Berberine prevents the formation of aortic dissection in C57BL/6 mice through the regulation of vascular smooth muscle cell function | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Berberine prevents the formation of aortic dissection in C57BL/6 mice through the regulation of vascular smooth muscle cell function Tongyi Wu, Ru Chen, Wuyi Ban, Chang Ren, Siwei Bi, Jun Gu, Zangjia Geng, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5258943/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose Aortic dissection (AD) represents a critical medical condition characterized by a high mortality rate and limited therapeutic options. The pathogenesis of AD is associated with the extracellular matrix degradation, phenotypic switching and the loss of vascular smooth muscle cells (VSMCs). Berberine (BBR) has demonstrated promising protective effects in various cardiovascular diseases, but its impact on AD and the underlying mechanisms remains unexplored. This study aims to investigate the potential of BBR in reducing the development of AD and preventing the phenotypic transformation of VSMCs, thereby proposing a novel therapeutic strategy for this life-threatening condition. Methods C57BL/6J mice and isolated VSMCs were used as in vivo and in vitro models, respectively. An AD mouse model was established through intragastric administration of β-aminopropionitrile monofumarate (BAPN), and VSMC phenotypic transformation was induced by angiotensin II (Ang-II) to assess the preventative effects of BBR. Results BBR significantly mitigates AD in a BAPN-induced mouse model by reducing AD incidence from 80–45% and increasing survival rates from 50–70%. BBR treatment alleviates aortic dilation and improves aortic morphology, while also attenuating extracellular matrix degradation, as evidenced by reduced collagen type I and fibronectin degradation. Histological and immunohistochemical analyses reveal that BBR diminishes inflammation, as indicated by reduced IL-6 and HIF-1α expression, and mitigates oxidative stress by lowering MDA levels and enhancing SOD activity. Additionally, BBR counteracts VSMC phenotypic transformation and apoptosis, demonstrated by restored contractile protein levels and reduced caspase-3, AKT, and PI3K levels. It also inhibits VSMC proliferation, migration, and MMP expression in vitro , highlighting its protective role against AD progression. Conclusion BBR exhibits protective effects against BAPN-induced AD in C57BL/6J mice, highlighting its potential as a viable and innovative therapeutic option for preventing AD progression. aortic dissection BAPN Berberine inflammation oxidative stress VSMC Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Aortic dissection (AD) is among the most prevalent aortic disease, characterized by a tear in the intima layer of the aorta, which leads to the formation of an intramural hematoma and subsequent vessel wall splitting. The aorta comprises three layers: the intima (inner), media (middle), and adventitia (outer)[ 1 ]. Currently, emergency surgery is the recommended treatment for AD; however, the mortality rate remains significant. Although the prognosis of AD has improved with new instruments and technologies, no specific early diagnostic tools or effective therapeutic drugs are available[ 2 ]. Therefore, preventing AD and elucidating its molecular mechanism are of paramount importance. The primary pathological change in vascular remodeling associated with AD is medial degeneration, characterized by vascular smooth muscle cell (VSMC) depletion and extracellular matrix (ECM) degradation [ 3 ]. VSMCs are crucial for maintaining vessel integrity and controlling the vascular tone, essential for normal function and maintenance of aortic walls. Under pathological conditions, contractile VSMCs transform into an active synthetic state, leading to increased VSMC migration and an increase in bulk ECM deposition and/or dysregulated expression of certain ECM components. Matrix metalloproteinases (MMPs), a group of proteolytic enzymes, degrade various ECM components and hence play a critical role in vascular remodeling[ 4 ]. Elevated MMP expression is observed in AD model, linking MMPs to development through ECM degradation [ 5 ]. Collagen and elastin are key structural proteins that maintain aortic wall integrity[ 6 ]. Inflammation is another significant mechanism in AD pathogenesis and is often interdependent with hypoxia [ 7 ]. Hypoxia-inducible factors (HIFs), particularly HIF-1, are activated in response to the hypoxic and inflammatory microenvironment [ 8 ]. Additionally, oxidative stress contributes to AD occurrence and progression [ 9 ]. Therefore, VSMC phenotypic transformation, oxidative stress, inflammation and structural remodeling of the aortic wall are crucial factors in AD development. Berberine (BBR), the principal bioactive ingredient of Rhizoma coptidis (also named 'Huang Lian' in Chinese), is a natural alkaloid with numerous medicinal properties [ 10 ]. Its antioxidant, anti-proliferative, and anti-inflammatory actions inhibit aberrant cell behaviors [ 11 , 12 ]. BBR has demonstrated various beneficial effects on the cardiovascular system, including normalizing endothelial function, anti-apoptotic effects, and inhibition of autophagy activation [ 10 ]. Studies have also shown that BBR inhibits human aortic smooth muscle cell (HASMC) migration by down-regulating MMP-2 and MMP-9 [ 13 ]. These pathogenic factors are closely related to AD pathogenesis. Therefore, BBR may be an endogenous protective molecule that maintains aortic homeostasis. However, its role in aortic diseases is not fully understood. This study aims to investigate berberine’s role in aortic dissection. 2. Materials and methods 2.1. Murine aortic dissection models and dosing regimen Wildtype C57BL/6J mice were purchased from the GemPharmatech Co., Ltd (Chengdu, China). This study was approved by the Academic Committee of Southwest Minzu University (2023MDLS059). The AD model was induced using β-aminopropionitrile (BAPN), obtained from Macklin (Shanghai, China). Male C57BL/6J mice (3 weeks old, weighing 8–10 g) were fed a normal diet. The sample size was determined based on previous experiments and experimental strategy. Sixty experimental mice were used and randomly categorized into three groups: control group (n = 20), BAPN group (n = 20), and BAPN + BBR group (n = 20). The control group received 0.2 ml of pure water via gavage. The BAPN group received 0.2 ml of BAPN (gavage, diluted in pure water, 1 g/kg/day). The BAPN + BBR group received 0.2 ml of BAPN and BBR (gavage, 100mg/kg/d, diluted in pure water). All experimental mice were diagnosed with AD based on the following criteria: at autopsy, tearing of the aortic wall with blood intrusion resulting in the separation of the aortic wall layers and the formation of a false lumen or mass of blood clot. Aortic rupture was defined as hemorrhage into the adjacent body cavity resulting in premature death [ 14 ]. 2.2. Survival rates, incidence of AD and body weights of mice Body weight was measured weekly for all mice. During the experimental periods, animal survival status, time of death, and cause of death were recorded. All mice were euthanized at the end of experiment (day 28). The mice were anesthetized, and the thoracic cavity was opened by careful dissection. After removing the surrounding tissues under sterile conditions, the extracted aortas were washed several times with sterile saline to remove residual blood. The aortic tissue was then measured and harvested for subsequent experiments. 2.3. Determination of plasma superoxide dismutase (SOD) activity and malondialdehyde (MDA) levels Blood samples were centrifuged at 3000 g for 20 minutes, and the supernatant was collected and kept at 4°C until the experiments began. Plasma SOD activity was determined using a SOD assay kit (Solarbio, Beijing, China) according to the manufacturer’s instructions. Absorbance at 560 nm was measured to calculate protein concentration as U per ml. Plasma MDA levels were determined using an MDA assay kit (Solarbio, Beijing, China) according to the manufacturer's instructions. Absorbance of the supernatant was measured at 450nm, expressed in nmol per ml of protein. 2.4. Histology, immunohistochemistry, and immunofluorescence Whole mouse aorta tissue samples were fixed in 4% paraformaldehyde for 48 hours, embedded in paraffin, and sliced into 4 µm thick sections. Hematoxylin and eosin (H&E) staining was used to determine the tissue morphology. The integrity of the aortic wall elastin was evaluated by elastic Verhoeff-Van Gieson (EVG) staining. Degradation of medial elastic lamina was scored based on an elastin degradation-grading system. Immunohistochemistry was performed to observe IL-6 and HIF-1 staining, and the number of IL-6 and HIF-1 positive cells was analyzed using the ImageJ (Version 1.46). Immunofluorescence was performed to observe staining with SM22α, α-SMA, Collagen type 1(COL1a1) and fibronectin (FN). 2.5. In vitro cell viability assay After trypsin digestion, vascular smooth muscle cells (MOVAS, jennio-bio, China) in suspension were seeded into a 96-well plate at a density of 7×10 4 cells/ml. After 24 hours of incubation, different doses of BBR (150µM, 200µM, 300µM) and angiotensin-II (Ang-II, 1µM) were added. Cell proliferation was detected using a cell counting kit-8 (CCK-8, Dojindo, Shanghai, China) after 24 hours of culture at 37°C, 5% CO 2 . VSMCs were treated with CCK-8 solution at a final concentration of 10% for 1 − 2 hours at 37°C, and absorbance was measured at 450 nm using a microplate reader (SPARK, TECAN). 2.6 In vitro cell migration assays VSMCs migration was evaluated using scratch wound healing assays[ 15 ]. VSMCs were inoculated in 6-well plastic plate and cultured to 80–90% confluence. The monolayer cells were wounded by 1 ml pipette tips to produce “scratches” and washed 3 times with PBS to remove the non-adherent cells. The scratched VSMCs were treated with Ang-II (1µM), with or without BBR (150µM, 200µM, 300µM), for 48 hours. The conformation of cells was recorded at 48 hours by photographing. The distance between two edges of “scratches” was measured using ImageJ, and the reduction in distance indicated cell migration. 2.7. Cell apoptosis detection The terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay was employed to analyze apoptosis[ 16 ]. Cells were cultured with or without BBR (150µM、200µM、300µM) for 24 hours and then challenged with Ang-II (1µM) for one day. After incubation, the cells samples were washed twice with PBS and fixed with 4% paraformaldehyde for 0.5 hours. Slides were then stained using a Colorimetric TUNEL Apoptosis Assay Kit (Keygen, KGA7063, Jiangsu, China) according to the manufacturer’s protocol. Light microscopy was used to observe the cover slips. Three randomly selected fields from each cover slip were analyzed to determine the percentage of TUNEL-positive cells. 2.8. Western blotting analysis Total protein was isolated from VSMC or mouse aortic tissue using RIPA lysis buffer. Lysates with the same protein content (determined by the BCA method; Keygen, KGA902) were prepared. Proteins were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore). After blocking for 1.5 hours in 5% skim milk powder, the bands were incubated overnight at 4°C with primary antibodies, followed by incubation with secondary antibodies (1:5000) for 2 hours at room temperature. The bands were scanned and detected by a chemiluminescence instrument (bio-rad ChemiDoc Touch) with Chemiluminescent HRP Substrate (Keygen, KGP116). ImageJ was used to quantify the intensity of the bands. The following primary antibodies were used: anti-MMP9 (Abcam, ab283575), anti- MMP2 (Abcam, ab181286), anti-OPN (Proteintech, 25715-1-AP), anti-Bax (Proteintech, 50599-2-AP), anti-Bcl2 (Abcam, ab182858), anti-AKT (servicebio, GB111114), anti-Caspase3 (servicebio, Servicebio), anti-HIF-1 (servicebio, GB111339), β-actin (servicebio, GB11001), anti-GAPDH (Keygen, KGAA002). 2.9. Quantitative real-time PCR (RT-qPCR) Total RNA was isolated using TRIzol (Invitrogen, 15596-026), and cDNA was synthesized using a commercial kit (TaKaRa, RR036B) following the instructional manual. RT-qPCR was performed using the Takara kit (TaKaRa, RR820A) on the ABI StepOne Plus Real-Time PCR system. The relative expression of each gene was normalized to the GAPDH gene and analyzed with 2-ΔΔCT method. Primers used in the study are shown in Table 1 . Table 1 Primers for real-time PCR GAPDH gene forward and reverse Gene Forward Reverse MMP2 CAAGTTCCCCGGCGATGTC TTCTGGTCAAGGTCACCTGTC MMP9 CTGGACAGCCAGACACTAAAG CTCGCGGCAAGTCTTCAGAG 2.10. Statistical analysis Data were analyzed using GraphPad Prism version 8.0 (GraphPad Software, San Diego, CA). Results are presented as mean ± standard deviation (SD). Groups comparisons were based on the analysis of variance (ANOVA) and Student’s t-test or one-way ANOVA followed by Dunnett's post hoc test, with p values less than 0.05 considered statistically significant. 3. Results 3.1. Berberine suppresses AD formation following BAPN induction We utilized a BAPN-induced AD model to investigate the role of BBR in aortic degeneration. Three-week-old male C57BL/6 mice were pretreated with BBR (gavage, 100mg/kg/d, diluted in pure water) and BAPN (gavage, 1 g/kg/day, diluted in pure water) for four weeks. During this period, the incidence of AD was 80% (16/20) during 4-week BAPN administration period, whereas BBR treatment reduced the incidence to 45% (9/20) (Fig. 1 A). By the fourth experimental week, the control group had gained significant weight, while the BAPN group experienced significant weight loss compared to the control group (Fig. 1 B). A significant difference in survival rates was observed between the BAPN and BAPN + BBR groups, with BBR treatment increasing the survival rate (70% vs. 50%) (Fig. 1 C). Additionally, BAPN induction significantly increased the maximum internal diameter of the thoracic aorta compared to the control group. BBR notably improved the aortic morphology of BAPN-treated mice and reduced aortic dilation (Fig. 1 D-E). Histologic examination revealed false lumen formation, destruction of the media, and marked thickening of the adventitia in the BAPN group (Fig. 1 F). However, these changes were significantly attenuated by BBR treatment. The elastin score of the experimental mice increased significantly after BAPN administration, and BBR treatment mitigated the breakage of elastic fibers (Fig. 1 F-G). 3.2. BBR blunts extracellular matrix degradation of the aorta Elastic fibers and collagen fibers are the main components of the ECM, which are essential for the development and structural integrity of the blood vessel wall [ 17 ]. Degradation of ECM under pathological conditions can lead to aortic dissection and aneurysm. To assess collagen type I (COL1a1) and fibronectin (FN) deposits in the aorta, immunofluorescence staining was performed. Compared to the control group, the degradation of COL1a1 and FN was intensified in the BAPN group, while BBR treatment reduced their degradation (Fig. 2 A-B). 3.3. BBR inhibits the accumulation of inflammatory cells and HIF-1α expression and oxidative stress in BAPN induced AD mice aorta To investigate the impact of inflammatory cell infiltration (IL-6) on aortic tissue, we examined the expression of IL-6 in proximal aortic tissue from BAPN group and nondissected controls. Immunohistochemical analysis of aortic cross-sections revealed that IL-6 was predominantly localized to the adventitia and media-adventitia border in the BAPN group, with lesser expression in the intima (Fig. 3 A-B). Consistent with previous findings, the adventitia represents the source of the most abundant local IL-6 cytokine production in vascular inflammation[ 18 ]. After BBR treatment, the positive expression of IL-6 in BAPN + BBR group decreased significantly (Fig. 3 A-B). In most cardiovascular diseases, local lesions are hypoxic. Therefore, we evaluated HIF-1α expression in the medial region of the thoracic aorta in mice with aortic dissection. The BAPN group had significantly more HIF-1α positive cells than the control group, whereas BBR significantly reduced the number of HIF-1α positive cells (Fig. 3 C-D). Similarly, significantly increased HIF-1α expression in BAPN group was also observed. However, BAPN + BBR group significantly reduced HIF-1α protein expression compared with the BAPN group (Fig. 3 E-F). Oxidative stress is involved in the occurrence and development of AD. To assess whether BBR acts as an antioxidant in the aorta during AD, we measured the levels of SOD and MDA. Compared with the control group, the antioxidant enzyme SOD activity in the aorta of the BAPN group decreased, while the oxidative stress marker MDA level increased. BBR reduced MDA levels and upregulated SOD activity in BAPN-induced mice (Fig. 3 G-H). 3.4. BBR regulate contractile protein degradation and mitigates cell death of aortic dissection VSMCs in the aorta’s media are the main cell types that provide the structure and function of the aortic wall integrity. In response to external environmental stimulus and pathological conditions, VSMCs can switch between contractile and synthetic phenotypes and participate in the occurrence of AAD/AAA. Immunofluorescence staining was performed on the aorta of mice to detect contractile markers (α-SMA and SM22α). α-SMA and SM22α levels were significantly decreased in the BAPN group compared to the control group. However, treatment with BBR partially reversed the synthetic phenotypic transformation of BAPN-induced VSMCs, as indicated by the upregulation of SM22α and α-SMA (Fig. 4 A). Furthermore, WB analysis was conducted to measure levels of caspase-3, AKT and PI3K in the aorta. The WB results demonstrated that, compared to the control group, the BAPN group showed a significant increase in the level of caspase-3, AKT and PI3K. In contrast, the BAPN + BBR group exhibited a decrease in caspase-3, AKT and PI3K levels compared to the BAPN group (Fig. 4 B- 4 F). Additionally, a marked decrease in the expression of p-AKT and p-PI3K was observed in the BAPN group, while substantial restoration of both p-AKT and p-PI3K levels was noted in the BAPN + BBR group, bringing them closer to the levels observed in the control group (Fig. 4 G- 4 I). 3.5. BBR Inhibited the proliferation and migration in Ang-II induced VSMCs To investigate the functional impacts of BBR on VSMC proliferation and migration, different concentrations of BBR were used to stimulate VSMCs. Both VSMC proliferation and migration play important roles in the progression of AD. For this assay, Ang-II was administered to vascular smooth muscle cells to promote the phenotype transformation, which has been described in many studies[ 3 ]. The results in our study showed that Ang-II treatment significantly promoted the proliferation of VSMCs. However, BBR pretreatment significantly attenuated the effect of Ang-II on VSMC proliferation (Fig. 5 A). We performed in vitro scratch wound healing assays on cultured VSMC. The test results showed a significant increase in VSMC migration after treatment with Ang-II compared to the control group. However, BBR’s group significantly inhibited Ang-II induced VSMC migration distance (Fig. 5 B-C). 3.6. BBR ameliorates phenotypic switch and MMP expression in Ang-II induced VSMC To determine whether BBR contributes to phenotypic transformation of aortic smooth muscle cells in vitro , we examined phenotypic transformation markers of OPN (synthetic phenotype). It was found that BBR decreased OPN in Ang II- treated VSMC (Fig. 6 A-B). Additionally, MMPs are major enzymes involved in extracellular matrix degradation. Elevated levels of MMP-2 and MMP-9 suggest extracellular matrix degradation. WB analysis revealed increased MMP-2 and MMP-9 protein expression in Ang-II treatment, which was rescued by BBR administration (Fig. 6 C-E). Meanwhile, RT-PCR analysis also concluded that BBR treatment significantly inhibited Ang-II-induced levels of MMP2 and MMP9 (Fig. 6 F-G). 3.7. BBR inhibited the apoptosis of VSMCs VSMC apoptosis is another major contributor to vascular disease. TUNEL assay was conducted in VSMCs to determine whether BBR plays a role in VSMC apoptosis. The results showed that Ang II treatment significantly increased apoptosis, while BBR significantly decreased Ang II-induced apoptosis (Fig. 7 A-B). Additionally, the expression levels of Bax and Bcl2 molecules in VSMCs treated with Ang-II were also examined. The results showed that Ang-II significantly down-regulated the expression of Bcl2 protein and up-regulated the expression of Bax protein, which was altered after BBR administration (Fig. 7 C-E). 4. Discussion This study is the first to explore the potential of BBR in mitigating the development of AD in a mouse model. Due to the increasing use of endovascular approaches, surgical thoracic aortic dissection (TAD) specimens have become rare [ 19 ], with most available data limited to advanced disease stages, with no comparable normal controls. Consequently, animal models are indispensable for clinical research into AD pathology. BAPN is widely used in immature and fast-growing animals to induce AD, mimicking clinical AD development, including intimal injury, hematoma, and aortic rupture [ 20 ]. BAPN-induced AD models include[ 21 ]: 1) BAPN alone inducing TAD, 2) sequential BAPN and Ang-II administration inducing TAD, and 3) co-administration of BAPN and Ang-II inducing TAD. While BAPN is commonly administered via drinking water, variability in this method led us to develop an improved protocol by administering BAPN via gavage to three-week-old C57BL/6J mice, ensuring accurate daily dosing. Our results showed that BAPN enlarged the aortic diameter from the root to the thoracic segment, resulting in hematoma and affecting the growth and development. This method proved reliable and simple, with a high success rate in experimental verification. BBR, an alkaloid with strong pharmacological activity, shows promise in preventing and treating cardiovascular diseases [ 11 ]. Although its effects on conditions such as atherosclerosis, hypertension and heart failure are well-documented, its impact on AD remains unclear. Our study provides the first evidence of BBR’s inhibitory effects on AD progression. Specifically, BBR reduced AD incidence, inhibited aortic dilatation, improved aortic morphology and increased survival in BAPN-induced AD model mice. These findings suggest BBR therapy could be a novel therapeutic option for AD prevention. ECM abnormalities play a critical role in AD pathology [ 3 ]. Abnormal ECM remodeling leads to unregulated cell proliferation, differentiation, and adhesion, causing developmental defects[ 22 ]. Elastin and collagen crosslinking are crucial for maintaining arterial structural integrity [ 23 ]. Previous studies found increased collagen deposition and elastin degradation in both TAD patients and TAD mouse models[ 24 , 25 ]. Our findings revealed that BBR prevented elastin degradation, preserved collagen type I (COL1a1) and fibronectin (FN), inhibited false lumens formation, thereby maintaining aortic structure and function. Furthermore, BBR significantly inhibited Ang-II-induced expression of MMP2 and MMP9 in smooth muscle cells, which are associated with maladaptive ECM remodeling. These results suggest that BBR exerts a protective role by preventing excessive MMP secretion and ECM degradation [ 26 ], thus attenuating AD progression. Clinical data indicate increased inflammatory cell recruitment, including macrophages, in aortic samples from patients with ascending aortic aneurysm and dissection [ 27 ]. Our results showed a significant increase IL-6 inflammatory cytokines following BAPN administration. BBR intervention reduced IL-6 levels, alleviating vascular inflammation, likely due to its anti-inflammatory activity. Previous studies linked oxidative stress to vascular damage and AD pathomechanisms [ 28 ], with increased MDA and decreased SOD expression in AD patients’ aortic tissues [ 29 ]. BBR treatment reduced MDA levels and increased SOD activity in BAPN-induced mice. Additionally, our study showed increased HIF-1α expression in the BAPN group, which BBR reduced, indicating BBR’s potential to modulate macrophage infiltration. WB results further confirmed BBR’s effect in reversing HIF-1α protein expression. These findings suggest BBR ameliorates inflammatory cell infiltration, oxidative stress, and HIF-1α expression, contributing to AD prevention. VSMCs are the primary cellular components of the aorta [ 30 ], and pathological changes in VSMCs are closely related to various aortic diseases [ 31 ]. VSMC loss leads to pathological aortic remodeling, with phenotypic changes in response to vascular injury or disease [ 32 ]. Our study observed significant VSMC reduction in BAPN-treated mice, with decreased α-SMA and SM22α levels. BBR effectively maintained VSMCs content and inhibited the phenotypic switch from contractile to synthetic type, as indicated by decreased OPN level. Increased VSMC proliferation and migration contribute to TAD development [ 33 ], and our data showed that BBR suppressed Ang-II-induced VSMC conditions, thereby potentially ameliorating the development of TAD. Apoptosis, regulated by extrinsic or intrinsic apoptotic pathways, is crucial in various cellular processes [ 34 , 35 ], with the Bax/Bcl2 ratio serving as a key indicator [ 36 ]. Our TUNEL assay results demonstrated that BBR regulates VSMC apoptosis, effectively attenuating Ang-II-induced apoptosis, by downregulating Bax and upregulating Bcl2. These results suggest BBR plays a protective role in AD development by inhibiting VSMC phenotypic switching and loss. The PI3K/AKT signaling pathway is critical in blocking VSMC apoptosis [ 37 ]. In the presence of increased AKT and PI3K expression induced by BAPN, but with inhibited activation, BBR may counteract the adverse effects by decreasing PI3K and AKT expression while promoting their phosphorylation, thereby stabilizing the vascular wall and reducing the risk of aortic dissection formation. Additionally, the PI3K/AKT pathway is closely linked to inflammatory responses and oxidative stress[ 38 , 39 ]. BBR may exert a protective effect against AD by mitigating vascular inflammation and oxidative stress through the activation of PI3K/AKT pathway. Overall, the present work provides a comprehensive mechanism of BBR preventing AD progression through multiple targets and complex pathway. However, this study raises several issues for future investigation. The roles of VSMCs, endothelial dysfunction, and macrophage and inflammatory cell infiltration into the injured arterial wall are critical contributors to AD formation and development, warranting further research. Additionally, while we focus on the PI3K/AKT pathway, other mechanisms involved in BBR’s protective effects require exploration. Finally, the impact of BBR on other AD models, such as Marfan syndrom and Loeys-Dietz syndrome, should be investigated, despite these being beyond the scope of the current study. 5. Conclusion BBR treatment significantly prevents the progression of AD, largely through PI3K/AKT pathway activation, reduction of oxidative stress, decreased inflammation and apoptosis, inhibition of phenotypic transformation, and improvement of ECM degradation. These results provide new insights for early medical intervention in AD patients. Abbreviations AD Aortic Dissection TAD thoracic aortic dissection ECM Extracellular Matrix BBR Berberine VSMCs Vascular Smooth Muscle Cells MMPs Matrix Metalloproteinases SOD Superoxide Dismutase MDA Malondialdehyde COL-I Collagen Type I COL-III Collagen Type III α-SMA Alpha-Smooth Muscle Actin SM22α Smooth Muscle 22 Alpha BAPN β-Aminopropionitrile IF Immunofluorescence HE Hematoxylin and Eosin EVG Elastic Van Gieson FN fibronectin Ang-II angiotensin-II Declarations Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Ethics approval This study was approved by the Academic Committee of Southwest Minzu University(2023MDLS059). Author Contributions Tongyi Wu : Writing-original draft, Software, Methodology, Investigation, Formal analysis, Data curation. Ru Chen : Writing-original draft, Writing – review & editing, Investigation, Conceptualization. Wuyi Ban :Investigation. Chang Ren :Data curation. Siwei Bi : Writing-review&editing. Jun Gu : Formal analysis. Zangjia Geng : Formal analysis. Lei Song :Writing-review & editing, Supervision, Conceptualization. Data Availability Not applicable. Code Availability Not applicable. Declarations Ethics Approval Not applicable. Consent to Participate Not applicable. Consent for Publication Not applicable. Competing Interests The authors declare no competing interests. References Wang K, Zhao J, Zhang W, et al. Resveratrol Attenuates Aortic Dissection by Increasing Endothelial Barrier Function Through the SIRT1 Pathway. J Cardiovasc Pharmacol. 2020;76(1):86–93. 10.1097/fjc.0000000000000837 . Pape LA, Awais M, Woznicki EM, et al. Presentation, Diagnosis, and Outcomes of Acute Aortic Dissection: 17-Year Trends From the International Registry of Acute Aortic Dissection. J Am Coll Cardiol. 2015;66(4):350–8. 10.1016/j.jacc.2015.05.029 . Wu D, Shen YH, Russell L, Coselli JS, LeMaire SA. Molecular mechanisms of thoracic aortic dissection. J Surg Res. 2013;184(2):907–24. 10.1016/j.jss.2013.06.007 . Cui N, Hu M, Khalil RA. Biochemical and Biological Attributes of Matrix Metalloproteinases. Prog Mol Biol Transl Sci. 2017;147:1–73. 10.1016/bs.pmbts.2017.02.005 . Manabe T, Imoto K, Uchida K, Doi C, Takanashi Y. Decreased tissue inhibitor of metalloproteinase-2/matrix metalloproteinase ratio in the acute phase of aortic dissection. Surg Today. 2004;34(3):220–5. 10.1007/s00595-003-2683-3 . Yang YY, Li LY, Jiao XL, et al. Intermittent Hypoxia Alleviates β-Aminopropionitrile Monofumarate Induced Thoracic Aortic Dissection in C57BL/6 Mice. Eur J Vasc Endovasc Surg. 2020;59(6):1000–10. 10.1016/j.ejvs.2019.10.014 . Colgan SP, Taylor CT. Hypoxia: an alarm signal during intestinal inflammation. Nat Rev Gastroenterol Hepatol. 2010;7(5):281–7. 10.1038/nrgastro.2010.39 . Zhang SY, Dong YQ, Wang P, et al. Adipocyte-derived Lysophosphatidylcholine Activates Adipocyte and Adipose Tissue Macrophage Nod-Like Receptor Protein 3 Inflammasomes Mediating Homocysteine-Induced Insulin Resistance. EBioMedicine. 2018;31:202–16. 10.1016/j.ebiom.2018.04.022 . Xiao T, Zhang L, Huang Y, et al. Sestrin2 increases in aortas and plasma from aortic dissection patients and alleviates angiotensin II-induced smooth muscle cell apoptosis via the Nrf2 pathway. Life Sci. 2019;218:132–8. 10.1016/j.lfs.2018.12.043 . Feng X, Sureda A, Jafari S, et al. Berberine in Cardiovascular and Metabolic Diseases: From Mechanisms to Therapeutics. Theranostics. 2019;9(7):1923–51. 10.7150/thno.30787 . Och A, Och M, Nowak R, Podgórska D, Podgórski R. Berberine, a Herbal Metabolite in the Metabolic Syndrome: The Risk Factors, Course, and Consequences of the Disease. Molecules. 2022;27(4). 10.3390/molecules27041351 . Ai X, Yu P, Peng L, et al. Berberine: A Review of its Pharmacokinetics Properties and Therapeutic Potentials in Diverse Vascular Diseases. Front Pharmacol. 2021;12:762654. 10.3389/fphar.2021.762654 . Liu SJ, Yin CX, Ding MC, et al. Berberine suppresses in vitro migration of human aortic smooth muscle cells through the inhibitions of MMP-2/9, u-PA, AP-1, and NF-κB. BMB Rep. 2014;47(7):388–92. 10.5483/bmbrep.2014.47.7.186 . Ren P, Wu D, Appel R, et al. Targeting the NLRP3 Inflammasome With Inhibitor MCC950 Prevents Aortic Aneurysms and Dissections in Mice. J Am Heart Assoc. 2020;9(7):e014044. 10.1161/jaha.119.014044 . Park HS, Quan KT, Han JH, et al. Rubiarbonone C inhibits platelet-derived growth factor-induced proliferation and migration of vascular smooth muscle cells through the focal adhesion kinase, MAPK and STAT3 Tyr(705) signalling pathways. Br J Pharmacol. 2017;174(22):4140–54. 10.1111/bph.13986 . Moore CL, Savenka AV, Basnakian AG. TUNEL Assay: A Powerful Tool for Kidney Injury Evaluation. Int J Mol Sci. 2021;22(1). 10.3390/ijms22010412 . Lin CJ, Lin CY, Stitziel NO. Genetics of the extracellular matrix in aortic aneurysmal diseases. Matrix Biol. 2018;71–72:128–43. 10.1016/j.matbio.2018.04.005 . Tieu BC, Lee C, Sun H, et al. An adventitial IL-6/MCP1 amplification loop accelerates macrophage-mediated vascular inflammation leading to aortic dissection in mice. J Clin Invest. 2009;119(12):3637–51. 10.1172/jci38308 . Zheng HQ, Rong JB, Ye FM, et al. Induction of thoracic aortic dissection: a mini-review of beta-aminopropionitrile-related mouse models. J Zhejiang Univ Sci B. 2020;21(8):603–10. 10.1631/jzus.B2000022 . Ren W, Liu Y, Wang X, et al. beta-Aminopropionitrile monofumarate induces thoracic aortic dissection in C57BL/6 mice. Sci Rep. 2016;6:28149. 10.1038/srep28149 . Ren W, Liu Y, Wang X, et al. β-Aminopropionitrile monofumarate induces thoracic aortic dissection in C57BL/6 mice. Sci Rep. 2016;6:28149. 10.1038/srep28149 . Ye S, Yang N, Lu T, et al. Adamts18 modulates the development of the aortic arch and common carotid artery. iScience. 2021;24(6):102672. 10.1016/j.isci.2021.102672 . Yang YY, Li LY, Jiao XL, et al. Intermittent Hypoxia Alleviates beta-Aminopropionitrile Monofumarate Induced Thoracic Aortic Dissection in C57BL/6 Mice. Eur J Vasc Endovasc Surg. 2020;59(6):1000–10. 10.1016/j.ejvs.2019.10.014 . Karimi A, Milewicz DM. Structure of the Elastin-Contractile Units in the Thoracic Aorta and How Genes That Cause Thoracic Aortic Aneurysms and Dissections Disrupt This Structure. Can J Cardiol. 2016;32(1):26–34. 10.1016/j.cjca.2015.11.004 . Milewicz DM, Guo DC, Tran-Fadulu V, et al. Genetic basis of thoracic aortic aneurysms and dissections: focus on smooth muscle cell contractile dysfunction. Annu Rev Genomics Hum Genet. 2008;9:283–302. 10.1146/annurev.genom.8.080706.092303 . Amin M, Pushpakumar S, Muradashvili N, et al. Regulation and involvement of matrix metalloproteinases in vascular diseases. Front Biosci (Landmark Ed). 2016;21(1):89–118. 10.2741/4378 . He R, Guo DC, Estrera AL, et al. Characterization of the inflammatory and apoptotic cells in the aortas of patients with ascending thoracic aortic aneurysms and dissections. J Thorac Cardiovasc Surg. 2006;131(3):671–8. 10.1016/j.jtcvs.2005.09.018 . Gavazzi G, Deffert C, Trocme C, et al. NOX1 deficiency protects from aortic dissection in response to angiotensin II. Hypertension. 2007;50(1):189–96. 10.1161/HYPERTENSIONAHA.107.089706 . Liao M, Liu Z, Bao J, et al. A proteomic study of the aortic media in human thoracic aortic dissection: implication for oxidative stress. J Thorac Cardiovasc Surg. 2008;136(1):65–72. 10.1016/j.jtcvs.2007.11.017 . e1-3. Liao WL, Tan MW, Yuan Y, et al. Brahma-related gene 1 inhibits proliferation and migration of human aortic smooth muscle cells by directly up-regulating Ras-related associated with diabetes in the pathophysiologic processes of aortic dissection. J Thorac Cardiovasc Surg. 2015;150(5):1292–e3012. 10.1016/j.jtcvs.2015.08.010 . Lacolley P, Regnault V, Nicoletti A, Li Z, Michel JB. The vascular smooth muscle cell in arterial pathology: a cell that can take on multiple roles. Cardiovasc Res. 2012;95(2):194–204. 10.1093/cvr/cvs135 . Zhang Y, Qian X, Sun X, et al. Liuwei Dihuang, a traditional Chinese medicinal formula, inhibits proliferation and migration of vascular smooth muscle cells via modulation of estrogen receptors. Int J Mol Med. 2018;42(1):31–40. 10.3892/ijmm.2018.3622 . Ren K, Li B, Liu Z, et al. GDF11 prevents the formation of thoracic aortic dissection in mice: Promotion of contractile transition of aortic SMCs. J Cell Mol Med. 2021;25(10):4623–36. 10.1111/jcmm.16312 . Häcker G. The morphology of apoptosis. Cell Tissue Res. 2000;301(1):5–17. 10.1007/s004410000193 . Su Z, Yang Z, Xu Y, Chen Y, Yu Q. Apoptosis, autophagy, necroptosis, and cancer metastasis. Mol Cancer. 2015;14:48. 10.1186/s12943-015-0321-5 . Moldoveanu T, Czabotar PE, BAX, BAK. A Coming of Age for the BCL-2 Family Effector Proteins. Cold Spring Harb Perspect Biol. 2020;12(4). 10.1101/cshperspect.a036319 . White GE, Tan TC, John AE, et al. Fractalkine has anti-apoptotic and proliferative effects on human vascular smooth muscle cells via epidermal growth factor receptor signalling. Cardiovasc Res. 2010;85(4):825–35. 10.1093/cvr/cvp341 . Li X, Huang S, Zhuo B, et al. Comparison of Three Species of Rhubarb in Inhibiting Vascular Endothelial Injury via Regulation of PI3K/AKT/NF-κB Signaling Pathway. Oxid Med Cell Longev. 2022;2022:8979329. 10.1155/2022/8979329 . Liu Q, Shan P, Li H. Gambogic acid prevents angiotensin II–induced abdominal aortic aneurysm through inflammatory and oxidative stress dependent targeting the PI3K/Akt/mTOR and NF–κB signaling pathways. Mol Med Rep. 2019;19(2):1396–402. 10.3892/mmr.2018.9720 . Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5258943","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":369109082,"identity":"75b10ca4-e853-4860-b3d6-bf34e1a60c53","order_by":0,"name":"Tongyi Wu","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Tongyi","middleName":"","lastName":"Wu","suffix":""},{"id":369109083,"identity":"30d63d78-a0ca-4af7-a365-2a20a93cdf19","order_by":1,"name":"Ru Chen","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Ru","middleName":"","lastName":"Chen","suffix":""},{"id":369109084,"identity":"1a0b1bbc-6b95-4923-9019-0879e2e014a3","order_by":2,"name":"Wuyi Ban","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Wuyi","middleName":"","lastName":"Ban","suffix":""},{"id":369109085,"identity":"86e7b8a9-84ba-4006-97d5-663bdf4bc728","order_by":3,"name":"Chang Ren","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Chang","middleName":"","lastName":"Ren","suffix":""},{"id":369109086,"identity":"d35b58e3-c97d-4275-baa5-7c9de05144bf","order_by":4,"name":"Siwei Bi","email":"","orcid":"","institution":"Sichuan University West China Hospital: West China Hospital of Sichuan University","correspondingAuthor":false,"prefix":"","firstName":"Siwei","middleName":"","lastName":"Bi","suffix":""},{"id":369109087,"identity":"92ff74eb-ee89-43ef-b94d-c3f0c260c635","order_by":5,"name":"Jun Gu","email":"","orcid":"","institution":"Sichuan University West China Hospital: West China Hospital of Sichuan University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Gu","suffix":""},{"id":369109088,"identity":"fa45162a-38fa-40b7-9cd5-2e88e6d243ae","order_by":6,"name":"Zangjia Geng","email":"","orcid":"","institution":"Southwest Minzu University","correspondingAuthor":false,"prefix":"","firstName":"Zangjia","middleName":"","lastName":"Geng","suffix":""},{"id":369109089,"identity":"59ab0267-37c1-47a1-af34-3ca76a199f63","order_by":7,"name":"lei song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYPACCwY29sbGhx9I0CLBwMZzuNlYgiQtDBLpbQI8xKiVbz/+8HHBLwk5PsmHbUCddnK6DQS0GJzJMTae2SdhzCad2PaggCHZ2OwAIS0SPGzSvD0SiW3Sie0GEgwHErcR0iI/g/0ZSEt9m+TBNgkeYrQw3GAwk+b5IZHAJsFIpBawX3gbJAzbeBKBgWxAhF/AIcbzx0YexHj4ocJOjqAWMGBsg1tKjHIw+EO0ylEwCkbBKBiJAAA80jqGP3mBjgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-0986-8490","institution":"Southwest Minzu University","correspondingAuthor":true,"prefix":"","firstName":"lei","middleName":"","lastName":"song","suffix":""}],"badges":[],"createdAt":"2024-10-14 07:25:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5258943/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5258943/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":67405099,"identity":"21c434d6-6f36-4483-afba-0f0b357b96a4","added_by":"auto","created_at":"2024-10-24 13:59:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3596624,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of BBR on AD incidence, body weight, survival rate, aortic histomorphology and elastin degradation. (A) Incidence of AD. (B) Body weight. (C) Survival rate. (D) Representative aortae from each group. (E) Maximal aortic diameter (n = 6 per group). (F) Representative images of H\u0026amp;E and EVG staining. Scale bar: 100 μm; 50 μm (n = 6 per group). (G) Quantification of elastin degradation (n = 6 per group). Data are expressed as mean ± SD. Statistical significance: *p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/fd4275a40d3bec0d412364fc.png"},{"id":67405356,"identity":"56c27ebc-ef4b-445a-bbe7-47dde4868b7c","added_by":"auto","created_at":"2024-10-24 14:07:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1429623,"visible":true,"origin":"","legend":"\u003cp\u003eBBR attenuates ECM degradation in the aorta. (A) Representative images of Fibronectin (green) staining. Scale bars: 50 μm (n = 6 per group). (B) Representative images of Col1a1 (green) staining. Scale bars: 50 μm (n = 6 per group). A: Adventitia, M: Media, L: Lumen. Data are expressed as mean ± SD. Statistical significance: *p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/d38ec8e63aafb3d3d1761db9.png"},{"id":67405096,"identity":"927d758d-8a8d-4af1-9b32-f6380d7f19f6","added_by":"auto","created_at":"2024-10-24 13:59:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2443853,"visible":true,"origin":"","legend":"\u003cp\u003eBBR inhibits inflammatory cell accumulation and HIF-1α expression and oxidative stress in BAPN-induced AD mice aorta. (A) Representative immunohistochemical staining for IL-6. Scale bars:100 μm; 50 μm (n = 6 per group). (B) IL-6 positive area (%). (C) Representative immunohistochemical staining for HIF-1α. Scale bars:100 μm; 50 μm (n = 6 per group). (D)HIF-1α positive area (%). (E) Representative western blot images of HIF-1α in aortic tissue. (E) Quantified expression of HIF-1α in aortic tissue (n = 3 per group). (G) SOD activity. (H) MDA levels. Data are expressed as mean ± SD. Statistical significance: *p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/f7ffc451159a16dba0647d16.png"},{"id":67406314,"identity":"2d353adc-db6f-41d2-b824-c4a7534c6971","added_by":"auto","created_at":"2024-10-24 14:15:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1845495,"visible":true,"origin":"","legend":"\u003cp\u003eBBR regulates contractile protein degradation and mitigates cell death in AD. (A) Representative images of α-SMA and SM22α immunohistochemical staining in aortas. Nucleus (blue). α-SMA (green). SM22α (red). Scale bars: 50 μm. (n = 6 per group). A: Adventitia, M: Media, L: Lumen. (B) Representative Western blots of Caspase-3 in aortic tissue. (C) Quantified expression of Caspase-3 in aortic tissue (n = 3 per group; each sample pooled from three thoracic aortae). (D) Representative Western blots of PI3K and AKT in aortic tissue. (E) Quantified expression of PI3K in aortic tissue (n = 3 per group; each sample pooled from three thoracic aortae). (F)Quantified expression of AKT in aortic tissue (n = 3 per group; each sample pooled from three thoracic aortae). (G) Representative Western blots of P-PI3K and P-AKT in aortic tissue. (H) Quantified expression of P-PI3K in aortic tissue (n = 3 per group; each sample pooled from three thoracic aortae). (I)Quantified expression of P-AKT in aortic tissue (n = 3 per group; each sample pooled from three thoracic aortae). Data are expressed as mean ± SD. Statistical significance: *p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/ede69cc1ab3ff6da3874e9bd.png"},{"id":67405095,"identity":"3d906a8d-93af-4e8b-9a13-fde8fc3f673b","added_by":"auto","created_at":"2024-10-24 13:59:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2710422,"visible":true,"origin":"","legend":"\u003cp\u003eBBR inhibits the proliferation and migration in Ang-II induced VSMCs. (A) \u0026nbsp;CCK8 assays were performed to determine the rate of VSMCs proliferation in each group. Relative proliferation rate was displayed using Ang II‑stimulated cells as a standard (n = 3 per group). (B) Representative images of scratch wound healing assays. The black lines indicated the two edges of “scratches”. (C) The migration distance of VSMCs was measure using ImageJ. The statistical result is presented as folds of the control group (n = 3 per group). Data are expressed as mean ± SD. Statistical significance: *p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/ee392ef308e8238e2efb05a3.png"},{"id":67405359,"identity":"299888f8-de6c-4e08-a869-f634b71eef0c","added_by":"auto","created_at":"2024-10-24 14:07:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1106727,"visible":true,"origin":"","legend":"\u003cp\u003eBBR ameliorates phenotypic switch and MMP expression in Ang-II induced VSMCs. (A) Representative Western blots of OPN in VSMCs. (B) Quantified expression of OPN in VSMCs (n = 3 per group). (C) Representative Western blots of MMP2 and MMP9 in VSMCs. (D) Quantified expression of MMP2 in VSMCs (n = 3 per group). (E) Quantified expression of MMP9 in VSMCs (n = 3 per group). (F) The expression of MMP2 mRNA examined using RT-qPCR in VSMCs of each treatment group (n = 3 per group). (G) Expression of MMP9 mRNA examined using RT-qPCR in VSMCs of each treatment group (n = 3 per group). Data are expressed as mean ± SD. Statistical significance: *p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/9b1f7096f13eed9b82cb28a1.png"},{"id":67405358,"identity":"3fb35861-e512-4109-b899-eb029794675d","added_by":"auto","created_at":"2024-10-24 14:07:25","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1095736,"visible":true,"origin":"","legend":"\u003cp\u003eBBR inhibits the apoptosis of VSMCs. (A) Representative TUNEL images of each group (n = 3 per group). (B) Quantification of TUNEL positive cells for each group (n = 3 per group). (C) Representative Western blots of BAX and BCL2 in VSMCs (n = 3 per group). (D) Quantified expression of BAX in VSMCs (n = 3 per group). (E) Quantified expression of BCL2 in VSMCs (n = 3 per group). Data are expressed as mean ± SD. Statistical significance: *p \u0026lt; 0.05, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/a30ac49a68f0c2e489027bb3.png"},{"id":70355040,"identity":"2cecce12-8c0e-41c8-ba39-f0098c6fc299","added_by":"auto","created_at":"2024-12-02 12:27:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2753042,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5258943/v1/f171ae28-9b75-43b0-a0c8-d3ea16ddc4b2.pdf"}],"financialInterests":"","formattedTitle":"Berberine prevents the formation of aortic dissection in C57BL/6 mice through the regulation of vascular smooth muscle cell function","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAortic dissection (AD) is among the most prevalent aortic disease, characterized by a tear in the intima layer of the aorta, which leads to the formation of an intramural hematoma and subsequent vessel wall splitting. The aorta comprises three layers: the intima (inner), media (middle), and adventitia (outer)[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Currently, emergency surgery is the recommended treatment for AD; however, the mortality rate remains significant. Although the prognosis of AD has improved with new instruments and technologies, no specific early diagnostic tools or effective therapeutic drugs are available[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Therefore, preventing AD and elucidating its molecular mechanism are of paramount importance.\u003c/p\u003e \u003cp\u003eThe primary pathological change in vascular remodeling associated with AD is medial degeneration, characterized by vascular smooth muscle cell (VSMC) depletion and extracellular matrix (ECM) degradation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. VSMCs are crucial for maintaining vessel integrity and controlling the vascular tone, essential for normal function and maintenance of aortic walls. Under pathological conditions, contractile VSMCs transform into an active synthetic state, leading to increased VSMC migration and an increase in bulk ECM deposition and/or dysregulated expression of certain ECM components. Matrix metalloproteinases (MMPs), a group of proteolytic enzymes, degrade various ECM components and hence play a critical role in vascular remodeling[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Elevated MMP expression is observed in AD model, linking MMPs to development through ECM degradation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Collagen and elastin are key structural proteins that maintain aortic wall integrity[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Inflammation is another significant mechanism in AD pathogenesis and is often interdependent with hypoxia [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Hypoxia-inducible factors (HIFs), particularly HIF-1, are activated in response to the hypoxic and inflammatory microenvironment [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Additionally, oxidative stress contributes to AD occurrence and progression [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, VSMC phenotypic transformation, oxidative stress, inflammation and structural remodeling of the aortic wall are crucial factors in AD development.\u003c/p\u003e \u003cp\u003eBerberine (BBR), the principal bioactive ingredient of Rhizoma coptidis (also named 'Huang Lian' in Chinese), is a natural alkaloid with numerous medicinal properties [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Its antioxidant, anti-proliferative, and anti-inflammatory actions inhibit aberrant cell behaviors [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. BBR has demonstrated various beneficial effects on the cardiovascular system, including normalizing endothelial function, anti-apoptotic effects, and inhibition of autophagy activation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Studies have also shown that BBR inhibits human aortic smooth muscle cell (HASMC) migration by down-regulating MMP-2 and MMP-9 [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. These pathogenic factors are closely related to AD pathogenesis. Therefore, BBR may be an endogenous protective molecule that maintains aortic homeostasis. However, its role in aortic diseases is not fully understood. This study aims to investigate berberine\u0026rsquo;s role in aortic dissection.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Murine aortic dissection models and dosing regimen\u003c/h2\u003e \u003cp\u003eWildtype C57BL/6J mice were purchased from the GemPharmatech Co., Ltd (Chengdu, China). This study was approved by the Academic Committee of Southwest Minzu University (2023MDLS059). The AD model was induced using β-aminopropionitrile (BAPN), obtained from Macklin (Shanghai, China). Male C57BL/6J mice (3 weeks old, weighing 8\u0026ndash;10 g) were fed a normal diet. The sample size was determined based on previous experiments and experimental strategy. Sixty experimental mice were used and randomly categorized into three groups: control group (n\u0026thinsp;=\u0026thinsp;20), BAPN group (n\u0026thinsp;=\u0026thinsp;20), and BAPN\u0026thinsp;+\u0026thinsp;BBR group (n\u0026thinsp;=\u0026thinsp;20). The control group received 0.2 ml of pure water via gavage. The BAPN group received 0.2 ml of BAPN (gavage, diluted in pure water, 1 g/kg/day). The BAPN\u0026thinsp;+\u0026thinsp;BBR group received 0.2 ml of BAPN and BBR (gavage, 100mg/kg/d, diluted in pure water). All experimental mice were diagnosed with AD based on the following criteria: at autopsy, tearing of the aortic wall with blood intrusion resulting in the separation of the aortic wall layers and the formation of a false lumen or mass of blood clot. Aortic rupture was defined as hemorrhage into the adjacent body cavity resulting in premature death [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Survival rates, incidence of AD and body weights of mice\u003c/h2\u003e \u003cp\u003eBody weight was measured weekly for all mice. During the experimental periods, animal survival status, time of death, and cause of death were recorded. All mice were euthanized at the end of experiment (day 28). The mice were anesthetized, and the thoracic cavity was opened by careful dissection. After removing the surrounding tissues under sterile conditions, the extracted aortas were washed several times with sterile saline to remove residual blood. The aortic tissue was then measured and harvested for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Determination of plasma superoxide dismutase (SOD) activity and malondialdehyde (MDA) levels\u003c/h2\u003e \u003cp\u003eBlood samples were centrifuged at 3000 g for 20 minutes, and the supernatant was collected and kept at 4\u0026deg;C until the experiments began. Plasma SOD activity was determined using a SOD assay kit (Solarbio, Beijing, China) according to the manufacturer\u0026rsquo;s instructions. Absorbance at 560 nm was measured to calculate protein concentration as U per ml. Plasma MDA levels were determined using an MDA assay kit (Solarbio, Beijing, China) according to the manufacturer's instructions. Absorbance of the supernatant was measured at 450nm, expressed in nmol per ml of protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Histology, immunohistochemistry, and immunofluorescence\u003c/h2\u003e \u003cp\u003eWhole mouse aorta tissue samples were fixed in 4% paraformaldehyde for 48 hours, embedded in paraffin, and sliced into 4 \u0026micro;m thick sections. Hematoxylin and eosin (H\u0026amp;E) staining was used to determine the tissue morphology. The integrity of the aortic wall elastin was evaluated by elastic Verhoeff-Van Gieson (EVG) staining. Degradation of medial elastic lamina was scored based on an elastin degradation-grading system. Immunohistochemistry was performed to observe IL-6 and HIF-1 staining, and the number of IL-6 and HIF-1 positive cells was analyzed using the ImageJ (Version 1.46). Immunofluorescence was performed to observe staining with SM22α, α-SMA, Collagen type 1(COL1a1) and fibronectin (FN).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. In vitro cell viability assay\u003c/h2\u003e \u003cp\u003eAfter trypsin digestion, vascular smooth muscle cells (MOVAS, jennio-bio, China) in suspension were seeded into a 96-well plate at a density of 7\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/ml. After 24 hours of incubation, different doses of BBR (150\u0026micro;M, 200\u0026micro;M, 300\u0026micro;M) and angiotensin-II (Ang-II, 1\u0026micro;M) were added. Cell proliferation was detected using a cell counting kit-8 (CCK-8, Dojindo, Shanghai, China) after 24 hours of culture at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e. VSMCs were treated with CCK-8 solution at a final concentration of 10% for 1\u0026thinsp;\u0026minus;\u0026thinsp;2 hours at 37\u0026deg;C, and absorbance was measured at 450 nm using a microplate reader (SPARK, TECAN).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 In vitro cell migration assays\u003c/h2\u003e \u003cp\u003eVSMCs migration was evaluated using scratch wound healing assays[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. VSMCs were inoculated in 6-well plastic plate and cultured to 80\u0026ndash;90% confluence. The monolayer cells were wounded by 1 ml pipette tips to produce \u0026ldquo;scratches\u0026rdquo; and washed 3 times with PBS to remove the non-adherent cells. The scratched VSMCs were treated with Ang-II (1\u0026micro;M), with or without BBR (150\u0026micro;M, 200\u0026micro;M, 300\u0026micro;M), for 48 hours. The conformation of cells was recorded at 48 hours by photographing. The distance between two edges of \u0026ldquo;scratches\u0026rdquo; was measured using ImageJ, and the reduction in distance indicated cell migration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Cell apoptosis detection\u003c/h2\u003e \u003cp\u003eThe terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay was employed to analyze apoptosis[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Cells were cultured with or without BBR (150\u0026micro;M、200\u0026micro;M、300\u0026micro;M) for 24 hours and then challenged with Ang-II (1\u0026micro;M) for one day. After incubation, the cells samples were washed twice with PBS and fixed with 4% paraformaldehyde for 0.5 hours. Slides were then stained using a Colorimetric TUNEL Apoptosis Assay Kit (Keygen, KGA7063, Jiangsu, China) according to the manufacturer\u0026rsquo;s protocol. Light microscopy was used to observe the cover slips. Three randomly selected fields from each cover slip were analyzed to determine the percentage of TUNEL-positive cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Western blotting analysis\u003c/h2\u003e \u003cp\u003eTotal protein was isolated from VSMC or mouse aortic tissue using RIPA lysis buffer. Lysates with the same protein content (determined by the BCA method; Keygen, KGA902) were prepared. Proteins were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore). After blocking for 1.5 hours in 5% skim milk powder, the bands were incubated overnight at 4\u0026deg;C with primary antibodies, followed by incubation with secondary antibodies (1:5000) for 2 hours at room temperature. The bands were scanned and detected by a chemiluminescence instrument (bio-rad ChemiDoc Touch) with Chemiluminescent HRP Substrate (Keygen, KGP116). ImageJ was used to quantify the intensity of the bands. The following primary antibodies were used: anti-MMP9 (Abcam, ab283575), anti- MMP2 (Abcam, ab181286), anti-OPN (Proteintech, 25715-1-AP), anti-Bax (Proteintech, 50599-2-AP), anti-Bcl2 (Abcam, ab182858), anti-AKT (servicebio, GB111114), anti-Caspase3 (servicebio, Servicebio), anti-HIF-1 (servicebio, GB111339), β-actin (servicebio, GB11001), anti-GAPDH (Keygen, KGAA002).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Quantitative real-time PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated using TRIzol (Invitrogen, 15596-026), and cDNA was synthesized using a commercial kit (TaKaRa, RR036B) following the instructional manual. RT-qPCR was performed using the Takara kit (TaKaRa, RR820A) on the ABI StepOne Plus Real-Time PCR system. The relative expression of each gene was normalized to the GAPDH gene and analyzed with 2-ΔΔCT method. Primers used in the study are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for real-time PCR GAPDH gene forward and reverse\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGTTCCCCGGCGATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTGGTCAAGGTCACCTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGACAGCCAGACACTAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGCGGCAAGTCTTCAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eData were analyzed using GraphPad Prism version 8.0 (GraphPad Software, San Diego, CA). Results are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Groups comparisons were based on the analysis of variance (ANOVA) and Student\u0026rsquo;s t-test or one-way ANOVA followed by Dunnett's post hoc test, with p values less than 0.05 considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Berberine suppresses AD formation following BAPN induction\u003c/h2\u003e \u003cp\u003eWe utilized a BAPN-induced AD model to investigate the role of BBR in aortic degeneration. Three-week-old male C57BL/6 mice were pretreated with BBR (gavage, 100mg/kg/d, diluted in pure water) and BAPN (gavage, 1 g/kg/day, diluted in pure water) for four weeks. During this period, the incidence of AD was 80% (16/20) during 4-week BAPN administration period, whereas BBR treatment reduced the incidence to 45% (9/20) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). By the fourth experimental week, the control group had gained significant weight, while the BAPN group experienced significant weight loss compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). A significant difference in survival rates was observed between the BAPN and BAPN\u0026thinsp;+\u0026thinsp;BBR groups, with BBR treatment increasing the survival rate (70% \u003cem\u003evs.\u003c/em\u003e 50%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Additionally, BAPN induction significantly increased the maximum internal diameter of the thoracic aorta compared to the control group. BBR notably improved the aortic morphology of BAPN-treated mice and reduced aortic dilation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). Histologic examination revealed false lumen formation, destruction of the media, and marked thickening of the adventitia in the BAPN group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). However, these changes were significantly attenuated by BBR treatment. The elastin score of the experimental mice increased significantly after BAPN administration, and BBR treatment mitigated the breakage of elastic fibers (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF-G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2. BBR blunts extracellular matrix degradation of the aorta\u003c/h2\u003e \u003cp\u003eElastic fibers and collagen fibers are the main components of the ECM, which are essential for the development and structural integrity of the blood vessel wall [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Degradation of ECM under pathological conditions can lead to aortic dissection and aneurysm. To assess collagen type I (COL1a1) and fibronectin (FN) deposits in the aorta, immunofluorescence staining was performed. Compared to the control group, the degradation of COL1a1 and FN was intensified in the BAPN group, while BBR treatment reduced their degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.3. BBR inhibits the accumulation of inflammatory cells and HIF-1α expression and oxidative stress in BAPN induced AD mice aorta\u003c/p\u003e \u003cp\u003eTo investigate the impact of inflammatory cell infiltration (IL-6) on aortic tissue, we examined the expression of IL-6 in proximal aortic tissue from BAPN group and nondissected controls. Immunohistochemical analysis of aortic cross-sections revealed that IL-6 was predominantly localized to the adventitia and media-adventitia border in the BAPN group, with lesser expression in the intima (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). Consistent with previous findings, the adventitia represents the source of the most abundant local IL-6 cytokine production in vascular inflammation[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. After BBR treatment, the positive expression of IL-6 in BAPN\u0026thinsp;+\u0026thinsp;BBR group decreased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). In most cardiovascular diseases, local lesions are hypoxic. Therefore, we evaluated HIF-1α expression in the medial region of the thoracic aorta in mice with aortic dissection. The BAPN group had significantly more HIF-1α positive cells than the control group, whereas BBR significantly reduced the number of HIF-1α positive cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). Similarly, significantly increased HIF-1α expression in BAPN group was also observed. However, BAPN\u0026thinsp;+\u0026thinsp;BBR group significantly reduced HIF-1α protein expression compared with the BAPN group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-F). Oxidative stress is involved in the occurrence and development of AD. To assess whether BBR acts as an antioxidant in the aorta during AD, we measured the levels of SOD and MDA. Compared with the control group, the antioxidant enzyme SOD activity in the aorta of the BAPN group decreased, while the oxidative stress marker MDA level increased. BBR reduced MDA levels and upregulated SOD activity in BAPN-induced mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-H).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4. BBR regulate contractile protein degradation and mitigates cell death of aortic dissection\u003c/h2\u003e \u003cp\u003eVSMCs in the aorta\u0026rsquo;s media are the main cell types that provide the structure and function of the aortic wall integrity. In response to external environmental stimulus and pathological conditions, VSMCs can switch between contractile and synthetic phenotypes and participate in the occurrence of AAD/AAA. Immunofluorescence staining was performed on the aorta of mice to detect contractile markers (α-SMA and SM22α). α-SMA and SM22α levels were significantly decreased in the BAPN group compared to the control group. However, treatment with BBR partially reversed the synthetic phenotypic transformation of BAPN-induced VSMCs, as indicated by the upregulation of SM22α and α-SMA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Furthermore, WB analysis was conducted to measure levels of caspase-3, AKT and PI3K in the aorta. The WB results demonstrated that, compared to the control group, the BAPN group showed a significant increase in the level of caspase-3, AKT and PI3K. In contrast, the BAPN\u0026thinsp;+\u0026thinsp;BBR group exhibited a decrease in caspase-3, AKT and PI3K levels compared to the BAPN group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Additionally, a marked decrease in the expression of p-AKT and p-PI3K was observed in the BAPN group, while substantial restoration of both p-AKT and p-PI3K levels was noted in the BAPN\u0026thinsp;+\u0026thinsp;BBR group, bringing them closer to the levels observed in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.5. BBR Inhibited the proliferation and migration in Ang-II induced VSMCs\u003c/h2\u003e \u003cp\u003eTo investigate the functional impacts of BBR on VSMC proliferation and migration, different concentrations of BBR were used to stimulate VSMCs. Both VSMC proliferation and migration play important roles in the progression of AD. For this assay, Ang-II was administered to vascular smooth muscle cells to promote the phenotype transformation, which has been described in many studies[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The results in our study showed that Ang-II treatment significantly promoted the proliferation of VSMCs. However, BBR pretreatment significantly attenuated the effect of Ang-II on VSMC proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). We performed \u003cem\u003ein vitro\u003c/em\u003e scratch wound healing assays on cultured VSMC. The test results showed a significant increase in VSMC migration after treatment with Ang-II compared to the control group. However, BBR\u0026rsquo;s group significantly inhibited Ang-II induced VSMC migration distance (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.6. BBR ameliorates phenotypic switch and MMP expression in Ang-II induced VSMC\u003c/h2\u003e \u003cp\u003eTo determine whether BBR contributes to phenotypic transformation of aortic smooth muscle cells \u003cem\u003ein vitro\u003c/em\u003e, we examined phenotypic transformation markers of OPN (synthetic phenotype). It was found that BBR decreased OPN in Ang II- treated VSMC (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-B). Additionally, MMPs are major enzymes involved in extracellular matrix degradation. Elevated levels of MMP-2 and MMP-9 suggest extracellular matrix degradation. WB analysis revealed increased MMP-2 and MMP-9 protein expression in Ang-II treatment, which was rescued by BBR administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-E). Meanwhile, RT-PCR analysis also concluded that BBR treatment significantly inhibited Ang-II-induced levels of MMP2 and MMP9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF-G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.7. BBR inhibited the apoptosis of VSMCs\u003c/h2\u003e \u003cp\u003eVSMC apoptosis is another major contributor to vascular disease. TUNEL assay was conducted in VSMCs to determine whether BBR plays a role in VSMC apoptosis. The results showed that Ang II treatment significantly increased apoptosis, while BBR significantly decreased Ang II-induced apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-B). Additionally, the expression levels of Bax and Bcl2 molecules in VSMCs treated with Ang-II were also examined. The results showed that Ang-II significantly down-regulated the expression of Bcl2 protein and up-regulated the expression of Bax protein, which was altered after BBR administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC-E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study is the first to explore the potential of BBR in mitigating the development of AD in a mouse model. Due to the increasing use of endovascular approaches, surgical thoracic aortic dissection (TAD) specimens have become rare [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], with most available data limited to advanced disease stages, with no comparable normal controls. Consequently, animal models are indispensable for clinical research into AD pathology. BAPN is widely used in immature and fast-growing animals to induce AD, mimicking clinical AD development, including intimal injury, hematoma, and aortic rupture [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. BAPN-induced AD models include[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]: 1) BAPN alone inducing TAD, 2) sequential BAPN and Ang-II administration inducing TAD, and 3) co-administration of BAPN and Ang-II inducing TAD. While BAPN is commonly administered via drinking water, variability in this method led us to develop an improved protocol by administering BAPN via gavage to three-week-old C57BL/6J mice, ensuring accurate daily dosing. Our results showed that BAPN enlarged the aortic diameter from the root to the thoracic segment, resulting in hematoma and affecting the growth and development. This method proved reliable and simple, with a high success rate in experimental verification.\u003c/p\u003e \u003cp\u003eBBR, an alkaloid with strong pharmacological activity, shows promise in preventing and treating cardiovascular diseases [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Although its effects on conditions such as atherosclerosis, hypertension and heart failure are well-documented, its impact on AD remains unclear. Our study provides the first evidence of BBR\u0026rsquo;s inhibitory effects on AD progression. Specifically, BBR reduced AD incidence, inhibited aortic dilatation, improved aortic morphology and increased survival in BAPN-induced AD model mice. These findings suggest BBR therapy could be a novel therapeutic option for AD prevention.\u003c/p\u003e \u003cp\u003eECM abnormalities play a critical role in AD pathology [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Abnormal ECM remodeling leads to unregulated cell proliferation, differentiation, and adhesion, causing developmental defects[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Elastin and collagen crosslinking are crucial for maintaining arterial structural integrity [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Previous studies found increased collagen deposition and elastin degradation in both TAD patients and TAD mouse models[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Our findings revealed that BBR prevented elastin degradation, preserved collagen type I (COL1a1) and fibronectin (FN), inhibited false lumens formation, thereby maintaining aortic structure and function. Furthermore, BBR significantly inhibited Ang-II-induced expression of MMP2 and MMP9 in smooth muscle cells, which are associated with maladaptive ECM remodeling. These results suggest that BBR exerts a protective role by preventing excessive MMP secretion and ECM degradation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], thus attenuating AD progression.\u003c/p\u003e \u003cp\u003eClinical data indicate increased inflammatory cell recruitment, including macrophages, in aortic samples from patients with ascending aortic aneurysm and dissection [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Our results showed a significant increase IL-6 inflammatory cytokines following BAPN administration. BBR intervention reduced IL-6 levels, alleviating vascular inflammation, likely due to its anti-inflammatory activity. Previous studies linked oxidative stress to vascular damage and AD pathomechanisms [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], with increased MDA and decreased SOD expression in AD patients\u0026rsquo; aortic tissues [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. BBR treatment reduced MDA levels and increased SOD activity in BAPN-induced mice. Additionally, our study showed increased HIF-1α expression in the BAPN group, which BBR reduced, indicating BBR\u0026rsquo;s potential to modulate macrophage infiltration. WB results further confirmed BBR\u0026rsquo;s effect in reversing HIF-1α protein expression. These findings suggest BBR ameliorates inflammatory cell infiltration, oxidative stress, and HIF-1α expression, contributing to AD prevention.\u003c/p\u003e \u003cp\u003eVSMCs are the primary cellular components of the aorta [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], and pathological changes in VSMCs are closely related to various aortic diseases [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. VSMC loss leads to pathological aortic remodeling, with phenotypic changes in response to vascular injury or disease [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our study observed significant VSMC reduction in BAPN-treated mice, with decreased α-SMA and SM22α levels. BBR effectively maintained VSMCs content and inhibited the phenotypic switch from contractile to synthetic type, as indicated by decreased OPN level. Increased VSMC proliferation and migration contribute to TAD development [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], and our data showed that BBR suppressed Ang-II-induced VSMC conditions, thereby potentially ameliorating the development of TAD. Apoptosis, regulated by extrinsic or intrinsic apoptotic pathways, is crucial in various cellular processes [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], with the Bax/Bcl2 ratio serving as a key indicator [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Our TUNEL assay results demonstrated that BBR regulates VSMC apoptosis, effectively attenuating Ang-II-induced apoptosis, by downregulating Bax and upregulating Bcl2. These results suggest BBR plays a protective role in AD development by inhibiting VSMC phenotypic switching and loss.\u003c/p\u003e \u003cp\u003eThe PI3K/AKT signaling pathway is critical in blocking VSMC apoptosis [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In the presence of increased AKT and PI3K expression induced by BAPN, but with inhibited activation, BBR may counteract the adverse effects by decreasing PI3K and AKT expression while promoting their phosphorylation, thereby stabilizing the vascular wall and reducing the risk of aortic dissection formation. Additionally, the PI3K/AKT pathway is closely linked to inflammatory responses and oxidative stress[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. BBR may exert a protective effect against AD by mitigating vascular inflammation and oxidative stress through the activation of PI3K/AKT pathway.\u003c/p\u003e \u003cp\u003eOverall, the present work provides a comprehensive mechanism of BBR preventing AD progression through multiple targets and complex pathway. However, this study raises several issues for future investigation. The roles of VSMCs, endothelial dysfunction, and macrophage and inflammatory cell infiltration into the injured arterial wall are critical contributors to AD formation and development, warranting further research. Additionally, while we focus on the PI3K/AKT pathway, other mechanisms involved in BBR\u0026rsquo;s protective effects require exploration. Finally, the impact of BBR on other AD models, such as Marfan syndrom and Loeys-Dietz syndrome, should be investigated, despite these being beyond the scope of the current study.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eBBR treatment significantly prevents the progression of AD, largely through PI3K/AKT pathway activation, reduction of oxidative stress, decreased inflammation and apoptosis, inhibition of phenotypic transformation, and improvement of ECM degradation. These results provide new insights for early medical intervention in AD patients.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAortic Dissection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTAD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ethoracic aortic dissection\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eECM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eExtracellular Matrix\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBBR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBerberine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVSMCs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eVascular Smooth Muscle Cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMMPs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMatrix Metalloproteinases\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSOD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuperoxide Dismutase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMDA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMalondialdehyde\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCOL-I\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCollagen Type I\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCOL-III\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCollagen Type III\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eα-SMA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAlpha-Smooth Muscle Actin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSM22α\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSmooth Muscle 22 Alpha\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBAPN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eβ-Aminopropionitrile\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eImmunofluorescence\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHematoxylin and Eosin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEVG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eElastic Van Gieson\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efibronectin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAng-II\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eangiotensin-II\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Academic Committee of Southwest Minzu University(2023MDLS059).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTongyi Wu\u003c/strong\u003e: Writing-original draft, Software, Methodology, Investigation, Formal analysis, Data curation. \u003cstrong\u003eRu Chen\u003c/strong\u003e: Writing-original draft, Writing \u0026ndash; review \u0026amp; editing, Investigation, Conceptualization. \u003cstrong\u003eWuyi Ban\u003c/strong\u003e:Investigation. \u003cstrong\u003eChang Ren\u003c/strong\u003e:Data curation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSiwei Bi\u003c/strong\u003e: Writing-review\u0026amp;editing. \u003cstrong\u003eJun Gu\u003c/strong\u003e: Formal analysis. \u003cstrong\u003eZangjia Geng\u003c/strong\u003e: Formal analysis. \u003cstrong\u003eLei Song\u003c/strong\u003e:Writing-review \u0026amp; editing, Supervision, Conceptualization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode Availability\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWang K, Zhao J, Zhang W, et al. Resveratrol Attenuates Aortic Dissection by Increasing Endothelial Barrier Function Through the SIRT1 Pathway. J Cardiovasc Pharmacol. 2020;76(1):86\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/fjc.0000000000000837\u003c/span\u003e\u003cspan address=\"10.1097/fjc.0000000000000837\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePape LA, Awais M, Woznicki EM, et al. Presentation, Diagnosis, and Outcomes of Acute Aortic Dissection: 17-Year Trends From the International Registry of Acute Aortic Dissection. J Am Coll Cardiol. 2015;66(4):350\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jacc.2015.05.029\u003c/span\u003e\u003cspan address=\"10.1016/j.jacc.2015.05.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu D, Shen YH, Russell L, Coselli JS, LeMaire SA. Molecular mechanisms of thoracic aortic dissection. J Surg Res. 2013;184(2):907\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jss.2013.06.007\u003c/span\u003e\u003cspan address=\"10.1016/j.jss.2013.06.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui N, Hu M, Khalil RA. Biochemical and Biological Attributes of Matrix Metalloproteinases. Prog Mol Biol Transl Sci. 2017;147:1\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/bs.pmbts.2017.02.005\u003c/span\u003e\u003cspan address=\"10.1016/bs.pmbts.2017.02.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManabe T, Imoto K, Uchida K, Doi C, Takanashi Y. Decreased tissue inhibitor of metalloproteinase-2/matrix metalloproteinase ratio in the acute phase of aortic dissection. Surg Today. 2004;34(3):220\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00595-003-2683-3\u003c/span\u003e\u003cspan address=\"10.1007/s00595-003-2683-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang YY, Li LY, Jiao XL, et al. Intermittent Hypoxia Alleviates β-Aminopropionitrile Monofumarate Induced Thoracic Aortic Dissection in C57BL/6 Mice. Eur J Vasc Endovasc Surg. 2020;59(6):1000\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejvs.2019.10.014\u003c/span\u003e\u003cspan address=\"10.1016/j.ejvs.2019.10.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColgan SP, Taylor CT. Hypoxia: an alarm signal during intestinal inflammation. Nat Rev Gastroenterol Hepatol. 2010;7(5):281\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrgastro.2010.39\u003c/span\u003e\u003cspan address=\"10.1038/nrgastro.2010.39\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang SY, Dong YQ, Wang P, et al. Adipocyte-derived Lysophosphatidylcholine Activates Adipocyte and Adipose Tissue Macrophage Nod-Like Receptor Protein 3 Inflammasomes Mediating Homocysteine-Induced Insulin Resistance. EBioMedicine. 2018;31:202\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ebiom.2018.04.022\u003c/span\u003e\u003cspan address=\"10.1016/j.ebiom.2018.04.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao T, Zhang L, Huang Y, et al. Sestrin2 increases in aortas and plasma from aortic dissection patients and alleviates angiotensin II-induced smooth muscle cell apoptosis via the Nrf2 pathway. Life Sci. 2019;218:132\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lfs.2018.12.043\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2018.12.043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng X, Sureda A, Jafari S, et al. Berberine in Cardiovascular and Metabolic Diseases: From Mechanisms to Therapeutics. Theranostics. 2019;9(7):1923\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/thno.30787\u003c/span\u003e\u003cspan address=\"10.7150/thno.30787\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOch A, Och M, Nowak R, Podg\u0026oacute;rska D, Podg\u0026oacute;rski R. Berberine, a Herbal Metabolite in the Metabolic Syndrome: The Risk Factors, Course, and Consequences of the Disease. Molecules. 2022;27(4). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/molecules27041351\u003c/span\u003e\u003cspan address=\"10.3390/molecules27041351\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAi X, Yu P, Peng L, et al. Berberine: A Review of its Pharmacokinetics Properties and Therapeutic Potentials in Diverse Vascular Diseases. Front Pharmacol. 2021;12:762654. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2021.762654\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2021.762654\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu SJ, Yin CX, Ding MC, et al. Berberine suppresses in vitro migration of human aortic smooth muscle cells through the inhibitions of MMP-2/9, u-PA, AP-1, and NF-κB. BMB Rep. 2014;47(7):388\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5483/bmbrep.2014.47.7.186\u003c/span\u003e\u003cspan address=\"10.5483/bmbrep.2014.47.7.186\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen P, Wu D, Appel R, et al. Targeting the NLRP3 Inflammasome With Inhibitor MCC950 Prevents Aortic Aneurysms and Dissections in Mice. J Am Heart Assoc. 2020;9(7):e014044. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/jaha.119.014044\u003c/span\u003e\u003cspan address=\"10.1161/jaha.119.014044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark HS, Quan KT, Han JH, et al. Rubiarbonone C inhibits platelet-derived growth factor-induced proliferation and migration of vascular smooth muscle cells through the focal adhesion kinase, MAPK and STAT3 Tyr(705) signalling pathways. Br J Pharmacol. 2017;174(22):4140\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/bph.13986\u003c/span\u003e\u003cspan address=\"10.1111/bph.13986\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore CL, Savenka AV, Basnakian AG. TUNEL Assay: A Powerful Tool for Kidney Injury Evaluation. Int J Mol Sci. 2021;22(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms22010412\u003c/span\u003e\u003cspan address=\"10.3390/ijms22010412\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin CJ, Lin CY, Stitziel NO. Genetics of the extracellular matrix in aortic aneurysmal diseases. Matrix Biol. 2018;71\u0026ndash;72:128\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.matbio.2018.04.005\u003c/span\u003e\u003cspan address=\"10.1016/j.matbio.2018.04.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTieu BC, Lee C, Sun H, et al. An adventitial IL-6/MCP1 amplification loop accelerates macrophage-mediated vascular inflammation leading to aortic dissection in mice. J Clin Invest. 2009;119(12):3637\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/jci38308\u003c/span\u003e\u003cspan address=\"10.1172/jci38308\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng HQ, Rong JB, Ye FM, et al. Induction of thoracic aortic dissection: a mini-review of beta-aminopropionitrile-related mouse models. J Zhejiang Univ Sci B. 2020;21(8):603\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1631/jzus.B2000022\u003c/span\u003e\u003cspan address=\"10.1631/jzus.B2000022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen W, Liu Y, Wang X, et al. beta-Aminopropionitrile monofumarate induces thoracic aortic dissection in C57BL/6 mice. Sci Rep. 2016;6:28149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep28149\u003c/span\u003e\u003cspan address=\"10.1038/srep28149\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen W, Liu Y, Wang X, et al. β-Aminopropionitrile monofumarate induces thoracic aortic dissection in C57BL/6 mice. Sci Rep. 2016;6:28149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep28149\u003c/span\u003e\u003cspan address=\"10.1038/srep28149\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe S, Yang N, Lu T, et al. Adamts18 modulates the development of the aortic arch and common carotid artery. iScience. 2021;24(6):102672. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2021.102672\u003c/span\u003e\u003cspan address=\"10.1016/j.isci.2021.102672\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang YY, Li LY, Jiao XL, et al. Intermittent Hypoxia Alleviates beta-Aminopropionitrile Monofumarate Induced Thoracic Aortic Dissection in C57BL/6 Mice. Eur J Vasc Endovasc Surg. 2020;59(6):1000\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejvs.2019.10.014\u003c/span\u003e\u003cspan address=\"10.1016/j.ejvs.2019.10.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarimi A, Milewicz DM. Structure of the Elastin-Contractile Units in the Thoracic Aorta and How Genes That Cause Thoracic Aortic Aneurysms and Dissections Disrupt This Structure. Can J Cardiol. 2016;32(1):26\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cjca.2015.11.004\u003c/span\u003e\u003cspan address=\"10.1016/j.cjca.2015.11.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMilewicz DM, Guo DC, Tran-Fadulu V, et al. Genetic basis of thoracic aortic aneurysms and dissections: focus on smooth muscle cell contractile dysfunction. Annu Rev Genomics Hum Genet. 2008;9:283\u0026ndash;302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.genom.8.080706.092303\u003c/span\u003e\u003cspan address=\"10.1146/annurev.genom.8.080706.092303\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmin M, Pushpakumar S, Muradashvili N, et al. Regulation and involvement of matrix metalloproteinases in vascular diseases. Front Biosci (Landmark Ed). 2016;21(1):89\u0026ndash;118. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2741/4378\u003c/span\u003e\u003cspan address=\"10.2741/4378\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe R, Guo DC, Estrera AL, et al. Characterization of the inflammatory and apoptotic cells in the aortas of patients with ascending thoracic aortic aneurysms and dissections. J Thorac Cardiovasc Surg. 2006;131(3):671\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jtcvs.2005.09.018\u003c/span\u003e\u003cspan address=\"10.1016/j.jtcvs.2005.09.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGavazzi G, Deffert C, Trocme C, et al. NOX1 deficiency protects from aortic dissection in response to angiotensin II. Hypertension. 2007;50(1):189\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/HYPERTENSIONAHA.107.089706\u003c/span\u003e\u003cspan address=\"10.1161/HYPERTENSIONAHA.107.089706\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao M, Liu Z, Bao J, et al. A proteomic study of the aortic media in human thoracic aortic dissection: implication for oxidative stress. J Thorac Cardiovasc Surg. 2008;136(1):65\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jtcvs.2007.11.017\u003c/span\u003e\u003cspan address=\"10.1016/j.jtcvs.2007.11.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. e1-3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao WL, Tan MW, Yuan Y, et al. Brahma-related gene 1 inhibits proliferation and migration of human aortic smooth muscle cells by directly up-regulating Ras-related associated with diabetes in the pathophysiologic processes of aortic dissection. J Thorac Cardiovasc Surg. 2015;150(5):1292\u0026ndash;e3012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jtcvs.2015.08.010\u003c/span\u003e\u003cspan address=\"10.1016/j.jtcvs.2015.08.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLacolley P, Regnault V, Nicoletti A, Li Z, Michel JB. The vascular smooth muscle cell in arterial pathology: a cell that can take on multiple roles. Cardiovasc Res. 2012;95(2):194\u0026ndash;204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cvr/cvs135\u003c/span\u003e\u003cspan address=\"10.1093/cvr/cvs135\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Qian X, Sun X, et al. Liuwei Dihuang, a traditional Chinese medicinal formula, inhibits proliferation and migration of vascular smooth muscle cells via modulation of estrogen receptors. Int J Mol Med. 2018;42(1):31\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ijmm.2018.3622\u003c/span\u003e\u003cspan address=\"10.3892/ijmm.2018.3622\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen K, Li B, Liu Z, et al. GDF11 prevents the formation of thoracic aortic dissection in mice: Promotion of contractile transition of aortic SMCs. J Cell Mol Med. 2021;25(10):4623\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jcmm.16312\u003c/span\u003e\u003cspan address=\"10.1111/jcmm.16312\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH\u0026auml;cker G. The morphology of apoptosis. Cell Tissue Res. 2000;301(1):5\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s004410000193\u003c/span\u003e\u003cspan address=\"10.1007/s004410000193\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu Z, Yang Z, Xu Y, Chen Y, Yu Q. Apoptosis, autophagy, necroptosis, and cancer metastasis. Mol Cancer. 2015;14:48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12943-015-0321-5\u003c/span\u003e\u003cspan address=\"10.1186/s12943-015-0321-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoldoveanu T, Czabotar PE, BAX, BAK. A Coming of Age for the BCL-2 Family Effector Proteins. Cold Spring Harb Perspect Biol. 2020;12(4). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a036319\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a036319\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite GE, Tan TC, John AE, et al. Fractalkine has anti-apoptotic and proliferative effects on human vascular smooth muscle cells via epidermal growth factor receptor signalling. Cardiovasc Res. 2010;85(4):825\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cvr/cvp341\u003c/span\u003e\u003cspan address=\"10.1093/cvr/cvp341\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Huang S, Zhuo B, et al. Comparison of Three Species of Rhubarb in Inhibiting Vascular Endothelial Injury via Regulation of PI3K/AKT/NF-κB Signaling Pathway. Oxid Med Cell Longev. 2022;2022:8979329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2022/8979329\u003c/span\u003e\u003cspan address=\"10.1155/2022/8979329\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Q, Shan P, Li H. Gambogic acid prevents angiotensin II\u0026ndash;induced abdominal aortic aneurysm through inflammatory and oxidative stress dependent targeting the PI3K/Akt/mTOR and NF\u0026ndash;κB signaling pathways. Mol Med Rep. 2019;19(2):1396\u0026ndash;402. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/mmr.2018.9720\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2018.9720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"aortic dissection, BAPN, Berberine, inflammation, oxidative stress, VSMC","lastPublishedDoi":"10.21203/rs.3.rs-5258943/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5258943/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e \u003cp\u003eAortic dissection (AD) represents a critical medical condition characterized by a high mortality rate and limited therapeutic options. The pathogenesis of AD is associated with the extracellular matrix degradation, phenotypic switching and the loss of vascular smooth muscle cells (VSMCs). Berberine (BBR) has demonstrated promising protective effects in various cardiovascular diseases, but its impact on AD and the underlying mechanisms remains unexplored. This study aims to investigate the potential of BBR in reducing the development of AD and preventing the phenotypic transformation of VSMCs, thereby proposing a novel therapeutic strategy for this life-threatening condition.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eC57BL/6J mice and isolated VSMCs were used as \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e models, respectively. An AD mouse model was established through intragastric administration of β-aminopropionitrile monofumarate (BAPN), and VSMC phenotypic transformation was induced by angiotensin II (Ang-II) to assess the preventative effects of BBR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eBBR significantly mitigates AD in a BAPN-induced mouse model by reducing AD incidence from 80\u0026ndash;45% and increasing survival rates from 50\u0026ndash;70%. BBR treatment alleviates aortic dilation and improves aortic morphology, while also attenuating extracellular matrix degradation, as evidenced by reduced collagen type I and fibronectin degradation. Histological and immunohistochemical analyses reveal that BBR diminishes inflammation, as indicated by reduced IL-6 and HIF-1α expression, and mitigates oxidative stress by lowering MDA levels and enhancing SOD activity. Additionally, BBR counteracts VSMC phenotypic transformation and apoptosis, demonstrated by restored contractile protein levels and reduced caspase-3, AKT, and PI3K levels. It also inhibits VSMC proliferation, migration, and MMP expression \u003cem\u003ein vitro\u003c/em\u003e, highlighting its protective role against AD progression.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eBBR exhibits protective effects against BAPN-induced AD in C57BL/6J mice, highlighting its potential as a viable and innovative therapeutic option for preventing AD progression.\u003c/p\u003e","manuscriptTitle":"Berberine prevents the formation of aortic dissection in C57BL/6 mice through the regulation of vascular smooth muscle cell function","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-24 13:59:20","doi":"10.21203/rs.3.rs-5258943/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2b8914cd-0a7b-442a-9d98-6ea9b2d423e3","owner":[],"postedDate":"October 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-12-02T12:19:01+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-24 13:59:20","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5258943","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5258943","identity":"rs-5258943","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.