Pleiotropic Effects of RsmA and RsmE Proteins in Pseudomonas Fluorescens 2P24 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Pleiotropic Effects of RsmA and RsmE Proteins in Pseudomonas Fluorescens 2P24 Yang Zhang, Bo Zhang, Haiyan Wu, Xiaogang Wu, Qing Yan, Li-qun Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-29303/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Jul, 2020 Read the published version in BMC Microbiology → Version 1 posted 10 You are reading this latest preprint version Abstract Background: Pseudomonas fluorescens 2P24 is a rhizosphere bacterium that produces 2,4-diacetyphloroglucinol (2,4-DAPG) as the decisive secondary metabolite to suppress soilborne plant diseases. The biosynthesis of 2,4-DAPG is strictly regulated by the RsmA family proteins RsmA and RsmE. However, mutation of both of rsmA and rsmE genes results in reduced bacterial growth. Results: In this study, we showed that overproduction of 2,4-DAPG in the rsmA rsmE double mutant influenced the growth of strain 2P24. This delay of growth could be partially reversal when the phlD gene was deleted or overexpression of the phlG gene encoding the 2,4-DAPG hydrolase in the rsmA rsmE double mutant. RNA-seq analysis of the rsmA rsmE double mutant revealed that a substantial portion of the P. fluorescens genome was regulated by RsmA family proteins. These genes are involved in the regulation of 2,4-DAPG production, cell motility, carbon metabolism, and type six secretion system. Conclusions: These results suggest that RsmA and RsmE are the important regulators of genes involved in the plant-associated strain 2P24 ecologic fitness and operate a sophisticated mechanism for fine-tuning the concentration of 2,4-DAPG in the cells. General Microbiology Applied & Industrial Microbiology Pseudomonas fluorescens RsmA/RsmE 2 4-DAPG biofilm motility Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Bacteria use a complex interconnecting mechanism to recognize and adapt to changes in their environment and reprogram numerous cellular processes in response to physiological homeostasis. An important element in this complex regulatory network is the Gac/Rsm cascade pathway [ 1 ]. This pathway is conserved in numerous Gram-negative bacteria and mediates the post-transcriptional regulation of diverse genes required for bacterial virulence and metabolism [ 2 ]. These include genes for the expression of extracellular enzymes [ 3 ], carbon storage compounds [ 4 ], motility [ 5 ], the formation of biofilm [ 6 ], and the production of secondary metabolites and virulence factors [ 7 , 8 ]. Signal transduction initially involves the GacS/GacA two-component system which consists of the histidine kinase protein GacS and its cognate response regulator GacA. Upon interaction with unknown signals, the membrane sensor GacS autophosphorylates and activates the GacA by phosphorylation. Phosphorylated GacA positively controls transcription initiation of one or more small non-coding RNAs (sRNA) genes, depending on the bacterial species, such as rsmX , rsmY and rsmZ in Pseudomonas protegens CHA0 [ 9 ]. A conserved upstream activating sequence (UAS) is found to be necessary for GacA protein to activate the expression of these sRNAs [ 10 ]. These sRNAs exhibit high affinity for the CsrA/RsmA family protein. The CsrA/RsmA family protein can inhibit translation or stability of transcripts of its target genes by binding to sites overlapping the SD sequence or ribosome binding sites of target mRNAs, thus influencing ribosome access [ 11 ]. In addition, varying numbers of RsmA orthologs have been described in different bacteria and these proteins exhibit distinct binding affinities to sRNAs and show distinct roles in particular strain [ 12 – 15 ]. P. fluorescens 2P24, a rhizospheric bacterium originally isolated from the take-all decline soil, has been investigated for its ability to produce the secondary metabolite 2,4-diacetylphloroglucinol (2,4-DAPG), which contributes to the protection of various crop plants against soil borne disease caused by many plant pathogens [ 16 ]. The biosynthetic pathway of 2,4-DAPG has been clarified in several Pseudomonas strains. The 2,4-DAPG locus includes the four biosynthetic genes phlACBD that are transcribed as a single operon and is directly involved in the catalytic process of 2,4-DAPG production [ 17 ]. The first step in 2,4-DAPG biosynthesis is the formation of phloroglucinol (PG) from three units of malonyl-coenzyme A (malonyl-CoA) by the type III polyketide synthase PhlD [ 18 ]. The products of phlACB genes are together required for the transacetylation of PG to monoacetylphloroglucinol (MAPG) and then 2,4-DAPG [ 19 ]. Since the high concentration of 2,4-DAPG is toxic to the producing bacterium, biosynthesis of 2,4-DAPG is subtly modulated by complex regulatory networks in response to abiotic and biotic factors, and cell physiological status [ 20 , 21 ]. The phlF and phlH genes, code for the pathway-specific transcriptional regulators of the production of 2,4-DAPG [ 19 , 22 ]. Besides PhlF and PhlH, the Gac/Rsm cascade pathway plays a critical role in the production of 2,4-DAPG [ 1 ]. In P. fluorescens 2P24, the RsmA and RsmE proteins directly repress the translation of phlACBD mRNA, whereas four sRNAs RsmX, RsmX1, RsmY, and RsmZ derepress the translation of phlACBD mRNA by sequestering the RsmA and RsmE proteins, thereby inducing the production of 2,4-DAPG [ 15 ]. In this study, we found that RsmA and RsmE proteins contribute to bacterial growth advantages in P. fluorescens 2P24. Deletion of both of rsmA and rsmE genes could impair growth rate and cell density, whereas the growth rate and cell density was partially restored in the rsmA rsmE phlD triple mutant compared with that of the wild-type strain, suggesting that high levels of 2,4-DAPG in the cells could influence the growth of the rsmA rsmE double mutant. In addition, we demonstrated the role of the RsmA family proteins on type six secretion system (T6SS), swimming motility, and biofilm formation in P. fluorescens . Results High concentration of 2,4-DAPG in the cells impaired the growth of the rsmA rsmE double mutant Previous study showed that the growth of the rsmA rsmE double mutant was severely impaired compared with the wild-type strain 2P24. Since high levels of 2,4-DAPG was toxic to the producing bacterium [ 20 ], to assess if the growth of the rsmA rsmE double mutant was impaired by the overdose of 2,4-DAPG in the cells, we overexpressed the phlG gene which encoding the 2,4-DAPG hydrolase and then measured the growth of 2P24 and its derivatives. As expected, introduction of the phlG gene cloned in the pRK415 plasmid (p415-phlG), into the rsmA rsmE double mutant, resulted in repression of 2,4-DAPG production (Fig. 1 A). The growth rate of the rsmA rsmE double mutant with p415-phlG could be partially restored to that of the wild-type strain 2P24 (Fig. 1 B). Furthermore, by deleting the phlD gene in the rsmA rsmE double mutant, the growth curve of the rsmA rsmE phlD triple mutant was significantly improved compared to that of the rsmA rsmE double mutant although was slightly lower compared to the wild-type strain 2P24 or the phlD mutant (Fig. 1 C). Thus, these data suggested that overproduction of 2,4-DAPG contributes to the reduced growth of the rsmA rsmE double mutant. RNA sequencing reveals the P. fluorescens RsmA and RsmE regulon. To insight into the role of RsmA and RsmE in P. fluorescens , RNA sequencing (RNA-seq) was performed to define the RsmA and RsmE regulon of P. fluorescens . The genes that are significantly downregulated or upregulated are summarized in Table S1 & S2. We defined the genes that showed a > 2-fold change of expression as differentially expressed genes (DEGs). In the rsmA rsmE double mutant, 621 genes were upregulated and 304 genes were downregulated compared to the wild-type strain (Table S1 & S2). Based on the RNA-seq results, we observed that the expression of genes in phl operon ( phlACBD ) was increased by 145 to 587-fold, which was consistent with that of the phlA′ - ′lacZ translational fusion assay [ 15 ]. Many regulatory elements, including Gcd [ 23 ], Hfq [ 24 ], PsrA [ 25 ], RpoS [ 26 ], and PhlG which directly or indirectly influence 2,4-DAPG biosynthesis, were regulated by the RsmA and RsmE. As expected, transcriptional fusion assays showed that both of the expression of phlG and phlF were significantly increased in the rsmA rsmE double mutant compared with that in the wild-type strain (Fig. 2 ). These results indicated a sophisticated role for the RsmA family proteins RsmA and RsmE in the production of 2,4-DAPG in P. fluorescens . Among the genes upregulated in the rsmA rsmE double mutant, 21 encoded proteins that are associate with type six secretion system (T6SS), which is known as an important mechanism in interactions and pathogenesis against bacterial and eukaryotic cells. In addition, the RNA-seq data revealed that a significant number of genes influenced by RsmA and RsmE were involved in fatty acid metabolism ( fadA , fadB , fabG , fadH , psrA ), energy and carbon metabolism ( glpD , zwf , fahA , gcd , gltK ), and cell motility ( flaG , fliT , fliS , motA , motC , flgE ). Collectively, our data suggested that RsmA and RsmE are the pleiotropic regulators of secondary metabolism, cell motility, and other physiological processes. RsmA and RsmE negatively regulated the Type six secretion system (T6SS) Bacterial T6SS plays an important role in both virulence and inter-bacterial competition and provide advantages to T6SS active strains in polymicrobial habitats [ 27 ]. Since many genes related to T6SS were up-regulated in the rsmA rsmE double mutant, we assayed the effect of the RsmA family protein on the production of T6SS structure protein Hcp1. Consistent with the RNA-seq data in the rsmA rsmE double mutant, Western blot analysis showed that this mutant produced higher amount of the Hcp1 protein than wild-type strain P. fluorescens 2P24 (Fig. 3 A). Previously studies showed that the T6SSs could inject the T6SS toxins into bacterial preys [ 28 ]. We then performed the antibacterial assays using E. coli carrying the plasmid pHSG299 as prey and P. fluorescens 2P24 or its derivatives as predators. Similar to the retS mutant which triggered the T6SS [ 29 ], The rsmA rsmE double mutant caused a significant increase in survival of E. coli (Fig. 3 B). Taken together, our results indicate that RsmA and RsmE repress the T6SS activity and play an important role for the inter-bacterial competition. The effect of RsmA and RsmE on cell motility and biofilm formation Analysis of the rsmA rsmE double mutant RNA-seq data showed that expression of 20 genes involved in flagella biosynthesis and assembly was significantly changed, indicated a decrease in cell motility. To confirm this result, the motility of strain 2P24 and its derivatives was measured. Compared to the wild-type strain, the swimming motility was reduced by 72% in the rsmA rsmE double mutant (Fig. 4 A). Motility is crucial in cell-to-cell adherence and attachment in early biofilm development. Whereas our data revealed a positive influence of the RsmA family proteins on biofilm formation (Fig. 4 B). All observed phenotypes in the rsmA rsmE double mutant could be partly complemented by introducing the plasmid pBBR-rsmE (Fig. 4 ). Taken together, these results demonstrated that RsmA and RsmE are crucial for cell motility and biofilm formation in strain 2P24. Discussion Plant growth-promoting rhizobacteria could antagonize plant pathogenic fungi by the production of antimicrobial secondary metabolites, such as 2,4-DAPG. Although 2,4-DAPG has antifungal, antibacterial, anthelminthic, and phytotoxic properties, it has toxicity to the producing bacterium at high concentrations. In the present study, we revealed that regulation of the production of 2,4-DAPG by the RsmA family proteins RsmA and RsmE contributes to bacterial growth advantages. The RsmA and RsmE proteins play a critical role for the production of 2,4-DAPG [ 1 ]. In P. fluorescens 2P24, RsmA and RsmE inhibited the expression of phlACBD at the translation level [ 15 ]. Varying numbers of RsmA orthologs have been identified in different Pseudomonas sp. [ 12 , 14 , 15 ]. The defects in the growth of the rsm mutants could be found in P. putida and P. syringae pv. tomato [ 12 , 30 ]. Although no evidence showed that deletion of both of rsmA and rsmE genes influenced the growth of P. protegens CHA0 which could produce several antibiotics, including 2,4-DAPG [ 31 ], our data showed that the defect of bacterial growth was observed in the rsmA rsmE double mutant when compared with the wild-type strain 2P24 [ 15 ]. Interestingly, overexpression of phlG gene or deletion of phlD gene in the rsmA rsmE double mutant partly restored the growth curve of strain 2P24 (Fig. 1 ). Transcriptional fusion assays further suggested that the expression of phlG and phlF genes were negatively regulated by RsmA and RsmE (Fig. 2 ), indicating that RsmA and RsmE could balance the concentration of 2,4-DAPG in the cells by fine-tuning the role of multiple regulators of the production of 2,4-DAPG. The biosynthesis of 2,4-DAPG leads to lower bacterial growth rates due to the increased metabolic costs in the cells [ 22 ]. Deletion of phlD gene in the rsmA rsmE double mutant could not completely restore the growth curve of strain 2P24 (Fig. 1 ), whereas the deficiency of the growth could be restored when the rsmA rsmE double mutant was growth in minimal medium with glucose as a carbon source [ 15 ], indicating that RsmA and RsmE play an important role in central carbohydrate metabolism. Our RNA-seq analysis supported this hypothesis which identified several genes that are known to be involved in fatty acid metabolism, carbon metabolism, and pleiotropic molecule cyclic diguanylate production (Table S1). In addition, our data suggested that RsmA and RsmE are the global regulators in a complex regulatory network that provides advantages to strain 2P24 in polymicrobial environments. For instance, inactivation of both of rsmA and rsmE increased the levels of Hcp1 and provided a growth advantage against E. coli in P. fluoresces 2P24 (Fig. 3 ). These results were in agreement with the previously proposed role of rsmA in affecting tssA1 , tse6 , and tsi4 [ 28 ]. Together, our data suggested that RsmA and RsmE might play a critical role in fine-tuning the concentration of 2,4-DAPG to maintain the metabolic homeostasis and improve the competitive advantages of 2P24 against other microbes living in or nearby the rhizosphere. We also identified 20 genes involved in flagella biosynthesis and assembly by genome-wide expression analysis (Table S1B). According to these observations, mutation in the rsmA and rsmE genes resulted in decreasing motility (Fig. 4 A). Bacterial motility and biofilm formation are inversely regulated in Gram-negative bacteria [ 32 ]. Interestingly, the results of this work strongly suggest that RsmA and RsmE positively affected biofilm formation (Fig. 4 B). Previous study showed that bacterial secondary messenger cyclic diguanylate (c-di-GMP) influences biofilm development [ 33 ]. Many genes involved in c-di-GMP turn over were regulated by RsmA and RsmE (Table S1). We speculate that RsmA and RsmE may interact with the c-di-GMP signaling pathway to regulate biofilm formation in P. fluorescens . In summary, these results demonstrated that several important intracellular activities and behaviors were regulated by the RsmA family proteins RsmA and RsmE in plant-associated P. fluorescens 2P24. By fine-tuning the concentration of 2,4-DAPG and carbon metabolism in the cells, RsmA and RsmE could contribute to growth advantages of strain 2P24. Conclusions The plant-associated P. fluorescens 2P24 can colonize root of many crops and protect them from infection by phytopathogens. The RsmA and RsmE proteins play an important role in regulating the production of antibiotic compound 2,4-DAPG, which is necessary for its biocontrol traits. In this study, our data showed that the regulation of 2,4-DAPG by RsmA and RsmE was complicated and involved in many specific elements. In addition, several important intracellular activities and behaviors, such as growth curve, carbon metanT6SS, the formation of biofilm, and motility were regulated by RsmA and RsmE in strain 2P24. These findings provide a new understanding of the regulatory role of RsmA and RsmE in P. fluorescens . Methods Bacterial strains, plasmids, and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1 . Escherichia coli was routinely grown in lysogeny broth (LB) medium at 37 ℃. Unless otherwise indicated, P. fluorescens 2P24 and its derivatives were grown in LB medium, King’s B medium (KB) [ 34 ], or ABM medium [ 35 ] at 28 ℃. The concentration of antibiotics was added as follows: ampicillin (50 µg/ml), kanamycin (50 µg/ml), tetracycline (20 µg/ml). Table 1 bacterial strains, plasmids, and oligonucletoides used in this study Strains, plasmids or oligonucletoide Relevant characteristics Reference or source Strains Pseudomonas fluorescens 2P24 Wild-type, Ap r 16 PM206 In-frame deletion of retS , Ap r 44 WPM30 In-frame deletion of phlD , Ap r This work WPM12 Double deletion of rsmA and rsmE , Ap r 15 WPM31 Triple deletion of rsmA , rsmE , and phlD , Ap r This work E. coli DH5α supE44 lacU 169 ( φ80lacZ M15) hsdR 17 recA 1 endA 1 gyrA 96 thi -1 relA 1 45 Plasmids p2P24Km Sucrose-based counter-selectable plasmid, Km r 36 p2P24Km-phlD Plasmid p2P24Km carrying a deleted phlD gene, Km r This work p970Km-phlFp phlF - lacZ transcriptional fusion, Km r This work p970Km-phlGp phlG - lacZ transcriptional fusion, Km r This work p415-phlG pRK415 containing the phlG gene, Tet r 22 pHSG299 Cloning vector, Km r TaKaRa Oligonucletoides Sequence (5′-′3) a Comment phlD-F1-EcoRI AA GAATTC ATGGCGATGGTGCGCCT phlD null mutant construction phlD-R1-680 GAATTTTCCGTCCGCCTGTATGGAACATGAAACCCGTGCACGATGTCACA phlD-F2-700 TGTGACATCGTGCACGGGTTTCATGTTCCATACAGGCCGGACGGAAAATTC phlD-R2-SalI AA GTCGAC CAGGCTGGTGATCAATG phlG-PFBamHI TA GGATCC AGTTGCA CCAACCGAGC phlG-lacZ transcriptional fusion phlG-PRBamHI AT GGATCC GGCACGCTGATCTTCGAGC phlF-PFBamHI AC GGATCC AGATCTTAAGGGTTTCTAT phlF - lacZ transcriptional fusion phlF-PRBamHI GT GGATCC ATAAGGATTGGTGCAG * Ap, ampicillin; Km, kanamycin; Tet, tetracycline. a Restriction site inserted in the primer for the cloning strategy are underlined. Mutant construction The phlD in-frame deletion mutant was constructed by allelic exchange mutagenesis [ 36 ]. Briefly, upstream and downstream fragments flanking the phlD gene were amplified by PCR using primers phlD-F1-EcoRI/phlD-R1-680 and phlD-F2-700/phlD-R2-SalI, respectively. The upstream and downstream PCR products were used as templates in fusion PCR with primers phlD-F1-EcoRI/phlD-R2-SalI. Subsequently, the fusing fragment was cloned into the suicide vector p2P24Km [ 36 ]. The resulting plasmid p2P24-phlD was introduced into strain 2P24 and the rsmA rsmE double mutant by electroporation and double-crossover recombination events were selected [ 37 ]. Substitution was confirmed by PCR and sequencing. RNA-seq analysis To test the effect of the rsmA and rsmE genes on the transcriptome in P. fluorescens 2P24, cells were cultured to early stationary phase (OD 600 = 1.0) in LB medium. Total RNA was conducted using the RNeasy minikit (Qiagen). The Ambion Turbo DNA-free kit was applied to remove contaminant DNA. After removal of rRNA by using the Ribo-Zero rRNA removal kit (Illumina), mRNA was used to generate the cDNA library according to NEBNext UltraTM II RNA Library Prep Kit, which was then sequenced using an Illumina HiSeq 2500 platform. High-quality reads were aligned to the P. fluorescens 2P24 genome (GenBank accession no. CP025542). From the resulting alignments, SAMtools version 1.6 [ 38 ] was applied to sort the bam file. The differentially expressed genes were identified by performing Cuffdiff version 2.2.1 [ 39 ] with a p value smaller than 1e-5. Each sample in the RNA-seq was repeated three times. Construction of the transcriptional lacZ fusion and measurements of β-galactosidase activity To construct the phlF - lacZ and phlG - lacZ transcriptional fusions, a 700-bp DNA fragment upstream of phlF and a 540-bp fragment upstream of phlG were cloned separately into pRG970Km [ 24 ], ahead of a promoterless lacZ gene, to gain p970Km-phlFp and p970Km-phlGp, respectively. The primers used are listed in Table 1 . S trains carry the lacZ transcriptional fusions were grown in LB medium with agitation at 28 ℃. The bacterial cells were collected by centrifugation and the β-galactosidase activity was measured using the method as reported previously [ 40 ]. Quantification of 2,4-DAPG Strain 2P24 and its derivatives were grown in 20 ml KBG (KB broth supplemented with 2% glucose) at 28 ℃ for 48 h. 2,4-DAPG was extracted from culture supernatant and quantitatively analyzed according to the method described previously [ 41 ]. Swimming motility assay Overnight LB culture was inoculated, and transferred at 1: 1,000 to 2 ml fresh LB medium, and then grown at 28 ℃ until it reached an OD600 of 0.8. Two microliters of the cultures were spotted on soft LB plates (0.3% agar). The plates were inoculated at 28 ℃ for 24 h. Biofilm formation assay A biofilm detection experiment was performed as reported previously [ 42 ]. In brief, overnight bacterial culture was transferred to a 2-ml EP tube containing 1 ml LB medium at an OD 600 of 0.5 and cultured statically at 28 ℃ for 2 d. Crystal violet (0.1%) was used to stain biofilm adhered to the tubes for 15 min. The tubes were washed gently three times with ddH 2 O, and the remaining crystal violet was fully dissolved in 200 µl of 95% ethanol and the absorbance was detected at 570 nm. Western blot analysis P. fluorescens cells were grown in LB at 28 ℃ for 12 h and 1-ml samples were taken. Cells were then collected by centrifugation, re-suspended in PBS buffer, and lysed by sonication. The protein in crude lysates was quantified using the Bradford protein assay (Bio-Rad). Samples were boiled before being loaded onto 12% sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gels. Proteins were then transferred onto a polyvinylidene fluoride membrane (PVDF) (Millipore). Blots were washed with PBS containing 0.05% Tween-20 and probed with an anti-Hcp1 antibody (1:2,000). Anti-RNA polymerase monoclonal antibody (1:2,000) (Neoclone) was used as a control. Signals were then developed using the chemiluminescence detection kit (Thermo Fisher). T6SS competition assays Competition assays were performed as previously described [ 43 ]. Overnight bacterial cultures were adjusted to OD 600 of 1 in PBS solution and mixed in a 1:1 ratio [ P. fluorescens - E. coli (pHSG299) as prey]. Bacteria were spotted on LB agar plates to co-culture at 28 ℃ for 5 h. The competition was then quantified by counting colony-forming units on antibiotic selection. Statistical analysis Data were tested for normality and analyzed using unpaired Student’s t test. Asterisks indicated P values ( * , P < 0.05; ** , P < 0.01), and results were presented as the mean standard deviation. Each experiment was performed three times with similar results. Abbreviations 2,4-DAPG: 2,4-diacetylphloroglucinol; small non-coding RNA: sRNA; upstream activating sequence: UAS; phlotoglucinol: PG; monoacetylphloroglucinol: MAPG; type six secretion system: T6SS; RNA sequencing: RNA-seq; differentially expressed genes: DEGs; cyclic diguanylate: c-di-GMP Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials The genome sequence of Pseudomonas fluorescens 2P24 has been submitted to GenBank with accession number CP025542. The datasets used and/or analyzed during this study available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This project was supported by grants from the Chinese National Natural Science Foundation (31760533), the National Key Research and Development Program of China (2017YFD02011083), the Science and Technology Major Project of Guangxi (AA17204041), and the Natural Science Foundation of Guangxi (2017GXNSFAA198341). Author’s contributions XG, QY and LQZ designed the project. YZ, BZ, and XG carried out the experiments. YZ, BZ, HW, QY and XG participated in the data analysis and wrote the manuscript. All authors read and approved the final manuscript. Acknowledgments We thank Dr. Joseph Mougous for providing the Hcp1 antibody and Dr. Ching-Hong Yang for his thoughtful suggestions about the project. References Haas, D., Défago, G., 2005. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat. Rev. Microbiol. 3, 307-319. Heeb, S., Haas, D., 2001. Regulatory roles of the GacS/GacA two-component system in plant-associated and other gram-negative bacteria. Mol. Plant Microbe Interact. 14, 1351-1363. Zuber, S., Carruthers, F., Keel, C., Mattart, A., Blumer, C., Pessi, G., et al., 2003. GacS sensor domains pertinent to the regulation of exoproduct formation and to the biocontrol potential of Pseudomonas fluorescens CHA0. Mol. Plant Microbe Interact. 16, 634-644. Romeo, T., Gong, M., Liu, M.Y., Brun-Zinkernagel, A.M., 1993. Identification and molecular characterization of csrA , a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J. Bacteriol. 175, 4744-4755. Wei, B.L., Brun-Zinkernagel, A.M., Simecka, J.W., Prüss, B.M., Babitzke, P., Romeo, T., 2001. Positive regulation of motility and flhDC expression by the RNA-binding protein CsrA of Escherichia coli . Mol Microbiol. 40, 245-256. Brencic, A., Lory, S., 2009. Determination of the regulon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA. Mol Microbiol. 72, 612-632. Blumer, C., Heeb, S., Pessi, G., Haas, D., 1999. Global GacA-steered control of cyanide and exoprotease production in Pseudomonas fluorescens involves specific ribosome binding sites. Proc. Natl. Acad. Sci. U. S. A. 96, 14073-14078. Pessi, G., Williams, F., Hindle, Z., Heurlier, K., Holden, M.T.G., Cámara, M., et al., 2001. The global posttranscriptional regulator RsmA modulates production of virulence determinants and N -acylhomoserine lactones in Pseudomonas aeruginosa . J. Bacteriol. 187, 276-285. Kay, E., Dubuis, C., Haas, D., 2005. Three small RNAs jointly ensure secondary metabolism and biocontrol in Pseudomonas fluorescens CHA0. Proc. Natl. Acad. Sci. U. S. A. 102, 17136-17141. Kay, E., Humair, B., Denervaud, V., Riedel, K, Spahr, S., Eberl, L., et al., 2006. Two-GacA-dependent small RNAs modulate the quorum-sensing response in Pseudomonas aeruginosa . J. Bacteriol. 188, 6026-6033. Lapouge, K., Schubert, M., Allain, F.H.-T. Haas, D., 2008. Gac/Rsm signal transduction pathway of g -proteobacteria: from RNA recognition to regulation of social behaviour. Mol. Microbiol. 67, 241-253. Huertas-Rosales, Ó, Ramos-González, M.I., Espinosa-Urgel, M., 2016. Self-regulation and interplay of Rsm family proteins modulate the lifestyle of Pseudomonas putida . Appl. Environ. Microbiol. 82, 5673-5686. Morris, E.R., Hall, G., Li, C., Heeb, S., Kulkarni, R.V., Lovelock, K. et al., 2013. Structural rearrangement in an RsmA/CsrA ortholog of Pseudomonas aeruginosa creates a dimeric RNA-binding protein, RsmN. Structure. 21, 1659-1671. Ferreiro, M.D., Nogales, J., Farias, G.A., Olmedilla, A., Sanjuán, J., Gallegos, M.T. 2018. Multiple CrsA proteins control key virulence traits in Pseudomonas syringae pv. tomato DC3000. Mol. Plant Microbe Interact. 31, 525-536. Zhang, Y., Zhang, B. Wu, X., Zhang, L.Q., 2020. Characterization the role of GacA-dependent small RNAs and RsmA family proteins on 2,4-diacetylphloroglucinol production in Pseudomonas fluorescens 2P24. Microbiol. Res. 233, 126391. Wei, H.L., Wang, Y., Zhang, L. Q., Tang, W. H., 2004. Identification and characterization of biocontrol bacterial strain 2P24 and CPF-10. Acta Phytopathol. Sin. 34, 80-85. Bangera, M.G., Thomashow, L.S., 1999. Identification and characterization of a gene cluster for synthesis of the polyketide antibiotic 2,4-diacetylphloroglucinol from Pseudomonas fluorescens Q2-87. J. Bacteriol . 181, 3155-3163. Zha, W., Rubin-Pitel, S.B., Zhao, H., 2006. Characterization of the substrate specificity of PhlD: a type III polyketide synthase from Pseudomonas fluorescens . J. Biol. Chem. 281, 32036-32047. Schnider-Keel, U., Seematter, A., Maurhofer, M., Blumer, C., Duffy, B., Gigot-Bonnefoy, C., et al. 2000. Autoinduction of 2,4-diacetylphloroglucinol biosynthesis in the biocontrol agent Pseudomonas fluorescens CHA0 and repression by the bacterial metabolites salicylate and pyoluteorin. J. Bacteriol. 182, 1215-1225. Abbas, A., McGuire, J.E., Crwoley, D., Baysse, C., Dow, M., O′Gara. F., 2004. The putative permease PhlE of Pseudomonas fluorescens F113 has a role in 2,4-diacetylphloroglucinol resistance and in general stress tolerance. Microbiology. 150, 2443-2450. Haas, D., Keel, C., 2003. Regulation of antibiotic production in root-colonizing Pseudomonas spp. and relevance for biological control of plant disease. Annu. Rev. Phytopathol. 41, 117-153. Yan, X., Yang, R., Zhao, R.X., Han, J.T., Jia, W.J., Li, D.Y., et al ., 2016. Transcriptional regulator PhlH modulates 2,4-diacetylphloroglucinol biosynthesis in response to the biosynthetic intermediate and end product. Appl. Environ. Microbiol. 83, e01419-17. Zhang, B., Zhao, H, Wu, X., Zhang, L.Q., 2020. The oxidoreductasee DsbA1 negatively influences 2,4-diacetylphloroglucinol biosynthesis by interfering the function of Gcd in Pseudomonas fluorescens 2P24. BMC Microbiol. 20, 39. Wu, X.G., Duan, H.M., Tian, T., Yao, N., Zhou, H.Y., Zhang, L.Q., 2010. Effect of the hfq gene on 2,4-diacetylphloroglucinol production and the PcoI/PcoR quorum-sensing system in Pseudomonas fluorescens 2P24. FEMS Microbiol. Lett. 309, 16-24. Wu, X., Liu, J., Zhang, W., Zhang, L.Q., 2012. Multiple-level regulation of 2,4-diacetylphloroglucinol production by the sigma regulator PsrA in Pseudomonas fluorescens 2P24. PloS ONE. e50149. Yan, Q., Wu, X.G., Wei, H.L., Wang, H.M., Zhang, L.Q., 2009. Differential control of the PcoI/PcoR quorum-sensing system in Pseudomonas fluorescens 2P24 by sigma factor RpoS and the GacS/GacA two-component regulatory system. Microbiol. Res. 164, 18-26. Bernal, P., Allsopp, L.P., Filloux, A., Llamas, M.A., 2017. The Pseudomonas putida T6SS is a plant warden against phytopathogens. ISME J. 11, 972-987. Allsopp, L.P., Wood, T.E., Howard, S.A., Maggiorelli, F., Nolan, L.M., Wettstadt, S., et al., 2017. RsmA and AmrZ orchestrate the assembly of all three type VI secretion systems in Pseudomonas aeruginosa . Proc. Natl. Acad. Sci. U. S. A. 114, 7707-7712. Hood, R.D., Singh, P., Hsu, F., Güvener, T., Carl, M.A., Trinidad, R.R.S., et al., 2010. A type VI secretion system of Pseudomonas aeruginosa targets a toxin to bacteria. Cell Host Microbe. 7, 25-37. Ge, Y., Lee, J.H., Liu, J., Yang, H.-W., Tian, Y., Hu, B., et al., 2019. Homologues of the RNA binding protein RsmA in Pseudomonas syringae pv. tomato DC3000 exhibit distinct binding affinities with non-coding small RNAs and have distinct roles in virulence. Mol. Plant Pathol. 20, 1217-1236. Reimmann, C., Valverde, C., Kay, E., Haas, D., 2005. Posttranscriptional repression of GacS/GacA-controlled genes by the RNA-binding protein RsmE acting together with RsmA in the biocontrol strain Pseudomonas fluorescens CHA0. J. Bacteriol. 187, 276-285. O’Toole. G.A, Kolter, R., 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30: 295-304. Römling, U., Galperin, M.Y., and Gomelsky, M. 2013. Cyclic di-GMP: the first 25 years of a universal bacterial second messenger. Microb. Mol. Biol. Rev. 77, 1-52. King, E.O., Ward, M.K., Raney, D.E., 1954. Two simple media for the demonstration of pyocyanin and fluorescein. J. Lab Clin. Med. 44, 301-307. Chilton, M.D., Currier, T.C., Farrand, S.K., Bendich, A.J., Gordon, M.P., Nester, E.W., 1974. Agrobacterium tumefaciens DNA and PS8 bacteriophage DNA not detected in crown gall tomors. Proc. Natl. Acad. Sci. U. S. A. 71, 3672-3676. Zhang, Y., Zhang, Y., Zhang, B., Wu, X., Zhang, L.Q., 2018. Effect of carbon sources on production of 2,4-diacetylphloroglucinol in Pseudomonas fluorescens 2P24. Acta Microbiol. Sin. 58, 1202-1212. Smith, A.W., Iglewski, B.H., 1989. Transformation of Pseudomonas aeruginosa by electroporation. Nucleic Acids Res.17: 10509. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., et al., 2009. The sequence alignment/map format and SAMtools. Bioinformatics. 25, 2078-2079. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., et al., 2010. Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511-515. Miller, J.H., 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Shanahan, P., O′Sullivan, D.J., Simpson, P., Glennon, J.D., O′Gara, F., 1992. Isolation of 2,4-diacetylphloroglucinol from a fluorescent pseudomonad and investigation of physiological parameters influencing its production. Appl. Environ. Microbiol. 58, 353-358. Wei, H.L., Zhang, L.Q., 2006. Quorum-sensing system influences root colonization and biological control ability in Pseudomonas fluorescens 2P24. Antonie van Leeuwenhoek. 89, 267-280. Hachani, A., Lossi, N.S., Filloux, A., 2013. A visual assay to monitor T6SS-mediated bacterial competition. J. Vis. Exp. 73, e50103. Liu, J., Zhang, W., Wu, X., Zhang, L., 2013. Effect of retS gene on biosynthesis of 2,4-diacetylphloroglucinol in Pseudomonas fluorescens 2P24. Acta Microbiol. Sin. 53, 118-126. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Supplementary Files TableS1A.xlsx TableS1B.xlsx Cite Share Download PDF Status: Published Journal Publication published 02 Jul, 2020 Read the published version in BMC Microbiology → Version 1 posted Review # 2 received at journal 09 Jun, 2020 Editorial decision: Major revision 09 Jun, 2020 Review # 1 received at journal 05 Jun, 2020 Reviewer # 2 agreed at journal 23 May, 2020 Reviewer # 1 agreed at journal 19 May, 2020 Editor assigned by journal 14 May, 2020 Reviewers invited by journal 14 May, 2020 Submission checks completed at journal 13 May, 2020 Editor invited by journal 13 May, 2020 First submitted to journal 11 May, 2020 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-29303","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":580288,"identity":"f76f44c9-5dc7-425f-84d2-7ebb248136c4","order_by":1,"name":"Yang Zhang","email":"","orcid":"","institution":"Guangxi University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Zhang","suffix":""},{"id":580289,"identity":"f157a8a9-8822-464f-ae6e-657194ef25d8","order_by":2,"name":"Bo Zhang","email":"","orcid":"","institution":"Guangxi University","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Zhang","suffix":""},{"id":580290,"identity":"8a0879af-97e1-4bb2-8f37-2dcea87086ca","order_by":3,"name":"Haiyan Wu","email":"","orcid":"","institution":"Guangxi University","correspondingAuthor":false,"prefix":"","firstName":"Haiyan","middleName":"","lastName":"Wu","suffix":""},{"id":580291,"identity":"d81131c0-91e5-43ec-91e9-eefcb8859d14","order_by":4,"name":"Xiaogang Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYBACxmaGxIcfDGzq2eQPHwDyLRgYeAhoYW5neGwsUZGWwC/BlsDAkCBBWAt7P+MzAZ4zhxMkZ/AYEKeFt5k5jUGyLS3P4HbPx8e8PyTk+HkOMH74mINbi2QzW9qDwjabYoM7Zzcb8yRIGEv2NjBLztyGW4thM0+6AdAWxg0HcrdJA7UkbjjPwMbMi0eL/WH+bxK8bYeBWnKeEacFGMhpEkDvJ86ckcMG0XK2gaCWZFAgG/PzHDM2nJMG9EvPwWa8fmHsPwCOSjk29uaHD97Y2ABDLPngh494tGA1poE09aNgFIyCUTAKMAAAONRQ4k6hmbIAAAAASUVORK5CYII=","orcid":"","institution":"Guangxi University","correspondingAuthor":true,"prefix":"","firstName":"Xiaogang","middleName":"","lastName":"Wu","suffix":""},{"id":580292,"identity":"f6f47792-ad80-43ff-94bb-1cfce38a2573","order_by":5,"name":"Qing Yan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYDACZijNjyRmQJwWyQYgcYAoLXCTDxCrhe847+EXjG12ecbXDh97/KHmjjwDe/M2CXxaJA/zpVkwtiUXm91OSzc4cOyZYQPPsTK8WgwO85gZMLYxJ267nWMmcYDtMGODBJBBhJb6xM2zQVr+HbZvkH9DUIvxA8a2w4kbpIFaDgIZDRI8+LVIAm1hSDh3PHHG7bQ0ibN9h5PbeNKKLfBp4Tt/xvjDh7LqxP7ZycckKr4dtu1nP7zxBj4twKhgk0hkQxJgw6kUoYX5A8MfgspGwSgYBaNgJAMAg9dMSBAZnHcAAAAASUVORK5CYII=","orcid":"","institution":"Montana State University","correspondingAuthor":true,"prefix":"","firstName":"Qing","middleName":"","lastName":"Yan","suffix":""},{"id":580293,"identity":"33bf94ce-7a97-41f9-8b00-8b85ce4b2e4d","order_by":6,"name":"Li-qun Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYDACCRBRwCAH4bERrcWAwZh0LYkNRGuRn9387OEXA+v0/vYzBgwfyg4z8M9uwK+Fcc4xc2MZg/TcGWdyDBhnnDvMIHHnAH4tzBIJZtISBodzNzDkGDDzth1mMJBIwK+FTSL9G0hLugH/GwPmv8Ro4ZHIMZP8YHA4wUACaAsjMVokJHLKpBkM0g1n3HhWcLDnXDqPxA0CWuRnpG+T/FFhLc/fn7zxwY8yazn+GQS0gAAzDwMzmHEA5FLC6oGA8QdUyygYBaNgFIwCrAAAg/o7wRwGY0IAAAAASUVORK5CYII=","orcid":"","institution":"China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Li-qun","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2020-05-14 21:49:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-29303/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-29303/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12866-020-01880-x","type":"published","date":"2020-07-02T12:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":1133529,"identity":"f8ea5139-5442-4e57-b1db-6069a1f0eaa5","added_by":"auto","created_at":"2020-05-19 21:46:57","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":640730,"visible":true,"origin":"","legend":"Overproduction of 2,4-DAPG influenced the growth curves of P. fluorescens. HPLC analysis of 2,4-DAPG production by strain 2P24 and its derivatives (A). Overexpression of phlG gene in the rsmA rsmE double mutant partially restored the growth of P. fluorescens (B). Deletion of phlD in the rsmA rsmE double mutant significantly influenced the growth of P. fluorescens (C). All experiments were performed in triplicate, and the mean values ± standard deviations are indicated. * indicates P \u003c 0.05, and ** indicates P \u003c 0.01.","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-29303/v1/Fig1.jpg"},{"id":1133531,"identity":"dad10f00-4a79-4df5-b4ce-278a7e9037eb","added_by":"auto","created_at":"2020-05-19 21:46:57","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":841176,"visible":true,"origin":"","legend":"RsmA and RsmE regulated the expression of phlF and phlG genes in P. fluorescens 2P24. The transcriptional fusion phlF-lacZ (A) and phlG-lacZ (B) were measured in strain 2P24 and its derivatives. All experiments were performed in triplicate, and the mean values ± standard deviations are indicated. Growth is indicated by the dotted line.","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-29303/v1/Fig2.jpg"},{"id":1133532,"identity":"d0484b30-fb37-4198-b642-cacc3b9fdb6f","added_by":"auto","created_at":"2020-05-19 21:46:58","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":803405,"visible":true,"origin":"","legend":"RsmA and RsmE repressed the T6SS in P. fluorescens 2P24. (A) Western blot analysis of Hcp1 protein level in wild-type strain 2P24 and its derivatives. (B) Quantification of bacterial killing assay after coincubation of E. coli, and various 2P24 attackers. All experiments were performed in triplicate, and the mean values ± standard deviations are indicated. * indicates P \u003c 0.05.","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-29303/v1/Fig3.jpg"},{"id":1133533,"identity":"ad05548c-4f78-4a8a-a5d2-4c5c4bf01398","added_by":"auto","created_at":"2020-05-19 21:46:58","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":783367,"visible":true,"origin":"","legend":"RsmA and RsmE controlled swimming motility and biofilm formation. (A) Swimming motility was tested on LB plates containing 0.3% agar. (B) Biofilm formation phenotype of wild-type strain 2P24 and its derivatives in LB medium. All experiments were performed in triplicate, and the mean values ± standard deviations are indicated. * indicates P \u003c 0.05.","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-29303/v1/Fig4.jpg"},{"id":13504380,"identity":"083eaf35-a192-4e27-9d06-500f3632a033","added_by":"auto","created_at":"2021-09-16 23:23:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":702555,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-29303/v1/2975f55d-5fc4-410f-8f20-7478d6dad5f8.pdf"},{"id":1133530,"identity":"1514e417-1a4d-4c89-89a0-5d8de4e5eaba","added_by":"auto","created_at":"2020-05-19 21:46:57","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":128841,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1A.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-29303/v1/TableS1A.xlsx"},{"id":1133528,"identity":"0be4dd15-a93a-44f5-8924-2085614d9a51","added_by":"auto","created_at":"2020-05-19 21:46:57","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":71967,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1B.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-29303/v1/TableS1B.xlsx"}],"financialInterests":"","formattedTitle":"\u003cp\u003ePleiotropic Effects of RsmA and RsmE Proteins in Pseudomonas Fluorescens 2P24\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eBacteria use a complex interconnecting mechanism to recognize and adapt to changes in their environment and reprogram numerous cellular processes in response to physiological homeostasis. An important element in this complex regulatory network is the Gac/Rsm cascade pathway [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This pathway is conserved in numerous Gram-negative bacteria and mediates the post-transcriptional regulation of diverse genes required for bacterial virulence and metabolism [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. These include genes for the expression of extracellular enzymes [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], carbon storage compounds [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], motility [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], the formation of biofilm [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], and the production of secondary metabolites and virulence factors [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Signal transduction initially involves the GacS/GacA two-component system which consists of the histidine kinase protein GacS and its cognate response regulator GacA. Upon interaction with unknown signals, the membrane sensor GacS autophosphorylates and activates the GacA by phosphorylation. Phosphorylated GacA positively controls transcription initiation of one or more small non-coding RNAs (sRNA) genes, depending on the bacterial species, such as \u003cem\u003ersmX\u003c/em\u003e, \u003cem\u003ersmY\u003c/em\u003e and \u003cem\u003ersmZ\u003c/em\u003e in \u003cem\u003ePseudomonas protegens\u003c/em\u003e CHA0 [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. A conserved upstream activating sequence (UAS) is found to be necessary for GacA protein to activate the expression of these sRNAs [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. These sRNAs exhibit high affinity for the CsrA/RsmA family protein. The CsrA/RsmA family protein can inhibit translation or stability of transcripts of its target genes by binding to sites overlapping the SD sequence or ribosome binding sites of target mRNAs, thus influencing ribosome access [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In addition, varying numbers of RsmA orthologs have been described in different bacteria and these proteins exhibit distinct binding affinities to sRNAs and show distinct roles in particular strain [\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24, a rhizospheric bacterium originally isolated from the take-all decline soil, has been investigated for its ability to produce the secondary metabolite 2,4-diacetylphloroglucinol (2,4-DAPG), which contributes to the protection of various crop plants against soil borne disease caused by many plant pathogens [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The biosynthetic pathway of 2,4-DAPG has been clarified in several \u003cem\u003ePseudomonas\u003c/em\u003e strains. The 2,4-DAPG locus includes the four biosynthetic genes \u003cem\u003ephlACBD\u003c/em\u003e that are transcribed as a single operon and is directly involved in the catalytic process of 2,4-DAPG production [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The first step in 2,4-DAPG biosynthesis is the formation of phloroglucinol (PG) from three units of malonyl-coenzyme A (malonyl-CoA) by the type III polyketide synthase PhlD [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The products of \u003cem\u003ephlACB\u003c/em\u003e genes are together required for the transacetylation of PG to monoacetylphloroglucinol (MAPG) and then 2,4-DAPG [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSince the high concentration of 2,4-DAPG is toxic to the producing bacterium, biosynthesis of 2,4-DAPG is subtly modulated by complex regulatory networks in response to abiotic and biotic factors, and cell physiological status [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The \u003cem\u003ephlF\u003c/em\u003e and \u003cem\u003ephlH\u003c/em\u003e genes, code for the pathway-specific transcriptional regulators of the production of 2,4-DAPG [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Besides PhlF and PhlH, the Gac/Rsm cascade pathway plays a critical role in the production of 2,4-DAPG [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24, the RsmA and RsmE proteins directly repress the translation of \u003cem\u003ephlACBD\u003c/em\u003e mRNA, whereas four sRNAs RsmX, RsmX1, RsmY, and RsmZ derepress the translation of \u003cem\u003ephlACBD\u003c/em\u003e mRNA by sequestering the RsmA and RsmE proteins, thereby inducing the production of 2,4-DAPG [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we found that RsmA and RsmE proteins contribute to bacterial growth advantages in \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24. Deletion of both of \u003cem\u003ersmA\u003c/em\u003e and \u003cem\u003ersmE\u003c/em\u003e genes could impair growth rate and cell density, whereas the growth rate and cell density was partially restored in the \u003cem\u003ersmA rsmE phlD\u003c/em\u003e triple mutant compared with that of the wild-type strain, suggesting that high levels of 2,4-DAPG in the cells could influence the growth of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant. In addition, we demonstrated the role of the RsmA family proteins on type six secretion system (T6SS), swimming motility, and biofilm formation in \u003cem\u003eP. fluorescens\u003c/em\u003e.\u003c/p\u003e "},{"header":"Results","content":"\u003ch2\u003eHigh concentration of 2,4-DAPG in the cells impaired the growth of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant\u003c/h2\u003e \u003cp\u003ePrevious study showed that the growth of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant was severely impaired compared with the wild-type strain 2P24. Since high levels of 2,4-DAPG was toxic to the producing bacterium [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], to assess if the growth of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant was impaired by the overdose of 2,4-DAPG in the cells, we overexpressed the \u003cem\u003ephlG\u003c/em\u003e gene which encoding the 2,4-DAPG hydrolase and then measured the growth of 2P24 and its derivatives. As expected, introduction of the \u003cem\u003ephlG\u003c/em\u003e gene cloned in the pRK415 plasmid (p415-phlG), into the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant, resulted in repression of 2,4-DAPG production (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The growth rate of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant with p415-phlG could be partially restored to that of the wild-type strain 2P24 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Furthermore, by deleting the \u003cem\u003ephlD\u003c/em\u003e gene in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant, the growth curve of the \u003cem\u003ersmA rsmE phlD\u003c/em\u003e triple mutant was significantly improved compared to that of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant although was slightly lower compared to the wild-type strain 2P24 or the \u003cem\u003ephlD\u003c/em\u003e mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Thus, these data suggested that overproduction of 2,4-DAPG contributes to the reduced growth of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant.\u003c/p\u003e \u003ch2\u003eRNA sequencing reveals the \u003cem\u003eP. fluorescens\u003c/em\u003e RsmA and RsmE regulon.\u003c/h2\u003e \u003cp\u003eTo insight into the role of RsmA and RsmE in \u003cem\u003eP. fluorescens\u003c/em\u003e, RNA sequencing (RNA-seq) was performed to define the RsmA and RsmE regulon of \u003cem\u003eP. fluorescens\u003c/em\u003e. The genes that are significantly downregulated or upregulated are summarized in Table S1 \u0026amp; S2. We defined the genes that showed a\u0026thinsp;\u0026gt;\u0026thinsp;2-fold change of expression as differentially expressed genes (DEGs). In the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant, 621 genes were upregulated and 304 genes were downregulated compared to the wild-type strain (Table S1 \u0026amp; S2).\u003c/p\u003e \u003cp\u003eBased on the RNA-seq results, we observed that the expression of genes in \u003cem\u003ephl\u003c/em\u003e operon (\u003cem\u003ephlACBD\u003c/em\u003e) was increased by 145 to 587-fold, which was consistent with that of the \u003cem\u003ephlA\u0026prime;\u003c/em\u003e-\u003cem\u003e\u0026prime;lacZ\u003c/em\u003e translational fusion assay [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Many regulatory elements, including Gcd [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], Hfq [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], PsrA [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], RpoS [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and PhlG which directly or indirectly influence 2,4-DAPG biosynthesis, were regulated by the RsmA and RsmE. As expected, transcriptional fusion assays showed that both of the expression of \u003cem\u003ephlG\u003c/em\u003e and \u003cem\u003ephlF\u003c/em\u003e were significantly increased in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant compared with that in the wild-type strain (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These results indicated a sophisticated role for the RsmA family proteins RsmA and RsmE in the production of 2,4-DAPG in \u003cem\u003eP. fluorescens\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eAmong the genes upregulated in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant, 21 encoded proteins that are associate with type six secretion system (T6SS), which is known as an important mechanism in interactions and pathogenesis against bacterial and eukaryotic cells. In addition, the RNA-seq data revealed that a significant number of genes influenced by RsmA and RsmE were involved in fatty acid metabolism (\u003cem\u003efadA\u003c/em\u003e, \u003cem\u003efadB\u003c/em\u003e, \u003cem\u003efabG\u003c/em\u003e, \u003cem\u003efadH\u003c/em\u003e, \u003cem\u003epsrA\u003c/em\u003e), energy and carbon metabolism (\u003cem\u003eglpD\u003c/em\u003e, \u003cem\u003ezwf\u003c/em\u003e, \u003cem\u003efahA\u003c/em\u003e, \u003cem\u003egcd\u003c/em\u003e, \u003cem\u003egltK\u003c/em\u003e), and cell motility (\u003cem\u003eflaG\u003c/em\u003e, \u003cem\u003efliT\u003c/em\u003e, \u003cem\u003efliS\u003c/em\u003e, \u003cem\u003emotA\u003c/em\u003e, \u003cem\u003emotC\u003c/em\u003e, \u003cem\u003eflgE\u003c/em\u003e). Collectively, our data suggested that RsmA and RsmE are the pleiotropic regulators of secondary metabolism, cell motility, and other physiological processes.\u003c/p\u003e \u003ch2\u003eRsmA and RsmE negatively regulated the Type six secretion system (T6SS)\u003c/h2\u003e \u003cp\u003eBacterial T6SS plays an important role in both virulence and inter-bacterial competition and provide advantages to T6SS active strains in polymicrobial habitats [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Since many genes related to T6SS were up-regulated in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant, we assayed the effect of the RsmA family protein on the production of T6SS structure protein Hcp1. Consistent with the RNA-seq data in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant, Western blot analysis showed that this mutant produced higher amount of the Hcp1 protein than wild-type strain \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Previously studies showed that the T6SSs could inject the T6SS toxins into bacterial preys [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We then performed the antibacterial assays using \u003cem\u003eE. coli\u003c/em\u003e carrying the plasmid pHSG299 as prey and \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24 or its derivatives as predators. Similar to the \u003cem\u003eretS\u003c/em\u003e mutant which triggered the T6SS [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], The \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant caused a significant increase in survival of \u003cem\u003eE. coli\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Taken together, our results indicate that RsmA and RsmE repress the T6SS activity and play an important role for the inter-bacterial competition.\u003c/p\u003e \u003ch2\u003eThe effect of RsmA and RsmE on cell motility and biofilm formation\u003c/h2\u003e \u003cp\u003eAnalysis of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant RNA-seq data showed that expression of 20 genes involved in flagella biosynthesis and assembly was significantly changed, indicated a decrease in cell motility. To confirm this result, the motility of strain 2P24 and its derivatives was measured. Compared to the wild-type strain, the swimming motility was reduced by 72% in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Motility is crucial in cell-to-cell adherence and attachment in early biofilm development. Whereas our data revealed a positive influence of the RsmA family proteins on biofilm formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). All observed phenotypes in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant could be partly complemented by introducing the plasmid pBBR-rsmE (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Taken together, these results demonstrated that RsmA and RsmE are crucial for cell motility and biofilm formation in strain 2P24.\u003c/p\u003e "},{"header":"Discussion","content":"\u003cp\u003ePlant growth-promoting rhizobacteria could antagonize plant pathogenic fungi by the production of antimicrobial secondary metabolites, such as 2,4-DAPG. Although 2,4-DAPG has antifungal, antibacterial, anthelminthic, and phytotoxic properties, it has toxicity to the producing bacterium at high concentrations. In the present study, we revealed that regulation of the production of 2,4-DAPG by the RsmA family proteins RsmA and RsmE contributes to bacterial growth advantages.\u003c/p\u003e \u003cp\u003eThe RsmA and RsmE proteins play a critical role for the production of 2,4-DAPG [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24, RsmA and RsmE inhibited the expression of \u003cem\u003ephlACBD\u003c/em\u003e at the translation level [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Varying numbers of RsmA orthologs have been identified in different \u003cem\u003ePseudomonas\u003c/em\u003e sp. [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The defects in the growth of the \u003cem\u003ersm\u003c/em\u003e mutants could be found in \u003cem\u003eP. putida\u003c/em\u003e and \u003cem\u003eP. syringae\u003c/em\u003e pv. \u003cem\u003etomato\u003c/em\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Although no evidence showed that deletion of both of \u003cem\u003ersmA\u003c/em\u003e and \u003cem\u003ersmE\u003c/em\u003e genes influenced the growth of \u003cem\u003eP. protegens\u003c/em\u003e CHA0 which could produce several antibiotics, including 2,4-DAPG [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], our data showed that the defect of bacterial growth was observed in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant when compared with the wild-type strain 2P24 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Interestingly, overexpression of \u003cem\u003ephlG\u003c/em\u003e gene or deletion of \u003cem\u003ephlD\u003c/em\u003e gene in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant partly restored the growth curve of strain 2P24 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Transcriptional fusion assays further suggested that the expression of \u003cem\u003ephlG\u003c/em\u003e and \u003cem\u003ephlF\u003c/em\u003e genes were negatively regulated by RsmA and RsmE (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003e), indicating that RsmA and RsmE could balance the concentration of 2,4-DAPG in the cells by fine-tuning the role of multiple regulators of the production of 2,4-DAPG. The biosynthesis of 2,4-DAPG leads to lower bacterial growth rates due to the increased metabolic costs in the cells [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Deletion of \u003cem\u003ephlD\u003c/em\u003e gene in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant could not completely restore the growth curve of strain 2P24 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003e), whereas the deficiency of the growth could be restored when the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant was growth in minimal medium with glucose as a carbon source [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], indicating that RsmA and RsmE play an important role in central carbohydrate metabolism. Our RNA-seq analysis supported this hypothesis which identified several genes that are known to be involved in fatty acid metabolism, carbon metabolism, and pleiotropic molecule cyclic diguanylate production (Table S1). In addition, our data suggested that RsmA and RsmE are the global regulators in a complex regulatory network that provides advantages to strain 2P24 in polymicrobial environments. For instance, inactivation of both of \u003cem\u003ersmA\u003c/em\u003e and \u003cem\u003ersmE\u003c/em\u003e increased the levels of Hcp1 and provided a growth advantage against \u003cem\u003eE. coli\u003c/em\u003e in \u003cem\u003eP. fluoresces\u003c/em\u003e 2P24 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These results were in agreement with the previously proposed role of \u003cem\u003ersmA\u003c/em\u003e in affecting \u003cem\u003etssA1\u003c/em\u003e, \u003cem\u003etse6\u003c/em\u003e, and \u003cem\u003etsi4\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Together, our data suggested that RsmA and RsmE might play a critical role in fine-tuning the concentration of 2,4-DAPG to maintain the metabolic homeostasis and improve the competitive advantages of 2P24 against other microbes living in or nearby the rhizosphere.\u003c/p\u003e \u003cp\u003eWe also identified 20 genes involved in flagella biosynthesis and assembly by genome-wide expression analysis (Table S1B). According to these observations, mutation in the \u003cem\u003ersmA\u003c/em\u003e and \u003cem\u003ersmE\u003c/em\u003e genes resulted in decreasing motility (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Bacterial motility and biofilm formation are inversely regulated in Gram-negative bacteria [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Interestingly, the results of this work strongly suggest that RsmA and RsmE positively affected biofilm formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Previous study showed that bacterial secondary messenger cyclic diguanylate (c-di-GMP) influences biofilm development [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Many genes involved in c-di-GMP turn over were regulated by RsmA and RsmE (Table S1). We speculate that RsmA and RsmE may interact with the c-di-GMP signaling pathway to regulate biofilm formation in \u003cem\u003eP. fluorescens\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn summary, these results demonstrated that several important intracellular activities and behaviors were regulated by the RsmA family proteins RsmA and RsmE in plant-associated \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24. By fine-tuning the concentration of 2,4-DAPG and carbon metabolism in the cells, RsmA and RsmE could contribute to growth advantages of strain 2P24.\u003c/p\u003e "},{"header":"Conclusions","content":"\u003cp\u003eThe plant-associated \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24 can colonize root of many crops and protect them from infection by phytopathogens. The RsmA and RsmE proteins play an important role in regulating the production of antibiotic compound 2,4-DAPG, which is necessary for its biocontrol traits. In this study, our data showed that the regulation of 2,4-DAPG by RsmA and RsmE was complicated and involved in many specific elements. In addition, several important intracellular activities and behaviors, such as growth curve, carbon metanT6SS, the formation of biofilm, and motility were regulated by RsmA and RsmE in strain 2P24. These findings provide a new understanding of the regulatory role of RsmA and RsmE in \u003cem\u003eP. fluorescens\u003c/em\u003e.\u003c/p\u003e "},{"header":"Methods","content":" \u003ch2\u003eBacterial strains, plasmids, and growth conditions.\u003c/h2\u003e \u003cp\u003eThe bacterial strains and plasmids used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. \u003cem\u003eEscherichia coli\u003c/em\u003e was routinely grown in lysogeny broth (LB) medium at 37 ℃. Unless otherwise indicated, \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24 and its derivatives were grown in LB medium, King\u0026rsquo;s B medium (KB) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], or ABM medium [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] at 28 ℃. The concentration of antibiotics was added as follows: ampicillin (50 \u0026micro;g/ml), kanamycin (50 \u0026micro;g/ml), tetracycline (20 \u0026micro;g/ml).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ebacterial strains, plasmids, and oligonucletoides used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrains, plasmids or oligonucletoide\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRelevant characteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReference or source\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrains\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas fluorescens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2P24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWild-type, Ap\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePM206\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIn-frame deletion of \u003cem\u003eretS\u003c/em\u003e, Ap\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWPM30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIn-frame deletion of \u003cem\u003ephlD\u003c/em\u003e, Ap\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWPM12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDouble deletion of \u003cem\u003ersmA\u003c/em\u003e and \u003cem\u003ersmE\u003c/em\u003e, Ap\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWPM31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTriple deletion of \u003cem\u003ersmA\u003c/em\u003e, \u003cem\u003ersmE\u003c/em\u003e, and \u003cem\u003ephlD\u003c/em\u003e, Ap\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e DH5α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esupE44 lacU\u003c/em\u003e169 (\u003cem\u003eφ80lacZ\u003c/em\u003e M15) \u003cem\u003ehsdR\u003c/em\u003e17 \u003cem\u003erecA\u003c/em\u003e1 \u003cem\u003eendA\u003c/em\u003e1 \u003cem\u003egyrA\u003c/em\u003e96 \u003cem\u003ethi\u003c/em\u003e-1 \u003cem\u003erelA\u003c/em\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlasmids\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep2P24Km\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSucrose-based counter-selectable plasmid, Km\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep2P24Km-phlD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePlasmid p2P24Km carrying a deleted \u003cem\u003ephlD\u003c/em\u003e gene, Km\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep970Km-phlFp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ephlF\u003c/em\u003e-\u003cem\u003elacZ\u003c/em\u003e transcriptional fusion, Km\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep970Km-phlGp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ephlG\u003c/em\u003e-\u003cem\u003elacZ\u003c/em\u003e transcriptional fusion, Km\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep415-phlG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epRK415 containing the \u003cem\u003ephlG\u003c/em\u003e gene, Tet\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epHSG299\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCloning vector, Km\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTaKaRa\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOligonucletoides\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;-\u0026prime;3) \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eComment\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlD-F1-EcoRI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAA\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGAATTC\u003c/span\u003eATGGCGATGGTGCGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003ephlD\u003c/em\u003e null mutant construction\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlD-R1-680\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAATTTTCCGTCCGCCTGTATGGAACATGAAACCCGTGCACGATGTCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlD-F2-700\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTGACATCGTGCACGGGTTTCATGTTCCATACAGGCCGGACGGAAAATTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlD-R2-SalI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAA\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGTCGAC\u003c/span\u003eCAGGCTGGTGATCAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlG-PFBamHI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTA\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGATCC\u003c/span\u003eAGTTGCA CCAACCGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ephlG-lacZ\u003c/em\u003e transcriptional fusion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlG-PRBamHI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAT\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGATCC\u003c/span\u003eGGCACGCTGATCTTCGAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlF-PFBamHI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGATCC\u003c/span\u003eAGATCTTAAGGGTTTCTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ephlF\u003c/em\u003e-\u003cem\u003elacZ\u003c/em\u003e transcriptional fusion\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ephlF-PRBamHI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGT\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGATCC\u003c/span\u003eATAAGGATTGGTGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003csup\u003e*\u003c/sup\u003eAp, ampicillin; Km, kanamycin; Tet, tetracycline.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003csup\u003ea\u003c/sup\u003e Restriction site inserted in the primer for the cloning strategy are underlined.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \n\u003ch2\u003eMutant construction\u003c/h2\u003e\n\u003cp\u003eThe \u003cem\u003ephlD\u003c/em\u003e in-frame deletion mutant was constructed by allelic exchange mutagenesis [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Briefly, upstream and downstream fragments flanking the \u003cem\u003ephlD\u003c/em\u003e gene were amplified by PCR using primers phlD-F1-EcoRI/phlD-R1-680 and phlD-F2-700/phlD-R2-SalI, respectively. The upstream and downstream PCR products were used as templates in fusion PCR with primers phlD-F1-EcoRI/phlD-R2-SalI. Subsequently, the fusing fragment was cloned into the suicide vector p2P24Km [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The resulting plasmid p2P24-phlD was introduced into strain 2P24 and the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant by electroporation and double-crossover recombination events were selected [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Substitution was confirmed by PCR and sequencing.\u003c/p\u003e \u003ch2\u003eRNA-seq analysis\u003c/h2\u003e\u003cp\u003eTo test the effect of the \u003cem\u003ersmA\u003c/em\u003e and \u003cem\u003ersmE\u003c/em\u003e genes on the transcriptome in \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24, cells were cultured to early stationary phase (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.0) in LB medium. Total RNA was conducted using the RNeasy minikit (Qiagen). The Ambion Turbo DNA-free kit was applied to remove contaminant DNA. After removal of rRNA by using the Ribo-Zero rRNA removal kit (Illumina), mRNA was used to generate the cDNA library according to NEBNext UltraTM II RNA Library Prep Kit, which was then sequenced using an Illumina HiSeq 2500 platform. High-quality reads were aligned to the \u003cem\u003eP. fluorescens\u003c/em\u003e 2P24 genome (GenBank accession no. CP025542). From the resulting alignments, SAMtools version 1.6 [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] was applied to sort the bam file. The differentially expressed genes were identified by performing Cuffdiff version 2.2.1 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] with a \u003cem\u003ep\u003c/em\u003e value smaller than 1e-5. Each sample in the RNA-seq was repeated three times.\u003c/p\u003e \u003ch2\u003eConstruction of the transcriptional \u003cem\u003elacZ\u003c/em\u003e fusion and measurements of β-galactosidase activity\u003c/h2\u003e \u003cp\u003eTo construct the \u003cem\u003ephlF\u003c/em\u003e-\u003cem\u003elacZ\u003c/em\u003e and \u003cem\u003ephlG\u003c/em\u003e-\u003cem\u003elacZ\u003c/em\u003e transcriptional fusions, a 700-bp DNA fragment upstream of \u003cem\u003ephlF\u003c/em\u003e and a 540-bp fragment upstream of \u003cem\u003ephlG\u003c/em\u003e were cloned separately into pRG970Km [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], ahead of a promoterless \u003cem\u003elacZ\u003c/em\u003e gene, to gain p970Km-phlFp and p970Km-phlGp, respectively. The primers used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eS\u003c/em\u003etrains carry the \u003cem\u003elacZ\u003c/em\u003e transcriptional fusions were grown in LB medium with agitation at 28 ℃. The bacterial cells were collected by centrifugation and the β-galactosidase activity was measured using the method as reported previously [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e \n\u003ch2\u003eQuantification of 2,4-DAPG\u003c/h2\u003e\n\u003cp\u003eStrain 2P24 and its derivatives were grown in 20\u0026nbsp;ml KBG (KB broth supplemented with 2% glucose) at 28 ℃ for 48\u0026nbsp;h. 2,4-DAPG was extracted from culture supernatant and quantitatively analyzed according to the method described previously [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \n\u003ch2\u003eSwimming motility assay\u003c/h2\u003e\n \u003cp\u003eOvernight LB culture was inoculated, and transferred at 1: 1,000 to 2\u0026nbsp;ml fresh LB medium, and then grown at 28 ℃ until it reached an OD600 of 0.8. Two microliters of the cultures were spotted on soft LB plates (0.3% agar). The plates were inoculated at 28 ℃ for 24\u0026nbsp;h.\u003c/p\u003e \n\u003ch2\u003eBiofilm formation assay\u003c/h2\u003e\n \u003cp\u003eA biofilm detection experiment was performed as reported previously [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In brief, overnight bacterial culture was transferred to a 2-ml EP tube containing 1\u0026nbsp;ml LB medium at an OD\u003csub\u003e600\u003c/sub\u003e of 0.5 and cultured statically at 28 ℃ for 2 d. Crystal violet (0.1%) was used to stain biofilm adhered to the tubes for 15\u0026nbsp;min. The tubes were washed gently three times with ddH\u003csub\u003e2\u003c/sub\u003eO, and the remaining crystal violet was fully dissolved in 200 \u0026micro;l of 95% ethanol and the absorbance was detected at 570\u0026nbsp;nm.\u003c/p\u003e \n\u003ch2\u003eWestern blot analysis\u003c/h2\u003e\n \u003cp\u003e \u003cem\u003eP. fluorescens\u003c/em\u003e cells were grown in LB at 28 ℃ for 12\u0026nbsp;h and 1-ml samples were taken. Cells were then collected by centrifugation, re-suspended in PBS buffer, and lysed by sonication. The protein in crude lysates was quantified using the Bradford protein assay (Bio-Rad). Samples were boiled before being loaded onto 12% sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gels. Proteins were then transferred onto a polyvinylidene fluoride membrane (PVDF) (Millipore). Blots were washed with PBS containing 0.05% Tween-20 and probed with an anti-Hcp1 antibody (1:2,000). Anti-RNA polymerase monoclonal antibody (1:2,000) (Neoclone) was used as a control. Signals were then developed using the chemiluminescence detection kit (Thermo Fisher).\u003c/p\u003e \u003ch2\u003eT6SS competition assays\u003c/h2\u003e\u003cp\u003eCompetition assays were performed as previously described [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Overnight bacterial cultures were adjusted to OD\u003csub\u003e600\u003c/sub\u003e of 1 in PBS solution and mixed in a 1:1 ratio [\u003cem\u003eP. fluorescens\u003c/em\u003e-\u003cem\u003eE. coli\u003c/em\u003e (pHSG299) as prey]. Bacteria were spotted on LB agar plates to co-culture at 28 ℃ for 5\u0026nbsp;h. The competition was then quantified by counting colony-forming units on antibiotic selection.\u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData were tested for normality and analyzed using unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test. Asterisks indicated \u003cem\u003eP\u003c/em\u003e values (\u003csup\u003e*\u003c/sup\u003e, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u003csup\u003e**\u003c/sup\u003e, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and results were presented as the mean standard deviation. Each experiment was performed three times with similar results.\u003c/p\u003e \u003c/div\u003e "},{"header":"Abbreviations","content":"\u003cp\u003e2,4-DAPG: 2,4-diacetylphloroglucinol; small non-coding RNA: sRNA; upstream activating sequence: UAS; phlotoglucinol: PG; monoacetylphloroglucinol: MAPG; type six secretion system: T6SS; RNA sequencing: RNA-seq; differentially expressed genes: DEGs; cyclic diguanylate: c-di-GMP\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003ch2\u003eConsent for publication\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003ch2\u003eAvailability of data and materials\u003c/h2\u003e \u003cp\u003eThe genome sequence of \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e 2P24 has been submitted to GenBank with accession number CP025542. The datasets used and/or analyzed during this study available from the corresponding author on reasonable request.\u003c/p\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e \u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis project was supported by grants from the Chinese National Natural Science Foundation (31760533), the National Key Research and Development Program of China (2017YFD02011083), the Science and Technology Major Project of Guangxi (AA17204041), and the Natural Science Foundation of Guangxi (2017GXNSFAA198341).\u003c/p\u003e \u003ch2\u003eAuthor\u0026rsquo;s contributions\u003c/h2\u003e \u003cp\u003eXG, QY and LQZ designed the project. YZ, BZ, and XG carried out the experiments. YZ, BZ, HW, QY and XG participated in the data analysis and wrote the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e \u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eWe thank Dr. Joseph Mougous for providing the Hcp1 antibody and Dr. Ching-Hong Yang for his thoughtful suggestions about the project.\u003c/p\u003e "},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHaas, D., D\u0026eacute;fago, G., 2005. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat. Rev. Microbiol. 3, 307-319.\u003c/li\u003e\n\u003cli\u003eHeeb, S., Haas, D., 2001. Regulatory roles of the GacS/GacA two-component system in plant-associated and other gram-negative bacteria. Mol. Plant Microbe Interact. 14, 1351-1363.\u003c/li\u003e\n\u003cli\u003eZuber, S., Carruthers, F., Keel, C., Mattart, A., Blumer, C., Pessi, G., et al., 2003. GacS sensor domains pertinent to the regulation of exoproduct formation and to the biocontrol potential of \u003cem\u003ePseudomonas fluorescens \u003c/em\u003eCHA0. Mol. Plant Microbe Interact. 16, 634-644.\u003c/li\u003e\n\u003cli\u003eRomeo, T., Gong, M., Liu, M.Y., Brun-Zinkernagel, A.M., 1993. Identification and molecular characterization of \u003cem\u003ecsrA\u003c/em\u003e, a pleiotropic gene from \u003cem\u003eEscherichia coli \u003c/em\u003ethat affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J. Bacteriol. 175, 4744-4755.\u003c/li\u003e\n\u003cli\u003eWei, B.L., Brun-Zinkernagel, A.M., Simecka, J.W., Pr\u0026uuml;ss, B.M., Babitzke, P., Romeo, T., 2001. Positive regulation of motility and \u003cem\u003eflhDC \u003c/em\u003eexpression by the RNA-binding protein CsrA of \u003cem\u003eEscherichia coli\u003c/em\u003e. Mol Microbiol. 40, 245-256.\u003c/li\u003e\n\u003cli\u003eBrencic, A., Lory, S., 2009. Determination of the regulon and identification of novel mRNA targets of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e RsmA. Mol Microbiol. 72, 612-632.\u003c/li\u003e\n\u003cli\u003eBlumer, C., Heeb, S., Pessi, G., Haas, D., 1999. Global GacA-steered control of cyanide and exoprotease production in \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e involves specific ribosome binding sites. Proc. Natl. Acad. Sci. U. S. A. 96, 14073-14078.\u003c/li\u003e\n\u003cli\u003ePessi, G., Williams, F., Hindle, Z., Heurlier, K., Holden, M.T.G., C\u0026aacute;mara, M., et al., 2001. The global posttranscriptional regulator RsmA modulates production of virulence determinants and \u003cem\u003eN\u003c/em\u003e-acylhomoserine lactones in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. J. Bacteriol. 187, 276-285.\u003c/li\u003e\n\u003cli\u003eKay, E., Dubuis, C., Haas, D., 2005. Three small RNAs jointly ensure secondary metabolism and biocontrol in \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e CHA0. Proc. Natl. Acad. Sci. U. S. A. 102, 17136-17141.\u003c/li\u003e\n\u003cli\u003eKay, E., Humair, B., Denervaud, V., Riedel, K, Spahr, S., Eberl, L., et al., 2006. Two-GacA-dependent small RNAs modulate the quorum-sensing response in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. J. Bacteriol. 188, 6026-6033.\u003c/li\u003e\n\u003cli\u003eLapouge, K., Schubert, M., Allain, F.H.-T. Haas, D., 2008. Gac/Rsm signal transduction pathway of \u003cem\u003eg\u003c/em\u003e-proteobacteria: from RNA recognition to regulation of social behaviour. Mol. Microbiol. 67, 241-253.\u003c/li\u003e\n\u003cli\u003eHuertas-Rosales, \u0026Oacute;, Ramos-Gonz\u0026aacute;lez, M.I., Espinosa-Urgel, M., 2016. Self-regulation and interplay of Rsm family proteins modulate the lifestyle of \u003cem\u003ePseudomonas putida\u003c/em\u003e. Appl. Environ. Microbiol. 82, 5673-5686.\u003c/li\u003e\n\u003cli\u003eMorris, E.R., Hall, G., Li, C., Heeb, S., Kulkarni, R.V., Lovelock, K. et al., 2013. Structural rearrangement in an RsmA/CsrA ortholog of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e creates a dimeric RNA-binding protein, RsmN. Structure. 21, 1659-1671.\u003c/li\u003e\n\u003cli\u003eFerreiro, M.D., Nogales, J., Farias, G.A., Olmedilla, A., Sanju\u0026aacute;n, J., Gallegos, M.T. 2018. Multiple CrsA proteins control key virulence traits in \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003etomato \u003c/em\u003eDC3000. Mol. Plant Microbe Interact. 31, 525-536.\u003c/li\u003e\n\u003cli\u003eZhang, Y., Zhang, B. Wu, X., Zhang, L.Q., 2020. Characterization the role of GacA-dependent small RNAs and RsmA family proteins on 2,4-diacetylphloroglucinol production in \u003cem\u003ePseudomonas\u003c/em\u003e \u003cem\u003efluorescens\u003c/em\u003e 2P24. Microbiol. Res. 233, 126391.\u003c/li\u003e\n\u003cli\u003eWei, H.L., Wang, Y., Zhang, L. Q., Tang, W. H., 2004. Identification and characterization of biocontrol bacterial strain 2P24 and CPF-10. Acta Phytopathol. Sin. 34, 80-85.\u003c/li\u003e\n\u003cli\u003eBangera, M.G., Thomashow, L.S., 1999. Identification and characterization of a gene cluster for synthesis of the polyketide antibiotic 2,4-diacetylphloroglucinol from \u003cem\u003ePseudomonas\u003c/em\u003e \u003cem\u003efluorescens\u003c/em\u003e Q2-87. J. Bacteriol\u003cem\u003e.\u003c/em\u003e 181, 3155-3163.\u003c/li\u003e\n\u003cli\u003eZha, W., Rubin-Pitel, S.B., Zhao, H., 2006. Characterization of the substrate specificity of PhlD: a type III polyketide synthase from \u003cem\u003ePseudomonas\u003c/em\u003e \u003cem\u003efluorescens\u003c/em\u003e. J. Biol. Chem. 281, 32036-32047.\u003c/li\u003e\n\u003cli\u003eSchnider-Keel, U., Seematter, A., Maurhofer, M., Blumer, C., Duffy, B., Gigot-Bonnefoy, C., et al. 2000. Autoinduction of 2,4-diacetylphloroglucinol biosynthesis in the biocontrol agent\u003cem\u003e Pseudomonas fluorescens \u003c/em\u003eCHA0 and repression by the bacterial metabolites salicylate and pyoluteorin. J. Bacteriol. 182, 1215-1225.\u003c/li\u003e\n\u003cli\u003eAbbas, A., McGuire, J.E., Crwoley, D., Baysse, C., Dow, M., O\u0026prime;Gara. F., 2004. The putative permease PhlE of \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e F113 has a role in 2,4-diacetylphloroglucinol resistance and in general stress tolerance. Microbiology. 150, 2443-2450.\u003c/li\u003e\n\u003cli\u003eHaas, D., Keel, C., 2003. Regulation of antibiotic production in root-colonizing \u003cem\u003ePseudomonas \u003c/em\u003espp. and relevance for biological control of plant disease. Annu. Rev. Phytopathol. 41, 117-153.\u003c/li\u003e\n\u003cli\u003eYan, X., Yang, R., Zhao, R.X., Han, J.T., Jia, W.J., Li, D.Y., \u003cem\u003eet al\u003c/em\u003e., 2016. Transcriptional regulator PhlH modulates 2,4-diacetylphloroglucinol biosynthesis in response to the biosynthetic intermediate and end product. Appl. Environ. Microbiol. 83, e01419-17.\u003c/li\u003e\n\u003cli\u003eZhang, B., Zhao, H, Wu, X., Zhang, L.Q., 2020. The oxidoreductasee DsbA1 negatively influences 2,4-diacetylphloroglucinol biosynthesis by interfering the function of Gcd in \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e 2P24. BMC Microbiol. 20, 39.\u003c/li\u003e\n\u003cli\u003eWu, X.G., Duan, H.M., Tian, T., Yao, N., Zhou, H.Y., Zhang, L.Q., 2010. Effect of the \u003cem\u003ehfq\u003c/em\u003e gene on 2,4-diacetylphloroglucinol production and the PcoI/PcoR quorum-sensing system in\u003cem\u003e Pseudomonas fluorescens\u003c/em\u003e 2P24. FEMS Microbiol. Lett. 309, 16-24.\u003c/li\u003e\n\u003cli\u003eWu, X., Liu, J., Zhang, W., Zhang, L.Q., 2012. Multiple-level regulation of 2,4-diacetylphloroglucinol production by the sigma regulator PsrA in \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e 2P24. PloS ONE. e50149.\u003c/li\u003e\n\u003cli\u003eYan, Q., Wu, X.G., Wei, H.L., Wang, H.M., Zhang, L.Q., 2009. Differential control of the PcoI/PcoR quorum-sensing system in \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e 2P24 by sigma factor RpoS and the GacS/GacA two-component regulatory system. Microbiol. Res. 164, 18-26.\u003c/li\u003e\n\u003cli\u003eBernal, P., Allsopp, L.P., Filloux, A., Llamas, M.A., 2017. The\u003cem\u003e Pseudomonas putida \u003c/em\u003eT6SS is a plant warden against phytopathogens. ISME J. 11, 972-987.\u003c/li\u003e\n\u003cli\u003eAllsopp, L.P., Wood, T.E., Howard, S.A., Maggiorelli, F., Nolan, L.M., Wettstadt, S., et al., 2017. RsmA and AmrZ orchestrate the assembly of all three type VI secretion systems in\u003cem\u003e Pseudomonas aeruginosa\u003c/em\u003e. Proc. Natl. Acad. Sci. U. S. A. 114, 7707-7712.\u003c/li\u003e\n\u003cli\u003eHood, R.D., Singh, P., Hsu, F., G\u0026uuml;vener, T., Carl, M.A., Trinidad, R.R.S., et al., 2010. A type VI secretion system of\u003cem\u003e Pseudomonas aeruginosa \u003c/em\u003etargets a toxin to bacteria. Cell Host Microbe. 7, 25-37.\u003c/li\u003e\n\u003cli\u003eGe, Y., Lee, J.H., Liu, J., Yang, H.-W., Tian, Y., Hu, B., et al., 2019. Homologues of the RNA binding protein RsmA in\u003cem\u003e Pseudomonas syringae\u003c/em\u003e pv. \u003cem\u003etomato\u003c/em\u003e DC3000 exhibit distinct binding affinities with non-coding small RNAs and have distinct roles in virulence. Mol. Plant Pathol. 20, 1217-1236.\u003c/li\u003e\n\u003cli\u003eReimmann, C., Valverde, C., Kay, E., Haas, D., 2005. Posttranscriptional repression of GacS/GacA-controlled genes by the RNA-binding protein RsmE acting together with RsmA in the biocontrol strain \u003cem\u003ePseudomonas fluorescens \u003c/em\u003eCHA0. J. Bacteriol. 187, 276-285.\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Toole. G.A, Kolter, R., 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30: 295-304.\u003c/li\u003e\n\u003cli\u003eR\u0026ouml;mling, U., Galperin, M.Y., and Gomelsky, M. 2013. Cyclic di-GMP: the first 25 years of a universal bacterial second messenger. Microb. Mol. Biol. Rev. 77, 1-52.\u003c/li\u003e\n\u003cli\u003eKing, E.O., Ward, M.K., Raney, D.E., 1954. Two simple media for the demonstration of pyocyanin and fluorescein. J. Lab Clin. Med. 44, 301-307.\u003c/li\u003e\n\u003cli\u003eChilton, M.D., Currier, T.C., Farrand, S.K., Bendich, A.J., Gordon, M.P., Nester, E.W., 1974. \u003cem\u003eAgrobacterium\u003c/em\u003e \u003cem\u003etumefaciens\u003c/em\u003e DNA and PS8 bacteriophage DNA not detected in crown gall tomors. Proc. Natl. Acad. Sci. U. S. A. 71, 3672-3676.\u003c/li\u003e\n\u003cli\u003eZhang, Y., Zhang, Y., Zhang, B., Wu, X., Zhang, L.Q., 2018. Effect of carbon sources on production of 2,4-diacetylphloroglucinol in \u003cem\u003ePseudomonas\u003c/em\u003e \u003cem\u003efluorescens\u003c/em\u003e 2P24. Acta Microbiol. Sin. 58, 1202-1212.\u003c/li\u003e\n\u003cli\u003eSmith, A.W., Iglewski, B.H., 1989. Transformation of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e by electroporation. Nucleic Acids Res.17: 10509.\u003c/li\u003e\n\u003cli\u003eLi, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., et al., 2009. The sequence alignment/map format and SAMtools. Bioinformatics. 25, 2078-2079.\u003c/li\u003e\n\u003cli\u003eTrapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., et al., 2010. Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511-515.\u003c/li\u003e\n\u003cli\u003eMiller, J.H., 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.\u003c/li\u003e\n\u003cli\u003eShanahan, P., O\u0026prime;Sullivan, D.J., Simpson, P., Glennon, J.D., O\u0026prime;Gara, F., 1992. Isolation of 2,4-diacetylphloroglucinol from a fluorescent pseudomonad and investigation of physiological parameters influencing its production. Appl. Environ. Microbiol. 58, 353-358.\u003c/li\u003e\n\u003cli\u003eWei, H.L., Zhang, L.Q., 2006. Quorum-sensing system influences root colonization and biological control ability in \u003cem\u003ePseudomonas\u003c/em\u003e \u003cem\u003efluorescens\u003c/em\u003e 2P24. Antonie van Leeuwenhoek. 89, 267-280.\u003c/li\u003e\n\u003cli\u003eHachani, A., Lossi, N.S., Filloux, A., 2013. A visual assay to monitor T6SS-mediated bacterial competition. J. Vis. Exp. 73, e50103.\u003c/li\u003e\n\u003cli\u003eLiu, J., Zhang, W., Wu, X., Zhang, L., 2013. Effect of\u003cem\u003e retS \u003c/em\u003egene on biosynthesis of 2,4-diacetylphloroglucinol in \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e 2P24. Acta Microbiol. Sin. 53, 118-126.\u003c/li\u003e\n\u003cli\u003eSambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Pseudomonas fluorescens, RsmA/RsmE, 2,4-DAPG, biofilm, motility","lastPublishedDoi":"10.21203/rs.3.rs-29303/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-29303/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003e\u003cem\u003ePseudomonas fluorescens\u003c/em\u003e 2P24 is a rhizosphere bacterium that produces 2,4-diacetyphloroglucinol (2,4-DAPG) as the decisive secondary metabolite to suppress soilborne plant diseases. The biosynthesis of 2,4-DAPG is strictly regulated by the RsmA family proteins RsmA and RsmE. However, mutation of both of \u003cem\u003ersmA\u003c/em\u003e and \u003cem\u003ersmE\u003c/em\u003e genes results in reduced bacterial growth.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eIn this study, we showed that overproduction of 2,4-DAPG in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant influenced the growth of strain 2P24. This delay of growth could be partially reversal when the \u003cem\u003ephlD\u003c/em\u003e gene was deleted or overexpression of the \u003cem\u003ephlG\u003c/em\u003e gene encoding the 2,4-DAPG hydrolase in the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant. RNA-seq analysis of the \u003cem\u003ersmA rsmE\u003c/em\u003e double mutant revealed that a substantial portion of the \u003cem\u003eP. fluorescens\u003c/em\u003e genome was regulated by RsmA family proteins. These genes are involved in the regulation of 2,4-DAPG production, cell motility, carbon metabolism, and type six secretion system.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThese results suggest that RsmA and RsmE are the important regulators of genes involved in the plant-associated strain 2P24 ecologic fitness and operate a sophisticated mechanism for fine-tuning the concentration of 2,4-DAPG in the cells.\u003c/p\u003e","manuscriptTitle":"Pleiotropic Effects of RsmA and RsmE Proteins in Pseudomonas Fluorescens 2P24","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-05-19 21:46:45","doi":"10.21203/rs.3.rs-29303/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2020-06-09T12:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"decision","content":"Major revision","date":"2020-06-09T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-06-05T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewerAgreed","content":"","date":"2020-05-23T12:00:00+00:00","index":2,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-05-19T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2020-05-14T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-05-14T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-05-13T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-05-13T12:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2020-05-11T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"95d9f555-2314-4e21-a484-50ee4c161c10","owner":[],"postedDate":"May 19th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":102899,"name":"General Microbiology"},{"id":102900,"name":"Applied \u0026 Industrial Microbiology"}],"tags":[],"updatedAt":"2020-07-05T15:01:09+00:00","versionOfRecord":{"articleIdentity":"rs-29303","link":"https://doi.org/10.1186/s12866-020-01880-x","journal":{"identity":"bmc-microbiology","isVorOnly":false,"title":"BMC Microbiology"},"publishedOn":"2020-07-02 12:00:00","publishedOnDateReadable":"July 2nd, 2020"},"versionCreatedAt":"2020-05-19 21:46:45","video":"","vorDoi":"10.1186/s12866-020-01880-x","vorDoiUrl":"https://doi.org/10.1186/s12866-020-01880-x","workflowStages":[]},"version":"v1","identity":"rs-29303","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-29303","identity":"rs-29303","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.