finally, the sections were washed and mounted on charged slides. The slides were then allowed to dry overnight before being coverslipped with Aqua-Poly/Mount (Cat: 18606-20). The slides were finally scanned using the Olympus Nanozoomer 2.0-HT (Hamamatsu, Bridgewater, NJ, USA) at the University of Texas Southwestern Medical Center Whole Brain Microscopy Core Facility (RRID: SCR_017949). Immunohistochemistry of human brain Paraffin-embedded human AD and control brain slices were deparaffinated twice with Xylene, each for 5 minutes. Slides were then rehydrated for 2 minutes each in a gradient of 100%, 95%, 70%, and 50% ethanol. Next, the slides containing brain sections were washed under running water for 2 minutes, followed by washing twice with 1x PBS for 5 minutes. Autofluorescence was quenched by first treating with a 0.25% KMnO4 solution for 20 minutes, followed by modified Pal’s solution (1% K2SO4/1% Oxalic Acid) for 3 minutes, and lastly with a solution consisting of 1% NaOH, 0.9% H 2 O 2 for 40 minutes. The sections were then incubated in 1x PBS containing 0.25% Triton X-100 for 45 minutes at room temperature, for permeabilization. Next, they were blocked in an NGS blocking buffer (1x PBST + 5% BSA + 10% NGS) for 1 hour at room temperature. After blocking, the tissues were stained with 1:500 dilution of AT8 in NGS blocking buffer for 4 hours at room temperature. The sections were then washed three times with 1x PBS for 5 minutes and incubated with 1:1,000 dilution of streptavidin-Alexa Fluor™ 568 conjugate for 1 hour, at room temperature. Finally, the slides were washed three times with 1x PBS and stained with 2 ng/µl of final anti-tau VHH(510M) conjugated with Alexa Fluor™ 647 in NGS blocking buffer, overnight at room temperature. Next, the slides were washed three times with ddH 2 O for 5 minutes each and incubated with 1:1,000 DAPI for 20 minutes. The slides were then placed on coverslips with Aqua-Poly/Mount, and allowed to dry in the dark. The slides were scanned on the Olympus Nanozoomer 2.0-HT (Hamamatsu, Bridgewater, NJ, USA) at the University of Texas Southwestern Medical Center Whole Brain Microscopy Core Facility (RRID: SCR_017949). Media and buffer used in this study: Yglc4.5 –Trp (for 1 liter) Mix 7.6 g of –Trp drop-out media supplement (US Biological D9531) + 6.7 g Yeast nitrogen base (Himedia M878) + 10.4 g Sodium citrate + 7.4 g Citric acid monohydrate + 10 ml Pen-strep (10,000 units/ml stock) + 20 g glucose in sterile Milli-Q water. Once dissolved adjust pH to 4.5 and sterilize the media by filtering through 0.22 µm sterifilter. –Trp + glucose media : Mix 3.8 g of –Trp drop-out media supplement (US Biological D9531) + 6.7 g Yeast nitrogen base (Himedia M878) + 10 ml Pen-Strep (10,000 units/ml stock) + 20 g glucose in sterile Milli-Q. Once dissolved adjust pH to 6.0 and sterilize the media by filtering through 0.22 µm sterifilter. –Trp + galactose media : Mix 3.8 g of –Trp drop-out media supplement (US Biological D9531) + 6.7 g Yeast Nitrogen Base (Himedia M878) + 6.7 g Yeast Nitrogen Base + 10 ml Pen-Strep (10,000 units/ml stock) + 20 g galactose in sterile Milli-Q. Once dissolved adjust pH to 6.0 and sterilize the media by filtering through 0.22 µm sterifilter. Selection buffer Filter sterilized 20 mM HEPES pH 7.5 buffer with 150 mM sodium chloride, 0.1% (w/v) bovine serum albumin, and 5 mM maltose. VHH lysis buffer 1x PBS pH 7.2, 2% glycerol, 2 mM EDTA, protease inhibitor cocktail. 15 N lysis buffer 50 mM MES pH 6, 10 mM EDTA, 10 mM DTT, 0.1 mM PMSF, protease inhibitor cocktail. IHC Blocking buffer 5% BSA, 0.25% Triton X-100 (blocking buffer), 10% Serum in PBS. Declarations Competing Interests MID and JVA are co-founders of Handshake Bio, a biotechnology company focused on developing diagnostics and therapeutics for neurodegenerative diseases, including tauopathies. The authors declare that Handshake Bio did not directly fund or influence the design, execution, or interpretation of the experiments presented in this manuscript. The remaining authors declare no competing interests. Data and materials availability All data needed to evaluate the conclusions in the paper are present in the paper and/or the supplementary materials. Raw data files are available upon request. Funding The research is supported by The Hamon Charitable Foundation. Author Contribution Conceptualization: AG, JVA, MIDMethodology: AG, JVA, MIDInvestigation: AG, JVA, RL, DK, VS, YT, KK, SJT, CLW, WPR, JR, NLVisualization: AG, JVA, MIDSupervision: JVA, MIDWriting—original draft: AG, JVA, MIDWriting—review & editing: AG, JVA, RL, DK, VS, YT, KK, SJT, CLW, WPR, JR, NL Acknowledgement We thank Dr. Maikke Ohlson, Dr. Andrea Shiakolas, Dr. Sushobhna Batra, Dr. Peter Kunach, Dr. Lukasz A. Joachimiak and Varun Jalapati for critical discussions and their suggestions. For cell sorting and flow cytometry instrumentation support, we acknowledge the Moody Foundation Flow Cytometry Facility. We thank Dr. Denise Ramirez and “Whole Brain Microscopy Facility (RRID:SCR_017949)” for microscopy support. NL is supported by the Thomas O. Hicks Scholarship in Medical Research. JR is supported by Welch grant (I-1304). Data Availability All data needed to evaluate the conclusions in the paper are present in the paper and/or the supplementary materials. Raw data files are available upon request. References Samudra N, Lane-Donovan C, VandeVrede L, Boxer AL (2023) Tau pathology in neurodegenerative disease: disease mechanisms and therapeutic avenues. J Clin Invest 133:e168553 Scheres SH, Zhang W, Falcon B, Goedert M (2020) Cryo-EM structures of tau filaments. Curr Opin Struct Biol 64:17–25 Scheres SHW, Ryskeldi-Falcon B, Goedert M (2023) Molecular pathology of neurodegenerative diseases by cryo-EM of amyloids. Nature 621:701–710 Sanders DW, Kaufman SK, Holmes BB, Diamond MI (2016) Prions and Protein Assemblies that Convey Biological Information in Health and Disease. Neuron 89:433–448 Clavaguera F, Bolmont T, Crowther RA, Abramowski D, Frank S, Probst A, Fraser G, Stalder AK, Beibel M, Staufenbiel M, Jucker M, Goedert M, Tolnay M (2009) Transmission and spreading of tauopathy in transgenic mouse brain. Nat Cell Biol 11:909–913 Frost B, Jacks RL, Diamond MI (2009) Propagation of tau misfolding from the outside to the inside of a cell. J Biol Chem 284:12845–12852 Jucker M, Walker LC (2018) Propagation and spread of pathogenic protein assemblies in neurodegenerative diseases. Nat Neurosci 21:1341–1349 Vaquer-Alicea J, Diamond MI, Joachimiak LA (2021) Tau strains shape disease. Acta Neuropathol 142:57–71 Congdon EE, Ji C, Tetlow AM, Jiang Y, Sigurdsson EM (2023) Tau-targeting therapies for Alzheimer disease: current status and future directions. Nat Rev Neurol 19:715–736 Sinsky J, Pichlerova K, Hanes J (2021) Tau Protein Interaction Partners and Their Roles in Alzheimer’s Disease and Other Tauopathies. Int J Mol Sci 22:9207 Yanamandra K, Kfoury N, Jiang H, Mahan TE, Ma S, Maloney SE, Wozniak DF, Diamond MI, Holtzman DM (2013) Anti-Tau Antibodies that Block Tau Aggregate Seeding In Vitro Markedly Decrease Pathology and Improve Cognition In Vivo. Neuron 80:402–414 Agadjanyan MG, Zagorski K, Petrushina I, Davtyan H, Kazarian K, Antonenko M, Davis J, Bon C, Blurton-Jones M, Cribbs DH, Ghochikyan A (2017) Humanized monoclonal antibody armanezumab specific to N-terminus of pathological tau: characterization and therapeutic potency. Mol Neurodegener 12:33 Shin M-K, Vázquez-Rosa E, Koh Y, Dhar M, Chaubey K, Cintrón-Pérez CJ, Barker S, Miller E, Franke K, Noterman MF, Seth D, Allen RS, Motz CT, Rao SR, Skelton LA, Pardue MT, Fliesler SJ, Wang C, Tracy TE, Gan L, Liebl DJ, Savarraj JPJ, Torres GL, Ahnstedt H, McCullough LD, Kitagawa RS, Choi HA, Zhang P, Hou Y, Chiang C-W, Li L, Ortiz F, Kilgore JA, Williams NS, Whitehair VC, Gefen T, Flanagan ME, Stamler JS, Jain MK, Kraus A, Cheng F, Reynolds JD, Pieper AA (2021) Reducing acetylated tau is neuroprotective in brain injury. Cell 184:2715–2732e23 Bryan Iii MR, Tian X, Tseng J-H, Evangelista BA, Ragusa JV, Bryan AF, Trotman W, Irwin D, Cohen TJ (2024) Development and characterization of novel anti-acetylated tau monoclonal antibodies to probe pathogenic tau species in Alzheimer’s disease. Acta Neuropathol Commun 12:163 Sigurdsson EM (2024) Tau Immunotherapies for Alzheimer’s Disease and Related Tauopathies: Status of Trials and Insights from Preclinical Studies. J Alzheimers Dis 101:S129–S140 Ossenkoppele R, van der Kant R, Hansson O (2022) Tau biomarkers in Alzheimer’s disease: towards implementation in clinical practice and trials. Lancet Neurol 21:726–734 Vaquer-Alicea J, Manon VA, Bommareddy V, Kunach P, Gupta A, Monistrol J, Perez VA, Tran HT, Saez-Calveras N, Du S, Batra S, Stoddard D, White CL, Joachimiak LA, Shahmoradian SH, Diamond MI (2025) Functional classification of tauopathy strains reveals the role of protofilament core residues. Sci Adv 11 Hitt BD, Gupta A, Singh R, Yang T, Beaver JD, Shang P, White CL, Joachimiak LA, Diamond MI (2023) Anti-tau antibodies targeting a conformation-dependent epitope selectively bind seeds. J Biol Chem 299:105252 Wesolowski J, Alzogaray V, Reyelt J, Unger M, Juarez K, Urrutia M, Cauerhff A, Danquah W, Rissiek B, Scheuplein F, Schwarz N, Adriouch S, Boyer O, Seman M, Licea A, Serreze DV, Goldbaum FA, Haag F (2009) Koch-Nolte, Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Med Microbiol Immunol 198:157–174 Alexander E, Leong KW (2024) Discovery of nanobodies: a comprehensive review of their applications and potential over the past five years. J Nanobiotechnol 22:661 De Leiris N, Perret P, Lombardi C, Gözel B, Chierici S, Millet P, Debiossat M, Bacot S, Tournier BB, Chames P, Lenormand J-L, Ghezzi C, Fagret D, Moulin M (2024) A single-domain antibody for the detection of pathological Tau protein in the early stages of oligomerization. J Transl Med 22:163 Danis C, Dupré E, Zejneli O, Caillierez R, Arrial A, Bégard S, Mortelecque J, Eddarkaoui S, Loyens A, Cantrelle F-X, Hanoulle X, Rain J-C, Colin M, Buée L, Landrieu I (2022) Inhibition of Tau seeding by targeting Tau nucleation core within neurons with a single domain antibody fragment. Mol Ther 30:1484–1499 Mortelecque J, Zejneli O, Bégard S, Simões MC, ElHajjar L, Nguyen M, Cantrelle F-X, Hanoulle X, Rain J-C, Colin M, Gomes CM, Buée L, Landrieu I, Danis C, Dupré E (2024) A selection and optimization strategy for single-domain antibodies targeting the PHF6 linear peptide within the tau intrinsically disordered protein. J Biol Chem 300:107163 McArthur N, Kang B, Rivera Moctezuma FG, Shaikh AT, Loeffler K, Bhatt NN, Kidd M, Zupancic JM, Desai AA, Djeddar N, Bryksin A, Tessier PM, Kayed R, Wood LB, Kane RS (2024) Development of a pan-tau multivalent nanobody that binds tau aggregation motifs and recognizes pathological tau aggregates. Biotechnol Prog 40:e3463 Dupré E, Danis C, Arrial A, Hanoulle X, Homa M, Cantrelle F-X, Merzougui H, Colin M, Rain J-C, Buée L (2019) Landrieu, Single Domain Antibody Fragments as New Tools for the Detection of Neuronal Tau Protein in Cells and in Mice Studies. ACS Chem Neurosci 10:3997–4006 Zupancic JM, Smith MD, Trzeciakiewicz H, Skinner ME, Ferris SP, Makowski EK, Lucas MJ, McArthur N, Kane RS, Paulson HL, Tessier PM (2023) Quantitative flow cytometric selection of tau conformational nanobodies specific for pathological aggregates. Front Immunol 14:1164080 Zhang W, Falcon B, Murzin AG, Fan J, Crowther RA, Goedert M, Scheres SH (2019) Heparin-induced tau filaments are polymorphic and differ from those in Alzheimer’s and Pick’s diseases. eLife 8:e43584 Holmes BB, Furman JL, Mahan TE, Yamasaki TR, Mirbaha H, Eades WC, Belaygorod L, Cairns NJ, Holtzman DM, Diamond MI (2014) Proteopathic tau seeding predicts tauopathy in vivo. Proc. Natl. Acad. Sci. U.S.A. 111 Hitt BD, Vaquer-Alicea J, Manon VA, Beaver JD, Kashmer OM, Garcia JN, Diamond MI (2021) Ultrasensitive tau biosensor cells detect no seeding in Alzheimer’s disease CSF. acta neuropathol commun 9:99 Dingus JG, Tang JCY, Amamoto R, Wallick GK, Cepko CL (2022) A general approach for stabilizing nanobodies for intracellular expression. Elife 11:e68253 McMahon C, Baier AS, Pascolutti R, Wegrecki M, Zheng S, Ong JX, Erlandson SC, Hilger D, Rasmussen SGF, Ring AM, Manglik A, Kruse AC (2018) Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nat Struct Mol Biol 25:289–296 Narayanan RL, Dürr UHN, Bibow S, Biernat J, Mandelkow E, Zweckstetter M (2010) Automatic Assignment of the Intrinsically Disordered Protein Tau with 441-Residues. J Am Chem Soc 132:11906–11907 Yoshiyama Y, Higuchi M, Zhang B, Huang S-M, Iwata N, Saido TC, Maeda J, Suhara T, Trojanowski JQ, Lee VM-Y (2007) Synapse Loss and Microglial Activation Precede Tangles in a P301S Tauopathy Mouse Model. Neuron 53:337–351 Gibbons GS, Kim S-J, Wu Q, Riddle DM, Leight SN, Changolkar L, Xu H, Meymand ES, O’Reilly M, Zhang B, Brunden KR, Trojanowski JQ, Lee VMY (2020) Conformation-selective tau monoclonal antibodies inhibit tau pathology in primary neurons and a mouse model of Alzheimer’s disease. Mol Neurodegener 15:64 Congdon EE, Pan R, Jiang Y, Sandusky-Beltran LA, Dodge A, Lin Y, Liu M, Kuo M-H, Kong X-P, Sigurdsson EM (2022) Single domain antibodies targeting pathological tau protein: Influence of four IgG subclasses on efficacy and toxicity. EBioMedicine 84:104249 Chen D, Drombosky KW, Hou Z, Sari L, Kashmer OM, Ryder BD, Perez VA, Woodard DR, Lin MM, Diamond MI, Joachimiak LA (2019) Tau local structure shields an amyloid-forming motif and controls aggregation propensity. Nat Commun 10:2493 Furman JL, Holmes BB, Diamond MI (2015) Sensitive Detection of Proteopathic Seeding Activity with FRET Flow Cytometry. J Vis Exp, e53205 Marley J, Lu M, Bracken C (2001) A method for efficient isotopic labeling of recombinant proteins. J Biomol NMR 20:71–75 Delaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J, Bax A (1995) NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR 6:277–293 Johnson BA, Blevins RA, View NMR (1994) A computer program for the visualization and analysis of NMR data. J Biomol NMR 4:603–614 Additional Declarations Competing interest reported. MID and JVA are co-founders of Handshake Bio, a biotechnology company focused on developing diagnostics and therapeutics for neurodegenerative diseases, including tauopathies. The authors declare that Handshake Bio did not directly fund or influence the design, execution, or interpretation of the experiments presented in this manuscript. The remaining authors declare no competing interests. Supplementary Files Gupta2025ActaSI.docx Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 19 Dec, 2025 Reviews received at journal 18 Dec, 2025 Reviews received at journal 18 Dec, 2025 Reviewers agreed at journal 05 Dec, 2025 Reviewers agreed at journal 04 Dec, 2025 Reviewers invited by journal 04 Dec, 2025 Editor assigned by journal 04 Dec, 2025 Submission checks completed at journal 04 Dec, 2025 First submitted to journal 03 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8274351","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":555746728,"identity":"4b46694d-d903-450c-9e0b-97ba3b13d22a","order_by":0,"name":"ANKIT GUPTA","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"ANKIT","middleName":"","lastName":"GUPTA","suffix":""},{"id":555746729,"identity":"7d9f272b-b450-41b4-a1bf-3e87ef189e4a","order_by":1,"name":"Richard Liu","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Richard","middleName":"","lastName":"Liu","suffix":""},{"id":555746730,"identity":"3b23da93-b331-4751-8d71-c24956ea54b0","order_by":2,"name":"Devin Keely","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Devin","middleName":"","lastName":"Keely","suffix":""},{"id":555746731,"identity":"72d7680d-5c05-4563-8947-afdd1efb87f0","order_by":3,"name":"Victoria Sunderman","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Victoria","middleName":"","lastName":"Sunderman","suffix":""},{"id":555746733,"identity":"296646e6-55a8-4830-b71f-ac3347a0b84d","order_by":4,"name":"Yogesh Tak","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Yogesh","middleName":"","lastName":"Tak","suffix":""},{"id":555746734,"identity":"7cb53d1b-7a89-44e9-b861-efa408f55ff4","order_by":5,"name":"Katerina Konstantoulea","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Katerina","middleName":"","lastName":"Konstantoulea","suffix":""},{"id":555746735,"identity":"b05181d7-5184-49ad-b090-19e2d872a379","order_by":6,"name":"Sandi-Jo Terpack","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Sandi-Jo","middleName":"","lastName":"Terpack","suffix":""},{"id":555746736,"identity":"ea67714d-4782-41f4-8199-2972568a5ff8","order_by":7,"name":"Charles L. White","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Charles","middleName":"L.","lastName":"White","suffix":""},{"id":555746737,"identity":"9aa43e00-f2e6-4cb3-8293-b0193628eece","order_by":8,"name":"William P. Russ","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"William","middleName":"P.","lastName":"Russ","suffix":""},{"id":555746738,"identity":"ca93a87a-43c7-4780-b53b-618a71ad762d","order_by":9,"name":"Josep Rizo","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Josep","middleName":"","lastName":"Rizo","suffix":""},{"id":555746739,"identity":"7b9e8ef4-f44b-48bc-b185-73500f744c6c","order_by":10,"name":"Nikolaos Louros","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Nikolaos","middleName":"","lastName":"Louros","suffix":""},{"id":555746740,"identity":"7d24e0cb-471b-4308-a21e-ce67429a0683","order_by":11,"name":"Jaime Vaquer-Alicea","email":"","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Jaime","middleName":"","lastName":"Vaquer-Alicea","suffix":""},{"id":555746743,"identity":"5fd9512e-aa7b-4cdc-8ae7-397ad78a572d","order_by":12,"name":"Marc I. Diamond","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABK0lEQVRIie3QPWuDQBjAcQ/BLAbXRxz6CQqKIJUQ/CqKkCx92UKGIpmuy7Wz+RadnA1CslzsKnRpCWQ2m0P6cp4QCmfatcP9B/Veftyhoshk/zA7Zw/UAB/AAX8F7K392KAJxOeEdMRcYogWisq3wTkScIK7gTXEECp/EW+zfa8Rvrq4fHhcvY4ZMeBuvdPnSWJY21ypZ4VA6NQFhMHJaBmPbjAEZhoPXJ0WYD7dhigtRZJPNHYxQFl17VmMoOcq1thHDjbVbXWIBWK/7DkJOPFP5DOBoCUfPaTqTok4QSeyUMHWGUF9ZK9CRCDOKHV9QiFakp1nHdeFmbJTVqSciheboPrQJONsQ5yqmUNgDKK9md4nhkF0562ZjYS/3Bb2zrblZ1dkMplM9lvfv5RvMsvyvL4AAAAASUVORK5CYII=","orcid":"","institution":"The University of Texas Southwestern Medical Center","correspondingAuthor":true,"prefix":"","firstName":"Marc","middleName":"I.","lastName":"Diamond","suffix":""}],"badges":[],"createdAt":"2025-12-04 01:38:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8274351/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8274351/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97894411,"identity":"3c16aa12-58c7-4b9d-af32-54c3601ce5ba","added_by":"auto","created_at":"2025-12-10 15:32:27","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3998684,"visible":true,"origin":"","legend":"","description":"","filename":"Gupta2025ActaMS.docx","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/b7b2015f54987f3347fefe32.docx"},{"id":97893458,"identity":"b711f005-d673-48cd-8e46-d165364b71fd","added_by":"auto","created_at":"2025-12-10 15:30:28","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14056,"visible":true,"origin":"","legend":"","description":"","filename":"abbbf8f77ecd4ac4b9b3f6e098742cf9.json","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/dcca11e51c17cf6b055fd8df.json"},{"id":97893290,"identity":"5fad688f-5d99-47a7-887a-8ee6811bc19f","added_by":"auto","created_at":"2025-12-10 15:29:46","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7249014,"visible":true,"origin":"","legend":"","description":"","filename":"Gupta2025ActaSI.docx","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/66f0681ace2037a57707ee54.docx"},{"id":97700605,"identity":"81d88ff3-0441-400c-8a32-f36d45c72264","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159311,"visible":true,"origin":"","legend":"","description":"","filename":"abbbf8f77ecd4ac4b9b3f6e098742cf91enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/163b50749b39a61ac9e3e1ba.xml"},{"id":97700597,"identity":"db97275a-d40e-4a08-af0d-65bd16959470","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":337236,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/f85f74fc9fbf14ab3e98d1b6.jpeg"},{"id":97700604,"identity":"b1264cfe-958f-466c-80d7-d566fbb8961c","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":210358,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/6aaf4d261a3f3963726fc27f.jpeg"},{"id":97895046,"identity":"72a9a601-284e-4cd8-aad6-d9dd1d7de852","added_by":"auto","created_at":"2025-12-10 15:33:26","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":166772,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/cc1a77cfb17d58e08eb2a5d0.jpeg"},{"id":97894525,"identity":"a26d802f-6fca-400f-a078-4cec5d2b19b3","added_by":"auto","created_at":"2025-12-10 15:32:41","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":523038,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/02082b635e787ee437d99469.jpeg"},{"id":97700607,"identity":"0e9688f4-0d78-4d9a-addc-15eaf279c382","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":776276,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/a36bde7655e03addfd38d1ab.jpeg"},{"id":97700616,"identity":"3bdc838f-cd54-46c1-bf92-4bc29cffefc4","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1270674,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/197dc6cc08a847c99063492a.jpeg"},{"id":97893097,"identity":"cba5b626-1e0d-4343-9a90-5431e5186b2c","added_by":"auto","created_at":"2025-12-10 15:26:55","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1098812,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/9afa15a9e91f6e19eca81dad.jpeg"},{"id":97894289,"identity":"6d7b2bf6-0ed9-4e0d-b24d-b9d0db6c508b","added_by":"auto","created_at":"2025-12-10 15:32:14","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":53051,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/2ef0bb46a6cc7e731da32f6b.png"},{"id":97892889,"identity":"e6794074-8584-44ee-b701-1282e5894134","added_by":"auto","created_at":"2025-12-10 15:23:55","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59407,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/88c8939bb98caaf1aa5a079d.png"},{"id":97894239,"identity":"19306ff9-efdd-4d81-b1f9-4099b7e98827","added_by":"auto","created_at":"2025-12-10 15:32:05","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18355,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/5c36faff9a1376abd8824877.png"},{"id":97700614,"identity":"0d63971d-445e-4816-9bbb-7e6e43f3e5a3","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":190346,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/e9de093ac32c9ca32a9c492f.png"},{"id":97700622,"identity":"cc7eb039-68be-4a30-8da4-220421902df9","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":133297,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/c55abd8829f1d940672e18ed.png"},{"id":97700623,"identity":"72591f5a-df1c-42b0-900c-17437e688105","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":152057,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/8fc35c6a87c89b7f5e0e1a6a.png"},{"id":97895062,"identity":"402b8d66-9f2c-4099-b5ba-36bac8d937e6","added_by":"auto","created_at":"2025-12-10 15:33:28","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":164453,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/2607664de0ee1a49cd76bf4d.png"},{"id":97700620,"identity":"d6593ff5-0fac-4657-bc33-9489f3a32f5d","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":154398,"visible":true,"origin":"","legend":"","description":"","filename":"abbbf8f77ecd4ac4b9b3f6e098742cf91structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/0f49d5d223f45289a6edb470.xml"},{"id":97700624,"identity":"a1a1cb92-77a4-4e36-b0f0-823b57782835","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":167900,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/13c999baf080e58efb39305e.html"},{"id":97700596,"identity":"13d7282d-d41e-4278-acb6-b5b77c8b906c","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":389975,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA hybrid approach for VHH screening.\u003c/strong\u003e\u003cbr\u003e\n(\u003cstrong\u003eA\u003c/strong\u003e) Schematic of the initial screen using a yeast surface-display library of approximately 1×10\u003csup\u003e8\u003c/sup\u003e VHH clones (procured from Kerafast, Cat EF0014-FP). Two rounds of magnetic-activated cell sorting (MACS) enriched for yeast displaying VHHs that bind full-length 2N4R tau, followed by three rounds of fluorescence-activated cell sorting (FACS) to further refine the selection. See \u003cstrong\u003eFigure S1\u003c/strong\u003e for additional details on screening parameters. (\u003cstrong\u003eB\u003c/strong\u003e) VHHs identified from (\u003cstrong\u003eA\u003c/strong\u003e) were used to immunoprecipitate tau seeds from clarified AD brain lysates, and the eluted material was transfected into tau biosensor cells. FRET-positive cells in this assay reflect pathogenic seeding activity, thereby serving as a readout of seed binders.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/84df34fb8c77808295f8bfc4.png"},{"id":97894861,"identity":"0c5d2cf4-db7d-41f9-872b-68c36c33d98b","added_by":"auto","created_at":"2025-12-10 15:33:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":295470,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDiscovery of VHHs selective for tauopathy seeds. \u003c/strong\u003eCorrelation between the percentages of FRET-positive cells detected by an IP-and-seeding assay for the top 300 VHH clones tested with distinct tau seed sources. Shown are pairwise comparisons between two independent AD samples (\u003cstrong\u003eA\u003c/strong\u003e), two independent CBD samples (B), an AD sample and P301S lysate (C), and an AD sample with heparin-induced recombinant fibrils (Rec 2N4R) (D). We observe a strong correlation between the two AD samples and, separately, between two CBD samples. Furthermore, AD shows a moderate correlation with CBD and P301S (Figure S2) but a poor correlation with recombinant fibrils. \u003cstrong\u003eFigure S2\u003c/strong\u003e provides additional data and analyses. Data points represent average of two independent experiments (each with technical replicates); error bars = S.D.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/757b84b6bf9ea6de4931f146.png"},{"id":97894955,"identity":"16a95835-5586-4f63-8c87-85d810068a51","added_by":"auto","created_at":"2025-12-10 15:33:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":221596,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunoprecipitation of tau seeds from various tauopathy and control brains. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e-\u003cstrong\u003eC\u003c/strong\u003e) Seed capture from two AD brain samples (AD 1, AD 2), two CBD brain samples (CBD 1, CBD 2), and a P301S mouse brain, respectively, using anti-tau VHH(510M) or VHH(50M). (\u003cstrong\u003eD\u003c/strong\u003e) Immunoprecipitation from a non-tauopathy control brain. Error bars = S.D. Significance was evaluated against a non-specific VHH (NS VHH) and bead-only controls using two-way ANOVA with Tukey’s multiple comparison test. ***p ≤ 0.0002; **p ≤ 0.001; ****p ≤ 0.0001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/3afa0e612af3ced5678b34be.png"},{"id":97700601,"identity":"20325dbc-8a0d-4f69-9af9-39e50d806f11","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":421578,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDot blot analysis of anti-tau VHH binding to AD, P301S, and control brain lysates.\u003c/strong\u003e\u003cbr\u003e\n (\u003cstrong\u003eA\u003c/strong\u003e) Representative dot-blot profile using anti-tau VHH(510M), anti-tau VHH(50M), and HJ8.5 antibody as detection molecules against various lysate concentrations from two AD cases (AD1, AD2), a P301S mouse model, and control brain. (\u003cstrong\u003eB\u003c/strong\u003e) Comparison of signal intensity at 1.25 µg of total protein, based on integrated optical densities measured with Fiji (version 1.54f). Here, Anti-tau VHH(510M) preferentially binds to AD and P301S lysates (left panel), while showing minimal reactivity to control tissue, as compared to Anti-tau VHH(50M) (middle panel), that shows broadly similar signal across all tested samples. By contrast, HJ8.5 antibody (right panel) shows greater binding to P301S and comparably lower binding to AD brains. Error bars represent S.D. (n = 4). Statistical significance was assessed with one-way ANOVA followed by Šídák’s multiple comparisons test (p ≤ 0.0029, **p ≤ 0.0001).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/059bf418dda0b9bd84df9a28.png"},{"id":97892964,"identity":"bd54fa31-d6cb-4a4a-b037-2247864ce4e0","added_by":"auto","created_at":"2025-12-10 15:24:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":688873,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEpitope mapping of anti-tau VHH(510M).\u003c/strong\u003e\u003cbr\u003e\n(\u003cstrong\u003eA\u003c/strong\u003e) Overlaid 2D \u003csup\u003e1\u003c/sup\u003eH,\u003csup\u003e15\u003c/sup\u003eN-HSQC spectra of \u003csup\u003e15\u003c/sup\u003eN-labeled tau 2N4R alone (black) and in the presence of equimolar VHH(510M) (blue). Several cross-peaks, particularly in the C-terminal region, shift or disappear upon binding, indicating that (VHH510M) recognizes residues at the carboxy-terminus of tau. Insets show enlarged views of selected regions highlighting peak perturbations. (\u003cstrong\u003eB\u003c/strong\u003e) Schematic representation of 2N4R-tau epitope recognized by anti-tau VHH(510M).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/2a331a617d688c7c68a168d5.png"},{"id":97700599,"identity":"5487292a-41fe-4c83-ae64-6a8ffb733414","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":694848,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAge-dependent immunostaining of P301S mouse brains with VHH(510M).\u003c/strong\u003e \u003cbr\u003e\n Representative images from P301S tauopathy mice (9-, and 12-month old) and WT control mice stained with anti-tau VHH510M (red) and phospho-tau antibody AT8 (green). Anti-tau VHH(510M) labels pathological inclusions that overlap with AT8-positive aggregates and stains additional inclusions not recognized by AT8 (white arrows). See \u003cstrong\u003eFigure S9 and S10\u003c/strong\u003e for additional images and details.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/f8a7d837cf7b14c9d6922b1e.png"},{"id":97894789,"identity":"0e103470-1c84-44a8-a270-7d3819b2eab4","added_by":"auto","created_at":"2025-12-10 15:33:01","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":896717,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVHH(510M) immunoreactivity in human AD and CBD brain tissue.\u003c/strong\u003e\u003cbr\u003e\n Representative images from tissue microarray sections of the fixed frontal cortex of two AD cases and two CBD cases. Staining with the anti-tau VHH(510M) (red) and phospho-tau antibody AT8 (green) reveals co-localization of tau inclusions in overlapping regions (yellow in overlay). Anti-tau VHH(510M) labels pathological inclusions that overlap with AT8-positive aggregates but also additional inclusions not recognized by AT8 (white arrows).\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/e1e7d64815b6e545b5f7641a.png"},{"id":97902481,"identity":"71891ad9-d146-43b5-bfb5-8e0362b8dc1c","added_by":"auto","created_at":"2025-12-10 15:52:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5040105,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/2a0907c6-2ddc-443f-8f2a-db98a8fc7ca8.pdf"},{"id":97700610,"identity":"065da79b-f5a9-4cd6-b913-07059f3caa41","added_by":"auto","created_at":"2025-12-08 12:21:41","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":7249014,"visible":true,"origin":"","legend":"","description":"","filename":"Gupta2025ActaSI.docx","url":"https://assets-eu.researchsquare.com/files/rs-8274351/v1/ecfb04cad0d080f59dd53659.docx"}],"financialInterests":"Competing interest reported. MID and JVA are co-founders of Handshake Bio, a biotechnology company focused on developing diagnostics and therapeutics for neurodegenerative diseases, including tauopathies. The authors declare that Handshake Bio did not directly fund or influence the design, execution, or interpretation of the experiments presented in this manuscript. The remaining authors declare no competing interests.","formattedTitle":"Conformation-based detection of tau seeds with a novel VHH","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eTau assembly into amyloid fibrils causes neurodegeneration and cognitive decline, and underlies a spectrum of neurodegenerative disorders collectively termed tauopathies, including Alzheimer's disease (AD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and Pick's disease (PiD)(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Each disorder features unique conformations of assembled tau (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Previously, we proposed that distinct fibrillar tau assemblies, or strains, function as prions, and produce progressive pathology by serving as self-propagating templates upon which native tau assembles into amyloid fibrils (\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). The propagation of tau seeds between neurons is considered a key driver of disease progression (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Consequently, the targeting of tau seeds represents a promising strategy for early disease detection and intervention.\u003c/p\u003e\u003cp\u003eVarious approaches to inhibit tau pathology have been proposed (\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Multiple antibodies target different regions or post-translational modifications of tau, including the N- and C-terminus, proline-rich domain, repeat domain, and phosphorylated or acetylated epitopes (\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). However, despite reported benefits in mouse models, none have yet demonstrated efficacy in patients. This likely derives from conformational heterogeneity of tauopathies, variability of disease in mice vs. humans, and poor brain delivery.\u003c/p\u003e\u003cp\u003eReagents that preferentially bind human brain-derived tau seeds might better target disease-associated structures(\u003cem\u003e3\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e). In this context, camelid variable domain of heavy chain (VHH) or single domain antibodies (sdAb) have received attention for their small size, stability, ease of production, and specificity (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), and many have been proposed for tau (\u003cspan additionalcitationids=\"CR22 CR23 CR24 CR25\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). However, current anti-tau VHHs generated to date target recombinant tau monomer or heparin-induced fibrils, whose structures differ from those observed in disease (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDespite progress, our understanding of the biochemical and structural properties of tau seeds remains limited, and isolating large quantities of highly purified patient-derived tau seeds is impractical for large screening campaigns. To address this challenge, we devised a two-stage VHH screening strategy, coupling yeast display with mammalian cell-based seeding assays. We have characterized a resultant VHH with detailed biophysical, biochemical, and immunofluorescence studies.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eTwo-step VHH screening to identify tau seed-binding clones\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eWe used a hybrid screening strategy to identify VHHs that preferentially recognized pathogenic tau seeds from AD brains (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Tau monomer is dynamic, and interconverts among an ensemble of conformations. Therefore, we first enriched VHH clones from a fully synthetic yeast display library (~\u0026thinsp;1\u0026times;10\u003csup\u003e8\u003c/sup\u003e clones) that bound full-length 2N4R tau monomer. We performed five rounds of selection\u0026mdash;two rounds of Magnetic-Activated Cell Sorting (MACS) followed by three rounds of Fluorescence-Activated Cell Sorting (FACS)\u0026mdash;progressively lowering the tau concentration from 500 nM to 10 nM to isolate\u0026thinsp;~\u0026thinsp;900 binders (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe screened these arrayed clones for seed-binding by immunoprecipitation (IP) from patient-derived lysates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). We used clarified homogenates of the frontal cortex from two AD cases (AD 1, AD 2), two CBD cases (CBD 1, CBD 2), and a P301S mouse model, each known to harbor distinct conformations of pathogenic tau seeds. After incubation with VHHs, we eluted bound material and measured seeding activity in v2L tau biosensor cells (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). We quantified seeding as the percentage of FRET-positive cells in the v2L tau biosensor line (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). This allowed prioritization of ~\u0026thinsp;300 clones that bound tau seeds (see the correlation plots in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Figure S2).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eSelected VHHs preferentially bind AD and CBD-derived tau seeds\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eTo assess the selectivity for human brain-derived seeds, we tested each clone via immunoprecipitation coupled with cell-based seeding assays (IP/seeding) against multiple tau sources: two independent Alzheimer's disease (AD) cases (AD 1, AD 2), two Corticobasal degeneration (CBD) cases (CBD 1, CBD 2), one P301S mouse brain lysate, and heparin-induced recombinant 2N4R fibrils (Rec 2N4R) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; Figure S2). Upon comparing the seed binding ability of top VHH clones, we observed a strong correlation between two AD samples and separately between two CBD samples, but a weak correlation between patient-derived tau seeds and seeds extracted from P301S tauopathy (PS19) mouse brain, and negligible correlation with recombinant fibrils (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This indicated that the selection process identified VHHs selective for human tau seeds. Sequence analysis of the best seed-binding clones revealed\u0026thinsp;\u0026gt;\u0026thinsp;15 unique VHHs, including VHH(510) and VHH(50), which we further characterized.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eFramework optimization improves VHH expression and stability\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eTo purify VHHs for functional and structural assays, we subcloned and expressed them in \u003cem\u003eE. coli\u003c/em\u003e; however, many clones aggregated at high concentrations during expression and purification (Figures S3 and S4), limiting yields. Following a strategy described previously (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e), we introduced framework mutations that increased VHH stability without altering the antigen-binding complementarity-determining regions (CDRs). The stabilized mutant (M) variants were termed VHH(510M) and VHH(50M). SDS-PAGE analyses confirmed that VHH(510M) and VHH(50M) expressed at higher levels and exhibited diminished aggregation when compared to their original counterparts VHH(510) and VHH(50) (Figure S3 and S4). After affinity purification using Amsphere\u0026trade; A3 beads (Figure S5) and size-exclusion chromatography (SEC), we measured the secondary structure of both mutant VHHs by circular dichroism (CD). Both stabilized VHHs retained a typical β-sheet signature (Figure S6A) and were stable up to 55\u0026deg;C (Figure S6B). When tested by IP/seeding (Figure S7), the framework-optimized VHHs preserved the seed-binding capabilities of their wild-type counterparts.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eAnti-tau VHHs have low affinity for tau monomer\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eNext, we carried out on-yeast EC\u003csub\u003e50\u003c/sub\u003e measurements for VHH(510) and VHH(50) to quantify their monomer affinity (Figure S8A), as described previously (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). VHH(510) and VHH(50) bound tau monomer above micromolar affinity, with VHH(510) having notably weaker affinity (higher EC\u003csub\u003e50\u003c/sub\u003e). To further validate these findings, we performed affinity measurements for stabilized mutant (M) variant VHHs ((VHH(510) and VHH(50)), using flow-induced dispersion analysis (FIDA). In line with EC\u003csub\u003e50\u003c/sub\u003e measurements, both VHHs exhibited weak affinity for tau monomer (Figure S8B): VHH(510M) demonstrated a K\u003csub\u003eD\u003c/sub\u003e of \u0026gt;\u0026thinsp;4 \u0026micro;M, comparatively higher than what we observed for VHH(50M), with a K\u003csub\u003eD\u003c/sub\u003e of ~\u0026thinsp;0.1 \u0026micro;M. Overall, these results suggest that VHH(510M) has low affinity for tau monomer.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eAnti-tau VHHs immunoprecipitate seeds from AD and CBD brains\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eWe further characterized the binding properties of the VHH(510M) and VHH(50M) by IP/seeding of brain homogenates from cases of Alzheimer's disease (AD), Corticobasal degeneration (CBD), P301S mouse brain, and human control using Amsphere\u0026trade; A3 beads (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Both VHHs immunoprecipitated tau seeds from AD and CBD brains, and the eluted seeds were detectable on v2L tau biosensor cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). Both VHHs also bound P301S brain seeds but we detected no seeding activity from control brain samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D). Overall, our measurements indicated that VHH(510M) and VHH(50M) had comparable binding activities against pathogenic tau seeds from human brain.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAnti-tau VHH(510M) selectively binds to AD and CBD brains\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eTo further test seed vs. monomer binding under non-denaturing conditions, we performed dot-blot analyses with VHH(510M) and VHH(50M), analyzing AD, P301S, and control brain samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). We applied brain homogenates onto membranes, exposed them to anti-tau VHHs and HJ8.5 antibody, which binds monomer with high affinity (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). VHH(510M) exhibited strong binding to tauopathy brain homogenates and weak binding to control brains (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB; left panel), whereas VHH(50M) equally bound AD and control brain homogenates (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB; middle panel). In contrast, HJ8.5 exhibited comparatively poor binding to AD brain and high binding to control brain extracts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB; right panel). These results indicated that only VHH(510M) has selectivity for pathogenic tau seeds, whereas VHH(50M) exhibits a comparatively higher affinity for tau monomer.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eVHH(510M) binds to the carboxy-terminus of tau\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eWe next used solution-state NMR to identify the binding site for VHH(510M) on tau. We incubated the purified VHH(510M) with \u003csup\u003e15\u003c/sup\u003eN labeled full-length tau 2N4R at a 1:1 molar ratio, recorded the \u003csup\u003e1\u003c/sup\u003eH,\u003csup\u003e15\u003c/sup\u003eN- heteronuclear single quantum coherence (HSQC) spectra of full-length 2N4R tau as described previously (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), and assigned well-resolved HSQC cross-peaks based on previously published assignments (BMRB Entry 50701). The superimposed two-dimensional \u003csup\u003e1\u003c/sup\u003eH,\u003csup\u003e15\u003c/sup\u003eN-HSQC spectra of tau alone vs. with VHH(510M) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) showed broadening or disappearance of cross-peaks corresponding to residues near the tau C-terminus: Gly427, Asp430, Ala434, Ser435, leu436, Ala437, Leu441 (also see schematic in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). These data show that VHH(510M) binds to the tau C-terminus.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eVHH(510M) stains tau inclusions in P301S mice and human AD brains\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eFinally we used VHH(510M) to stain fixed tissues from a P301S (PS19) mice (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e) and AD brains, in comparison with AT8, an anti-phospho-tau antibody. We analyzed PS19 mice brains at various ages (3 to 12 months) with fluorescently conjugated VHH(510M). PS19 mice do not develop consistent AT8 pathology until ~\u0026thinsp;6 months of age (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). However, VHH(510M) stained tau inclusions in P301S mice as early as 3 months, including the neocortex, amygdala, hippocampus, and brain stem(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, S9, and S10). VHH(510M) staining largely included areas positive for AT8, but detected additional unique inclusions in various brain regions not revealed by AT8. In AD brain VHH(510M) similarly co-localized with AT8 in many tau inclusions and labeled additional distinct tau inclusions in both AD and CBD brains that were not stained by AT8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eTrans-cellular propagation of unique conformations of tau assemblies appears to be central to Alzheimer's disease (AD) and other tauopathies (\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Thus, agents that specifically target and neutralize tau seeds, particularly those present in the early stages of the disease, could significantly improve both early detection and therapy. Two major challenges complicate the development of effective binding agents. First, it is difficult to produce conformations of desired amyloid structure at scale and reproducibility sufficient for high throughput discovery. Second, it has not been possible to include seed binding directly within the selection paradigm. This study thus represents a significant advance, as we report a novel VHH discovery strategy that has revealed an agent with selectivity for pathological tau assemblies, incorporating human brain-derived seed binding into the selection process. The use of a pure \u003cem\u003ein vitro\u003c/em\u003e system highlights the power of this approach, as it can incorporate established yeast expression libraries (as we have done here) or those selected \u003cem\u003ein vivo\u003c/em\u003e and subcloned. In this case, we report a novel VHH which reveals ultra-high selectivity for pathological tau structures, and novel patterns of tau deposition \u003cem\u003ein vivo\u003c/em\u003e. This agent, and its derivatives, could thus significantly improve diagnosis and therapy of tauopathy, while the approaches described could be applied much more broadly in the amyloid field.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eA discovery paradigm to selectively target brain-derived tau seeds\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eIt is very difficult to incorporate disease-relevant tau seeds into primary vaccine campaigns to produce seed selective monoclonal antibodies with anything other than moderate throughput. Moreover, processing of complex protein assemblies by antigen presenting cells cannot maintain the amyloid structure. This work advances discovery methods by demonstrating the feasibility of screening tau binding agents against soluble clarified brain lysates from AD or CBD brains. This allowed us to identify an anti-tau VHH with high avidity for pathogenic aggregates and low affinity for tau monomer. This property is crucial for successful diagnosis and therapy, as the goal is to selectively target pathogenic tau. Because the discovery paradigm exploits brain-derived seeding activity within a high throughput context, it can be adapted across tauopathies, and, in theory, to any disorder for which it is possible to incorporate cell-based or \u003cem\u003ein vitro\u003c/em\u003e screening for bound seeds. This work augments prior efforts to isolate conformation-specific antibodies and nanobodies (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e), underscoring how epitope choice is critical for discrimination of pathological from native tau.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eVHH(510M) selectively targets pathological tau seeds vs. monomer\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eIt has been difficult to engineer tau binding agents with high selectivity for tau seeds vs. monomer. Thus, VHH(510M) represents a potentially useful tool for the field, as it binds tau seeds with high avidity, and has low affinity for tau monomer. Using IP and dot-blot against multiple tauopathy brain homogenates we found that VHH(510M) bound pathogenic tau seeds from AD and CBD brain but not to native tau present in control brain. Finally, immunohistochemistry indicated that VHH(510M) stained tau inclusions in both PS19 and AD brains. The distinct staining pattern observed versus AT8, and the ability to detect early pathology in PS19 mice, indicates an advantage of conformation vs. post-translational modification as a detection method.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003ePotential applications and advantages of VHH-based reagents\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eDue to their small size, high stability, and ease of genetic manipulation, VHHs hold considerable promise for next-generation immunotherapies and \u003cem\u003ein vivo\u003c/em\u003e imaging tools (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). These could be delivered intracerebrally or peripherally, fused to blood-brain barrier shuttle peptides or packaged within viral vectors, allowing for specific targeting of intracellular tau species. The selectivity of VHH(510M) for inclusions in both mouse and human tauopathy tissue suggests that it binds pathological assemblies in complex environments. This property may be exploited to visualize early-stage tau lesions via PET imaging or to track the spread of disease-relevant aggregates longitudinally in animal models. Furthermore, the capacity to distinguish pathogenic tau seeds from monomeric tau would be expected to minimize off-target depletion of physiological tau, which is important for neuronal function.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eTargeting other amyloidogenic proteins\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eMany neurodegenerative diseases, including Parkinson\u0026rsquo;s disease and amyotrophic lateral sclerosis, are associated with prion-like spread of aggregates derived from α-synuclein and TDP-43, respectively. Each protein may exist in structural forms that differ significantly from recombinant assemblies, suggesting that our approach could be generalized to discover VHHs targeting more physiologically relevant conformations. Indeed, early detection and selective neutralization of these misfolded species might represent a powerful strategy for slowing or preventing disease progression.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eWe have identified VHH that preferentially bind pathological tau seeds in AD and CBD, with demonstrated utility in cell-based assays, biochemical immunoprecipitations, and histological detection of pathological inclusions. These tools provide new avenues to develop diagnostic probes and disease-modifying therapies that minimize off-target effects on normal tau. Future studies will focus on optimizing VHH engineering for \u003cem\u003ein vivo\u003c/em\u003e delivery, expanding the breadth of targets, and determining if selective interference with pathogenic tau seeds might modify disease trajectory in animal models and ultimately in human clinical settings (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eLibrary expansion and VHH expression\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThe \"Yeast surface display nanobody library (NbLib)\" generated by McMahon et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e) was procured from Kerafast (Catalog number: EF0014-FP). Upon receipt, the yeast library was thawed and expanded in \u0026lsquo;Yglc4.5 \u0026ndash;Trp\u0026rsquo; media, as previously described (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Cell viability was assessed, and the presence of contamination was ruled out. Finally, we prepared multiple glycerol stocks at \u0026gt;\u0026thinsp;10-fold higher cell viability than the number of clones to ensure no loss in library diversity, and the aliquots were frozen at -80\u0026ordm;C for VHH screening.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e\u003cb\u003eVHH expression check\u003c/b\u003e\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eAliquots of the VHH library were thawed at 30\u0026deg;C, each containing approximately 5 \u0026times; 10\u0026sup1;⁰ cells, and were recovered by growing in 1 liter of \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media at 30\u0026deg;C and 220 rpm for 24 hours. The following day, the total number of yeast cells in the overnight culture was counted by measuring the OD\u003csub\u003e600\u003c/sub\u003e (where OD\u003csub\u003e600\u003c/sub\u003e of 1\u0026thinsp;\u0026asymp;\u0026thinsp;1.5 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e yeast cells). 1 \u0026times; 10\u0026sup1;⁰ cells from the \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; culture were collected and washed once with \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose\u0026rdquo; media, and transferred into 1 liter of \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose\u0026rdquo; media. The yeast were grown at 25\u0026deg;C and 220 rpm for 72 hours, and checked for VHH expression at 24, 48, and 72 hours. In parallel, 1 \u0026times; 10\u003csup\u003e10\u003c/sup\u003e cells from the primary culture were transferred into \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media as a negative control for VHH expression. At each time point, 1 \u0026times; 10⁶ cells from both the glucose and galactose cultures were collected, washed twice with 100 \u0026micro;l of selection buffer, and incubated with 5 \u0026micro;g of anti-HA antibody labeled with Alexa Fluor\u0026trade; 647 for 30 minutes at 4\u0026deg;C. The cells were then washed twice with selection buffer to remove unbound antibody and analyzed on a BD LSRFortessa\u0026trade; Cell Analyzer to determine the percentage of yeast cells expressing nanobodies in both \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; and \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose\u0026rdquo; media.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003ePreparation of labeled tau for VHH screening\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThe pET28b plasmid encoding full-length 2N4R tau protein sequence was a kind gift from Dr. David Eisenberg (UCLA). Full-length tau monomer was purified as described previously (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), with minor modifications. A pET28b-tau plasmid was transformed into BL21(DE3) competent \u003cem\u003eE. coli\u003c/em\u003e cells and colonies were screened for protein expression. The colony with the highest protein expression was grown overnight into 50 ml 1\u0026times; Terrific Broth (TB) media at 37\u0026deg;C at 220 rpm. The next day, the primary culture was transferred in 1 liter 1\u0026times; TB media at 37\u0026deg;C at 220 rpm and protein expression was induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 4 hour at 37\u0026deg;C. Cells were harvested by centrifugation at 6000\u0026times; g for 20 min at 4\u0026deg;C, resuspended in tau lysis buffer (50 mM Tris pH 7.5 containing 500 mM NaCl, 1 mM β-mercaptoethanol, 20 mM imidazole, and 1 mM phenylmethylsulfonyl fluoride (PMSF), with cOmplete\u0026trade; EDTA-free Protease Inhibitor Cocktail), and lysed using GEA PandaPLUS Lab Homogenizer 2000. The cell lysate was centrifuged at 20,000\u0026times; g for 40 min at 4\u0026deg;C and the supernatant was filtered and loaded on pre-equilibrated Ni-NTA Agarose beads. The column was washed with lysis buffer and protein was eluted with lysis buffer containing a gradient of 20 mM to 500 mM imidazole. Clean fractions for Ni-NTA purification were concentrated and buffer exchanged into 50 mM MES, 50 mM NaCl, 1 mM β-mercaptoethanol (pH 6) by PD-10 column (Cytiva Life Sciences, cat. no 17-0851-01) and loaded onto a 5 ml HiTrap SP-HP column (Cytiva Life Sciences, Cat. No. 17115201) for cation exchange purification. Pure fractions from cation-exchange chromatography were pooled, concentrated and injected onto a HiLoad 16/600 Superdex 75 pg column (Cytiva Life Sciences, cat. No. 28989333) for size-exclusion chromatography (SEC). The fractions from SEC containing clean protein were pooled and labeled with Alexa Fluor\u0026trade; 647, Alexa Fluor\u0026trade; 488, and FITC fluorophore using Alexa Fluor\u0026trade; 647 NHS Ester (Succinimidyl ester), Alexa Fluor\u0026trade; 488 NHS Ester (Succinimidyl ester), and NHS-Fluorescein (5/6-carboxyfluorescein succinimidyl ester), respectively. For labeling, the purified protein was incubated with a 20-fold molar excess of dye overnight at 4\u0026deg;C, on a rotary shaker. The reaction was quenched by adding 0.1 ml of freshly prepared 1.5 M hydroxylamine (pH 8.5), and the free dye was removed by PD-10 desalting column. The labeled protein was quantified and stored in -80\u0026deg;C for further use.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eMagnetic Assisted Cell Sorting (MACS)\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eTwo glycerol stocks of the VHH library containing\u0026thinsp;~\u0026thinsp;5 x 10\u003csup\u003e9\u003c/sup\u003e cells were thawed and inoculated into 1 liter \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media and grown for 24 hours, at 30\u0026deg;C with shaking at 230 rpm. The OD\u003csub\u003e600\u003c/sub\u003e was recorded (here, OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1 is ~\u0026thinsp;1 x 10\u003csup\u003e7\u003c/sup\u003e cells/ml), and enough yeast for 100-fold library diversity/previous round coverage were inoculated into 1 liter \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose\u0026rdquo; media and induced for 48 hour at 25\u0026deg;C, 250 rpm. The VHH expression was checked as described above, and yeast were used for MACS. For the first round of Magnetic Assisted Cell Sorting (MACS), yeast cells were washed twice with selection buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM maltose, 0.1% BSA) and were incubated with 500 \u0026micro;l Anti-Cy5/Anti-Alexa Fluor\u0026trade; 647 Microbeads (Miltenyi CAT NO. 130-091-395) with constant mixing for 2 hour at 4\u0026deg;C. The yeast cells were then centrifuged to remove the unbound magnetic beads, and the yeast cells were washed with selection buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM maltose, 0.1% BSA) to remove loosely bound magnetic beads. The cells were then passed over a pre-equilibrated LD column (Miltenyi CAT NO. 130-042-901) for negative selection. This step removes all the yeast cells that non-specifically bind to Anti-Cy5/Anti-Alexa Fluor\u0026trade; 647 Microbeads. The yeast cells passed through LD column were collected and washed once with selection buffer. The cells were then resuspended and incubated with 500 nM 2N4R tau labeled with Alexa Fluor\u0026trade; 647 with constant mixing for 1 hour at 4\u0026deg;C. The yeast cells were then washed twice with selection buffer to remove unbound protein, and the resuspended cells were again incubated with 500 \u0026micro;l Anti-Cy5/Anti-Alexa Fluor\u0026trade; 647 MicroBeads (Miltenyi Cat no. 130-091-395) for 1 hour, at 4\u0026deg;C with constant mixing. This allows for the formation of a yeast-tau-microbead complex that can be selected with MACS. The cells were then washed twice with the selection buffer to remove unbound microbeads and passed through LS column (Miltenyi Cat no. 130-042-401) for positive selection. The unbound yeast cells were discarded and the yeast cells collected on LS column were collected and grown in \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media for the next rounds of screening. We collected a small amount of yeast cells at each step and plated them on \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose agar\u0026rdquo; and YPD-agar plate; this is done to count the number of yeast cells after each step and to confirm that there is no contamination throughout the process. For the second round of MACS, we followed a similar process to the one we used for MACS1. Here, we expanded the yeast cells collected from MACS1 into 1 liter of \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media for 24 hours and then transferred\u0026thinsp;~\u0026thinsp;10\u003csup\u003e9\u003c/sup\u003e yeast cells into 1 liter of \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose\u0026rdquo; media, grown for 48 h at 25\u0026deg;C, 250 rpm to induce VHH expression. For the second round of MACS, yeast cells were washed twice with selection buffer and the yeast cells were incubated with 500 \u0026micro;l Anti-FITC microbeads (Miltenyi cat no. 130-042-901) for negative selection. The unbound cells were then incubated with 250 nM 2N4R tau labeled with FITC with constant mixing for 1 hour at 4\u0026deg;C. The yeast cells were then washed and incubated with 500 \u0026micro;l Anti-FITC microbeads (Miltenyi cat no. 130-042-901). The yeast cells were then passed through LS column (Miltenyi cat no. 130-042-401) for positive selection. The unbound yeast cells were discarded, and the yeast cells collected on LS column were grown in \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media for the subsequent rounds of screening.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eFluorescence Activated Cell Sorting (FACS)\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eYeast from MACS2 were grown, and VHH expression was induced as before. After VHH expression was verified, 1 x 10\u003csup\u003e7\u003c/sup\u003e yeast cells were washed in selection buffer and incubated with 100 nM tau 2N4R- Alexa Fluor\u0026trade; 647 with constant mixing for 1 hour at 4\u0026deg; C. The yeast cells were washed twice with selection buffer to remove unbound tau. The yeast cells bound with tau were then resuspended and incubated with 25 \u0026micro;g of Alexa Fluor\u0026trade; 488-conjugated anti-HA tag antibody (Cell Signaling Technology cat. no. 2350S). After incubation, yeast cells were washed twice to remove unbound antibody, resuspended in selection buffer and filtered before running on FACSAria SORP 4-laser sorter (BD Biosciences). Yeast cells showing maximal binding to tau 2N4R- Alexa Fluor\u0026trade; 647 and anti-HA tag antibody- Alexa Fluor\u0026trade; 488 were sorted and collected in \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media. Here, we collected\u0026thinsp;~\u0026thinsp;0.05% of total cells. Collected yeast cells were revived by growing for 24 hours, at 30\u0026deg;C with shaking at 230 rpm. These cells were then used for the next round of screening.\u003c/p\u003e\u003cp\u003eThe cells collected after 1st round of FACS were expanded in 1 liter \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media and VHH expression was induced in \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose\u0026rdquo; media. The VHH expression was confirmed as described above and cells were used for the 2nd round of FACS. Here, we used 30 nM of 2N4R tau labeled with FITC that was used for screening. The tau-binding positive yeast cells were selected and used for the third and final round of FACS. For the final round of FACS, we used 10 nM of 2N4R tau labeled with Alexa Fluor\u0026trade; 488 for the screening. After five rounds of screening, a total of ~\u0026thinsp;1,000 individual yeast single colonies were collected onto \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; agar plates and grown for 3\u0026ndash;5 days at 30\u0026deg;C until colonies were visible. These colonies were then screened further to check for their seed binding.\u003c/p\u003e\u003cp\u003e\u003cb\u003eVHH sequence verification and cloning in\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e \u003cb\u003efor recombinant protein production\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIndividual yeast colonies were grown in 5 ml \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media and DNA was extracted using Zymoprep Yeast Plasmid Miniprep II (cat no D2004). The VHH sequence was then amplified using the following primers:\u003c/p\u003e\u003cp\u003eForward primer:\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003cp\u003eGTTTAACTTTAAGAAGGAGATATACCATGCAGGTGCAGCTGCAGGAAAG\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eReverse primer: GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTTAGCAGCTGCTCACGGTCACCTG.\u003c/p\u003e\u003cp\u003eThe PCR product was checked on agarose gel and used for sequencing as well as for cloning in \u003cem\u003eE. coli\u003c/em\u003e for recombinant protein production. For sequencing, a portion of the amplified product was purified with ExoSAP-IT\u0026trade; (Cat no. 78201.1.ML), and the sequence was determined by Sanger sequencing. For cloning into \u003cem\u003eE. coli\u003c/em\u003e, the PCR product was cleaned using Zymo Genomic DNA Clean and Concentrator (Cat no. D4011). The purified product was then assembled into a pre-digested pET28b vector (digested with NcoI and XhoI restriction enzymes) using NEBuilder\u0026reg; HiFi DNA assembly cloning kit. The assembled product was then transformed into NEB\u0026reg; 5-alpha Competent \u003cem\u003eE. coli\u003c/em\u003e (High Efficiency) cells from NEB. The single colonies were used to purify the plasmid, and the plasmid was sent for sequencing. Once, the VHH sequence was confirmed, the plasmid was transformed into BL21(DE3) competent cells (prod. no. C2527) for recombinant VHH expression.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003ePurification using A3 resin\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThe pET28b plasmid containing the VHH sequence was transformed into BL21(DE3) cells and single colonies were selected and screened for protein expression. The colony having high protein expression was grown overnight in Luria-Bertani broth at 37\u0026deg;C. The saturated culture was then transferred into 1 liter Auto-Induction Medium (cat no GCM17.0500 BOCA Scientific) and grown at 37\u0026deg;C for 8 hours, followed by 16 h growth at 24\u0026deg;C to induce protein expression. The bacterial culture was spun down, and the cell pellet was resuspended into VHH lysis buffer (1x PBS pH 7.2, 2% glycerol, 2 mM EDTA, protease inhibitor cocktail). The resuspended cells were lysed by GEA PandaPLUS Lab Homogenizer 2000 until clarified. The clarified lysate was spun down to remove cell debris, filtered through 0.45 \u0026micro;m filter, and purified using Amsphere A3 resin (JSR Life Sciences). The clarified cell lysate was loaded onto pre-equilibrated Amsphere A3 resin. The beads were washed with 10 CV (column volumes) of 1x PBS, followed by 10 CV of 1 M NaCl in 1x PBS, 10 CV of 2 M NaCl in 1x PBS, and finally with 10 CV of 5 M NaCl in 1x PBS to remove non-specifically bound impurities. The nanobodies were then eluted using 2 CV of 100 mM Glycine pH 3.0 followed by a second elution using 2 CV of 250 mM Glycine pH 2.5. All of the elutions were collected in a tube containing 0.25 CV 1M Tris-HCl pH 8.0 and 0.25 CV 10% glycerol to neutralize the elutions, preventing VHH precipitation. The VHHs were further purified using size-exclusion chromatography to perform buffer exchange (1x PBS containing 2% glycerol) and to remove residual protein impurities. Purified fractions were checked on SDS-PAGE, filtered using 0.22 \u0026micro;m filter (to remove insoluble aggregates if there are any), and stored at 4\u0026deg;C for further use.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eBrain lysate preparation\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eFlash-frozen human or mouse brain was suspended in 1x TBS containing 1x cOmplete protease inhibitor cocktail (Roche) at a final concentration of 10% w/v. The tissues were homogenized using probe homogenizer with Power Gen 125 tissue homogenizer (Fischer 734 Scientific). The brain lysate was then sonicated for 5 min at 4\u0026deg;C at an amplitude of 65 in a bath-sonicator, with a \u0026ldquo;30 sec on and 30 sec off\u0026rdquo; interval at to avoid heating of the sample. The sonicated sample was then centrifuged at 20,000x g, at 4\u0026deg;C for 20 min, and the supernatant was collected in protein low-binding tubes. The brain lysate was then quantified using Pierce\u0026trade; 660nm protein assay reagent (cat. no 22660) and used for experiments.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003eImmunoprecipitation using Amsphere\u0026trade; A3 resin\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003ePurified VHHs were concentrated using Amicon ultra centrifugal filter, 3 kDa MWCO (Cat. no UFC9003). The VHHs were then filtered using Ultrafree-MC 0.22 \u0026micro;m pore size filters (0.5 ml volume, cat. no UFC30GV0S) to remove any aggregated protein. The VHHs were then spun at 20,000 x g for 20 min at 4\u0026deg;C to remove any residual aggregated VHH (if any) and supernatant protein was quantified using DeNovix DS-11 FX\u0026thinsp;+\u0026thinsp;spectrophotometer. In parallel, the clarified brain lysate was prepared and the total protein concentration was quantified (as described above) before using it for IP. VHHs and lysate were mixed in a 96-well clear round bottom plate (Corning, cat. no 3788), and incubated overnight at 4\u0026deg;C, with shaking at 1,000 rpm. The following day, 30 \u0026micro;l pre-equilibrated Amsphere A3 beads (prod. no 10000204-330) (bead equilibration process: washing twice with 1x PBS, followed by washing twice with 1x PBST, followed by washing twice with 1x PBST supplemented with 2% BSA, and twice with TBS\u0026thinsp;+\u0026thinsp;PIC) were added to the \u0026ldquo;lysate\u0026thinsp;+\u0026thinsp;VHH\u0026rdquo; reaction mixture. The reaction mixture was incubated for 1 hour, at 4\u0026deg;C, with shaking at 1,000 rpm to allow the formation of a \u0026ldquo;bead-VHH-seed complex.\u0026rdquo; The reaction mixture was then centrifuged at 10,000 x g for 3 minutes and unbound supernatant was removed and saved for transfection into tau biosensor cells. The beads were then washed twice with 1x PBST, followed by four times wash with TBS\u0026thinsp;+\u0026thinsp;PIC to remove non-specifically bound proteins. Finally, the seeds were eluted by adding 50 \u0026micro;l \u0026ldquo;Pierce IgG elution buffer\u0026rdquo; pH 2.5 (cat. no 21004) to the beads. The elution was neutralized by the addition of 1:5 part of 1 M Tris-HCl pH 8.0, and transfected into tau RD(P301S) v2L-biosensors, as described previously (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Cells were allowed to grow for 48 hours at 37\u0026deg;C. After 48 hour, the cells were checked for formation of tau puncta in the cells by fluorescence microscopy. The cells were then fixed with 2% PFA, resuspended in 1x PBS, and analyzed on LSR-Fortessa flow cytometer for FRET analysis. The acquired data was processed using FlowJo software, and FRET-positive cells were counted and plotted for various samples, as described previously (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\u003ch2\u003eDot blot against brain lysates\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eClarified brain lysate from two AD cases, one P301S mouse, and one healthy control case were applied onto a polyvinylidene difluoride membrane (Immobilon\u0026reg; -FL PVDF Membrane, Millipore Sigma) using a dot blot apparatus (Bio-Dot Apparatus, BIO-RAD). The membrane was subsequently blocked for 30 min at room temperature in 5% w/v skimmed milk prepared in 1x TBST. The membrane was then incubated overnight at room temperature with 0.001 \u0026micro;g/ml anti-tau VHHs ((510M) or (50M)) and HJ8.5 antibody diluted in 5% w/v skimmed milk prepared in 1x TBST. The membrane was then washed twice with 1x TBST and then incubated with 1:2,000 dilution of MonoRab\u0026trade; Rabbit Anti-Camelid VHH [HRP] or Goat anti-Mouse IgG (H\u0026thinsp;+\u0026thinsp;L) Secondary Antibody [HRP], respectively, for 60 min at room temperature. After incubation, the blot was washed twice with 1x TBST for 10 min to wash unbound secondary antibody. Finally, the blot was scanned, and spots were detected using the Thermo Scientific SuperSignal\u0026trade; West Femto Maximum Sensitivity Substrate kit, Thermo Scientific. Specific protein signal from the membranes was visualized using a Chemi Doc (Syngene G: BOX Chemi XRQ gel doc system) and images were captured with GeneSys Image Capture Software. The signal intensity at 1.25 \u0026micro;g of total protein, based on integrated optical densities were quantified using Fiji (version 1.54f). The raw intensities for each sample were then normalized with the corresponding Ponceau intensity and compared across the samples.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\u003ch2\u003eOn-yeast EC\u003csub\u003e50\u003c/sub\u003e measurement\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThe individual yeast colonies were grown in \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose\u0026rdquo; media and VHH expression was induced with \u0026ldquo;\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose\u0026rdquo; media. A total of 1 x 10\u003csup\u003e6\u003c/sup\u003e cells were washed with selection buffer and incubated with various concentrations of fluorescently labeled tau 2N4R tau (2N4R labeled with Alexa Fluor\u0026trade; 647) with shaking for 1 hour at 4\u0026deg;C. Each sample was also incubated with 2 \u0026micro;g fluorophore-conjugated anti-HA Alexa Fluor\u0026trade; 488 antibody with shaking for 1 hour at 4\u0026deg;C. The samples were then washed twice with selection buffer and all the samples were then analyzed on LSRFortessa. The percentage of double positive yeast cells (yeast cells that show binding to anti-HA Alexa Fluor\u0026trade; 488 antibody as well as 2N4R- Alexa Fluor\u0026trade; 647) at each concentration of tau monomer was plotted and compared for both the VHH clones. The titration curve was then fitted to a sigmoidal function to derive EC\u003csub\u003e50\u003c/sub\u003e value.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003eFIDA measurements\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eFlow Induced Dispersion Analysis (FIDA) measurement for anti-tau VHH(510M) and VHH(50M) were performed on Fida 1 (Fida Biosystems, Denmark) using a dynamic coated 75 \u0026micro;m capillary with 100 cm length (Fida Biosystems, Denmark). Here, 50 nM of Alexa Fluor\u0026trade; 647-labeled anti-tau VHHs were incubated with varying concentrations of full-length 2N4R tau. Each sample was then analyzed on the Fida instrument, and the hydrodynamic radius of the complex was measured at each concentration using the 640 nm detector. The parameters of the analysis were:\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTray\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVial\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePressure (mbar)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTime (s)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eOutlet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eMeasure\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eComments\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e3500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e120\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eBuffer Rinse and Equilibration\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnalyte\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e3500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eFill with analyte\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIndicator\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eInject indicator\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnalyte\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e400\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e180\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eYes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eMobilize and measure\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e3500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e120\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNo\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003eWater Rinse\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eAll the trays and capillary were set at 25\u0026deg;C, and the kinetic measurements were performed at 25\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\u003ch2\u003eCD measurements\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eCircular dichroism (CD) measurements were performed using a Jasco J-815 spectropolarimeter (Serial No. B064061168) at the Macromolecular Biophysics Resource at UT Southwestern Medical Center in Dallas. Measurements were collected using a 1 mm pathlength quartz cuvette under standard sensitivity settings. A final concentration of 1.0 mg/ml of anti-tau VHH(510M) in 1x PBS containing 2% glycerol was used for all the measurements. The far-UV CD spectra were recorded at 25\u0026deg;C at a data pitch of 0.1 nm, with a scanning speed of 50 nm/min. The CD thermal melts were recorded from 4\u0026deg;C to 95\u0026deg;C by measuring the change in secondary structure at 215 nm (θ\u003csub\u003e215\u003c/sub\u003e), using a CDF-426S temperature control accessory (S/N A00861183). The temperature was controlled with a precision of \u0026plusmn;\u0026thinsp;0.10\u0026deg;C, with a hold time of 5 seconds at each target temperature before data acquisition. The change in ME\u003csub\u003e215\u003c/sub\u003e was then plotted against temperature and fitted to a sigmoidal function for calculation of the mid-point of thermal denaturation (T\u003csub\u003em\u003c/sub\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePreparation of N tau\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eBL21(DE3) cells transformed with pET28b plasmid containing tau 2N4R sequence were grown in minimal M9 media for protein production (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). The single colony expressing tau protein was grown overnight in M9 media. The following day, the saturated culture was transferred to 1liter M9 media, and protein production was induced with 1 mM IPTG for 4 hours, at 37\u0026deg;C. The bacterial culture was centrifuged at 6,000 \u0026times; g for 30 minutes, lysed, and purified as described above. The pellet was resuspended in \u003csup\u003e15\u003c/sup\u003eN lysis buffer (50 mM MES pH 6, 10 mM EDTA, 10 mM DTT, 0.1 mM PMSF, with cOmplete\u0026trade; EDTA-free Protease Inhibitor Cocktail), and lysed using GEA PandaPLUS Lab Homogenizer 2000. The lysate was centrifuged at 15,000 \u0026times; g for 30 minutes, and the supernatant was filtered using a 0.45 \u0026micro;m filter. This clarified lysate was loaded onto a 5 ml HiTrap SP-HP column (Cytiva Life Sciences, cat. No. 17115201), and the protein was purified against a NaCl gradient. The fractions were checked on SDS-PAGE and all the fractions containing pure protein were pooled, concentrated, and injected onto HiLoad 16/600 Superdex 75 pg column (Cytiva Life Sciences, cat. No. 28989333) for SEC. The fractions from SEC containing clean protein were pooled and sent for mass-spectrometric analysis to confirm the degree of isotopic labeling. The \u003csup\u003e15\u003c/sup\u003eN protein was then stored at -80\u0026deg;C for NMR experiments.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\u003ch2\u003eNMR\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eNMR spectra were acquired on an Agilent DD2 spectrometer operating at 800 MHz. \u003csup\u003e1\u003c/sup\u003eH-\u003csup\u003e15\u003c/sup\u003eN HSQC spectra were recorded at 4\u0026deg;C with samples dissolved in 50 mM sodium phosphate buffer pH 6.5 containing 1 mM DTT and 10% D\u003csub\u003e2\u003c/sub\u003eO. A total of 50 \u0026micro;M 2N4R tau protein and 50 \u0026micro;M anti-tau VHH(510M) was used for all the NMR measurements. All data were processed with NMRpipe (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e) and analyzed with NMRView (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec32\" class=\"Section2\"\u003e\u003ch2\u003eIsolation of mouse brain\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eP301S and WT mice at various ages were anesthetized with isoflurane and perfused with cold 1x PBS. Brains were hemi-dissected. The right hemisphere was frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for subsequent biochemical assays while the left hemispheres were drop-fixed in phosphate-buffered 4% paraformaldehyde (FD NeuroTechnologies, Colombia, MD, USA) overnight at 4\u0026deg;C. Left hemispheres were then placed in 10% sucrose in PBS for 24 hours at 4\u0026deg;C, followed by 24 hours in 20% sucrose in PBS at 4\u0026deg;C, and finally stored in 30% sucrose in PBS at 4\u0026deg;C until sectioning.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec33\" class=\"Section3\"\u003e\u003ch2\u003eImmunohistochemistry of mouse brain\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eA sliding-base freezing microtome (Thermo-Fisher Scientific, Waltham, MA, USA) was used to collect 30 \u0026micro;m free-floating coronal sections from fixed mouse brains. The sections were stored in cryoprotectant at 4 until immunohistochemistry (IHC) was performed. Slices were washed three times with 1x PBS for 5 minutes, and all subsequent washing steps followed the same procedure. The sections were incubated in 1x PBS containing 0.25% Triton X-100 for 45 minutes at room temperature for permeabilization. Next, they were blocked in an NGS blocking buffer (1x PBST\u0026thinsp;+\u0026thinsp;5% BSA\u0026thinsp;+\u0026thinsp;10% NGS) for 1 hour at room temperature. Sections were then incubated with 1 drop of avidin block per 3 ml of IHC blocking buffer for 30 minutes, followed by washing. They were subsequently incubated with 1 drop of biotin block per 3 ml in IHC blocking buffer for 30 minutes, and washed again (Avidin/Biotin Blocking Kit, SP-2001). The washed sections were then incubated with biotinylated AT8 antibody (1:1,000, Thermo Scientific) for 4 hours at 25\u0026deg;C. The sections were washed and incubated with streptavidin-Alexa Fluor\u0026trade; 488 conjugate for 1 hour at 25\u0026deg;C. The AT8-stained sections were washed and incubated with a final concentration of 2 ng/\u0026micro;l Alexa Fluor\u0026trade; 647-conjugated anti-tau VHH(510M). The next day, the sections were washed and stained with 1:1,000 DAPI for 20 minutes. Finally, the sections were washed and mounted on charged slides. The slides were then allowed to dry overnight before being coverslipped with Aqua-Poly/Mount (Cat: 18606-20). The slides were finally scanned using the Olympus Nanozoomer 2.0-HT (Hamamatsu, Bridgewater, NJ, USA) at the University of Texas Southwestern Medical Center Whole Brain Microscopy Core Facility (RRID: SCR_017949).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec34\" class=\"Section3\"\u003e\u003ch2\u003eImmunohistochemistry of human brain\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eParaffin-embedded human AD and control brain slices were deparaffinated twice with Xylene, each for 5 minutes. Slides were then rehydrated for 2 minutes each in a gradient of 100%, 95%, 70%, and 50% ethanol. Next, the slides containing brain sections were washed under running water for 2 minutes, followed by washing twice with 1x PBS for 5 minutes. Autofluorescence was quenched by first treating with a 0.25% KMnO4 solution for 20 minutes, followed by modified Pal\u0026rsquo;s solution (1% K2SO4/1% Oxalic Acid) for 3 minutes, and lastly with a solution consisting of 1% NaOH, 0.9% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 40 minutes. The sections were then incubated in 1x PBS containing 0.25% Triton X-100 for 45 minutes at room temperature, for permeabilization. Next, they were blocked in an NGS blocking buffer (1x PBST\u0026thinsp;+\u0026thinsp;5% BSA\u0026thinsp;+\u0026thinsp;10% NGS) for 1 hour at room temperature. After blocking, the tissues were stained with 1:500 dilution of AT8 in NGS blocking buffer for 4 hours at room temperature. The sections were then washed three times with 1x PBS for 5 minutes and incubated with 1:1,000 dilution of streptavidin-Alexa Fluor\u0026trade; 568 conjugate for 1 hour, at room temperature. Finally, the slides were washed three times with 1x PBS and stained with 2 ng/\u0026micro;l of final anti-tau VHH(510M) conjugated with Alexa Fluor\u0026trade; 647 in NGS blocking buffer, overnight at room temperature. Next, the slides were washed three times with ddH\u003csub\u003e2\u003c/sub\u003eO for 5 minutes each and incubated with 1:1,000 DAPI for 20 minutes. The slides were then placed on coverslips with Aqua-Poly/Mount, and allowed to dry in the dark. The slides were scanned on the Olympus Nanozoomer 2.0-HT (Hamamatsu, Bridgewater, NJ, USA) at the University of Texas Southwestern Medical Center Whole Brain Microscopy Core Facility (RRID: SCR_017949).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eMedia and buffer used in this study:\u003c/h3\u003e\n\u003cp\u003e\u003cstrong\u003eYglc4.5 \u0026ndash;Trp (for 1 liter)\u003c/strong\u003e\u003cp\u003eMix 7.6 g of \u0026ndash;Trp drop-out media supplement (US Biological D9531)\u0026thinsp;+\u0026thinsp;6.7 g Yeast nitrogen base (Himedia M878)\u0026thinsp;+\u0026thinsp;10.4 g Sodium citrate\u0026thinsp;+\u0026thinsp;7.4 g Citric acid monohydrate\u0026thinsp;+\u0026thinsp;10 ml Pen-strep (10,000 units/ml stock)\u0026thinsp;+\u0026thinsp;20 g glucose in sterile Milli-Q water. Once dissolved adjust pH to 4.5 and sterilize the media by filtering through 0.22 \u0026micro;m sterifilter.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003e\u003cb\u003e\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;glucose media\u003c/b\u003e: Mix 3.8 g of \u0026ndash;Trp drop-out media supplement (US Biological D9531)\u0026thinsp;+\u0026thinsp;6.7 g Yeast nitrogen base (Himedia M878)\u0026thinsp;+\u0026thinsp;10 ml Pen-Strep (10,000 units/ml stock)\u0026thinsp;+\u0026thinsp;20 g glucose in sterile Milli-Q. Once dissolved adjust pH to 6.0 and sterilize the media by filtering through 0.22 \u0026micro;m sterifilter.\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e\u003cb\u003e\u0026ndash;Trp\u0026thinsp;+\u0026thinsp;galactose media\u003c/b\u003e: Mix 3.8 g of \u0026ndash;Trp drop-out media supplement (US Biological D9531)\u0026thinsp;+\u0026thinsp;6.7 g Yeast Nitrogen Base (Himedia M878)\u0026thinsp;+\u0026thinsp;6.7 g Yeast Nitrogen Base\u0026thinsp;+\u0026thinsp;10 ml Pen-Strep (10,000 units/ml stock)\u0026thinsp;+\u0026thinsp;20 g galactose in sterile Milli-Q. Once dissolved adjust pH to 6.0 and sterilize the media by filtering through 0.22 \u0026micro;m sterifilter.\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eSelection buffer\u003c/strong\u003e\u003cp\u003eFilter sterilized 20 mM HEPES pH 7.5 buffer with 150 mM sodium chloride, 0.1% (w/v) bovine serum albumin, and 5 mM maltose.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eVHH lysis buffer\u003c/strong\u003e\u003cp\u003e1x PBS pH 7.2, 2% glycerol, 2 mM EDTA, protease inhibitor cocktail.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e\u003csup\u003e15\u003c/sup\u003eN lysis buffer\u003c/strong\u003e\u003cp\u003e50 mM MES pH 6, 10 mM EDTA, 10 mM DTT, 0.1 mM PMSF, protease inhibitor cocktail.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eIHC Blocking buffer\u003c/strong\u003e\u003cp\u003e5% BSA, 0.25% Triton X-100 (blocking buffer), 10% Serum in PBS.\u003c/p\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eCompeting Interests\u003c/h2\u003e\u003cp\u003eMID and JVA are co-founders of Handshake Bio, a biotechnology company focused on developing diagnostics and therapeutics for neurodegenerative diseases, including tauopathies. The authors declare that Handshake Bio did not directly fund or influence the design, execution, or interpretation of the experiments presented in this manuscript. The remaining authors declare no competing interests.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eData and materials availability\u003c/h2\u003e\u003cp\u003eAll data needed to evaluate the conclusions in the paper are present in the paper and/or the supplementary materials. Raw data files are available upon request.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThe research is supported by The Hamon Charitable Foundation.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization: AG, JVA, MIDMethodology: AG, JVA, MIDInvestigation: AG, JVA, RL, DK, VS, YT, KK, SJT, CLW, WPR, JR, NLVisualization: AG, JVA, MIDSupervision: JVA, MIDWriting\u0026mdash;original draft: AG, JVA, MIDWriting\u0026mdash;review \u0026amp; editing: AG, JVA, RL, DK, VS, YT, KK, SJT, CLW, WPR, JR, NL\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank Dr. Maikke Ohlson, Dr. Andrea Shiakolas, Dr. Sushobhna Batra, Dr. Peter Kunach, Dr. Lukasz A. Joachimiak and Varun Jalapati for critical discussions and their suggestions. For cell sorting and flow cytometry instrumentation support, we acknowledge the Moody Foundation Flow Cytometry Facility. We thank Dr. Denise Ramirez and \u0026ldquo;Whole Brain Microscopy Facility (RRID:SCR_017949)\u0026rdquo; for microscopy support. NL is supported by the Thomas O. Hicks Scholarship in Medical Research. JR is supported by Welch grant (I-1304).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data needed to evaluate the conclusions in the paper are present in the paper and/or the supplementary materials. Raw data files are available upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSamudra N, Lane-Donovan C, VandeVrede L, Boxer AL (2023) Tau pathology in neurodegenerative disease: disease mechanisms and therapeutic avenues. J Clin Invest 133:e168553\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScheres SH, Zhang W, Falcon B, Goedert M (2020) Cryo-EM structures of tau filaments. Curr Opin Struct Biol 64:17\u0026ndash;25\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScheres SHW, Ryskeldi-Falcon B, Goedert M (2023) Molecular pathology of neurodegenerative diseases by cryo-EM of amyloids. Nature 621:701\u0026ndash;710\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSanders DW, Kaufman SK, Holmes BB, Diamond MI (2016) Prions and Protein Assemblies that Convey Biological Information in Health and Disease. Neuron 89:433\u0026ndash;448\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClavaguera F, Bolmont T, Crowther RA, Abramowski D, Frank S, Probst A, Fraser G, Stalder AK, Beibel M, Staufenbiel M, Jucker M, Goedert M, Tolnay M (2009) Transmission and spreading of tauopathy in transgenic mouse brain. Nat Cell Biol 11:909\u0026ndash;913\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFrost B, Jacks RL, Diamond MI (2009) Propagation of tau misfolding from the outside to the inside of a cell. J Biol Chem 284:12845\u0026ndash;12852\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJucker M, Walker LC (2018) Propagation and spread of pathogenic protein assemblies in neurodegenerative diseases. Nat Neurosci 21:1341\u0026ndash;1349\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVaquer-Alicea J, Diamond MI, Joachimiak LA (2021) Tau strains shape disease. Acta Neuropathol 142:57\u0026ndash;71\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCongdon EE, Ji C, Tetlow AM, Jiang Y, Sigurdsson EM (2023) Tau-targeting therapies for Alzheimer disease: current status and future directions. Nat Rev Neurol 19:715\u0026ndash;736\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSinsky J, Pichlerova K, Hanes J (2021) Tau Protein Interaction Partners and Their Roles in Alzheimer\u0026rsquo;s Disease and Other Tauopathies. Int J Mol Sci 22:9207\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYanamandra K, Kfoury N, Jiang H, Mahan TE, Ma S, Maloney SE, Wozniak DF, Diamond MI, Holtzman DM (2013) Anti-Tau Antibodies that Block Tau Aggregate Seeding In Vitro Markedly Decrease Pathology and Improve Cognition In Vivo. Neuron 80:402\u0026ndash;414\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAgadjanyan MG, Zagorski K, Petrushina I, Davtyan H, Kazarian K, Antonenko M, Davis J, Bon C, Blurton-Jones M, Cribbs DH, Ghochikyan A (2017) Humanized monoclonal antibody armanezumab specific to N-terminus of pathological tau: characterization and therapeutic potency. Mol Neurodegener 12:33\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShin M-K, V\u0026aacute;zquez-Rosa E, Koh Y, Dhar M, Chaubey K, Cintr\u0026oacute;n-P\u0026eacute;rez CJ, Barker S, Miller E, Franke K, Noterman MF, Seth D, Allen RS, Motz CT, Rao SR, Skelton LA, Pardue MT, Fliesler SJ, Wang C, Tracy TE, Gan L, Liebl DJ, Savarraj JPJ, Torres GL, Ahnstedt H, McCullough LD, Kitagawa RS, Choi HA, Zhang P, Hou Y, Chiang C-W, Li L, Ortiz F, Kilgore JA, Williams NS, Whitehair VC, Gefen T, Flanagan ME, Stamler JS, Jain MK, Kraus A, Cheng F, Reynolds JD, Pieper AA (2021) Reducing acetylated tau is neuroprotective in brain injury. Cell 184:2715\u0026ndash;2732e23\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBryan Iii MR, Tian X, Tseng J-H, Evangelista BA, Ragusa JV, Bryan AF, Trotman W, Irwin D, Cohen TJ (2024) Development and characterization of novel anti-acetylated tau monoclonal antibodies to probe pathogenic tau species in Alzheimer\u0026rsquo;s disease. Acta Neuropathol Commun 12:163\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSigurdsson EM (2024) Tau Immunotherapies for Alzheimer\u0026rsquo;s Disease and Related Tauopathies: Status of Trials and Insights from Preclinical Studies. J Alzheimers Dis 101:S129\u0026ndash;S140\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOssenkoppele R, van der Kant R, Hansson O (2022) Tau biomarkers in Alzheimer\u0026rsquo;s disease: towards implementation in clinical practice and trials. Lancet Neurol 21:726\u0026ndash;734\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVaquer-Alicea J, Manon VA, Bommareddy V, Kunach P, Gupta A, Monistrol J, Perez VA, Tran HT, Saez-Calveras N, Du S, Batra S, Stoddard D, White CL, Joachimiak LA, Shahmoradian SH, Diamond MI (2025) Functional classification of tauopathy strains reveals the role of protofilament core residues. Sci Adv 11\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHitt BD, Gupta A, Singh R, Yang T, Beaver JD, Shang P, White CL, Joachimiak LA, Diamond MI (2023) Anti-tau antibodies targeting a conformation-dependent epitope selectively bind seeds. J Biol Chem 299:105252\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWesolowski J, Alzogaray V, Reyelt J, Unger M, Juarez K, Urrutia M, Cauerhff A, Danquah W, Rissiek B, Scheuplein F, Schwarz N, Adriouch S, Boyer O, Seman M, Licea A, Serreze DV, Goldbaum FA, Haag F (2009) Koch-Nolte, Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Med Microbiol Immunol 198:157\u0026ndash;174\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlexander E, Leong KW (2024) Discovery of nanobodies: a comprehensive review of their applications and potential over the past five years. J Nanobiotechnol 22:661\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDe Leiris N, Perret P, Lombardi C, G\u0026ouml;zel B, Chierici S, Millet P, Debiossat M, Bacot S, Tournier BB, Chames P, Lenormand J-L, Ghezzi C, Fagret D, Moulin M (2024) A single-domain antibody for the detection of pathological Tau protein in the early stages of oligomerization. J Transl Med 22:163\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDanis C, Dupr\u0026eacute; E, Zejneli O, Caillierez R, Arrial A, B\u0026eacute;gard S, Mortelecque J, Eddarkaoui S, Loyens A, Cantrelle F-X, Hanoulle X, Rain J-C, Colin M, Bu\u0026eacute;e L, Landrieu I (2022) Inhibition of Tau seeding by targeting Tau nucleation core within neurons with a single domain antibody fragment. Mol Ther 30:1484\u0026ndash;1499\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMortelecque J, Zejneli O, B\u0026eacute;gard S, Sim\u0026otilde;es MC, ElHajjar L, Nguyen M, Cantrelle F-X, Hanoulle X, Rain J-C, Colin M, Gomes CM, Bu\u0026eacute;e L, Landrieu I, Danis C, Dupr\u0026eacute; E (2024) A selection and optimization strategy for single-domain antibodies targeting the PHF6 linear peptide within the tau intrinsically disordered protein. J Biol Chem 300:107163\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcArthur N, Kang B, Rivera Moctezuma FG, Shaikh AT, Loeffler K, Bhatt NN, Kidd M, Zupancic JM, Desai AA, Djeddar N, Bryksin A, Tessier PM, Kayed R, Wood LB, Kane RS (2024) Development of a pan-tau multivalent nanobody that binds tau aggregation motifs and recognizes pathological tau aggregates. Biotechnol Prog 40:e3463\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDupr\u0026eacute; E, Danis C, Arrial A, Hanoulle X, Homa M, Cantrelle F-X, Merzougui H, Colin M, Rain J-C, Bu\u0026eacute;e L (2019) Landrieu, Single Domain Antibody Fragments as New Tools for the Detection of Neuronal Tau Protein in Cells and in Mice Studies. ACS Chem Neurosci 10:3997\u0026ndash;4006\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZupancic JM, Smith MD, Trzeciakiewicz H, Skinner ME, Ferris SP, Makowski EK, Lucas MJ, McArthur N, Kane RS, Paulson HL, Tessier PM (2023) Quantitative flow cytometric selection of tau conformational nanobodies specific for pathological aggregates. Front Immunol 14:1164080\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang W, Falcon B, Murzin AG, Fan J, Crowther RA, Goedert M, Scheres SH (2019) Heparin-induced tau filaments are polymorphic and differ from those in Alzheimer\u0026rsquo;s and Pick\u0026rsquo;s diseases. eLife 8:e43584\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHolmes BB, Furman JL, Mahan TE, Yamasaki TR, Mirbaha H, Eades WC, Belaygorod L, Cairns NJ, Holtzman DM, Diamond MI (2014) Proteopathic tau seeding predicts tauopathy in vivo. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A.\u003c/em\u003e 111\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHitt BD, Vaquer-Alicea J, Manon VA, Beaver JD, Kashmer OM, Garcia JN, Diamond MI (2021) Ultrasensitive tau biosensor cells detect no seeding in Alzheimer\u0026rsquo;s disease CSF. acta neuropathol commun 9:99\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDingus JG, Tang JCY, Amamoto R, Wallick GK, Cepko CL (2022) A general approach for stabilizing nanobodies for intracellular expression. Elife 11:e68253\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcMahon C, Baier AS, Pascolutti R, Wegrecki M, Zheng S, Ong JX, Erlandson SC, Hilger D, Rasmussen SGF, Ring AM, Manglik A, Kruse AC (2018) Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nat Struct Mol Biol 25:289\u0026ndash;296\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNarayanan RL, D\u0026uuml;rr UHN, Bibow S, Biernat J, Mandelkow E, Zweckstetter M (2010) Automatic Assignment of the Intrinsically Disordered Protein Tau with 441-Residues. J Am Chem Soc 132:11906\u0026ndash;11907\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoshiyama Y, Higuchi M, Zhang B, Huang S-M, Iwata N, Saido TC, Maeda J, Suhara T, Trojanowski JQ, Lee VM-Y (2007) Synapse Loss and Microglial Activation Precede Tangles in a P301S Tauopathy Mouse Model. Neuron 53:337\u0026ndash;351\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGibbons GS, Kim S-J, Wu Q, Riddle DM, Leight SN, Changolkar L, Xu H, Meymand ES, O\u0026rsquo;Reilly M, Zhang B, Brunden KR, Trojanowski JQ, Lee VMY (2020) Conformation-selective tau monoclonal antibodies inhibit tau pathology in primary neurons and a mouse model of Alzheimer\u0026rsquo;s disease. Mol Neurodegener 15:64\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCongdon EE, Pan R, Jiang Y, Sandusky-Beltran LA, Dodge A, Lin Y, Liu M, Kuo M-H, Kong X-P, Sigurdsson EM (2022) Single domain antibodies targeting pathological tau protein: Influence of four IgG subclasses on efficacy and toxicity. EBioMedicine 84:104249\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen D, Drombosky KW, Hou Z, Sari L, Kashmer OM, Ryder BD, Perez VA, Woodard DR, Lin MM, Diamond MI, Joachimiak LA (2019) Tau local structure shields an amyloid-forming motif and controls aggregation propensity. Nat Commun 10:2493\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFurman JL, Holmes BB, Diamond MI (2015) Sensitive Detection of Proteopathic Seeding Activity with FRET Flow Cytometry. J Vis Exp, e53205\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarley J, Lu M, Bracken C (2001) A method for efficient isotopic labeling of recombinant proteins. J Biomol NMR 20:71\u0026ndash;75\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDelaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J, Bax A (1995) NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR 6:277\u0026ndash;293\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJohnson BA, Blevins RA, View NMR (1994) A computer program for the visualization and analysis of NMR data. J Biomol NMR 4:603\u0026ndash;614\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"acta-neuropathologica","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aneu","sideBox":"Learn more about [Acta Neuropathologica](https://link.springer.com/journal/401)","snPcode":"401","submissionUrl":"https://submission.springernature.com/new-submission/401/3","title":"Acta Neuropathologica","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8274351/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8274351/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn Alzheimer\u0026rsquo;s disease (AD) and related tauopathies, progressive pathology has been linked to prion mechanisms whereby ordered tau assemblies, or \u0026ldquo;seeds,\u0026rdquo; form in one cell and transit to neighboring or connected cells where they serve as templates for their own replication. While post-translational modifications of pathological tau have been useful to mark pathology, effective methods to accurately detect and target pathogenic seed conformations remain limited. We report a novel discovery and characterization paradigm to identify camelid variable heavy domain of heavy chain (VHH) sequences with desired properties. From a published synthetic VHH yeast display library, we screened for clones capable of immunoprecipitating tau seeds from human tauopathy brain homogenates and identified two seed-selective anti-tau VHHs \u0026ndash; VHH(510) and VHH(50) \u0026ndash; that target pathological tau. These VHHs preferentially target tau seeds present in AD, corticobasal degeneration (CBD), and PS19 tauopathy mouse brains. We enhanced their stability through framework mutations (M), while maintaining their seed-binding characteristics. We characterized VHH(510M) in detail, determining that it bound the carboxy terminus of tau with robust avidity for seeds, and low affinity for monomer. When used to stain mouse and human brain tissues, VHH(510M) revealed pathological tau accumulation that was often independent of AT8-positive lesions. The distinct staining pattern observed with anti-tau VHH(510M) underscores the potential of VHH-based reagents for PET imaging and histopathology. Adaptation of VHH(510M) could also improve therapy and diagnosis for diverse tauopathies.\u003c/p\u003e","manuscriptTitle":"Conformation-based detection of tau seeds with a novel VHH","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-08 12:21:36","doi":"10.21203/rs.3.rs-8274351/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-19T12:38:27+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-18T22:27:56+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-18T12:33:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"259418019283163105161668841985927751348","date":"2025-12-05T10:42:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"260861403914505404794166787490968756643","date":"2025-12-04T19:45:58+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-04T15:17:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-04T15:09:08+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-04T14:23:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Acta Neuropathologica","date":"2025-12-04T01:31:52+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"acta-neuropathologica","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aneu","sideBox":"Learn more about [Acta Neuropathologica](https://link.springer.com/journal/401)","snPcode":"401","submissionUrl":"https://submission.springernature.com/new-submission/401/3","title":"Acta Neuropathologica","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8b273637-fa44-46ed-b8fb-ffbfd4e5ed48","owner":[],"postedDate":"December 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2025-12-19T12:53:21+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-08 12:21:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8274351","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8274351","identity":"rs-8274351","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-29T02:00:03.542394+00:00
License: CC-BY-4.0