The regulatory effect of miR-181c-5p on the differentiation function of bone marrow mesenchymal stem cells in postmenopausal osteoporotic mice

The regulatory effect of miR-181c-5p on the differentiation function of bone marrow mesenchymal stem cells in postmenopausal osteoporotic mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The regulatory effect of miR-181c-5p on the differentiation function of bone marrow mesenchymal stem cells in postmenopausal osteoporotic mice Chi Yang, Kai Shi, Jie Wang, Lianqi Yan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1453818/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Osteoporosis (OP) is a metabolic bone disease syndrome for which there is no good treatment. In this study, we investigated the expression changes of miR-181c-5p in osteoporosis-derived BMMSCs, and the role and molecular mechanism in the osteogenic-lipogenic differentiation of BMMSCs. Methods In this study, an OP mouse model was successfully established using the ovariectomy method, and osteoporotic-derived BMMSCs (O-BMMSCs) and sham-operated-derived BMMSCs (S-BMMSCs) were isolated and cultured using the whole bone marrow method. A genetic screen revealed that miR-181c-5p was differentially expressed in O-BMMSCs and S-BMMSCs. The expression levels of miR-181c-5p in BMMSCs were overexpressed or inhibited by cell transfection, and the regulatory effects of miR-181c-5p on the proliferation and osteogenic-adipogenic differentiation of BMMSCs were examined using MTT, multi-directional differentiation induction, alizarin red staining, oil red O staining, qRT-PCR and Western blot. Candidate target genes for miR-181c-5p were screened by target gene prediction software and bioinformatics websites, and target gene validation was performed. Results The study found that overexpression of miR-181c-5p or inhibition of miR-181c-5p had no significant effect on the proliferation ability of BMMSCs. Upregulation of miR-181c-5p could reduce the osteogenic ability and enhance the adipogenic ability of BMMSCs, while downregulation of miR-181c-5p could increase the osteogenic ability and inhibit the adipogenic ability of BMMSCs. Besides, Foxo1 was confirmed as a direct target gene of miR-181c-5p, and miR-181c-5p negatively regulated Foxo1 expression. Downregulation of miR-181c-5p in O-BMMSCs promoted Foxo1 expression, improved the osteogenic differentiation of O-BMMSCs, and reduced abnormal lipogenic differentiation of O-BMMSCs and eventually partially restored the normal differentiation ability of O-BMMSCs. Conclusion miR-181c-5p regulated the osteogenic and adipogenic differentiation of BMMSCs by negatively regulating the expression of target gene Foxo1. The overexpression of miR-181c-5p in the process of osteoporosis leads to the disruption of the balance of osteogenic and adipogenic differentiation of BMMSCs, and reduces the bone formation ability of stem cells. Osteoporosis Mesenchymal stem cells microRNA Ovariectomy Multidirectional differentiation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 1. Introduction Osteoporosis (OP) is a metabolic bone disease syndrome characterized by osteopenia and destruction of bone microarchitecture. Patients have decreased osteogenic strength, increased fragility, and are prone to fractures. Postmenopausal osteoporosis, also known as type I OP, generally occurs about 10 years after menopause, and is most commonly seen clinically in women aged 60–80 [ 1 ]. At present, more than 200 million people in the world suffer from osteoporosis, and there are more than 88 million in China, and its incidence has jumped to the 7th place of common diseases and morbidities[ 2 ]. The underlying cause is an imbalance between osteoclastic bone resorption and osteoblastic bone formation, resulting in a decrease in bone mass and structural changes in bone tissue, which increases bone fragility and leads to fractures. Epidemiological studies in North America have shown that the risk of osteoporotic fractures in white women over 50 years of age is 17.5% for hip fractures, 15.6% for vertebral fractures and 16.9% for distal forearm fractures; the corresponding risks for men are 6.0%, 5.0% and 3.0% respectively [ 3 ]. These fractures (especially hip fractures) have a high incidence, poor prognosis, high disability rate and high medical costs, often causing a large financial burden to the patient, family and society. Therefore, the prevention and treatment of fractures in patients with postmenopausal osteoporosis (OPM) is one of the hot topics of clinical research in internal medicine and orthopaedic clinical research in recent years. However, the current clinical treatment of OPM is mainly based on hormone replacement, calcium supplementation and inhibition of bone resorption, but the treatment is not effective due to drug toxicity, malabsorption, unstable efficacy and poor patient compliance. Bone marrow mesenchymal stem cells (BMMSCs) are adult stem cells derived from mesoderm with self-renewal and multi-directional differentiation potential [ 4 ]. BMMSCs play an important role in bone development, regeneration and repair by differentiating into various cells. BMMSCs are the source cells of both osteoblasts and adipocytes, and the balance of their osteogenic-adipogenic differentiation capacity is closely related to the homeostatic balance of bone remodeling. In the process of osteoporosis, the osteogenic differentiation ability of BMMSCs decreases, while the adipogenic differentiation ability increases. This may be one of the reasons for osteoporosis, but the specific regulatory mechanism of the multi-directional differentiation of BMMSCs is still unclear. MicroRNAs (miRNAs) are a newly discovered class of small non-coding RNAs that widely exist in animals and plants, and can bind to the 3′-untranslated region of target genes in a base-pairing manner [ 5 ]. The miRNA can silence the expression of target genes at the post-transcriptional level, and play important regulatory roles in a variety of physiological and pathological processes. A variety of miRNAs have been identified that are involved in the osteogenic-adipogenic differentiation process of stem cells and play an important role in regulating stem cell fate. However, it is still unclear which miRNAs play key roles in the multidirectional differentiation of BMMSCs, the molecular signaling pathways that specifically regulate the differentiation of BMMSCs, and whether miRNAs play a role in the occurrence and development of OPM. In this study, BMMSCs were isolated and purified from normal mice and osteoporosis model mice [ 6 ]. It has been reported that miR-705 abnormally regulates the differentiation of bone marrow mesenchymal stem cells in postmenopausal osteoporotic mice. Studies have shown that BMMSCs from two sources, post-O-BMMSCs and post-S-BMMSCs, both express normal mesenchymal stem cell surface markers, but do not express hematopoietic system-derived cell surface markers, and have clonogenic ability. The osteogenic differentiation ability of O-BMMSCs was significantly lower than S-BMMSCs after osteogenic induction, while the adipogenic differentiation ability of O-BMMSCs after adipogenic induction was significantly higher than S-BMMSCs. Gene screening revealed that miR-181c-5p was differentially expressed between normal mice and osteoporosis model mice. In this experiment, miR-181c-5p was selected for further functional study. The miR-181 family is an evolutionarily conserved family of microRNAs with a wide range of functions involved in the regulation of immune system function [ 7 ], vascular inflammatory response [ 8 ], and haematopoietic development [ 9 ]. In addition, the miR-181 family is aberrantly expressed in a variety of tumors, however the role in osteogenic differentiation is not reported. In osteoporosis caused by estrogen deficiency, high expression of miR-181a can inhibit the proliferation of BMMSCs and reduce the osteogenic capacity of bone marrow stromal cells, which may be one of the important factors affecting the pathogenesis of osteoporosis [ 10 ]. In addition, miR-181b was found to significantly reduce the osteogenic differentiation ability of BMMSCs in vitro [ 11 ]. This study further explored the role and mechanism of miR-181c-5p in the pathogenesis of OPM, both to deepen the understanding of the molecular mechanism of OPM pathogenesis and to clarify the underlying causes of bone loss in osteoporosis, and to provide important guidance for the prevention and treatment of various postmenopausal osteoporosis-induced fracture diseases. 2. Methods And Materials 2.1 Establishment of postmenopausal osteoporosis (OPM) mouse model All protocols in this study were approved by the Committee on the Ethics of Animal Experiments of Yangzhou University Medical College, Xuzhou Medical University and the Xuzhou Council on Animal Care, Xuzhou, China, in compliance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication no.85 − 23, revised 1996). The study was performed in accordance with ARRIVE guidelines too. Female healthy C57BL/6 mice (5 weeks old, weighing 15 ± 2 g) were purchased from the animal center. Mice were housed in cages with appropriate water and food at an ambient temperature of 25°C ± 1°C, humidity of 50% ± 5%, and light conditions with a 12-h light/dark cycle. The procedure was performed according to previous reports [ 12 ]. Briefly, the mice in the castration group were anesthetized by inhaling isoflurane gas (300ml/min), the skin was disinfected, and an approximately 1.5 cm incision was made in the midline of the abdomen to expose the bilateral fallopian tubes and ovaries. Lateral ligation was performed, the ovaries and ligated fallopian tubes were removed, the wounds were sutured after the operation, and penicillin was injected intraperitoneally for 3 consecutive days after the operation. In the sham-operated group, only equal amounts of adipose tissue around the ovaries were excised, the wounds were sutured after the operation, and penicillin was injected intraperitoneally for 3 consecutive days after the operation. All animals at 3 months after surgery were weighed and recorded for data analysis and comparison. 2.2 Hematoxylin-Eosin (HE) staining for femoral bone morphology The distal femoral stem ends of mice from the ovariectomized group (OVX) and the sham-operated group (SHAM) (5 mice each) were fixed overnight in 10% formalin at 3 months post-operatively. Then, decalcify with 10% EDTA (PH = 7.4) at room temperature for 3 weeks, and replace the decalcification solution every 3 days. The decalcified specimens were rinsed overnight in running water, paraffin embedded and cut into paraffin sections of approximately 10 um thickness. The sections were routinely dewaxed and then stained with HE solution. Histomorphological observation and photography were performed under an optical microscope. 2.3 Isolation and culture of bone marrow mesenchymal stem cells (BMMSCs) BMMSCs were isolated from C57BL/6 mice using a whole bone marrow apposition screening method [ 13 ]. briefly, bone marrow was isolated from the femur and tibia of the mice and all bone marrow cells were placed in DMEM culture medium containing 20% FBS and cultured in primary culture at 37°C in a 5% CO2 incubator. After 48 h of incubation, the first full volume of fluid was changed to remove any cells that were not adherent to the wall, followed by half volume changes every 3 days. When the walled cells covered 80%-90% of the bottom area of the dish, the cells were digested with 0.25% trypsin.When BMMSCs were expanded to generation 3 for subsequent experiments. 2.4 Cell transfection The miR-181c-5p mimics, miR-181c-5p inhibitor and mus-miR-negative control were synthesized by GenepPharma (Suzhou,China). The miR-181c-5p mimics, miR-181c-5p inhibitor and mus-miR-negative control were transfected into BMMSCs according to Lipofectamine 2000™ instructions (Thermofisher Scientific). Transfection efficiency was examined by qRT-PCR. 2.5 Osteogenic and adipogenic differentiation To induce osteogenic-adipogenic differentiation, P2-5 BMMSCs were seeded into 6-well plates to about 80% confluence, and the osteogenic group was supplemented with DMEM containing 10% FBS, 10 mmol/L sodium β-glycerophosphate and 0.2 mmol/L ascorbic acid. The adipogenic group was supplemented with 0.01 uM dexamethasone, 0.5 mM IBMX, 60 uM indomethacin, 2 ml insulin.The medium was changed every other day during differentiation. 2.6 MTT assay To detect the effect of miR-181c-5p on the proliferation of BMMSCs, BMMSCs were transfected with miR-181c-5p mimics or miR-181c-5p inhibitor, and then inoculated in well plate. Replaced with complete medium after 12 h, and continued to incubate for 6 days. Adding 20 ul MTT solution to the culture wells, incubated at 37°C for 4 h and then discarded. 150 ul DMSO was added and shaken for 10 min avoiding light. The OD value was detected with a microplate reader at 490 nm wavelength and the growth curve was drawn. 2.7 Alizarin red staining and quantification The cells in osteoblast group were washed 3 times with PBS on 21 days, added with 4% paraformaldehyde for 15 min, and washed 3 times with distilled water. Then adding an appropriate amount of alizarin red staining solution at room temperature for 30 min, rinse with distilled water for 2 minutes, observe under a microscope and take pictures. For quantification, 10% cetylpyridinium chloride solution was added to the stained calcified nodule samples for 15 minutes, the lysate was collected, and the OD value of the lysate was detected by a microplate reader (wavelength 570 mm). 2.8 Oil Red O staining and quantification The cells in the adipogenic group were washed 3 times with PBS on 10 days, then stained with oil red dye solution for 10 min, observed under a microscope and photographed. For quantification, isopropyl alcohol was added to the stained oil droplet samples for 10min, the lysate was collected and the OD of the lysate (wavelength 520mm) was detected by enzyme marker. 2.9 Quantitative Real-time PCR (qRT-PCR) analysis [ 14 ] Total RNA was extracted from BMMSCs after osteogenic or adipogenic differentiation using RNA-easy Isolation Reagent (Vazyme) and cDNA was then obtained using a reverse transcription kit. cDNA was subsequently quantified by real-time PCR using SYBR Green (Takara). primers were synthesized by Sangon Biotech (Shanghai, China). and the sequences are shown in the following Table 1 . Table 1 Primer sequences for PCR Gene Sequence (5’-3’) RUNX2-F TGTCATGGCGGGTAACGAT RUNX2-R AAGACGGTTATGGTCAAGGTGAA PPAR-γ-F ACTGCCGGATCCACAAAA PPAR-γ-R TCTCCTTCTCGGCCTGTG Foxo1-F ACGAGTGGATGGTGAAGAGC Foxo1-R TGCTGTGAAGGGACAGATTG β-actin-F CTGGAGAACATTCATTGCTGTC β-actin-R GTGCAGGGTCCGAGGT 2.10 Western blot assay [ 14 ] After osteogenic or adipogenic differentiation of S-BMMSCs and O-BMMSCs, cell samples were collected and operated according to the previously reported methods. Briefly, cells were lysed with RIPA lysis buffer (Beyotime) containing protease inhibitor cocktail (Roche) to obtain total protein. The supernatant was separated by centrifugation at 12,000g and the total protein content was assayed using a BCA kit (Beyotime). The proteins were separated by 12% SDS-PAGE and transferred onto PVDF membranes (Millipore). The membranes were then sealed with a sealing solution containing 5% skimmed milk powder. After sealing for 1 hour, the protein-containing membrane was incubated overnight at 4°C with primary antibodies, including Anti-mouse RUNX2 and Anti-mouse PPAR-γ (Abcam, USA). The next day the membrane was washed five times with TBS buffer containing 1% Tween. The membranes were then incubated with HRP-labelled secondary antibodies for 2 hours at room temperature and developed with ECL luminescent solution. Anti-mouse β-actin (Cell signaling, USA) was used as a control protein. 2.11 Dual luciferase reporting assay Foxo1 and control plasmids were co-transfected with miR-7-5p mimic or mock control into BMMSCs cells. After 48 hours of transfection, cells were collected and luciferase activity was assessed using a dual luciferase assay kit (Solarbio). 2.12 Statistical analysis All data were statistically analyzed using SPSS17.0 software, and measurement data were expressed as mean ± standard deviation (SD). The t- test was used for comparison between two groups. All experiments were repeated more than 3 times. The datasets used and analysed during the current study available from the corresponding author on reasonable request,we will reply as soon as we receive the emails. 3 Results 3.1 Identification of the mouse OPM model To identify the OPM mouse model, the weight of the mice was measured and samples were collected after 3 months of surgery. The body weight of the mice in the OVX group was significantly higher than SHAM group, indicating that ovariectomy caused excessive obesity in the mice, which was consistent with previous reports (Fig. 1 ). HE staining was performed on the histological sections of the femur, and the comparison under the light microscope showed that the trabecular bone in the OVX group was slender, few in number and disorderly arranged, and osteoporosis such as enlarged medullary cavity appeared (Fig. 2 ). These results proved that the mice showed significant osteoporosis in the femur and the OPM model was successfully established after the removal of the ovaries. 3.2 Compare the cell morphology of BMMSCs BMMSCs were obtained from the bone marrow of mice and cultured to compare the morphology of cells in the normal and surgical groups. After three days of culture by whole bone marrow apposition method, both groups of BMMSCs were able to grow appositionally with similar cell morphology, both were shuttle-shaped or triangular, with little cytoplasm, large nuclei, strong refractive index and uneven cell protrusions (Fig. 3 A and C). After 12 days of culture, most of the cell colonies fused with each other and grew to the bottom of the bottle (Fig. 3 B and D). 3.3 The miRNA screening in BMMSCs Previous studies compared the miRNA expression profiles of O-BMMSCs and S-BMMSCs, and the screening found that the expression of miR-181c-5p was specifically increased in BMMSCs of OPM (Fig. 4 ), suggesting that miR-181c-5p is related to the functional changes in BMMSCs of OPM. It was previously reported that the miR-181 family can reduce the osteogenic differentiation ability of BMMSCs [ 7 ] [ 8 ]. Based on the above evidence, we hypothesized that the abnormal increase of miR-181c-5p during the occurrence of OPM changes the differentiation phenotype of BMMSCs, causing an imbalance in their osteogenic-adipogenic differentiation balance and thus contributing to the development of OPM. Therefore, we further used synthetic miRNA mimics and inhibitors to specifically upregulate and downregulate the expression of miR-181c-5p in BMMSCs, and observe the changes in the expression level of miR-181c-5p on the biology of BMMSCs. Furthermore, the key target genes regulated by miR-181c-5p were further identified by bioinformatics analysis, and the molecular mechanism of its regulation of BMMSCs differentiation was discussed. 3.4 Functional characterization of chemically synthesized mimics and inhibitor To test whether the synthesized miR-181c-5p mimics and miR-181c-5p inhibitor could specifically alter the expression level of miR-181c-5p in cells, we detected the expression levels of miR-181c-5p in BMMSCs transfected with miR-181c-5p mimics, miR-181c-5p inhibitor and negative control by qRT-PCR. The results are shown in Fig. 5 . After 72h of transfection, the expression of miR-181c-5p in the mimics transfected group was upregulated approximately 39-fold compared to the control group, while the expression in the inhibitor transfected group was downregulated approximately 5-fold compared to the control group. This indicates that the expression level of miR-181c-5p in BMMSCs could be effectively regulated by transfection with specific mimics or inhibitor. 3.5 Effect of miR-181c-5p on the proliferative capacity of BMMSCs The proliferation of BMMSCs transfected with miR-181c-5p mimics or miR-181c-5p inhibitor was detected by MTT assay. The results showed that there was no significant change in cell growth rate and cell proliferation curve after upregulation or downregulation of miR-181c-5p compared with control group (Fig. 6 , P > 0.05). These results demonstrate that miR-181c-5p does not affect the proliferative capacity of BMMSCs. 3.6 Effect of miR-181c-5p on the osteogenic differentiation of BMMSCs To investigate the effect of miR-181c-5p on the osteogenic differentiation ability of BMMSCs, we performed alizarin red staining analysis on BMMSCs after 14 days with osteogenic induction, and detected the expression of osteogenic-related genes by Western blot. The results showed that the red-positive nodules formed in the miR-181c-5p inhibitor group were larger, more numerous and darker than miR-181c-5p mimics group (Fig. 7 A-B). It showed that the expression level of miR-181c-5p was negatively correlated with calcium deposition in BMMSCs. The results of western blot showed that the protein expression of Runx2 was reduced in the mimics group compared to the control group, while Runx2 was significantly higher in the inhibitor group (Fig. 7 C). These results demonstrated that miR-181c-5p inhibited the osteogenic differentiation of BMMSCs. 3.7 Effect of miR-181c-5p on the adipogenic differentiation of BMMSCs Next, we detected the effect of miR-181c-5p on the adipogenic differentiation ability of BMMSCs by Oil Red O Staining and Western blot. The results of Oil Red O staining showed that lipid droplets formed in the miR-181c-5p inhibitor group were smaller in volume and less in number than those in the miR-181c-5p mimics group, indicating that the expression level of miR-181c-5p was positively correlated to the lipid formation of BMMSCs (Fig. 8 A-B). As shown in Fig. 8 C, the protein expression of PPAR-γ was lower in mimics group, while PPAR-γ was significantly increased in inhibitor group. These results indicated that miR-181c-5p promoted adipogenic differentiation of BMMSCs. 3.8 The miR-181c-5p target gene screening The above experiments proved that miR-181c-5p is an inhibitor of osteogenic differentiation and a promoter of adipogenic differentiation in BMMSCs. To clarify the mechanism of miR-181c-5p in differentiation of BMMSCs, we performed bioinformatics analysis through target gene prediction software and websites (TargetScan, miRanda, miRwalk, PITA and RNAhybrid), and predicted that miR-181c-5p may interact with more than 700 genes. Among them, miR-181c-5p had binding sites with 3'-UTR region of Foxo1. In addition, Foxo1 has been confirmed to be a transcription factor that promoted the osteogenic differentiation and inhibited the adipogenic differentiation in BMMSCs. Therefore, we hypothesize that Foxo1 is a target gene of miR-181c-5p, and the expression pairing diagram is shown in Fig. 9 . 3.9 Foxo1 negatively regulates miR-181c-5p To investigate the relationship between Foxo1 and miR-181c-5p, we detected the expression level of Foxo1 in BMMSCs by Western blot. The results showed that overexpression of miR-181c-5p prevented the expression of endogenous Foxo1 protein in BMMSCs, while the protein level of endogenous Foxo1 was significantly increased in BMMSCs after downregulation of miR-181c-5p (Fig. 10 A). This indicated that miR-181c-5p prevented Foxo1 protein translation. The receptor tyrosine kinase RTK-MAPK plays an important role in embryonic somite development and osteogenic differentiation [ 15 ]. Various cytokines including BMP, bFGF and IGF can regulate osteogenic differentiation by activating RUNX2 through the MAPK/ERK signaling pathway [ 16 ]. RUNX2 is a transcription factor that plays a key role in osteogenic differentiation and bone formation, and miR-181c-5p may inhibit the normal osteogenic and adipogenic differentiation of BMMSCs by inhibiting the MAPK/ERK signaling pathway. Furthermore, in the comparison between Sham and OVX,qRT-PCR and Westernblot showed that the mRNA and protein expression of Foxo1 was significantly lower in O-BMMSCs than S-BMMSCs(Fig. 11 ), in contrast to the expression pattern of miR-181c-5p in O-BMMSCs versus S-BMMSCs [ 10 ]. These results suggest that miR-181c-5p causes imbalance in adipogenic-osteogenic differentiation in O-BMMSCs by repressing the expression of target genes. 3.10 Foxo1 is a direct target of miR-181c-5p Next, we verified the relationship between miR-181c-5p and Foxo1 by dual luciferase reporter. We constructed a luciferase gene plasmid containing the 3′-UTR sequence of Foxo1, and cotransfected the gene plasmid and the internal control plasmid with miR-181c-5p mimics, inhibitor and negative control to measure Foxo1 luciferase activity. As shown in Fig. 10 B, the activity of Foxo1 luciferase decreased by 55% in all mimics transfected groups compared to the control group, while Foxo1 luciferase activity increased by approximately 65% in the inhibitor transfected group (P < 0.05). These results indicate that miR-181c-5p plays a role in inhibiting the protein expression of the target gene by binding directly to the Foxo1 3′-UTR region. 3.11 The reversal effect of miR-181c-5p inhibitor on the osteogenic and adipogenic differentiation of O-BMMSCs To further investigate the mechanism of miR-181c-5p in BMMSCs, we intervened the role of miR-181c-5p by miR-181c-5p inhibitor. The miR-181c-5p inhibitor or inhibitor-control (NC) were transfected into O-BMMSCs and S-BMMSCs. The transfected cells were subjected to osteogenic induction for 14 days followed by alizarin red staining. The results showed that, compared with the OVX + NC group, the calcified nodules in the transfected miR-181c-5p inhibitor group were larger, more numerous, and darker in color, but not as much as the SHAM + NC group (Fig. 12 A-B). The OD value of miR-181c-5p inhibitor alizarin red was higher than OVX + NC group, which indicated that miR-181c-5p inhibitor had a certain recovery effect on the osteogenic differentiation defect of O-BMMSC s (Fig. 12 C). Western blot results showed that the expression of Foxo1 and Runx2 was significantly increased in O-BMMSCs with downregulated miR-181c-5p (Fig. 12 D-E), indicating that the miR-181c-5p inhibitor was effective in restoring the osteogenic ability of O-BMMSCs by elevating the expression levels of endogenous Foxo1 and RUNX2. In addition, the adipogenic induction group was stained with Oil Red O. The results showed that the miR-181c-5p inhibitor transfected group had smaller and fewer lipid droplets for oil-red O staining compared to the OVX + NC group, but larger and more lipid droplets than the SHAM + NC group (Fig. 13 A). Quantitative analysis of Oil Red O showed that BMMSCs with downregulated miR-181c-5p had lower Oil Red OD value and lower adipogenic differentiation ability, but higher OD value than SHAM + NC group (Fig. 13 B). As shown in Fig. 13 C and 13 D, Foxo1 protein levels were significantly increased and PPAR-γ protein levels were significantly decreased compared to the OVX + NC group, but their expression levels were not as high as those of the SHAM + NC group. This indicates that miR-181c-5p inhibitor increases the expression level of endogenous Foxo1, thereby inhibiting the expression of PPAR-γ, but miR-181c-5p inhibitor can only partially counteract the high adipogenic differentiation of O-BMMSCs, and could not completely restore the lipogenic differentiation ability of O-BMMSCs to the similar differentiation characteristics of S-BMMSCs. 4. Discussion In order to clarify the biological function of miR-181c-5p on BMMSCs, this studay specifically regulated the expression level of miR-181c-5p in BMMSCs by transfecting chemically synthesized miR-181c-5p mimics and inhibitors. The results of cell differentiation showed that miR-181c-5p was involved in the osteogenic- adipogenic differentiation of BMMSCs, inhibiting osteogenic differentiation and promoting adipogenic differentiation of BMMSCs. To further clarify the multifunctional role of miR-181c-5p in promoting adipogenic and inhibiting osteogenic differentiation in BMMSCs, we first hypothesized that Foxo1, a gene that has been shown to be important in promoting osteogenesis and inhibiting lipogenesis, would most likely be a candidate for miR-181c-5p based on biological information analysis software, common target gene prediction software, databases and the negative regulation mechanism of miRNAs and target genes. Bioinformatics results showed that the predicted target of miR-181c-5p was located at the 3'-UTR sequence of Foxo1. Foxo1 has been reported to be an important transcription factor [ 17 ] that promotes bone formation, bone matrix mineralization, and osteoblast differentiation [ 18 , 19 ]. It was found that the mRNA levels of Col-1, RUNX2, OCN and MMP13 in osteogenic differentiation were significantly decreased after Foxo1 knockout [ 20 ]in osteoblasts. RUNX2 is a transcription factor that plays a key role in osteogenic differentiation and bone formation, and miR-181c-5p may inhibit the osteogenic differentiation of BMMSCs by inhibiting the MAPK/ERK signaling pathway. The study found that the promoter of RUNX2 is the direct target of Foxo1, and verified that RUNX2 is an important downstream gene of Foxo1. In addition, Foxo1 has been found to be involved in adipocyte differentiation, negatively regulates adipocyte differentiation and inhibits the formation of lipid droplets in precursor adipocytes [ 21 , 22 ]. Osteoblasts and adipocytes are derived from a common progenitor cell, and inhibition of adipogenic differentiation will inversely promote osteoblast differentiation [ 23 ]. These findings suggest that Foxo1 may first regulate the differentiation of blasts toward osteogenic and away from adipogenic differentiation [ 20 ]. To clarify whether miR-181c-5p can regulate the expression of predicted target genes and Foxo1, this study analyzed the protein expression level of Foxo1 by overexpressing and inhibiting the expression level of miR-181c-5p in BMMSCs. The results showed that the protein level of Foxo1 were significantly decreased in the miR-181c-5p overexpression group, while the protein levels of Foxo1 in the miR-181c-5p inhibition group showed an increasing trend. These results indicated that miR-181c-5p was negatively regulated with Foxo1, validating Foxo1 as a direct target gene of miR-181c-5p mediated by translational repression. Next, we cotransfected miR-181c-5p and a luciferase reporter gene containing the 3’-UTR sequence of Foxo1 into BMMSCs to further verify the relationship between miR-181c-5p and Foxo1. The results showed that the luciferase activity of target genes in miR-181c-5p upregulated group was significantly decreased, while the luciferase activity in the miR-181c-5p downregulated group was significantly increased. This strongly indicates that Foxo1 is a target gene of miR-181c-5p, and miR-181c-5p prevents the expression of Foxo1 through translational inhibition, which can inhibit osteogenic differentiation and promote adipogenic differentiation in BMMSCs, ultimately causing an imbalance in osteogenic- adipogenic differentiation in BMMSCs. Previous experiments confirmed that miR-181c-5p targets Foxo1, inhibits its synthesis post-transcriptionally, and alters the osteogenic-adipogenic differentiation balance of BMMSCs. To clarify whether miR-181c-5p regulates the imbalance of BMMSCs differentiation by interacting with Foxo1 target genes, we investigated the mRNA and protein levels of endogenous Foxo1 in O-BMMSCs and S-BMMSCs. These results indicated that miR-181c-5p in OPM caused the adipogenic and osteogenic differentiation bias of O-BMMSCs by inhibiting the expression of target gene Foxo1, and also proved that miR-181c-5p is a positive regulator of OPM. Studies have shown that target genes mediate the role of miRNAs. Therefore, modulating the expression levels of endogenous target genes by changing miRNAs is an effective way to regulate various biological processes [ 24 , 25 ]. In this study, we reduced the expression of miR-181c-5p in O-BMMSCs by inhibiting miR-181c-5p and detected the level of endogenous target genes. The results showed that miR-181c-5p inhibitor partially elevated endogenous Foxo1 expression, and promote RUNX2 expression and calcified nodule formation, reduce PPAR-γ levels and lipid droplet formation, thereby improving Osteogenic-adipogenic differentiation balance of O-BMMSCs. However, miR-181c-5p inhibitor could not fully restore expression levels of Foxo1 to normal levels. This may be due to the presence of other signaling molecules involved in the osteoblastic-lipogenic differentiation of O-BMMSCs [ 26 , 27 ], which warrants further investigation. In conclusion, miR-181c-5p inhibitor could partially restore the low osteogenic capacity and inhibit the high adipogenic capacity of O-BMMSCs, thereby correcting the osteogenic-adipogenic differentiation balance of O-BMMSCs and improving the bone remodeling microenvironment of OPM. 5. Conclusion In conclusion, this study reveals a new mechanism for the development of osteoporosis due to reduced estrogen levels, which may provide new targets and new ideas for the prevention and treatment of bone resorption in osteoporosis. References R. Marcus, Post-menopausal osteoporosis, Best practice & Research Clinical Obstetrics and Gynaecology, 16 (2002) 309–327. K.E.E. Pierre D. Delmas, Jonathan D. Adachi, Kristine D. Harper, C.G. Somnath Sarkar, Jean-Yves Reginster, Huibert A. P. Pols,, S.T.H. Robert R. Recker, Wentao WU, Harry K. Genant, Dennis M. Black, And Richard Eastell, Efficacy of Raloxifene on Vertebral Fracture Risk Reduction in Postmenopausal Women with Osteoporosis: Four-Year Results from a Randomized Clinical Trial, The Journal of Clinical Endocrinology & Metabolism 87 (2002) 3609–3617. K. Kerschan-Schindl, Prevention and rehabilitation of osteoporosis, Wiener medizinische Wochenschrift, 166 (2016) 22–27. M. Gnecchi, L.G. Melo, Bone marrow-derived mesenchymal stem cells: isolation, expansion, characterization, viral transduction, and production of conditioned medium, Methods in molecular biology, 482 (2009) 281–294. M. Ha, V.N. Kim, Regulation of microRNA biogenesis, Nature reviews. Molecular cell biology, 15 (2014) 509–524. L.W. Xue-Min Qiu, Yu-Yan Gui, Ying-Ping Xu, Da-Jin Li, BSNXD modulates mesenchymal stem cell differentiation into osteoblasts in a postmenopausal osteoporotic mouse model, Int J Clin Exp Pathol 8(2015) 4408–4417. A. Williams, J. Henao-Mejia, C.C. Harman, R.A. Flavell, miR-181 and metabolic regulation in the immune system, Cold Spring Harbor symposia on quantitative biology, 78 (2013) 223–230. B.I. Xinghui Sun, Akm Khyrul Wara, Nathan Belkin, Shaolin He, Lester Kobzik,, M.P.V. Gary M. Hunninghake, MICU Registry, Timothy S. Blackwell, MicroRNA-181b regulates NF-κB–mediated vascular inflammatio, The Journal of clinical investigation, 122 (2012) 1973–1990. R. Su, H.S. Lin, X.H. Zhang, X.L. Yin, H.M. Ning, B. Liu, P.F. Zhai, J.N. Gong, C. Shen, L. Song, J. Chen, F. Wang, H.L. Zhao, Y.N. Ma, J. Yu, J.W. Zhang, MiR-181 family: regulators of myeloid differentiation and acute myeloid leukemia as well as potential therapeutic targets, Oncogene, 34 (2015) 3226–3239. Z. Ruan, L. Lu, L. Zhang, M. Dong, Bone marrow stromal cells-derived microRNA-181-containing extracellular vesicles inhibit ovarian cancer cell chemoresistance by downregulating MEST via the Wnt/beta-catenin signaling pathway, Cancer gene therapy, 28 (2021) 785–798. Z. lyu, Z. Mao, H. Wang, Y. Fang, T. Chen, Q. Wan, M. Wang, N. Wang, J. Xiao, H. Wei, X. Li, Y. Liu, Q. Zhou, MiR-181b targets Six2 and inhibits the proliferation of metanephric mesenchymal cells in vitro, Biochemical and biophysical research communications, 440 (2013) 495–501. T. Komori, Animal models for osteoporosis, European journal of pharmacology, 759 (2015) 287–294. H. Li, R. Ghazanfari, D. Zacharaki, H.C. Lim, S. Scheding, Isolation and characterization of primary bone marrow mesenchymal stromal cells, Annals of the New York Academy of Sciences, 1370 (2016) 109–118. Q. Zhuang, B. Ye, S. Hui, Y. Du, R.C. Zhao, J. Li, Z. Wu, N. Li, Y. Zhang, H. Li, S. Wang, Y. Yang, S. Li, H. Zhao, Z. Fan, G. Qiu, J. Zhang, Long noncoding RNA lncAIS downregulation in mesenchymal stem cells is implicated in the pathogenesis of adolescent idiopathic scoliosis, Cell death and differentiation, 26 (2019) 1700–1715. C.L. Neben, M. Lo, N. Jura, O.D. Klein, Feedback regulation of RTK signaling in development, Dev Biol, 447 (2019) 71–89. T. Matsubara, K. Kida, A. Yamaguchi, K. Hata, F. Ichida, H. Meguro, H. Aburatani, R. Nishimura, T. Yoneda, BMP2 regulates Osterix through Msx2 and Runx2 during osteoblast differentiation, The Journal of biological chemistry, 283 (2008) 29119–29125. K.E. van der Vos, P.J. Coffer, FOXO-binding partners: it takes two to tango, Oncogene, 27 (2008) 2289–2299. M.T. Rached, A. Kode, L. Xu, Y. Yoshikawa, J.H. Paik, R.A. Depinho, S. Kousteni, FoxO1 is a positive regulator of bone formation by favoring protein synthesis and resistance to oxidative stress in osteoblasts, Cell metabolism, 11 (2010) 147–160. E. Ambrogini, M. Almeida, M. Martin-Millan, J.H. Paik, R.A. Depinho, L. Han, J. Goellner, R.S. Weinstein, R.L. Jilka, C.A. O'Brien, S.C. Manolagas, FoxO-mediated defense against oxidative stress in osteoblasts is indispensable for skeletal homeostasis in mice, Cell metabolism, 11 (2010) 136–146. M.F. Siqueira, S. Flowers, R. Bhattacharya, D. Faibish, Y. Behl, D.N. Kotton, L. Gerstenfeld, E. Moran, D.T. Graves, FOXO1 modulates osteoblast differentiation, Bone, 48 (2011) 1043–1051. M. Armoni, C. Harel, S. Karni, H. Chen, F. Bar-Yoseph, M.R. Ver, M.J. Quon, E. Karnieli, FOXO1 represses peroxisome proliferator-activated receptor-gamma1 and -gamma2 gene promoters in primary adipocytes. A novel paradigm to increase insulin sensitivity, The Journal of biological chemistry, 281 (2006) 19881–19891. T.K. Jun Nakae, Yukari Kitamura,Karen C. Arden,William H. Biggs III,and Domenico Accili, The Forkhead Transcription Factor Foxo1 Regulates Adipocyte Differentiation, Developmental cell, 4 (2003). I. Gerin, G.T. Bommer, M.E. Lidell, A. Cederberg, S. Enerback, O.A. Macdougald, On the role of FOX transcription factors in adipocyte differentiation and insulin-stimulated glucose uptake, The Journal of biological chemistry, 284 (2009) 10755–10763. K. Kajimoto, H. Naraba, N. Iwai, MicroRNA and 3T3-L1 pre-adipocyte differentiation, Rna, 12 (2006) 1626–1632. S.F. Reinhart BJ, Basson M,Pasquinelli AE,Bettinger JC,Rougvie AE,Horvitz HR,Ruvkun G The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans, Nature, 403 (2000) 901–906. M. Sciaudone, E. Gazzerro, L. Priest, A.M. Delany, E. Canalis, Notch 1 Impairs Osteoblastic Cell Differentiation, Endocrinology, 144 (2003) 5631–5639. C.M.N. Rowena McBeath, and Christopher S. Chen, Dana M. Pirone, Kiran Bhadriraju,, Cell Shape, Cytoskeletal Tension, and RhoA Regulate Stem Cell Lineage Commitment, Developmental cell, 6 (2004) 483–495. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1453818","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":97699359,"identity":"e185562f-9979-4340-8161-df7487acf9fe","order_by":0,"name":"Chi Yang","email":"","orcid":"","institution":"Yangzhou University Medical College","correspondingAuthor":false,"prefix":"","firstName":"Chi","middleName":"","lastName":"Yang","suffix":""},{"id":97699360,"identity":"16dde064-675e-4dd8-91c9-8e1bac18679d","order_by":1,"name":"Kai Shi","email":"","orcid":"","institution":"Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Shi","suffix":""},{"id":97699361,"identity":"ffd39550-57e1-4683-a211-c9991ec5e8f6","order_by":2,"name":"Jie Wang","email":"","orcid":"","institution":"Affiliated Hospital of Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Wang","suffix":""},{"id":97699364,"identity":"c1bd1ff3-ad42-46a1-b96a-38c3d14ec176","order_by":3,"name":"Lianqi Yan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvklEQVRIiWNgGAWjYBACNv7mAwYfKmyY+dkbiNTCJ3EsoXDGmTR2yZ4DRGqRY8hR+MzZcpjf4EYCsQ5jOMO4mbEhTdrg5uONNxhqbKIJa2HuPWxcuMPGWPJ2WrEFw7G03AbCtpxLM555Ji2Z73aOmQRjw2FitOSY/+ZtO1zfcPMM8VoMjIFamAVu8BCrBRjIhsBAZpbsAfolgRi/yPfDo/LwxhsfamwIa0EGBhIJpCiHaCFVxygYBaNgFIwMAACmrkG83AebPQAAAABJRU5ErkJggg==","orcid":"","institution":"Yangzhou University Medical College","correspondingAuthor":true,"prefix":"","firstName":"Lianqi","middleName":"","lastName":"Yan","suffix":""}],"badges":[],"createdAt":"2022-03-15 11:14:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1453818/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1453818/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":20360389,"identity":"70c03ca9-1d50-48bd-af72-5ccf7fc8d5c9","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":13853,"visible":true,"origin":"","legend":"\u003cp\u003eComparison the body weight of mice in each group after 3 months of OPM surgery\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/127fd5f82f3778f118e02e8e.png"},{"id":20360384,"identity":"8a6f3323-393e-4056-ac1c-352b86f200b0","added_by":"auto","created_at":"2022-04-14 18:51:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":709797,"visible":true,"origin":"","legend":"\u003cp\u003eBone morphology of the distal femur of mice in each group after 3 months of OPM surgery (n=5).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/b9100dd20772eeb1bfeb90b6.png"},{"id":20360386,"identity":"9829555b-560d-4d1e-a0a1-8d659f60447d","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1904886,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOptical microscope images of primary cultured S-BMMSCs and O-BMMSCs.\u003c/strong\u003e (A) Growth and cell morphology of primary cultured S-BMMSCs on day 3 (×40); (B) Growth and cell morphology of primary cultured S-BMMSCs on day 12 (×100); (C) Growth and cell morphology of primary cultured O-BMMSCs on day 3 (×40); (D) Growth and cell morphology of primary cultured O-BMMSCs on day 12 (×100).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/6f1bbf747952f8640b8d1cb6.png"},{"id":20360392,"identity":"dc6debe4-e4e9-44c5-8ab9-acc6474f7548","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":816472,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of differentially expressed miRNAs in S-BMMSCs and O-BMMSCs miRNA microarray screening.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/788483b578441fe2e4d2ed90.png"},{"id":20360385,"identity":"d049dbd7-64cc-43dd-a264-80ae55ed3bbd","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":11173,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of chemically synthesized miR-181c-5p mimics and miR-181c-5p inhibitor on the expression level of iR-181c-5p detected by qRT-PCR (n=5；*P\u0026lt;0.05 vs control).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/9703d47882d99f8efa1e8e6d.png"},{"id":20360568,"identity":"b7afde58-bddf-4f2d-86b6-7f2467effbec","added_by":"auto","created_at":"2022-04-14 18:56:09","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":37381,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of miR-181c-5p on the proliferation of BMMSCs detected by MTT assay\u003c/p\u003e","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/602ef9dc327facd01658eee2.jpg"},{"id":20360398,"identity":"a800a78c-8e46-45da-83c8-14321fea75c9","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1158352,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of miR-181c-5p on osteogenic differentiation of BMMSCs. \u003c/strong\u003e(A) Alizarin red staining (×200); (B) Quantification of alizarin red staining; (C) Western blot detection of Runx2 protein expression. (n = 5; * indicates P\u0026lt;0.05 vs control).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/3814ebfc8d53c98f3dba3c55.png"},{"id":20360396,"identity":"8d873baf-c767-4e30-add1-07b334f158e7","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1170694,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effect of miR-181c-5p on adipogenic differentiation of BMMSCs.\u003c/strong\u003e (A) Oil red O staining (×200); (B) Oil red O staining quantification; (C) Western blot detection of PPAR-γ protein expression. (n = 5, * means P\u0026lt;0.05 vs control).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/1e04d711045de5e3949f61e4.png"},{"id":20360388,"identity":"34113d49-1cf4-41fe-a920-cc8410b48f5f","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":6291,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of miR-181c-5p paired with the 3′-UTR region of Foxo1.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/e3ef028ac61100116d032af2.png"},{"id":20360390,"identity":"9ccd8e24-3bff-4ab1-86e5-dffff08445e7","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":123184,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe regulatory effect of miR-181c-5p on Foxo1. \u003c/strong\u003e(A) The protein expression of Foxo1 after miR-181c-5p mimics, inhibitor and control transfection; (B) Foxo1 3′-UTR luciferase activity after transfection with miR-181c-5p mimics, inhibitor and control. (n = 5, * means P\u0026lt;0.05 vs control).\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/696e4b0dc232ed320c05d7f2.png"},{"id":20360394,"identity":"e058a593-0804-4eb5-b888-07afe694d89c","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":116810,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEndogenous expression of Foxo1 in O-BMMSCs and S-BMMSCs. \u003c/strong\u003e(A) Comparison of Foxo1 mRNA levels in O-BMMSCs and S-BMMSCs; (B) Comparison of Foxo1 protein content in O-BMMSCs and S-BMMSCs. (n=5, * means P\u0026lt;0.05 vs Sham).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/092b031387733be0797f0d21.png"},{"id":20360397,"identity":"db9a9dbe-7973-4fcf-ae13-69cd0f7b2a4f","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":2267493,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of miR-181c-5p inhibitor on osteogenic differentiation of O-BMMSCs.\u003c/strong\u003e (A) Alizarin red staining micrograph (x200); (B) Quantification of alizarin red staining; (C) Protein expression of Foxo1; (D) Protein expression of Runx2. (n=5, * indicates P\u0026lt;0.05 vs control, ** indicates P\u0026lt;0.01 vs control).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/f753812054b4b8b8f2177178.png"},{"id":20360391,"identity":"5ba58e5b-433c-4396-ab72-6ffccc785256","added_by":"auto","created_at":"2022-04-14 18:51:09","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":1434196,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effect of miR-181c-p inhibitor on the adipogenic differentiation of O-BMMSCS.\u003c/strong\u003e (A) Oil red O staining; (B) Oil red O staining quantification; (C) Protein expression of Foxo1; (D) Protein expression of PPAR-γ. (n=5, * means P\u0026lt;0.05 vs control, ** means P\u0026lt;0.01 vs control).\u003c/p\u003e","description":"","filename":"floatimage13.png","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/13168ea2e56cc7e8326e9e7f.png"},{"id":22488435,"identity":"c02c58fb-7034-4169-a550-52fd4b5c6299","added_by":"auto","created_at":"2022-06-10 06:14:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7108781,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1453818/v1/a5347a5c-9e51-4ae7-b40f-d5a259d52a6a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The regulatory effect of miR-181c-5p on the differentiation function of bone marrow mesenchymal stem cells in postmenopausal osteoporotic mice","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eOsteoporosis (OP) is a metabolic bone disease syndrome characterized by osteopenia and destruction of bone microarchitecture. Patients have decreased osteogenic strength, increased fragility, and are prone to fractures. Postmenopausal osteoporosis, also known as type I OP, generally occurs about 10 years after menopause, and is most commonly seen clinically in women aged 60\u0026ndash;80 [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. At present, more than 200\u0026nbsp;million people in the world suffer from osteoporosis, and there are more than 88\u0026nbsp;million in China, and its incidence has jumped to the 7th place of common diseases and morbidities[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The underlying cause is an imbalance between osteoclastic bone resorption and osteoblastic bone formation, resulting in a decrease in bone mass and structural changes in bone tissue, which increases bone fragility and leads to fractures. Epidemiological studies in North America have shown that the risk of osteoporotic fractures in white women over 50 years of age is 17.5% for hip fractures, 15.6% for vertebral fractures and 16.9% for distal forearm fractures; the corresponding risks for men are 6.0%, 5.0% and 3.0% respectively [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. These fractures (especially hip fractures) have a high incidence, poor prognosis, high disability rate and high medical costs, often causing a large financial burden to the patient, family and society. Therefore, the prevention and treatment of fractures in patients with postmenopausal osteoporosis (OPM) is one of the hot topics of clinical research in internal medicine and orthopaedic clinical research in recent years. However, the current clinical treatment of OPM is mainly based on hormone replacement, calcium supplementation and inhibition of bone resorption, but the treatment is not effective due to drug toxicity, malabsorption, unstable efficacy and poor patient compliance.\u003c/p\u003e \u003cp\u003eBone marrow mesenchymal stem cells (BMMSCs) are adult stem cells derived from mesoderm with self-renewal and multi-directional differentiation potential [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. BMMSCs play an important role in bone development, regeneration and repair by differentiating into various cells. BMMSCs are the source cells of both osteoblasts and adipocytes, and the balance of their osteogenic-adipogenic differentiation capacity is closely related to the homeostatic balance of bone remodeling. In the process of osteoporosis, the osteogenic differentiation ability of BMMSCs decreases, while the adipogenic differentiation ability increases. This may be one of the reasons for osteoporosis, but the specific regulatory mechanism of the multi-directional differentiation of BMMSCs is still unclear.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are a newly discovered class of small non-coding RNAs that widely exist in animals and plants, and can bind to the 3\u0026prime;-untranslated region of target genes in a base-pairing manner [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The miRNA can silence the expression of target genes at the post-transcriptional level, and play important regulatory roles in a variety of physiological and pathological processes. A variety of miRNAs have been identified that are involved in the osteogenic-adipogenic differentiation process of stem cells and play an important role in regulating stem cell fate. However, it is still unclear which miRNAs play key roles in the multidirectional differentiation of BMMSCs, the molecular signaling pathways that specifically regulate the differentiation of BMMSCs, and whether miRNAs play a role in the occurrence and development of OPM.\u003c/p\u003e \u003cp\u003eIn this study, BMMSCs were isolated and purified from normal mice and osteoporosis model mice [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. It has been reported that miR-705 abnormally regulates the differentiation of bone marrow mesenchymal stem cells in postmenopausal osteoporotic mice. Studies have shown that BMMSCs from two sources, post-O-BMMSCs and post-S-BMMSCs, both express normal mesenchymal stem cell surface markers, but do not express hematopoietic system-derived cell surface markers, and have clonogenic ability. The osteogenic differentiation ability of O-BMMSCs was significantly lower than S-BMMSCs after osteogenic induction, while the adipogenic differentiation ability of O-BMMSCs after adipogenic induction was significantly higher than S-BMMSCs. Gene screening revealed that miR-181c-5p was differentially expressed between normal mice and osteoporosis model mice. In this experiment, miR-181c-5p was selected for further functional study.\u003c/p\u003e \u003cp\u003eThe miR-181 family is an evolutionarily conserved family of microRNAs with a wide range of functions involved in the regulation of immune system function [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], vascular inflammatory response [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], and haematopoietic development [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In addition, the miR-181 family is aberrantly expressed in a variety of tumors, however the role in osteogenic differentiation is not reported. In osteoporosis caused by estrogen deficiency, high expression of miR-181a can inhibit the proliferation of BMMSCs and reduce the osteogenic capacity of bone marrow stromal cells, which may be one of the important factors affecting the pathogenesis of osteoporosis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In addition, miR-181b was found to significantly reduce the osteogenic differentiation ability of BMMSCs in vitro [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis study further explored the role and mechanism of miR-181c-5p in the pathogenesis of OPM, both to deepen the understanding of the molecular mechanism of OPM pathogenesis and to clarify the underlying causes of bone loss in osteoporosis, and to provide important guidance for the prevention and treatment of various postmenopausal osteoporosis-induced fracture diseases.\u003c/p\u003e"},{"header":"2. Methods And Materials","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Establishment of postmenopausal osteoporosis (OPM) mouse model\u003c/h2\u003e \u003cp\u003e All protocols in this study were approved by the Committee on the Ethics of Animal Experiments of Yangzhou University Medical College, Xuzhou Medical University and the Xuzhou Council on Animal Care, Xuzhou, China, in compliance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication no.85\u0026thinsp;\u0026minus;\u0026thinsp;23, revised 1996). The study was performed in accordance with ARRIVE guidelines too.\u003c/p\u003e \u003cp\u003eFemale healthy C57BL/6 mice (5 weeks old, weighing 15\u0026thinsp;\u0026plusmn;\u0026thinsp;2 g) were purchased from the animal center. Mice were housed in cages with appropriate water and food at an ambient temperature of 25\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, humidity of 50% \u0026plusmn; 5%, and light conditions with a 12-h light/dark cycle.\u003c/p\u003e \u003cp\u003eThe procedure was performed according to previous reports [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Briefly, the mice in the castration group were anesthetized by inhaling isoflurane gas (300ml/min), the skin was disinfected, and an approximately 1.5 cm incision was made in the midline of the abdomen to expose the bilateral fallopian tubes and ovaries. Lateral ligation was performed, the ovaries and ligated fallopian tubes were removed, the wounds were sutured after the operation, and penicillin was injected intraperitoneally for 3 consecutive days after the operation. In the sham-operated group, only equal amounts of adipose tissue around the ovaries were excised, the wounds were sutured after the operation, and penicillin was injected intraperitoneally for 3 consecutive days after the operation. All animals at 3 months after surgery were weighed and recorded for data analysis and comparison.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Hematoxylin-Eosin (HE) staining for femoral bone morphology\u003c/h2\u003e \u003cp\u003eThe distal femoral stem ends of mice from the ovariectomized group (OVX) and the sham-operated group (SHAM) (5 mice each) were fixed overnight in 10% formalin at 3 months post-operatively. Then, decalcify with 10% EDTA (PH\u0026thinsp;=\u0026thinsp;7.4) at room temperature for 3 weeks, and replace the decalcification solution every 3 days. The decalcified specimens were rinsed overnight in running water, paraffin embedded and cut into paraffin sections of approximately 10 um thickness. The sections were routinely dewaxed and then stained with HE solution. Histomorphological observation and photography were performed under an optical microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Isolation and culture of bone marrow mesenchymal stem cells (BMMSCs)\u003c/h2\u003e \u003cp\u003eBMMSCs were isolated from C57BL/6 mice using a whole bone marrow apposition screening method [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. briefly, bone marrow was isolated from the femur and tibia of the mice and all bone marrow cells were placed in DMEM culture medium containing 20% FBS and cultured in primary culture at 37\u0026deg;C in a 5% CO2 incubator. After 48 h of incubation, the first full volume of fluid was changed to remove any cells that were not adherent to the wall, followed by half volume changes every 3 days. When the walled cells covered 80%-90% of the bottom area of the dish, the cells were digested with 0.25% trypsin.When BMMSCs were expanded to generation 3 for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Cell transfection\u003c/h2\u003e \u003cp\u003eThe miR-181c-5p mimics, miR-181c-5p inhibitor and mus-miR-negative control were synthesized by GenepPharma (Suzhou,China). The miR-181c-5p mimics, miR-181c-5p inhibitor and mus-miR-negative control were transfected into BMMSCs according to Lipofectamine 2000\u0026trade; instructions (Thermofisher Scientific). Transfection efficiency was examined by qRT-PCR.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Osteogenic and adipogenic differentiation\u003c/h2\u003e \u003cp\u003eTo induce osteogenic-adipogenic differentiation, P2-5 BMMSCs were seeded into 6-well plates to about 80% confluence, and the osteogenic group was supplemented with DMEM containing 10% FBS, 10 mmol/L sodium β-glycerophosphate and 0.2 mmol/L ascorbic acid. The adipogenic group was supplemented with 0.01 uM dexamethasone, 0.5 mM IBMX, 60 uM indomethacin, 2 ml insulin.The medium was changed every other day during differentiation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 MTT assay\u003c/h2\u003e \u003cp\u003eTo detect the effect of miR-181c-5p on the proliferation of BMMSCs, BMMSCs were transfected with miR-181c-5p mimics or miR-181c-5p inhibitor, and then inoculated in well plate. Replaced with complete medium after 12 h, and continued to incubate for 6 days. Adding 20 ul MTT solution to the culture wells, incubated at 37\u0026deg;C for 4 h and then discarded. 150 ul DMSO was added and shaken for 10 min avoiding light. The OD value was detected with a microplate reader at 490 nm wavelength and the growth curve was drawn.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Alizarin red staining and quantification\u003c/h2\u003e \u003cp\u003eThe cells in osteoblast group were washed 3 times with PBS on 21 days, added with 4% paraformaldehyde for 15 min, and washed 3 times with distilled water. Then adding an appropriate amount of alizarin red staining solution at room temperature for 30 min, rinse with distilled water for 2 minutes, observe under a microscope and take pictures. For quantification, 10% cetylpyridinium chloride solution was added to the stained calcified nodule samples for 15 minutes, the lysate was collected, and the OD value of the lysate was detected by a microplate reader (wavelength 570 mm).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Oil Red O staining and quantification\u003c/h2\u003e \u003cp\u003eThe cells in the adipogenic group were washed 3 times with PBS on 10 days, then stained with oil red dye solution for 10 min, observed under a microscope and photographed. For quantification, isopropyl alcohol was added to the stained oil droplet samples for 10min, the lysate was collected and the OD of the lysate (wavelength 520mm) was detected by enzyme marker.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Quantitative Real-time PCR (qRT-PCR) analysis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from BMMSCs after osteogenic or adipogenic differentiation using RNA-easy Isolation Reagent (Vazyme) and cDNA was then obtained using a reverse transcription kit. cDNA was subsequently quantified by real-time PCR using SYBR Green (Takara). primers were synthesized by Sangon Biotech (Shanghai, China). and the sequences are shown in the following Table\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRUNX2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCATGGCGGGTAACGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRUNX2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGACGGTTATGGTCAAGGTGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPAR-γ-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGCCGGATCCACAAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPAR-γ-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTCCTTCTCGGCCTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFoxo1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGAGTGGATGGTGAAGAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFoxo1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTGTGAAGGGACAGATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGAGAACATTCATTGCTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGCAGGGTCCGAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Western blot assay [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/h2\u003e \u003cp\u003eAfter osteogenic or adipogenic differentiation of S-BMMSCs and O-BMMSCs, cell samples were collected and operated according to the previously reported methods. Briefly, cells were lysed with RIPA lysis buffer (Beyotime) containing protease inhibitor cocktail (Roche) to obtain total protein. The supernatant was separated by centrifugation at 12,000g and the total protein content was assayed using a BCA kit (Beyotime). The proteins were separated by 12% SDS-PAGE and transferred onto PVDF membranes (Millipore). The membranes were then sealed with a sealing solution containing 5% skimmed milk powder. After sealing for 1 hour, the protein-containing membrane was incubated overnight at 4\u0026deg;C with primary antibodies, including Anti-mouse RUNX2 and Anti-mouse PPAR-γ (Abcam, USA). The next day the membrane was washed five times with TBS buffer containing 1% Tween. The membranes were then incubated with HRP-labelled secondary antibodies for 2 hours at room temperature and developed with ECL luminescent solution. Anti-mouse β-actin (Cell signaling, USA) was used as a control protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Dual luciferase reporting assay\u003c/h2\u003e \u003cp\u003eFoxo1 and control plasmids were co-transfected with miR-7-5p mimic or mock control into BMMSCs cells. After 48 hours of transfection, cells were collected and luciferase activity was assessed using a dual luciferase assay kit (Solarbio).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e \u003cp\u003eAll data were statistically analyzed using SPSS17.0 software, and measurement data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). The \u003cem\u003et-\u003c/em\u003etest was used for comparison between two groups. All experiments were repeated more than 3 times. The datasets used and analysed during the current study available from the corresponding author on reasonable request,we will reply as soon as we receive the emails.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv class=\"Section2\" id=\"Sec16\"\u003e\n \u003ch2\u003e3.1 Identification of the mouse OPM model\u003c/h2\u003e\n \u003cp\u003eTo identify the OPM mouse model, the weight of the mice was measured and samples were collected after 3 months of surgery. The body weight of the mice in the OVX group was significantly higher than SHAM group, indicating that ovariectomy caused excessive obesity in the mice, which was consistent with previous reports (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). HE staining was performed on the histological sections of the femur, and the comparison under the light microscope showed that the trabecular bone in the OVX group was slender, few in number and disorderly arranged, and osteoporosis such as enlarged medullary cavity appeared (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). These results proved that the mice showed significant osteoporosis in the femur and the OPM model was successfully established after the removal of the ovaries.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec17\"\u003e\n \u003ch2\u003e3.2 Compare the cell morphology of BMMSCs\u003c/h2\u003e\n \u003cp\u003eBMMSCs were obtained from the bone marrow of mice and cultured to compare the morphology of cells in the normal and surgical groups. After three days of culture by whole bone marrow apposition method, both groups of BMMSCs were able to grow appositionally with similar cell morphology, both were shuttle-shaped or triangular, with little cytoplasm, large nuclei, strong refractive index and uneven cell protrusions (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA and C). After 12 days of culture, most of the cell colonies fused with each other and grew to the bottom of the bottle (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB and D).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec18\"\u003e\n \u003ch2\u003e3.3 The miRNA screening in BMMSCs\u003c/h2\u003e\n \u003cp\u003ePrevious studies compared the miRNA expression profiles of O-BMMSCs and S-BMMSCs, and the screening found that the expression of miR-181c-5p was specifically increased in BMMSCs of OPM (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e), suggesting that miR-181c-5p is related to the functional changes in BMMSCs of OPM. It was previously reported that the miR-181 family can reduce the osteogenic differentiation ability of BMMSCs [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e] [\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]. Based on the above evidence, we hypothesized that the abnormal increase of miR-181c-5p during the occurrence of OPM changes the differentiation phenotype of BMMSCs, causing an imbalance in their osteogenic-adipogenic differentiation balance and thus contributing to the development of OPM. Therefore, we further used synthetic miRNA mimics and inhibitors to specifically upregulate and downregulate the expression of miR-181c-5p in BMMSCs, and observe the changes in the expression level of miR-181c-5p on the biology of BMMSCs. Furthermore, the key target genes regulated by miR-181c-5p were further identified by bioinformatics analysis, and the molecular mechanism of its regulation of BMMSCs differentiation was discussed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec19\"\u003e\n \u003ch2\u003e3.4 Functional characterization of chemically synthesized mimics and inhibitor\u003c/h2\u003e\n \u003cp\u003eTo test whether the synthesized miR-181c-5p mimics and miR-181c-5p inhibitor could specifically alter the expression level of miR-181c-5p in cells, we detected the expression levels of miR-181c-5p in BMMSCs transfected with miR-181c-5p mimics, miR-181c-5p inhibitor and negative control by qRT-PCR. The results are shown in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. After 72h of transfection, the expression of miR-181c-5p in the mimics transfected group was upregulated approximately 39-fold compared to the control group, while the expression in the inhibitor transfected group was downregulated approximately 5-fold compared to the control group. This indicates that the expression level of miR-181c-5p in BMMSCs could be effectively regulated by transfection with specific mimics or inhibitor.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec20\"\u003e\n \u003ch2\u003e3.5 Effect of miR-181c-5p on the proliferative capacity of BMMSCs\u003c/h2\u003e\n \u003cp\u003eThe proliferation of BMMSCs transfected with miR-181c-5p mimics or miR-181c-5p inhibitor was detected by MTT assay. The results showed that there was no significant change in cell growth rate and cell proliferation curve after upregulation or downregulation of miR-181c-5p compared with control group (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). These results demonstrate that miR-181c-5p does not affect the proliferative capacity of BMMSCs.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec21\"\u003e\n \u003ch2\u003e3.6 Effect of miR-181c-5p on the osteogenic differentiation of BMMSCs\u003c/h2\u003e\n \u003cp\u003eTo investigate the effect of miR-181c-5p on the osteogenic differentiation ability of BMMSCs, we performed alizarin red staining analysis on BMMSCs after 14 days with osteogenic induction, and detected the expression of osteogenic-related genes by Western blot. The results showed that the red-positive nodules formed in the miR-181c-5p inhibitor group were larger, more numerous and darker than miR-181c-5p mimics group (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA-B). It showed that the expression level of miR-181c-5p was negatively correlated with calcium deposition in BMMSCs. The results of western blot showed that the protein expression of Runx2 was reduced in the mimics group compared to the control group, while Runx2 was significantly higher in the inhibitor group (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC). These results demonstrated that miR-181c-5p inhibited the osteogenic differentiation of BMMSCs.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec22\"\u003e\n \u003ch2\u003e3.7 Effect of miR-181c-5p on the adipogenic differentiation of BMMSCs\u003c/h2\u003e\n \u003cp\u003eNext, we detected the effect of miR-181c-5p on the adipogenic differentiation ability of BMMSCs by Oil Red O Staining and Western blot. The results of Oil Red O staining showed that lipid droplets formed in the miR-181c-5p inhibitor group were smaller in volume and less in number than those in the miR-181c-5p mimics group, indicating that the expression level of miR-181c-5p was positively correlated to the lipid formation of BMMSCs (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eA-B). As shown in Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eC, the protein expression of PPAR-\u0026gamma; was lower in mimics group, while PPAR-\u0026gamma; was significantly increased in inhibitor group. These results indicated that miR-181c-5p promoted adipogenic differentiation of BMMSCs.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec23\"\u003e\n \u003ch2\u003e3.8 The miR-181c-5p target gene screening\u003c/h2\u003e\n \u003cp\u003eThe above experiments proved that miR-181c-5p is an inhibitor of osteogenic differentiation and a promoter of adipogenic differentiation in BMMSCs. To clarify the mechanism of miR-181c-5p in differentiation of BMMSCs, we performed bioinformatics analysis through target gene prediction software and websites (TargetScan, miRanda, miRwalk, PITA and RNAhybrid), and predicted that miR-181c-5p may interact with more than 700 genes. Among them, miR-181c-5p had binding sites with 3\u0026apos;-UTR region of Foxo1. In addition, Foxo1 has been confirmed to be a transcription factor that promoted the osteogenic differentiation and inhibited the adipogenic differentiation in BMMSCs. Therefore, we hypothesize that Foxo1 is a target gene of miR-181c-5p, and the expression pairing diagram is shown in Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec24\"\u003e\n \u003ch2\u003e3.9 Foxo1 negatively regulates miR-181c-5p\u003c/h2\u003e\n \u003cp\u003eTo investigate the relationship between Foxo1 and miR-181c-5p, we detected the expression level of Foxo1 in BMMSCs by Western blot. The results showed that overexpression of miR-181c-5p prevented the expression of endogenous Foxo1 protein in BMMSCs, while the protein level of endogenous Foxo1 was significantly increased in BMMSCs after downregulation of miR-181c-5p (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eA). This indicated that miR-181c-5p prevented Foxo1 protein translation. The receptor tyrosine kinase RTK-MAPK plays an important role in embryonic somite development and osteogenic differentiation [\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e]. Various cytokines including BMP, bFGF and IGF can regulate osteogenic differentiation by activating RUNX2 through the MAPK/ERK signaling pathway [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e]. RUNX2 is a transcription factor that plays a key role in osteogenic differentiation and bone formation, and miR-181c-5p may inhibit the normal osteogenic and adipogenic differentiation of BMMSCs by inhibiting the MAPK/ERK signaling pathway. Furthermore, in the comparison between Sham and OVX,qRT-PCR and Westernblot showed that the mRNA and protein expression of Foxo1 was significantly lower in O-BMMSCs than S-BMMSCs(Fig. \u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e), in contrast to the expression pattern of miR-181c-5p in O-BMMSCs versus S-BMMSCs [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]. These results suggest that miR-181c-5p causes imbalance in adipogenic-osteogenic differentiation in O-BMMSCs by repressing the expression of target genes.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec25\"\u003e\n \u003ch2\u003e3.10 Foxo1 is a direct target of miR-181c-5p\u003c/h2\u003e\n \u003cp\u003eNext, we verified the relationship between miR-181c-5p and Foxo1 by dual luciferase reporter. We constructed a luciferase gene plasmid containing the 3\u0026prime;-UTR sequence of Foxo1, and cotransfected the gene plasmid and the internal control plasmid with miR-181c-5p mimics, inhibitor and negative control to measure Foxo1 luciferase activity. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003eB, the activity of Foxo1 luciferase decreased by 55% in all mimics transfected groups compared to the control group, while Foxo1 luciferase activity increased by approximately 65% in the inhibitor transfected group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results indicate that miR-181c-5p plays a role in inhibiting the protein expression of the target gene by binding directly to the Foxo1 3\u0026prime;-UTR region.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec26\"\u003e\n \u003ch2\u003e3.11 The reversal effect of miR-181c-5p inhibitor on the osteogenic and adipogenic differentiation of O-BMMSCs\u003c/h2\u003e\n \u003cp\u003eTo further investigate the mechanism of miR-181c-5p in BMMSCs, we intervened the role of miR-181c-5p by miR-181c-5p inhibitor. The miR-181c-5p inhibitor or inhibitor-control (NC) were transfected into O-BMMSCs and S-BMMSCs. The transfected cells were subjected to osteogenic induction for 14 days followed by alizarin red staining. The results showed that, compared with the OVX\u0026thinsp;+\u0026thinsp;NC group, the calcified nodules in the transfected miR-181c-5p inhibitor group were larger, more numerous, and darker in color, but not as much as the SHAM\u0026thinsp;+\u0026thinsp;NC group (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eA-B). The OD value of miR-181c-5p inhibitor alizarin red was higher than OVX\u0026thinsp;+\u0026thinsp;NC group, which indicated that miR-181c-5p inhibitor had a certain recovery effect on the osteogenic differentiation defect of O-BMMSC s (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eC). Western blot results showed that the expression of Foxo1 and Runx2 was significantly increased in O-BMMSCs with downregulated miR-181c-5p (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eD-E), indicating that the miR-181c-5p inhibitor was effective in restoring the osteogenic ability of O-BMMSCs by elevating the expression levels of endogenous Foxo1 and RUNX2.\u003c/p\u003e\n \u003cp\u003eIn addition, the adipogenic induction group was stained with Oil Red O. The results showed that the miR-181c-5p inhibitor transfected group had smaller and fewer lipid droplets for oil-red O staining compared to the OVX\u0026thinsp;+\u0026thinsp;NC group, but larger and more lipid droplets than the SHAM\u0026thinsp;+\u0026thinsp;NC group (Fig. \u003cspan class=\"InternalRef\"\u003e13\u003c/span\u003eA). Quantitative analysis of Oil Red O showed that BMMSCs with downregulated miR-181c-5p had lower Oil Red OD value and lower adipogenic differentiation ability, but higher OD value than SHAM\u0026thinsp;+\u0026thinsp;NC group (Fig. \u003cspan class=\"InternalRef\"\u003e13\u003c/span\u003eB). As shown in Fig. \u003cspan class=\"InternalRef\"\u003e13\u003c/span\u003eC and \u003cspan class=\"InternalRef\"\u003e13\u003c/span\u003eD, Foxo1 protein levels were significantly increased and PPAR-\u0026gamma; protein levels were significantly decreased compared to the OVX\u0026thinsp;+\u0026thinsp;NC group, but their expression levels were not as high as those of the SHAM\u0026thinsp;+\u0026thinsp;NC group. This indicates that miR-181c-5p inhibitor increases the expression level of endogenous Foxo1, thereby inhibiting the expression of PPAR-\u0026gamma;, but miR-181c-5p inhibitor can only partially counteract the high adipogenic differentiation of O-BMMSCs, and could not completely restore the lipogenic differentiation ability of O-BMMSCs to the similar differentiation characteristics of S-BMMSCs.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn order to clarify the biological function of miR-181c-5p on BMMSCs, this studay specifically regulated the expression level of miR-181c-5p in BMMSCs by transfecting chemically synthesized miR-181c-5p mimics and inhibitors. The results of cell differentiation showed that miR-181c-5p was involved in the osteogenic- adipogenic differentiation of BMMSCs, inhibiting osteogenic differentiation and promoting adipogenic differentiation of BMMSCs.\u003c/p\u003e \u003cp\u003eTo further clarify the multifunctional role of miR-181c-5p in promoting adipogenic and inhibiting osteogenic differentiation in BMMSCs, we first hypothesized that Foxo1, a gene that has been shown to be important in promoting osteogenesis and inhibiting lipogenesis, would most likely be a candidate for miR-181c-5p based on biological information analysis software, common target gene prediction software, databases and the negative regulation mechanism of miRNAs and target genes. Bioinformatics results showed that the predicted target of miR-181c-5p was located at the 3'-UTR sequence of Foxo1. Foxo1 has been reported to be an important transcription factor [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] that promotes bone formation, bone matrix mineralization, and osteoblast differentiation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. It was found that the mRNA levels of Col-1, RUNX2, OCN and MMP13 in osteogenic differentiation were significantly decreased after Foxo1 knockout [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]in osteoblasts. RUNX2 is a transcription factor that plays a key role in osteogenic differentiation and bone formation, and miR-181c-5p may inhibit the osteogenic differentiation of BMMSCs by inhibiting the MAPK/ERK signaling pathway. The study found that the promoter of RUNX2 is the direct target of Foxo1, and verified that RUNX2 is an important downstream gene of Foxo1. In addition, Foxo1 has been found to be involved in adipocyte differentiation, negatively regulates adipocyte differentiation and inhibits the formation of lipid droplets in precursor adipocytes [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Osteoblasts and adipocytes are derived from a common progenitor cell, and inhibition of adipogenic differentiation will inversely promote osteoblast differentiation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These findings suggest that Foxo1 may first regulate the differentiation of blasts toward osteogenic and away from adipogenic differentiation [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. To clarify whether miR-181c-5p can regulate the expression of predicted target genes and Foxo1, this study analyzed the protein expression level of Foxo1 by overexpressing and inhibiting the expression level of miR-181c-5p in BMMSCs. The results showed that the protein level of Foxo1 were significantly decreased in the miR-181c-5p overexpression group, while the protein levels of Foxo1 in the miR-181c-5p inhibition group showed an increasing trend. These results indicated that miR-181c-5p was negatively regulated with Foxo1, validating Foxo1 as a direct target gene of miR-181c-5p mediated by translational repression.\u003c/p\u003e \u003cp\u003eNext, we cotransfected miR-181c-5p and a luciferase reporter gene containing the 3\u0026rsquo;-UTR sequence of Foxo1 into BMMSCs to further verify the relationship between miR-181c-5p and Foxo1. The results showed that the luciferase activity of target genes in miR-181c-5p upregulated group was significantly decreased, while the luciferase activity in the miR-181c-5p downregulated group was significantly increased. This strongly indicates that Foxo1 is a target gene of miR-181c-5p, and miR-181c-5p prevents the expression of Foxo1 through translational inhibition, which can inhibit osteogenic differentiation and promote adipogenic differentiation in BMMSCs, ultimately causing an imbalance in osteogenic- adipogenic differentiation in BMMSCs.\u003c/p\u003e \u003cp\u003ePrevious experiments confirmed that miR-181c-5p targets Foxo1, inhibits its synthesis post-transcriptionally, and alters the osteogenic-adipogenic differentiation balance of BMMSCs. To clarify whether miR-181c-5p regulates the imbalance of BMMSCs differentiation by interacting with Foxo1 target genes, we investigated the mRNA and protein levels of endogenous Foxo1 in O-BMMSCs and S-BMMSCs. These results indicated that miR-181c-5p in OPM caused the adipogenic and osteogenic differentiation bias of O-BMMSCs by inhibiting the expression of target gene Foxo1, and also proved that miR-181c-5p is a positive regulator of OPM.\u003c/p\u003e \u003cp\u003eStudies have shown that target genes mediate the role of miRNAs. Therefore, modulating the expression levels of endogenous target genes by changing miRNAs is an effective way to regulate various biological processes [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In this study, we reduced the expression of miR-181c-5p in O-BMMSCs by inhibiting miR-181c-5p and detected the level of endogenous target genes. The results showed that miR-181c-5p inhibitor partially elevated endogenous Foxo1 expression, and promote RUNX2 expression and calcified nodule formation, reduce PPAR-γ levels and lipid droplet formation, thereby improving Osteogenic-adipogenic differentiation balance of O-BMMSCs. However, miR-181c-5p inhibitor could not fully restore expression levels of Foxo1 to normal levels. This may be due to the presence of other signaling molecules involved in the osteoblastic-lipogenic differentiation of O-BMMSCs [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], which warrants further investigation. In conclusion, miR-181c-5p inhibitor could partially restore the low osteogenic capacity and inhibit the high adipogenic capacity of O-BMMSCs, thereby correcting the osteogenic-adipogenic differentiation balance of O-BMMSCs and improving the bone remodeling microenvironment of OPM.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn conclusion, this study reveals a new mechanism for the development of osteoporosis due to reduced estrogen levels, which may provide new targets and new ideas for the prevention and treatment of bone resorption in osteoporosis.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u003cspan\u003eR. Marcus, Post-menopausal osteoporosis, Best practice \u0026amp; Research Clinical Obstetrics and Gynaecology, 16 (2002) 309\u0026ndash;327.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eK.E.E. Pierre D. Delmas, Jonathan D. Adachi, Kristine D. Harper, C.G. Somnath Sarkar, Jean-Yves Reginster, Huibert A. P. Pols,, S.T.H. Robert R. Recker, Wentao WU, Harry K. Genant, Dennis M. Black, And Richard Eastell, Efficacy of Raloxifene on Vertebral Fracture Risk Reduction in Postmenopausal Women with Osteoporosis: Four-Year Results from a Randomized Clinical Trial, The Journal of Clinical Endocrinology \u0026amp; Metabolism 87 (2002) 3609\u0026ndash;3617.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eK. Kerschan-Schindl, Prevention and rehabilitation of osteoporosis, Wiener medizinische Wochenschrift, 166 (2016) 22\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eM. Gnecchi, L.G. Melo, Bone marrow-derived mesenchymal stem cells: isolation, expansion, characterization, viral transduction, and production of conditioned medium, Methods in molecular biology, 482 (2009) 281\u0026ndash;294.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eM. Ha, V.N. Kim, Regulation of microRNA biogenesis, Nature reviews. Molecular cell biology, 15 (2014) 509\u0026ndash;524.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eL.W. Xue-Min Qiu, Yu-Yan Gui, Ying-Ping Xu, Da-Jin Li, BSNXD modulates mesenchymal stem cell differentiation into osteoblasts in a postmenopausal osteoporotic mouse model, Int J Clin Exp Pathol 8(2015) 4408\u0026ndash;4417.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eA. Williams, J. Henao-Mejia, C.C. Harman, R.A. Flavell, miR-181 and metabolic regulation in the immune system, Cold Spring Harbor symposia on quantitative biology, 78 (2013) 223\u0026ndash;230.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eB.I. Xinghui Sun, Akm Khyrul Wara, Nathan Belkin, Shaolin He, Lester Kobzik,, M.P.V. Gary M. Hunninghake, MICU Registry, Timothy S. Blackwell, MicroRNA-181b regulates NF-\u0026kappa;B\u0026ndash;mediated vascular inflammatio, The Journal of clinical investigation, 122 (2012) 1973\u0026ndash;1990.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eR. Su, H.S. Lin, X.H. Zhang, X.L. Yin, H.M. Ning, B. Liu, P.F. Zhai, J.N. Gong, C. Shen, L. Song, J. Chen, F. Wang, H.L. Zhao, Y.N. Ma, J. Yu, J.W. Zhang, MiR-181 family: regulators of myeloid differentiation and acute myeloid leukemia as well as potential therapeutic targets, Oncogene, 34 (2015) 3226\u0026ndash;3239.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZ. Ruan, L. Lu, L. Zhang, M. Dong, Bone marrow stromal cells-derived microRNA-181-containing extracellular vesicles inhibit ovarian cancer cell chemoresistance by downregulating MEST via the Wnt/beta-catenin signaling pathway, Cancer gene therapy, 28 (2021) 785\u0026ndash;798.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZ. lyu, Z. Mao, H. Wang, Y. Fang, T. Chen, Q. Wan, M. Wang, N. Wang, J. Xiao, H. Wei, X. Li, Y. Liu, Q. Zhou, MiR-181b targets Six2 and inhibits the proliferation of metanephric mesenchymal cells in vitro, Biochemical and biophysical research communications, 440 (2013) 495\u0026ndash;501.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eT. Komori, Animal models for osteoporosis, European journal of pharmacology, 759 (2015) 287\u0026ndash;294.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eH. Li, R. Ghazanfari, D. Zacharaki, H.C. Lim, S. Scheding, Isolation and characterization of primary bone marrow mesenchymal stromal cells, Annals of the New York Academy of Sciences, 1370 (2016) 109\u0026ndash;118.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eQ. Zhuang, B. Ye, S. Hui, Y. Du, R.C. Zhao, J. Li, Z. Wu, N. Li, Y. Zhang, H. Li, S. Wang, Y. Yang, S. Li, H. Zhao, Z. Fan, G. Qiu, J. Zhang, Long noncoding RNA lncAIS downregulation in mesenchymal stem cells is implicated in the pathogenesis of adolescent idiopathic scoliosis, Cell death and differentiation, 26 (2019) 1700\u0026ndash;1715.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eC.L. Neben, M. Lo, N. Jura, O.D. Klein, Feedback regulation of RTK signaling in development, Dev Biol, 447 (2019) 71\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eT. Matsubara, K. Kida, A. Yamaguchi, K. Hata, F. Ichida, H. Meguro, H. Aburatani, R. Nishimura, T. Yoneda, BMP2 regulates Osterix through Msx2 and Runx2 during osteoblast differentiation, The Journal of biological chemistry, 283 (2008) 29119\u0026ndash;29125.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eK.E. van der Vos, P.J. Coffer, FOXO-binding partners: it takes two to tango, Oncogene, 27 (2008) 2289\u0026ndash;2299.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eM.T. Rached, A. Kode, L. Xu, Y. Yoshikawa, J.H. Paik, R.A. Depinho, S. Kousteni, FoxO1 is a positive regulator of bone formation by favoring protein synthesis and resistance to oxidative stress in osteoblasts, Cell metabolism, 11 (2010) 147\u0026ndash;160.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eE. Ambrogini, M. Almeida, M. Martin-Millan, J.H. Paik, R.A. Depinho, L. Han, J. Goellner, R.S. Weinstein, R.L. Jilka, C.A. O\u0026apos;Brien, S.C. Manolagas, FoxO-mediated defense against oxidative stress in osteoblasts is indispensable for skeletal homeostasis in mice, Cell metabolism, 11 (2010) 136\u0026ndash;146.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eM.F. Siqueira, S. Flowers, R. Bhattacharya, D. Faibish, Y. Behl, D.N. Kotton, L. Gerstenfeld, E. Moran, D.T. Graves, FOXO1 modulates osteoblast differentiation, Bone, 48 (2011) 1043\u0026ndash;1051.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eM. Armoni, C. Harel, S. Karni, H. Chen, F. Bar-Yoseph, M.R. Ver, M.J. Quon, E. Karnieli, FOXO1 represses peroxisome proliferator-activated receptor-gamma1 and -gamma2 gene promoters in primary adipocytes. A novel paradigm to increase insulin sensitivity, The Journal of biological chemistry, 281 (2006) 19881\u0026ndash;19891.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eT.K. Jun Nakae, Yukari Kitamura,Karen C. Arden,William H. Biggs III,and Domenico Accili, The Forkhead Transcription Factor Foxo1 Regulates Adipocyte Differentiation, Developmental cell, 4 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eI. Gerin, G.T. Bommer, M.E. Lidell, A. Cederberg, S. Enerback, O.A. Macdougald, On the role of FOX transcription factors in adipocyte differentiation and insulin-stimulated glucose uptake, The Journal of biological chemistry, 284 (2009) 10755\u0026ndash;10763.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eK. Kajimoto, H. Naraba, N. Iwai, MicroRNA and 3T3-L1 pre-adipocyte differentiation, Rna, 12 (2006) 1626\u0026ndash;1632.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eS.F. Reinhart BJ, Basson M,Pasquinelli AE,Bettinger JC,Rougvie AE,Horvitz HR,Ruvkun G The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans, Nature, 403 (2000) 901\u0026ndash;906.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eM. Sciaudone, E. Gazzerro, L. Priest, A.M. Delany, E. Canalis, Notch 1 Impairs Osteoblastic Cell Differentiation, Endocrinology, 144 (2003) 5631\u0026ndash;5639.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eC.M.N. Rowena McBeath, and Christopher S. Chen, Dana M. Pirone, Kiran Bhadriraju,, Cell Shape, Cytoskeletal Tension, and RhoA\u0026nbsp;\u003c/span\u003e\u003cspan\u003eRegulate Stem Cell Lineage Commitment, Developmental cell, 6 (2004) 483\u0026ndash;495.\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Osteoporosis, Mesenchymal stem cells, microRNA, Ovariectomy, Multidirectional differentiation","lastPublishedDoi":"10.21203/rs.3.rs-1453818/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1453818/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eOsteoporosis (OP) is a metabolic bone disease syndrome for which there is no good treatment. In this study, we investigated the expression changes of miR-181c-5p in osteoporosis-derived BMMSCs, and the role and molecular mechanism in the osteogenic-lipogenic differentiation of BMMSCs.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn this study, an OP mouse model was successfully established using the ovariectomy method, and osteoporotic-derived BMMSCs (O-BMMSCs) and sham-operated-derived BMMSCs (S-BMMSCs) were isolated and cultured using the whole bone marrow method. A genetic screen revealed that miR-181c-5p was differentially expressed in O-BMMSCs and S-BMMSCs. The expression levels of miR-181c-5p in BMMSCs were overexpressed or inhibited by cell transfection, and the regulatory effects of miR-181c-5p on the proliferation and osteogenic-adipogenic differentiation of BMMSCs were examined using MTT, multi-directional differentiation induction, alizarin red staining, oil red O staining, qRT-PCR and Western blot. Candidate target genes for miR-181c-5p were screened by target gene prediction software and bioinformatics websites, and target gene validation was performed.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe study found that overexpression of miR-181c-5p or inhibition of miR-181c-5p had no significant effect on the proliferation ability of BMMSCs. Upregulation of miR-181c-5p could reduce the osteogenic ability and enhance the adipogenic ability of BMMSCs, while downregulation of miR-181c-5p could increase the osteogenic ability and inhibit the adipogenic ability of BMMSCs. Besides, Foxo1 was confirmed as a direct target gene of miR-181c-5p, and miR-181c-5p negatively regulated Foxo1 expression. Downregulation of miR-181c-5p in O-BMMSCs promoted Foxo1 expression, improved the osteogenic differentiation of O-BMMSCs, and reduced abnormal lipogenic differentiation of O-BMMSCs and eventually partially restored the normal differentiation ability of O-BMMSCs.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003emiR-181c-5p regulated the osteogenic and adipogenic differentiation of BMMSCs by negatively regulating the expression of target gene Foxo1. The overexpression of miR-181c-5p in the process of osteoporosis leads to the disruption of the balance of osteogenic and adipogenic differentiation of BMMSCs, and reduces the bone formation ability of stem cells.\u003c/p\u003e","manuscriptTitle":"The regulatory effect of miR-181c-5p on the differentiation function of bone marrow mesenchymal stem cells in postmenopausal osteoporotic mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-04-14 18:51:07","doi":"10.21203/rs.3.rs-1453818/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c6894e54-973a-482d-8344-ac521cd22bc7","owner":[],"postedDate":"April 14th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-06-10T06:14:24+00:00","versionOfRecord":[],"versionCreatedAt":"2022-04-14 18:51:07","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1453818","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1453818","identity":"rs-1453818","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}