Silver Nanoparticles as A Highly Viricidal Agent to Deter Plant-Infecting Viruses and Disrupt their Acquisition and Transmissibility by Vector Aphid

preprint OA: closed CC-BY-4.0

Abstract

Abstract Silver nanoparticles (AgNPs) are a potentially effective tool for deterring viral plant pathogens. This study was carried out to evaluate the efficacy of AgNPs to defeat Bean yellow mosaic virus (BYMV) on faba bean plants from the host, virus and vector aphid tripartite interactions side. The antiviral capabilities were evaluated during a foliar protective and curative scheme. Furthermore, the efficiency of AgNPs on virus acquisition and transmission by its vector aphid was investigated. Results indicated that the AgNPs had greatly exhibited curative viricidal activities for inactivation BYMV when applied 48 h post-virus inoculation. The disease occurrence was entirely inhibited with AgNPs rate as low as 100 mg.l− 1, while the infectivity was completely arrested when plants were preventively exposed to 200 mg.l− 1 24 h pre-virus inoculation. AgNPs proved high bio-reactivity by binding to viral particles, suppressing their replication and accumulation within the plant tissues. Moreover, it was noticeably showed to upregulate the pathogenesis-related gene (PR-1) and promote the defense-related enzymes and protein profiles in treated plants irrespective of concentration. Exposure of aphids to AgNPs-treated plants before virus acquisition excitingly reduced the BYMV acquisition and transmission efficiency by 40.65% up to 100 % 24 h post-application and the virus acquisition was affected for 10 days by 6.89 Up to 79.64 % depending on the AgNPs rate. These results concluded that the AgNPs have a high curing viricidal activity by targeting the virus envelop, and more excitingly it can affect the virus-vector combination, suggesting that it may contribute to alleviating the natural disease occurrence and virus transmission under field conditions. Therefore, according to the available literature, this study provides the first report on the deterring activity of nanomaterials against plant virus acquisition and transmission by its vector insects.
Full text 153,913 characters · extracted from preprint-html · click to expand
Silver Nanoparticles as A Highly Viricidal Agent to Deter Plant-Infecting Viruses and Disrupt their Acquisition and Transmissibility by Vector Aphid | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Silver Nanoparticles as A Highly Viricidal Agent to Deter Plant-Infecting Viruses and Disrupt their Acquisition and Transmissibility by Vector Aphid Ahmed El Gamal, Mohamed Reda Tohamy, Mohamed Ibrahim Abou-Zaid, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-422790/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Silver nanoparticles (AgNPs) are a potentially effective tool for deterring viral plant pathogens. This study was carried out to evaluate the efficacy of AgNPs to defeat Bean yellow mosaic virus (BYMV) on faba bean plants from the host, virus and vector aphid tripartite interactions side. The antiviral capabilities were evaluated during a foliar protective and curative scheme. Furthermore, the efficiency of AgNPs on virus acquisition and transmission by its vector aphid was investigated. Results indicated that the AgNPs had greatly exhibited curative viricidal activities for inactivation BYMV when applied 48 h post-virus inoculation. The disease occurrence was entirely inhibited with AgNPs rate as low as 100 mg.l − 1 , while the infectivity was completely arrested when plants were preventively exposed to 200 mg.l − 1 24 h pre-virus inoculation. AgNPs proved high bio-reactivity by binding to viral particles, suppressing their replication and accumulation within the plant tissues. Moreover, it was noticeably showed to upregulate the pathogenesis-related gene (PR-1) and promote the defense-related enzymes and protein profiles in treated plants irrespective of concentration. Exposure of aphids to AgNPs-treated plants before virus acquisition excitingly reduced the BYMV acquisition and transmission efficiency by 40.65% up to 100 % 24 h post-application and the virus acquisition was affected for 10 days by 6.89 Up to 79.64 % depending on the AgNPs rate. These results concluded that the AgNPs have a high curing viricidal activity by targeting the virus envelop, and more excitingly it can affect the virus-vector combination, suggesting that it may contribute to alleviating the natural disease occurrence and virus transmission under field conditions. Therefore, according to the available literature, this study provides the first report on the deterring activity of nanomaterials against plant virus acquisition and transmission by its vector insects. Immunology General Microbiology Virology plant viruses virus acquisition antivirus silver nanoparticles PR-1 gene faba bean Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Faba bean ( Vicia faba L.) is one of the most important legume crops that is almost consumed daily in numerous developing countries as a human diet of a cheap and high-quality protein source. It has been simultaneously ranked as the third most important feed legume crop worldwide ( 1 , 2 ). Bean yellow mosaic virus (BYMV) a type member of potyviruses is a devastating disease for many legume crops and other ornamental flowers, which poses a significant threat for global faba bean and other legumes production ( 3 , 4 ). In this respect, BYMV becomes one of the most biotic factors that steadily reducing the faba bean production and their cultivated area in Egypt ( 5 ). The virus is naturally transmitted by over 20 species of aphids which can be effectively spread under field conditions, resulting in a high rate of viral infections for faba bean and other host species ( 6 ). In recent years, nanotechnology approaches have emerged as a new potential control means to deter a wide array of plant diseases ( 7 ). However, using nanotechnology tools in plant protection management hasn’t yet widely introduced on a large scale, which still under the research investigations and small scale of production and applications ( 8 , 9 ). Nanoparticles, ranged from 1 to 100 nm in size, prove superior chemical and physical features compare to their bulk materials due to their large surface area to its volume ratio, which strongly offers them to be one of the most promising ways that may effectively be used in many different sectors ( 10 , 11 ). Silver nanoparticles (AgNPs) are metal nanomaterials that have been investigated to be used in many applications notably for the controlling of human and plant pathogenic microorganisms ( 12 , 13 , 14 , 15 ). Due to their unique features, AgNPs have been documented as an antimicrobial agent to control some phytopathogenic fungi and bacteria ( 16 , 17 , 18 , 19 ). Simultaneously, some previous reports have been proved the effectiveness of nano-silver against some plant and human viruses by blocking the virus infectivity and its accumulation within the host tissues ( 20 , 21 ). However, the little efforts that have been done to investigate the AgNPs as an antiviral agent, there is no documented investigations to show the ability of AgNPs to control plant viruses from different tripartite interactions point of view (host, virus and vector interactions), and since the BYMV, as well as more than 75% of other plant viruses, are naturally transmitted by insects, therefore the research aims of the present study were to investigate not only the effectiveness of the AgNPs on virus infectivity and plant responses but also to note whether the pre-acquisition treatment of AgNPs may affect the virus-vector combination by altering the virus acquisition and transmission process. 2. Experimental Methods 2.1. Virus isolation and propagation Faba bean plants showed putative Bean yellow mosaic virus symptoms were collected from a local open field at Giza governorate, Egypt during the 2018 growing season. Leaf samples were initially tested by the serological DAS-ELISA technique as described by Clark and Adams ( 22 ) using a specific polyclonal antibody against BYMV (EPHYRA Bioscience inc., Canada). Positive samples reacted with BYMV antibodies were used as a source of virus inoculum. Ten seedlings of faba bean (cv. Giza 3) and Chenopodium amaranticolor as an indicator host plants were inoculated with a freshly prepared sap inoculum using 0.01M phosphate buffer pH 7.1, (1:10), 0.01% Na 2 SO3 and carborundum (600 mesh). All inoculated plants were grown under insect-proof greenhouse conditions (20–24°C) and daily observed until symptoms develop. The virus was biologically purified from a single local lesion produced on C. amaranticolor using a single lesion technique ( 23 ). The purified isolate was propagated on faba bean plants (cv. Giza 843) and was used as a source of BYMV for further studies. Furthermore, the mechanically inoculated plants with purified BYMV were checked again using the ELISA technique for serological relationship verification against BYMV antiserum and other viruses infecting faba bean plants. 2.2. Molecular identification of BYMV Total RNA was isolated from 50 mg of each healthy and symptomatic leaves using RNeasy Plant Mini Kit (Qiagen Co., Germany) according to the manufacturer’s instructions. Reverse transcription (RT)-PCR reaction was optimized using Verso™ one-Step RT-PCR system (Thermo F. Scientific, USA). A specific primer pair BYMV-CPF and BYMV-CPR were used targeting coat protein (CP) gene region to amplify 907 bp fragment of the BYMV genome as suggested by Al-Khalaf et al. ( 24 ) (Table 1 ). The one-step RT-PCR reaction was performed by combining 25 µl one-Step PCR Master Mix, 1 µl of each primer pair (200 nM), µl 2.5 of RT-enzyme enhancer, 1 µl verso enzyme mix, 3 ng of RNA template and the mixture was completed up to 50 µl using nuclease-free water. The amplification reaction was automated in a T-Gradient thermal cycler (Biometra Co., Germany) with an initial reverse transcription process at 50°C for 15 min, followed by 35 cycles of denaturation at 94°C for 1 min., annealing at 50°C for 1 min and extension at 72°C for 2 min, with a final additional extension step for 10 min at 72°C. The PCR products were electrophoresed on 1 % agarose gel in 0.5 x TAE buffer, then visualized under the Gel Doc. system (2000, Bio-Rad, USA). Table 1 Primers used in the current study to amplify the target coat protein gene of BYMV (CPF-forward, CPR-reverse) in conventional RT-PCR, as well as the selected PR-1 gene and the endogenous reference gene used in qReal time-PCR experiment. primer name primer sequence (5′–3′) target gene BYMV-CPF/CPR BYMV-CPF: GTCGATTTCAATCCGAACAAG BYMV-CPR: GGAGGTGAAACCTCACTAATAC CP gene of BYMV (907 bp) PR-1F/R PR1-F: GGGCAGTGGTGACATAACAGGAA PR1-R: CATCCAACCCGAACCGAAT PR-1 gene ELF1A/F-R ELF1A-F: GTGAAGCCCGGTATGCTTGT ELF1A-R: CTTGAGATCCTTGACTGCAACATT Elongation factor 1- alpha reference gene 2.3. Synthesis of silver nanoparticles (AgNPs) Silver nanoparticles colloidal solution was synthesized by reduction of silver nitrate (AgNO3) [99.99%, Aldrich, US] using a co-precipitation protocol of sodium citrate trihydrate (99%, Aldrich, US) under boiling conditions ( 25 ). Briefly, 50 ml of AgNO3 (0.001 M) was brought to boil under stirring for 5 min in 250 ml beaker, a 5 ml of sodium citrate trihydrate (1%) was then added a drop per second under continuous stirring. The solution color turned pale yellow to yellowish-brown producing a colloidal silver nanoparticles form, then it was left to cool and proceeds for physicochemical characterization. 2.4. Characterization of silver nanoparticles 2.4.1. Particle size determination. The particle size distribution, polydispersity index (PDI) and zeta potential of AgNPs were measured using the Dynamic Light scattering (DLS) analysis on Zetasizer (Malvern, ZS Nano, UK). The colloidal nanoparticles solution was diluted with distilled water and put into a disposable glass cuvette for analysis ( 26 ). 2.4.2. X-ray Diffraction (XRD) measurement. The Physico-chemical crystalline nature of AgNPs was confirmed using X-Ray diffractometer (X‘pert PRO, PAN analytical, Netherlands) operated by Cu K radiation tube (= 1.54 A˚) at 40 kV. Colloidal AgNPs solution was centrifuged at 20,000 rpm for 30 min at 4 c for powder phase yield, the precipitated AgNPs were dried, then bombarded by X-ray for phase analysis ( 27 ). 2.4.3. Surface morphology determination. Particle size and the actual shape of AgNPs were performed by High-Resolution Transmission Electron Microscope (HR-TEM) (Tecnai G2, FEI, Netherlands) under an accelerating voltage of 200 kV. 2.5. Effect of silver nanoparticles on virus infectivity 2.5.1. AgNPs Treatments. Foliar applications of AgNPs were carried out under an insect-proof greenhouse with two protective and curative schemes, using six tested concentrations of AgNPs (50, 100, 150, 200, 250 and 300 mg.l − 1 ). Ten days old faba bean young plants (cv. Giza 843) were uniformly sprayed with the AgNPs concentrations 24 h pre (protective)- and 48 h (curative)- post virus challenge. The potted plants were mechanically inoculated with a cured sap of BYMV- infected plants and water-treated plants were served as a control. 2.5.2. Disease assessment. The percentage of disease occurrence and severity of symptoms was assessed three weeks later using a numerical scale of 0–4 grads, where 0 = no visible symptom apparent; 1 = mild chlorotic patterns; 2 = mosaic patterns and dark green vein banding; 3 = mosaic patterns, leaf distortion, and reduction in leaf size; 4 = severe mosaic and stunting of the whole plant. Values of disease severity were estimated by the following formula ( 28 ): Where A is the mean average of DI or DS values in untreated control plants; B is the average values in each treatment. 2.5.3. Determination of virus accumulation content. A newly emerged small leaves were collected 30 days post-inoculation to detect the BYMV accumulation and to further confirm the virus replication inhibition rate in AgNPs-treated and untreated plants using the double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) ( 22 ). The reactions were quantified at 405 nm in a microplate reader (BioTek, USA). Samples were considered positive when OD405 values were two times higher than the mean of the healthy control. 2.5.4. Transmission electron microscope. The direct activity of AgNPs on viral particles was investigated in faba plants curatively treated with 300 mg.l − 1 compared to untreated control. The leaf-dip preparation method was performed to increase the probability of examination five days after virus inoculation. Briefly, the leaf samples of both treated and untreated plants were washed, disked and resuspended in deionized water to remove any surface-AgNPs attached to the leaf samples. The samples were ground in a drop of phosphate buffer pH 7.5 and 0.01% Na 2 SO 3 . A 10 µl of leaf extracts were individually loaded on carbon-coated grids for 5 min, washed with distilled water and negatively stained with 2 % uranyl acetate ( 29 ). The grids were examined using a Jeol JEM1400 transmission electron microscope (TEM) (JEOL Co., Tokyo, Japan). 2.6. Enzyme activity assays Fresh leaves (0.2g) from all treated and untreated plants were collected at 0, 24, 48, 72, 96, 120 and 144 h post-AgNPs spraying. The peroxidase (POD) and polyphenol oxidase (PPO) antioxidant enzyme activities were assayed using the methods described by Kar and Mishra ( 30 ). Changes in activities were expressed as nmol of guaiacol per mg − 1 protein. min − 1. All experiments were performed in three biological replicates. 2.7. Protein pattern analysis Protein extract and separation were performed according to the procedure of Laemmli ( 31 ) with some modifications. Samples with 1 g of fresh leaves were collected from both AgNPs-treated and untreated plants 48 h after application. Leaf samples were ground in 0.5 ml Laemmli buffer, then centrifuged at 14,000 rpm for 20 min at 4°C. Protein contents were quantified against the bovine serum albumin (BSA) standards using a colorimetric (Bradford) protein assay protocol ( Thermo F. Scientific, USA). An equal amount of protein content for each sample (40 µg) was diluted with an equal volume of loading buffer (0.125 M Tris–HCl, pH 6.8, 4% SDS, 10% glycerol, 1% 2-mercaptoethanol and 0.01% bromophenol blue dye). The mixture was incubated in a water bath for 3 min at 95°C and separated by electrophoresis using 10% sodium dodecyl sulfate-polyacrylamide (SDS–PAGE) gel for 6 h. The gel was incubated in 1% nitric acid for 3 min and protein bands were visualized using 0.2% silver nitrate in a de-stain solution of 7% glacial acetic: 40 % methanol solution: 53 % distilled water solution (v/v). 2.8. PR-1 gene expression analysis using quantitative real time-PCR (qRT-PCR) 2.8.1. cDNA synthesis. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen) protocol. The harvested RNA (2 µg) was primed with Oligo (dT) and converted into the first-strand cDNA by using COSMO cDNA synthesis kit (Willowfort, UK) according to the manufacturer’s protocol. The cDNA synthesis reaction was performed in a T-Gradient thermal cycler with initial annealing at 25°C for 10 min., followed by an extension phase at 45°C for 15 min. 2.8.2. qRT-PCR analysis. Gene-specific primer encoding pathogenesis-related protein (PR-1 F/R) was designed according to Cheng et al . ( 32 ). Meanwhile, the elongation factor 1- alpha was used as an endogens reference gene (ELF1A/F-R) (Table 1 ). The HERA SYBR Green qPCR kit (Willowfort, UK) was used for RT-qPCR analysis with 20µl reaction mixture consisting of 10µl SYBR green master mix, nuclease-free water (7.2µl), diluted cDNA template (2µl) and 0.5µl of each primer. The qRT-PCR program was performed as follows: 95°C for 2 min initially, followed by 40 cycles at 95°C for 1 min and 60°C for 30 s. The reaction was normalized with melting curve analysis at 65°C for 10 s for 61 cycles. The changes in gene expression were calculated based on the internal reference gene using the 2 −ΔΔCt method ( 33 ). Each experiment was conducted in three biological replicates. 2.9. Effect on virus acquisition and transmission 2.9.1. Aphid cultures. Colonies of Aphis craccivora Koch. were collected from early grown faba bean fields at Giza Research Station, Agric. Res. Center (ARC), Egypt. The aphids were reared on cabbage seedlings under insect-proof cages for a long period of experimental time. Filial generations were used in subsequent as a source of non-viruliferous aphid cultures. 2.9.2. Treatments and virus acquisition assay. The BYMV acquisition assay was done 1, 5- and 10 days post foliar spraying of AgNPs treatments (50, 100, 150, 200, 250 and 300 mg.l − 1 ) compared to untreated control. Aphids were starved for 1 h before deposited on a BYMV-free plant treated with AgNPs for a propping period of 3 h, which allow most of them to get in contact with AgNPs. The aphids of each treatment were separately moved to BYMV-infected plants and left to feed (2 h) for virus acquisition. At the end of 2 h, aphids were transferred individually as one aphid per healthy plant and were left for an inoculation feeding period of 24 h. The acquisition efficiency was also determined by leaving aphids to feed directly on BYMV-infected plants which were individually treated with the tested AgNPs rates. The percentage of the acquisition was computed as the number of aphids that transmitted the virus/ total number of aphids x100. Virus incidence in the symptomless plants was checked by back inoculation made on Ch. amaranticolor plants and also by using the DAS-ELISA technique. 2.9.3. Coat protein gene accumulation . Leaf samples of faba bean plants were collected 30 days after acquisition assay for all AgNPs treatments sprayed 24 h. pre-acquisition. The total RNA extraction, the primer used and RT-PCR reaction were performed as mentioned above. 2.10. Statistical analysis Data were statistically analyzed using Completely Randomized Design (CRD) for analysis of variance (ANOVA) by the Assistat-statistics Software, Version 7.7 Beta ( 34 ). Each experiment was performed in three repeats. 3. Results 3.1. Virus isolation and propagation Bean yellow mosaic virus was isolated from naturally infected faba bean plants showed BYMV-like symptoms. The isolated BYMV produced severe mosaic symptoms on faba bean plant and similar to those observed in the field ( Fig. 1A,B ). The presence of BYMV isolate was confirmed by DAS-ELISA in mechanically inoculated plants and all samples were positive for BYMV. The virus titer was quantified with 1.206 OD and 0.743 OD in faba bean and C. amaranticolur plants respectively, compared with 0.318 OD at negative control. Whereas, it was failed to react with antiserum specific for other viruses affecting faba bean plants. 3.2. Molecular identification of BYMV The BYMV isolate was confirmed using the RT-PCR molecular tool ( Fig. 1C ). As illustrated by the agarose gel electrophoresis analysis, two samples of BYMV-infected plants produced a clear band at the expected amplicon size of 907 bp, however, no PCR products were achieved from healthy faba bean plants used as a negative control. 3.3. Characterization of silver nanoparticles The physicochemical properties of the synthesized AgNPs were measured using different techniques. The size distribution profile and surface zeta potential were examined in AgNP colloidal aqueous solution. The synthesized nano-silver showed an excellent polydispersity index (PDI) 0.302, with a high negative surface area charge at a zeta potential of − 36.50 mV ( Fig. 2A ). The average hydrodynamic size of the synthesized particles was found to be 7.43 nm with a range between 4.56 to 12.38 nm ( Fig. 2B ). In this respect, the HR-TEM image indicates a well uniformed spherical crystal structure of AgNPs with average diameter size particles of 8.54 nm ( Fig. 2D ). The crystalline fingerprint nature of silver nanoparticles was obtained by XRD. ( Fig. 2C ). The XRD pattern showed four prominent peaks at 38.14, 44.36, 64.49 and 77.44 2θ angles in crossbanding to (111), (200), (220) and (311) hkl parameter respectively and based on Bragg’s reflection low. 3.4. Effect of AgNPs on virus infectivity. Silver nanoparticles were superiorly found to exhibit antiviral activities against plant virus infection ( Fig. 3A, B, C ). The AgNPs treatments applied 48 h post-inoculation had exhibited higher viricidal activity more than that exposed 24 h pre-inoculation ( Fig. 3A, B) . Water-treated plants inoculated with BYMV showed severe mosaic, yellowing and stunting symptoms ( Fig. 3C) . Noticeably, a complete reduction in virus infectivity was obtained by 200, 250 and 300 mg.l − 1 AgNPs either when applied pre- or post-virus challenge, while the rate of 100 and 150 mg l − 1 only exhibited a complete reduction in virus occurrence when sprayed 48 h post-inoculation. Further, the virus occurrence and disease severity were greatly decreased in the 50 mg.l − 1 treated plants by 74.67 % and 89.14 % respectively, over untreated control and more than that obtained when applied 24 h pre-inoculation ( Fig. 3B ). In this respect, AgNPs display their ability to target the BYMV particles coat protein in treated plants, resulting in defeating the virus infectivity and disease proliferation ( Fig. 4 ). 3.5. Effect of AgNPs on virus content Virus accumulation was dramatically affected by AgNPs treatments depending on its rate and time of exposure. As presented by Fig. 3 (D, E) the highest virus titer was quantified with 1.504 OD in untreated positive control plants compared to 0.284 OD at healthy negative control. BYMV content was entirely arrested with 200, 250 300 mg.l − 1 AgNPs treatments when applied 24 h pre-inoculation, while 50, 100 and 150 mg.l − 1 rates significantly decreased the virus accumulation by 39.69 % (0.907 OD), 36.17% (0.960 OD) and 51.66% (0.728 OD) respectively ( Fig. 3D ). However, the AgNPs treatments sprayed 48 h post-inoculation had produced a negative ELISA reaction against BYMV at all tested concentrations excepted for 50 mg.l − 1 albeit with a significant reduction in the virus content by 51.86% (0.724 OD) in 50 mg.l − 1 treated plants compared to untreated control ( Fig. 3E) . 3.6. Changes in oxidative enzyme activity Peroxidase (POD) and polyphenol oxidase (PPO) activity were considerably generated upon exposure to AgNPs applications as compared to control irrespective of concentrations ( Fig. 5A ). Interestingly, the peak of PO activity stimulated by 150 mg.l − 1 spray was steadily increased at 24 h (2.04 fold) reaching its maximum with 3.57 fold at 144 h post-application. However, leaves treated with 300 mg.l − 1 showed a log-like phase of activity at 24 h (2.43 fold) and 48 h (4.26 fold), sharply decreased afterward at 144 h. Further, all AgNPs rates were constantly found to keep the activity peaks higher than either did of 300 mg.l − 1 and untreated control at the end of the time course. However, the maximum increase in PPO activity was significantly observed in leaves treated with 250 and 300 mg.l − 1 over the untreated control, reaching its maximum with 2.92 and 2.25 at 120 and 72 h respectively. The PPO activity was not significantly affected upon exposure to 50 and 100 mg.l − 1 sprayings during the all-time course excepted at 72 h (0.65 fold) and 48 h (0.91 fold) respectively. 3.7. Changes in protein constituents Foliar spraying of AgNPs proved some alterations of protein profile in treated faba bean leaves compared to both untreated infected and healthy control plants. Two new protein bands with about 90 and 140 kDa were observed and more or less accumulated depending on the AgNPs rate, while the BYMV-inoculated plants produce two polypeptides of 55 and 90 kDa compared to healthy control. Interestingly, the intensity of protein bands was increased as the AgNPs concentrations increased in which the band intensity was markedly accumulated in 50, 100 and 200 mg.l − 1 and start to decrease at 300 mg.l − 1 rate with a notable disappearance of some polypeptides which accumulated in other treatments ( Fig. 5B ). 3.8. Changes in gene expression level The transcription level of the defense-related PR-1 gene involved in response to plant biotic and abiotic stress was measured by qRT-PCR in AgNPs-treated and untreated plants ( Fig .5 C ). The gene expression levels were differentially promoted with the tested applications of AgNPs over the untreated plants. Following the 100 mg.l − 1 application, the fold change in gene expression was promoted with 8.51. The highest level of expression was generated with a 12.06 fold change in faba bean plants treated with 200 mg.l − 1 rate, while the lowest level of expression among the three tested concentrations was generated with a 5.36 fold over the control when the rate of AgNPs increased to 300 mg.l − 1 . 3.9. Effect on virus-vector interaction The direct activity of AgNPs on the ability of vector aphid to acquire BYMV particles and transmit it to other healthy plants was excitingly investigated after exposure to AgNPs-treated plants ( Fig. 6A, B, C ). Notably, a significant inhibition in virus acquisition and transmissibility was noted 1, 5 and 10 days after spraying with all tested concentrations compared to the untreated control, except for 50 mg.l − 1 at 10 days ( Fig .6 A ). The rate of acquisition was blocked totally by 300 mg.l − 1 at 1 and 5 days after application, while a great inhibition,79.64 % was observed at 10 days compared to untreated control. However, the 250 mg.l − 1 application completely blocked the virus acquisition and transmission 1 day after spraying. Furthermore, the 150 and 200 mg.l − 1 applications produced a significant reduction in virus acquisition by 89.45 and 77.61% for 1 day to reach 61.32% and 57.05% at 10 days respectively, while the 50 and 100 mg.l − 1 treatments significantly reduced the virus acquisition for 1 day by 40.65% and 66.21% respectively. On the other hands, the AgNPs treatments applied to BYMV-infected plants strongly affect the aphid ability to acquire the virus 24 h post spraying, proved a complete inhibition in virus acquisition and transmission at rates of 150, 200, 250 and 300 mg.l − 1 , while the 50 mg.l-1 and 100 mg.l-1 application greatly reduced the proportion of acquisition by 61.81 % and 86.91 % respectively ( Fig. 6D ). Coat protein gene accumulation was qualitatively measured using conventional RT-PCR reaction to confirm the efficacy of AgNPs on virus acquisition and transmissibility ( Fig. 6B ). Exposure to 300 and 250 mg.l − 1 of AgNPs hadn’t exhibited any viral RNA reproducibility (lane 2 and 3 respectively) compared to control plants that produced a high-intensity band reflecting a higher accumulation of viral RNA compared to AgNPs-treated plants. However, the intensity of PCR bands was less than that of control at exposure to 150 and 200 mg.l − 1 , while the CP gene accumulation bands for 50 and 100 mg.l − 1 rates were approximately similar in band intensity as control. 4. Discussion The control measures used to deter plant viruses are obtained during the pesticide application against vector, however, it is often ineffective with non-persistently transmitted viruses due to the short propping and subsequent inoculation time required for virus transmission by incoming viruliferous vectors ( 35 , 36 , 37 ). Hence, searching for effective innovation technologies is urgently needed to prevent crop losses and maintain sustainable agriculture without going into a pesticide treadmill. The present research was planned to investigate the role of AgNPs capabilities in controlling BYMV disease either by testing its direct or indirect activity on virus infectivity and/or during the evaluation of AgNPs on aphid feeding behavior through the combating of virus acquisition and transmissibility by vector aphid from infected to healthy plants. Concerning the effect of AgNPs on virus infectivity and host-virus interactions, the AgNPs proved a superior effect and highly prominent antiviral activities in curatively treated plants compared to the protective applications, the disease occurrence and virus accumulation content were entirely arrested at low rates of AgNPs in plants treated 48 h post-virus inoculation than those preventively exposed 24 h pre-inoculation. Generally, the AgNPs applied to the plant foliage are absorbed, dispersed into the plant cells and it was found to interact with many macromolecules, lipids, pectin, lignin and other cellular components ( 38 ). Furthermore, AgNPs have a high protein-affinity that facilitates interacting with a wide array of host proteins and cellular entities ( 39 , 40 ). Accordingly, these phenomena support our suggestion that the rate of free dispersed nanoparticles that are required to interfere with the virus units might be captured by plant proteins and other cellular components when plants are preventively treated 24 h ahead to virus inoculation. Conversely, the application of AgNPs after virus inoculation could increase the probability of a high number of nano-silver particles to target the viral proteins and/or the whole virus particle that eventually exhibit outstanding efficiency in suppressing BYMV disease compared to preventive applications of AgNPs applied at the same concentrations. The AgNPs-plant protein interactions are not documented clearly but other previous studies stated that the initial interaction between proteins and metal nanoparticles changes their in vivo properties and has remarkably altered the mechanism of nanoparticle interaction with other cell targets ( 41 ). As demonstrated in the present study, the transmission electron microscope confirms the ability of AgNPs to suppress viral infection in faba bean plants by targeting the BYMV particles directly when applied after virus inoculation. A potential notion for this may be due to the synthesized AgNPs have a surface area with negative charges, resulting in a high surface bio-reactivity to hold the viral capsid proteins which prominently contain a high positive charge. The results obtained herein are convergent with a previous finding that proved the ability of nano-silver particles to extensively aggregate and interfere with the viral envelope protein units of Potato virus Y in vitro ( 42 ). Thus, it is reasonable to argue that the AgNPs effects on the virus particles may be determined by the particle chemical nature, reactivity and the free dispersed amount of NPs present in the plant. Unfortunately, very limited reports have been conducted on the AgNPs-virus interactions and the mode of action of AgNP on virus particles still rather unambiguous in many plant, animal and human viruses. The underlying mechanisms of action of AgNPs have been proved as a novel therapeutic agent against some human and animal viruses ( 43 ). Due to the high affinity of Ag ions for nitrogen and sulfur, it is believed that it can disrupt the structure of many viral proteins by binding to amino and thiol groups. In this respect, Khandelwal et al. ( 44 ) documented that the antiviral activity of AgNPs and other metal nanoparticles might be attributed by interference with glycoproteins of the viral envelope which might ultimately prevent the virus invasion, uncoating of viral coat protein and the subsequent replication process of virus particles within the host cell. The small engineered size of NPs of 7–20 nm was proved to have higher antiviral effects by binding to the viral nucleic acid, translated functional proteins and cellular factors during the virus replication ( 45 ). This supports the notion that the AgNPs particle size seems to be critical for its antiviral properties. To some extent, all this fact might point out the role of silver in controlling plant viruses. However, more studies are required to prove the direct underlying mechanism of action for AgNPs in combating plant viruses, since the plant viruses have a different nature than other animal and human viruses especially in their mode of infection and cell invading. Moreover and given that the role of plant plasmodesmata in transporting substances including invaded-viruses from cells to another and since the nanoparticles are easily dispersed in the plant through its intercellular structure channels, with particle size less than 40 nm ( 46 ), we also envision that the AgNPs could affect the plasmodesmata protein factors and/or viral movement protein complex that facilities the virus cell-to-cell movement ( Fig. 7A ). Regarding the AgNPs ability in promoting the plant defense mechanism against the virus invading, our findings indicate that the changes in enzymes activity, upregulation of PR-1 gene expression and protein accumulation was not associated with increasing the application rate of AgNPs, in which the highest tested concentration of AgNPs affects the POD activity peak and reduced the protein accumulation. Furthermore, the upregulation of the PR-1 gene was lower than that obtained at the lowest tested dose. This finding suggests that the antiviral activity of AgNPs in defeating BYMV is not strongly correlated with strengthened plant immunity against the virus and the direct inhibition depending on the reactivity of AgNPs to virus remained sufficient to arrest the virus infectivity, albeit a dual role by stimulating plant resistance may be obtained with low AgNPs concentrations. Generally, AgNPs have been found to increase the plant oxidative enzymes and up-regulated the immunity-related genes such as PR-1 with very low concentrations ( 47 ). The mechanism underlying the role of AgNPs to motivate some adaptive mechanisms in plant defense booster is mainly due to its potential to enhance the reactive oxygen species (ROS) in treated plants ( 48 ). In this respect, plants activate some enzymatic and non-enzymatic constituents as a scavenging system to cope with the toxic free radicals of oxygen to prevent cell damage. All previous reports have indicated that the ROS is increased with increasing the AgNPs concentrations and with reducing particle size ( 49 ). Therefore and as the results reported herein, the sharp decrease in the peak of POD activity with the increasing of AgNPs rate is might be an indicator of removal of stressful conditions by other enzymatic scavenging systems, and since the faba bean plants have high phenolic content, the ongoing increase in oxidative enzymes like POD as a response for an excess generation of ROS could resulting in high oxidizing rate for phenolics that might ultimately affect the plant cell integrity. Consistent to results obtained herein concerning the protein accumulation and relative expression of PR-1 gene, previous studies have been differentially proved the AgNPs ability to up-regulate many biotic and abiotic-specific genes and increased protein accumulation in several treated plants at low rates, while considerable numbers of genes were down-regulated with increasing AgNPs rate ( 50 , 51 ). Arising from this fact is the AgNPs applied with high concentrations may damage the plant transcription machinery and genomic background in treated plants applied with high concentrations ( 52 , 53 ), which could concurrently affect the transcription level of some defense-related genes, protein accumulation and the synthesis of viral polyproteins depending on the AgNPs rate. The first required step for virus transmission is the ability of vector insects to acquire the virus from an infected plant and transmit it to other healthy plants. To the best of our knowledge and according to the available literature, there is nothing prior study was conducted to investigate the AgNP activity against virus acquisition and subsequent transmission by vector aphids. Thus, for this study, it was of interest to decide whether AgNPs can effectuate the virus-vector interaction and disrupt the virus acquisition and transmission capabilities. Our results clearly showed that the AgNPs applied prior-the virus acquisition greatly affects the BYMV transmission 24 h soon after application, to reach 100 % at 250 and 300 mg.l − 1 . The inhibiting activity reduced with time, and the virus acquisition was effectively inhibited for 10 days by more than 50 % at all tested concentrations excepted at the rate of 50 and 100 mg.l − 1 . No previous studies hypothesized the direct activity of AgNPs on virus-vector interaction, however, a few studies have elicited the activity of AgNPs and other metal nanomaterials on insect mortality, oviposition, feeding and larva development ( 54 ). Further, a trial conducted by Chakravarthy et al. ( 55 ) stated that AgNPs applied at high concentration (2400 mg.l − 1 ) had damaged the whole insect digestive system leading to insect death, while the concentration of AgNPs lower than 50 mg,l − 1 caused chronic toxicity by affecting the reproduction, emergence and larval development ( 56 ). Generally, non-persistent plant viruses including BYMV are retained in receptors present on the stylets common duct of insect mouthpart and are injected to the plant by salivating during brief intracellular punctures, these receptors are cuticular proteins that readily accessible all over the surface of the acrostylet responsible for the aphid transmission of potyviruses and many other plant viruses ( 57 ). The current understanding of how AgNPs interfere with intracellular components inside the insect is almost non-existent, however, the known mechanism is that AgNPs can interact with insect protein involved in serval cellular functions ( 58 ). Accordingly, we speculate that exposure of aphids to AgNPs treatments before virus acquisition may properly affect the cuticular proteins binding to aphid mouthpart, altering the ability of vector aphids to acquire the virus. On the other hand, our study illustrates the ability of AgNPs treatments to prevent aphids to acquire the virus from AgNPs-treated plants infected with BYMV, in which the acquisition and transmission were entirely inhabited as low concentration as 150 mg.l − 1 . Coat protein (CP) encapsidating the viral nucleic acid is the critical point in virus transmissibility by aphid vector in which the virus particles adhere to stylet mouthpart through motifs in CP and another viral protein called helper-component protein (HC-pro) that acts as a bridge between virus particles and the receptor proteins on insect stylet ( 59 ), hence, lacking in aphid transmissibility for viruses may occur with a chemical or physical change in the virus particles and the configurational HC-Pro protein. Consequently, and as demonstrated in the current study, it is plausible to suggest that the inhibition in virus acquisition and transmissibility when AgNPs applied on BYMV-infected plants may be due to the ability of AgNPs to interfere with viral CP and HC-pro proteins before the aphid came in contact with the virus particles, which could sequester or prevent the virus particles to adhere to the receptors on stylet mouthpart ( Fig. 7B ). 5. Conclusion In conclusion, despite the available information about the antiviral capabilities of AgNPs and their toxicity against pests, no knowledge was elicited on its possibility to affect the virus -vector interactions. These results surprisingly cast a new light on the potentiality of AgNPs to influence the virus acquisition and transmission by vector insect, which could be attributable to either by affecting the insect stylet mouthpart and/or by subverting or interference with viral CP and HC-pro proteins involved in virus-aphid transmissibility. However, further expanded research on this initial study is needed to explore the actual mechanisms underlying the critical role of silver nanoparticles in the virus-vector interactome. Importantly, this work introduces a new approach to utilize such nanoparticles as a potential candidate against insect transmitted-plant viruses, which could offer a new alternative strategy to control plant viruses under field conditions. However, further research should be carried out to assess the environmental and health cost before abundantly use in the cropping system compared to those conventional pesticides that are widely used in the agricultural sector. 6. Declarations Acknowledgment The authors gratefully would like to thank the Central Laboratory of Nanotechnology & Advanced Materials, Agricultural Research Center (ARC), Giza, Egypt, for providing some laboratory facilities for the characterization of synthesized silver nanoparticles. 7. References Singh AK, Bharati RC, Manibhushan NC, Pedpati A (2013) An assessment of faba bean ( Vicia faba L.) current status and future prospects. African J. Gric. Res. , 8 (50): 6634–6641. https://academicjournals.org/article/article1387443711_Singh%20et%20al.pdf Robinson GHJ, Balk J, Domoney C (2019) Improving pulse crops as a source of protein, starch and micronutrients. NutrBull .,44(3):202–215. https://doi.org/10.1111/nbu.12399 Miteva E, Hristova D, Nenova V, Maneva S (2005) Arsenic as a factor affecting virus infection in tomato plants: Changes in plant growth, peroxidase activity and chloroplast pigments. Scientia Hortic. , 105: 343–358. https://doi.org/10.1016/j.scienta.2005.01.026 Sharma PN, Sharma V, Anuradha S, Rajput K, Sharma SK (2015) Identification and molecular characterization of Bean yellow mosaic virus infecting French bean in Himachal Pradesh. VirusDisease , 26(4): 315–318. doi: 10.1007/s13337-015-0270-z El-Bramawy MAE, El-Beshehy EKF (2011) The Resistance of Bean yellow mosaic virus (BYMV) in faba bean ( Vicia faba L.) with diallel analysis. J. Biol. Life Sci. , 2 (1): 1–15. DOI: 10.5296/jbls.v2i1.588 Hampton RO, Jensen A, Hagel GT (2005) Attributes of Bean Yellow Mosaic Potyvirus Transmission from Clover to Snap Beans by Four Species of Aphids ( Homoptera: Aphididae ). J. Eco. Entomol ., 98(6): 1816–1823. https://doi:10.1603/0022-0493-98.6.1816 Singh S, Singh BK, Ydava SM, Kupta AK (2014) Applications of nanotechnology in agriculture and their role in disease management. Res. J. Nanosci. Nanotecnol ., ISSN 1996–5044. DOI: 10.3923/rjnn.2015.1.5 Prasad R, Bhattacharyya A, Nguyen QD (2017) Nanotechnology in Sustainable Agriculture: Recent Developments, Challenges, and Perspectives. Front Microbiol ., 8:1014. https://doi:10.3389/fmicb.2017.01014 Luca M (2018) Nanotechnology in Agriculture: New Opportunities and Perspectives, New Visions in Plant Science, IntechOpen, http://doi:10.5772/intechopen.74425 Osuwa JC, Anusionwu PC (2011) Some advances and prospects in nanotechnology: a review. Asian J. Inform. technol. , 10 (2):96–100. DOI: 10.3923/ajit.2011.96.100 Bakshi M, Singh HB, Abhilash PC (2014) The unseen impact of nanoparticles: more or less?” Current Science ,106: (3)350–352. https://www.jstor.org/stable/24099889 Rai M, Yadav A, Gade A (2009) Silver nanoparticles as a new generation of antimicrobials. Biotechnol. Advance , 27 (1): 76–83. https://doi.org/10.1016/j.biotechadv.2008.09.002 Chaloupka K, Malam Y, Seifalian AM (2010) Nanosilver as a new generation of nanoproducts in biomedical applications.” Trends in Biotechnol. , 28 (11): 580–588. https://doi.org/10.1016/j.tibtech.2010.07.006 Elbeshehy EKF, Elazzazy AM, Aggelis G (2015) Silver nanoparticles synthesis mediated by new isolates of Bacillus spp ., nanoparticle characterization and their activity against Bean yellow mosaic virus and human pathogens. Front. Microbiol ., 6:453–465. DOI: 10.3389/fmicb.2015.00453 Burduşel AC, Gherasim O, Grumezescu AM, Mogoant,ã L, Ficai A, Andronescu E (2018) Biomedical applications of silver nanoparticles: an up-to-date overview. J. Nanomaterials 8:E681. http://doi:10.3390/nano8090681 Jain D, Daima HK, Kachhwaha S, Kothari SL (2009) Synthesis of plant-mediated silver nanoparticles using papaya fruit extract and evaluation of their antimicrobial activities, Dig. J. Nanomaterial Biostruc. , 4 (3): 557–653. https://chalcogen.ro/557_Jain.pdf Mishra S, Singh HB (2015) Biosynthesized silver nanoparticles as a nanoweapon against phytopathogens: exploring their scope and potential in agriculture. Appl. Microbiol. Biotechnol ., 99: 1097–1107. https://pubmed.ncbi.nlm.nih.gov/25547832/ Huang W, Yan M, Duan H, Bi Y, Cheng X, Yu H (2020) Synergistic Antifungal Activity of Green Synthesized Silver Nanoparticles and Epoxiconazole against Setosphaeria turcica . J. Nanomaterials . https://doi.org/10.1155/2020/9535432 Noshad A, Mudassar L, Hetherington C, Wahab H (2020) Biogenic AgNPs—A Nano Weapon against Bacterial Canker of Tomato (BCT). Advances in Agriculture , (3): 1–10, https://doi.org/10.1155/2020/9630785 Jain D, Kothari SL (2014) Green Synthesis of Silver Nanoparticles and their Application in Plant Virus Inhibition. Mycol. Plant Pathol ., 44(1): 21–24. https://www.researchgate.net/publication/260981626 Yang XX, Li CM, Huang CZ (2016) Curcumin modified silver nanoparticles for highly efficient inhibition of respiratory syncytial virus infection. Nanoscale , 8: 3040–3048. DOI: 10.1039/C5NR07918G Clark MF, Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol ., 34:475–483. https://doi.org/10.1099/0022-1317-34-3-475 Kuhn CW (1964) Separation of cowpea virus mixtures. Phytopathol. , 54:739–740 AL-Khalaf M, Kumari SG, Kasem A, Makkouk KM, Shalaby AA, AL-Chaabi SA (2008) Molecular characterization of a Bean yellow mosaic virus isolate from Syria. Phytopathol Mediterr, 47: 282–285. https://doi.org/10.14601/Phytopathol_Mediterr-2734 Van Dong P, Ha CH, Binh LT, Kaspom J (2012) Chemical synthesis and antibacterial activity of novel-shaped silver nanoparticles. Int. Nano. Lett ., 2, 9. https://doi.org/10.1186/2228-5326-2-9 Richard CM, Braydich-Stolle L, Schrand AM, Schlager J, Hussain SM (2008) Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique. Toxicological Sciences , 101 (2): 239–253. DOI: 10.1093/toxsci/kfm240 Phanjom DP, Zoremi E, Mazumder J, Saha M, Baruah SB (2012) Green synthesis of silver nanoparticles using leaf extract of Myrica esculenta . Int. J. NanoSci. Nanotechnol, 7 : 991–998. https://www.researchgate.net/publication/273762430 Yang X, Liangyi K, Tien P (1996) Resistance of tomato infected with cucumber mosaic virus satellite RNA to potato spindle tuber viroid. Ann. Appl. Biol. , 129: 543–551. https://doi.org/10.1111/j.1744-7348.1996.tb05775.x Campos RE, Bejerman N, Nome C, Laguna IG, Pardina PR (2013) Bean Yellow Mosaic Virus in Soybean from Argentina. J. Phytopathol. , 162: 322–325. https://doi.org/10.1111/jph.12185 Kar M, Mishra D (1976) Catalase, peroxidase, and polyphenol oxidase activities during rice leaf senescence. Plant Physiol ., 57:315–319. Doi: 10.1104/pp.57.2.315 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head bacteriophage T4. Nature , 227: 680–685. https://www.nature.com/articles/227680a0 Cheng Y, Zhang H, Yao J, Wang X, Xu J, Han Q, Wei G, Huang L, Kang Z (2012) Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen. BMC Plant Biol 12:96. DOI:10.1186/1471-2229-12-96 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29 (9): 1–45. DOI: 10.1093/nar/29.9.e45 Siliva FDA, Azevedo CA (2009) Principal Components Analysis in the Software Assistat-Statistical Attendance. In: world congress on computers in agriculture, 7, Reno-NV-USA: American Society of Agricultural and Biological Engineers. https://www.scirp.org/(S(i43dyn45teexjx455qlt3d2q) Kumari SG, Makkouk K (2007) Virus diseases of faba bean (Vicia faba L.) in Asia and Africa. Plant viruses , 1(1): 93–105. https://www.researchgate.net/publication/272293078_Virus_diseases_of_faba_bean_Vicia_faba_L_in_Asia_and_Africa Bragard C, Caciagli P, Lemaire O, Lopez-Moya JJ, MacFarlane S, Peters D, Susi P, Torrance L (2013) Status and prospects of plant virus control through interference with vector transmission. Annu. Rev. Phytopathol. , 51:177–201. https://doi:10.1146/annurev-phyto-082712-102346 Jones RAC (2014) Trends in plant virus epidemiology: Opportunities from new improved technologies. Virus Res. , 186: 3–19. DOI: 10.1016/j.virusres.2013.11.003 Zuverza-Mena N, Armendariz R, Peralta-Videa JR, Gardea-Torresdey JL (2016) Effects of silver nanoparticles on radish sprouts: root growth reduction and modifications in the nutritional value. Front Plant Sci 7:90. Doi:10.3389/fpls.2016.00090 Banerjee V. and Das K (2013) Interaction of silver nanoparticles with proteins: A characteristic protein concentration-dependent profile of SPR signal. Colloids and surfaces. B, Biointerfaces . 11(1):71–79. https://doi:10.1016/j.colsurfb.2013.04.052 Ribeiro APC, Anbu S, Alegria ECBA, Fernandes AR, Baptista PV, Mendes R, Pombeiro AJL (2018) Evaluation of cell toxicity and DNA and protein binding of green synthesized silver nanoparticles. Biomedicine and Pharmacotherapy , 101: 137–144. https://doi:10.1016/j.biopha.2018.02.069 Abraham AN, Sharma TK, Bansal V, Shukla R Phytochemicals as Dynamic Surface Ligands To Control Nanoparticle-Protein Interactions. ACS Omega ., 2018, 3(2): 2220–2229. https://doi:10.1021/acsomega.7b01878 El-Dougdoug N, Bondok KA (2018) Evaluation of silver nanoparticles as antiviral agent against Tomato mosaic virus (ToMv) and Potato virus Y in tomato plants. Middle East J Appl Sci, 8 (1):100–111. http://www.curresweb.com/mejas/mejas/2018/100-111.pdf Nakamura S, Sato M, Sato Y, Ando N, Takayama T, Fujita M, Ishihara M (2019) Synthesis and Application of Silver Nanoparticles (Ag NPs) for the Prevention of Infection in Healthcare Workers. Int. J. Mol. Sci. , 20, 3620; https://doi:10.3390/ijms20153620 Khandelwal N, Kaur G, Kumar N, Tiwari A (2014) Application of silver nanoparticles in viral inhibition: a new hope for antivirals. Dig. J. Nanomaterial Biostruct. 9: 175 – 186. https://chalcogen.ro/175_Khandelwal.pdf Gaikwad S, Ingle A, Gade A, Rai M, Falanga A, Incoronato N, Russo L, Galdiero S, Galdiero M (2013) Antiviral activity of myco-synthesized silver nanoparticles against herpes simplex virus and human parainfluenza virus type 3. Int J Nanomed 8: 4303–4314. DOI: 10.2147/IJN.S50070 Geisler-Lee J, Wang Q, Yao Y, Zhang W, Geisler M, Li K, Huang Y, Chen Y, Kolmakov A, Ma X (2013) Phytotoxicity, accumulation and transport of silver nanoparticles by Arabidopsis thaliana. Nanotoxicol, 7: 323–337. DOI:10.3109/17435390.2012.658094 Mirzajani F, Askari H, Hamzelou S, Schober Y, Rompp A, Ghassempour A, Spengler B (2014) Proteomics study of silver nanoparticles toxicity on Bacillus thuringiensis. Ecotoxicol. Environ. Saf. , 100: 122–130. https://doi.org/10.1016/j.ecoenv.2013.10.009 Singh S, Vishwakarma K, Singh S, Sharma S, Dubey NK, Singh VK, Liu S, Tripathi DK, Chauhan DK (2017) Understanding the plant and nanoparticle interface at transcriptomic and proteomic level: a concentric overview. Plant Gene , http://dx.doi.org/10.1016/j.plgene.2017.03.006 Rastogi A, Zivcak M, Sytar O, Kalaji H, Xiaolan H, Mbarki S, Brestic M (2017) Impact of metal and metal oxide nanoparticles on plant: A Critical Review. Frontiers in Chemistry , 5: 78. 10.3389/fchem.2017.0007. https://doi.org/10.3389/fchem.2017.00078 Kaveh R, Yue-Shen L, Ranjbar S, Tehrani R, Brueck C, Van Aken B (2013) Changes in Arabidopsis thaliana gene expression in response to silver nanoparticles and silver ions. Enviro. Sci. Technol ., 47. 10.1021/es402209w. https://pubs.acs.org/doi/10.1021/es402209w Cvjetko P, Miloši´c A, Domijan AM, Vinkovic-Vrcek I, Tolic S, PeharecŠtefanic P (2017) Toxicity of silver ions and differently coated silver nanoparticles in Allium cepa roots. Ecotoxicol. Environ. Saf. , 137:18–28. https://doi:10.1016/j.ecoenv.2016.11.009 Hawthorne J, Musante C, Sinha SK, White JC (2012) Accumulation and phytotoxicity of engineered nanoparticles to Cucurbita pepo . Int. J. Phytoremediation. , 14:429–442. https://doi:10.1080/15226514.2011.620903 Saha N, Dutta Gupta S (2017) Low-dose toxicity of biogenic silver nanoparticles fabricated by Swertia chirata on root tips and flower buds of Allium cepa. J. Hazard. Mater. , 330:18–28. https://doi:10.1016/j.jhazmat.2017.01.021 Benelli G (2018) Mode of action of nanoparticles against insects. Environm. Sci. Pollution Rese. , 25(13):1232–1234. https://doi:10.1007/s11356-018-1850-4 Chakravarthy A, Chandrashekharaiah K, Kandakoor SB, Bhattacharya A, Dhanabala K, Gurunatha K, Ramesh P (2012) Bioefficacy of inorganic nanoparticles CdS nano-Ag and nano-TiO2 against Spodoptera litura ( Lepidoptera: Noctuidae ). Curr. Biot. , 6(3): 271–281. https://www.researchgate.net/publication/304354666 Nair PMG, Park SY, Lee SW, Choi J (2011) Differential expression of ribosomal protein gene, gonadotrophin-releasing hormone gene and Balbiani ring protein gene in silver nanoparticles exposed Chironomus riparius. Aquat Toxicol. , 101:31–37. DOI: 10.1016/j.aquatox.2010.08.013 Deshoux M, Monsion B, Uaest M (2018) Insect cuticular proteins and their role in transmission of phytoviruses.” Current opinion in virol. , 33: 137–143. https://doi:10.1016/j.coviro.2018.07.015 Armstrong N, Ramamoorthy M, Lyon D, Jones K, Duttaroy A (2013) Mechanism of silver nanoparticles action on insect pigmentation reveals intervention of copper homeostasis. PLoS ONE 8(1): e53186. https://doi:10.1371/journal.pone.0053186 Whitfield AE, Falk BW, Rotenberg D (2015) Insect vector-mediated transmission of plant viruses. Virol. , 479–480:278–289. https://doi.org/10.1016/j.virol.2015.03.026 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major Revision 19 May, 2021 Reviews received at journal 20 Apr, 2021 Reviewers invited by journal 18 Apr, 2021 Editor assigned by journal 16 Apr, 2021 First submitted to journal 13 Apr, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-422790","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":22423747,"identity":"f7ec50b0-76bb-42a6-a85b-338b583c7eac","order_by":0,"name":"Ahmed El Gamal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYDACCSDmAWI29gYGZtK08PEcIFWLnEQCkVr4Z3cnPnjbdiePTfKN4eeCChsG/vbuBPyW3Dm72XBu27NiNukcY+kZZ9IYJM6c3YDfmhu526R5zhxObJPOMZDmbTvMYCCRi1+L/I3c7b/BWiTPGP8mSosB0BZmngqgFgkeM+JsMbyRu1lyTsXhYjaetDJrnjNpPAT9Incjd+OHNwaH8+TbD2++zVNhI8ff3kvA+1CQwMDAYQBi8BClHKqF/QHRqkfBKBgFo2BkAQCzv0b84oZ6uwAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-7811-1195","institution":"Agricultural Research Center","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"El","lastName":"Gamal","suffix":""},{"id":22423748,"identity":"835bc044-3646-460b-9c0c-4b22a3f48145","order_by":1,"name":"Mohamed Reda Tohamy","email":"","orcid":"","institution":"Zagazig University Faculty of Agriculture","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Reda","lastName":"Tohamy","suffix":""},{"id":22423749,"identity":"b8309aa3-c7d6-4807-abc0-72d167d7a06f","order_by":2,"name":"Mohamed Ibrahim Abou-Zaid","email":"","orcid":"","institution":"Zagazig University Faculty of Agriculture","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Ibrahim","lastName":"Abou-Zaid","suffix":""},{"id":22423750,"identity":"df5c8204-c384-4961-bd88-1a43f09354ce","order_by":3,"name":"Mahmoud Mohamed Atia","email":"","orcid":"","institution":"Zagazig University Faculty of Agriculture","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mahmoud","middleName":"Mohamed","lastName":"Atia","suffix":""},{"id":22423751,"identity":"96b1b00e-a86f-47e2-ab98-b863a32429cb","order_by":4,"name":"Tarek El Sayed","email":"","orcid":"","institution":"Agricultural Research Center","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tarek","middleName":"El","lastName":"Sayed","suffix":""},{"id":22423752,"identity":"9ed90a1d-a6a0-403b-b837-7910d61eaf98","order_by":5,"name":"Khaled Farroh","email":"","orcid":"","institution":"Agricultural Research Center","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Khaled","middleName":"","lastName":"Farroh","suffix":""}],"badges":[],"createdAt":"2021-04-14 14:36:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-422790/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-422790/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":8444923,"identity":"c5d00d7e-d529-420e-a2f8-95add8c1e670","added_by":"auto","created_at":"2021-04-26 13:27:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":269113,"visible":true,"origin":"","legend":"Bean yellow mosaic virus disease phenotypic response and molecular confirmation. A: Symptoms of naturally infected faba bean plants with BYMV in the field showing severe mosaic symptoms. B: Typical mosaic symptoms of isolated BYMV as a result of artificial inoculation on faba bean plants under insect-proof greenhouse conditions. C: Agarose gel electrophoresis of two migrated RT-PCR products illustrating the genotypic identification of BYMV by amplifying the coat protein gene at a molecular weight of 907 bp; Lan 1: Healthy plant control, Lan 2: BYMV-infected faba bean plant, Lan 3: Artifally inoculated C. amaranticolor sample., M: 100 bp DNA ladder.","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/9984fb8d7e3758b6f7c1a02b.png"},{"id":8445338,"identity":"530cc5f3-8789-4729-9837-6dcf1d5e2718","added_by":"auto","created_at":"2021-04-26 13:30:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":36634,"visible":true,"origin":"","legend":"Physico-chemical characterization of synthesized silver nanoparticles (AgNPs). A: Zeta potential measurement showing a negative surface charge with -36.5 mV. B: Particle size distribution histogram of AgNPs with an average size of 7.43 nm. C: X-ray diffraction (XRD) pattern displaying four typical peaks related to the diffraction planes of silver nanoparticles. D: HR-TEM micrograph illustrating spherical shape nanoparticles with 8.54 nm average size.","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/4d6707dbfa6d6bccc7bd8682.png"},{"id":8445343,"identity":"741967dd-1418-44fe-9ad0-87e330287fda","added_by":"auto","created_at":"2021-04-26 13:30:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":352977,"visible":true,"origin":"","legend":"Effect of silver nanoparticles (AgNPs) on bean yellow mosaic virus disease infectivity and the virus concentration. A, B: Disease occurrence and severity on faba bean plants treated with foliar protective (A) and curative (B) applications of six tested concentrations of AgNPs compared to untreated control (C+ve). C: Symptomatic disease response on untreated plants displaying a severe mosaic and stunting compared to plants treated 24 h pre- and 48 h post- virus inoculation. D, E: BYMV accumulation content, scored 30 days post-virus inoculation for preventively and curatively treated plants compared to untreated control as well as negative healthy control (C-ve). Values with the same letters in each category have no significant difference (P\u003c0.05).","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/45291dc964880274ad1a8a77.png"},{"id":8445616,"identity":"1fd1ed8e-da81-40c5-8377-d537e49cc73f","added_by":"auto","created_at":"2021-04-26 13:36:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":274281,"visible":true,"origin":"","legend":"Transmission electron microscope micrograph from leaf dip-preparations of BYMV illustrating the direct effect of silver nanoparticles on virus units in vivo. A: AgNPs aggregates and attached to the envelope of virus particles in treated plants compared to untreated control (C), B: AgNPs- healthy treated plants served as a control. Photos were captured under direct mag.:100000 x with scale pare of 100 nm, Hv=80.0kv.","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/e89976a2c9ac0501b5e698d7.png"},{"id":8445339,"identity":"594f47b7-52e6-49aa-8341-f872cdb8af25","added_by":"auto","created_at":"2021-04-26 13:30:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":123278,"visible":true,"origin":"","legend":"Demonstrations of induced enzymatic and biochemical changes in treated faba bean plants with silver nanoparticles (AgNPs) compared to untreated control. A: Modulation in peroxidase (POD) and polyphenol oxidase (PPO) oxidative enzymes activities showing different peaks of activity within the time course of six days after spraying. The activity was determined as nmol guaiacol. mg-1 protein. min.-1. Values are means ±SE of three repeats (P≤0.05), B: Protein patterns illustrating changes in protein accumulations. C: Expression pattern analysis of pathogenesis-related gene 1 (PR-1) in response to three tested concentrations of AgNPs over the untreated control. Values are means of three repeats ±SE (P ≤0.05). ","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/780b92783d5a15fe957f97a7.png"},{"id":8445451,"identity":"016af6df-7557-4638-89f2-8a0356b583fb","added_by":"auto","created_at":"2021-04-26 13:33:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":234600,"visible":true,"origin":"","legend":"Silver nanoparticles (AgNPs) affect Bean yellow mosaic virus (BYMV) -acquisition and transmissibility. A: Effect on the percentage of BYMV-acquisition and transmissibility when vector aphids get contact with AgNPs-treated plants at 1, 5 and 10 days before acquisition assay. B: Gel electrophoresis analysis of RT-PCR coat protein gene products of BYMV in faba bean plants 30 days after acquisition assay, AgNPs treatments were sprayed 24 h pre-acquisition assay (before aphids get in contact with virus-infected plants). Lan1: control, Lan 2,3,4,5,6 and 7 are: 300, 250, 200, 150, 100 and 50 mg. l-1 of AgNPs treatments respectively. C: Disease response on faba plants scored 21 days after challenged with aphids at 24 h. D: Proportion of acquisition from AgNPs-treated plants infected with BYMV 24 h before acquisition assay. Values with the same letters for each experiment have no significant difference. ","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/8f7c21cb0950c1a56cc4db54.png"},{"id":8445453,"identity":"d73ea884-2a92-4d86-825a-736ae2defea2","added_by":"auto","created_at":"2021-04-26 13:33:11","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":136715,"visible":true,"origin":"","legend":"Schematic diagram proposing the direct mechanism of action of silver nanoparticles against virus infection (A) and virus acquisition and transmissibility process by their aphid vector (B).","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/3e56c6aea80337d876644850.png"},{"id":15672366,"identity":"bfdc520b-e5e8-480c-b9c1-a80eda7d79d9","added_by":"auto","created_at":"2021-11-18 14:11:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2298226,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-422790/v1/fa467460-0a03-4311-bd8e-dc51c8ca7948.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eSilver Nanoparticles as A Highly Viricidal Agent to Deter Plant-Infecting Viruses and\u003cem\u003e \u003c/em\u003eDisrupt their Acquisition and Transmissibility by Vector Aphid\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":" \u003cp\u003eFaba bean (\u003cem\u003eVicia faba\u003c/em\u003e L.) is one of the most important legume crops that is almost consumed daily in numerous developing countries as a human diet of a cheap and high-quality protein source. It has been simultaneously ranked as the third most important feed legume crop worldwide (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). \u003cem\u003eBean yellow mosaic virus\u003c/em\u003e (BYMV) a type member of potyviruses is a devastating disease for many legume crops and other ornamental flowers, which poses a significant threat for global faba bean and other legumes production (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). In this respect, BYMV becomes one of the most biotic factors that steadily reducing the faba bean production and their cultivated area in Egypt (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). The virus is naturally transmitted by over 20 species of aphids which can be effectively spread under field conditions, resulting in a high rate of viral infections for faba bean and other host species (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn recent years, nanotechnology approaches have emerged as a new potential control means to deter a wide array of plant diseases (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). However, using nanotechnology tools in plant protection management hasn\u0026rsquo;t yet widely introduced on a large scale, which still under the research investigations and small scale of production and applications (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Nanoparticles, ranged from 1 to 100 nm in size, prove superior chemical and physical features compare to their bulk materials due to their large surface area to its volume ratio, which strongly offers them to be one of the most promising ways that may effectively be used in many different sectors (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Silver nanoparticles (AgNPs) are metal nanomaterials that have been investigated to be used in many applications notably for the controlling of human and plant pathogenic microorganisms (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Due to their unique features, AgNPs have been documented as an antimicrobial agent to control some phytopathogenic fungi and bacteria (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Simultaneously, some previous reports have been proved the effectiveness of nano-silver against some plant and human viruses by blocking the virus infectivity and its accumulation within the host tissues (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, the little efforts that have been done to investigate the AgNPs as an antiviral agent, there is no documented investigations to show the ability of AgNPs to control plant viruses from different tripartite interactions point of view (host, virus and vector interactions), and since the BYMV, as well as more than 75% of other plant viruses, are naturally transmitted by insects, therefore the research aims of the present study were to investigate not only the effectiveness of the AgNPs on virus infectivity and plant responses but also to note whether the pre-acquisition treatment of AgNPs may affect the virus-vector combination by altering the virus acquisition and transmission process.\u003c/p\u003e "},{"header":"2. Experimental Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003e2.1. Virus isolation and propagation\u003c/h2\u003e\n\u003cp\u003eFaba bean plants showed putative \u003cem\u003eBean yellow mosaic virus\u003c/em\u003e symptoms were collected from a local open field at Giza governorate, Egypt during the 2018 growing season. Leaf samples were initially tested by the serological DAS-ELISA technique as described by Clark and Adams (\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e) using a specific polyclonal antibody against BYMV (EPHYRA Bioscience inc., Canada). Positive samples reacted with BYMV antibodies were used as a source of virus inoculum. Ten seedlings of faba bean (cv. Giza 3) and \u003cem\u003eChenopodium amaranticolor\u003c/em\u003e as an indicator host plants were inoculated with a freshly prepared sap inoculum using 0.01M phosphate buffer pH 7.1, (1:10), 0.01% Na\u003csub\u003e2\u003c/sub\u003eSO3 and carborundum (600 mesh). All inoculated plants were grown under insect-proof greenhouse conditions (20\u0026ndash;24\u0026deg;C) and daily observed until symptoms develop. The virus was biologically purified from a single local lesion produced on \u003cem\u003eC. amaranticolor\u003c/em\u003e using a single lesion technique (\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e). The purified isolate was propagated on faba bean plants (cv. Giza 843) and was used as a source of BYMV for further studies. Furthermore, the mechanically inoculated plants with purified BYMV were checked again using the ELISA technique for serological relationship verification against BYMV antiserum and other viruses infecting faba bean plants.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003e2.2. Molecular identification of BYMV\u003c/h2\u003e\n\u003cp\u003eTotal RNA was isolated from 50 mg of each healthy and symptomatic leaves using RNeasy Plant Mini Kit (Qiagen Co., Germany) according to the manufacturer\u0026rsquo;s instructions. Reverse transcription (RT)-PCR reaction was optimized using Verso\u0026trade; one-Step RT-PCR system (Thermo F. Scientific, USA). A specific primer pair BYMV-CPF and BYMV-CPR were used targeting coat protein (CP) gene region to amplify 907 bp fragment of the BYMV genome as suggested by Al-Khalaf \u003cem\u003eet al.\u003c/em\u003e (\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e) (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The one-step RT-PCR reaction was performed by combining 25 \u0026micro;l one-Step PCR Master Mix, 1 \u0026micro;l of each primer pair (200 nM), \u0026micro;l 2.5 of RT-enzyme enhancer, 1 \u0026micro;l verso enzyme mix, 3 ng of RNA template and the mixture was completed up to 50 \u0026micro;l using nuclease-free water. The amplification reaction was automated in a T-Gradient thermal cycler (Biometra Co., Germany) with an initial reverse transcription process at 50\u0026deg;C for 15 min, followed by 35 cycles of denaturation at 94\u0026deg;C for 1 min., annealing at 50\u0026deg;C for 1 min and extension at 72\u0026deg;C for 2 min, with a final additional extension step for 10 min at 72\u0026deg;C. The PCR products were electrophoresed on 1 % agarose gel in 0.5 x TAE buffer, then visualized under the Gel Doc. system (2000, Bio-Rad, USA).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimers used in the current study to amplify the target coat protein gene of BYMV (CPF-forward, CPR-reverse) in conventional RT-PCR, as well as the selected PR-1 gene and the endogenous reference gene used in qReal time-PCR experiment.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eprimer name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eprimer sequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003etarget gene\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBYMV-CPF/CPR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBYMV-CPF: GTCGATTTCAATCCGAACAAG\u003c/p\u003e\n\u003cp\u003eBYMV-CPR: GGAGGTGAAACCTCACTAATAC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCP gene of BYMV\u003c/p\u003e\n\u003cp\u003e(907 bp)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePR-1F/R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePR1-F: GGGCAGTGGTGACATAACAGGAA\u003c/p\u003e\n\u003cp\u003ePR1-R: CATCCAACCCGAACCGAAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePR-1 gene\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eELF1A/F-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eELF1A-F: GTGAAGCCCGGTATGCTTGT\u003c/p\u003e\n\u003cp\u003eELF1A-R: CTTGAGATCCTTGACTGCAACATT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eElongation factor 1- alpha reference gene\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e2.3. Synthesis of silver nanoparticles (AgNPs)\u003c/h2\u003e\n\u003cp\u003eSilver nanoparticles colloidal solution was synthesized by reduction of silver nitrate (AgNO3) [99.99%, Aldrich, US] using a co-precipitation protocol of sodium citrate trihydrate (99%, Aldrich, US) under boiling conditions (\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e). Briefly, 50 ml of AgNO3 (0.001 M) was brought to boil under stirring for 5 min in 250 ml beaker, a 5 ml of sodium citrate trihydrate (1%) was then added a drop per second under continuous stirring. The solution color turned pale yellow to yellowish-brown producing a colloidal silver nanoparticles form, then it was left to cool and proceeds for physicochemical characterization.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003e2.4. Characterization of silver nanoparticles\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003e2.4.1. Particle size determination.\u003c/strong\u003e The particle size distribution, polydispersity index (PDI) and zeta potential of AgNPs were measured using the Dynamic Light scattering (DLS) analysis on Zetasizer (Malvern, ZS Nano, UK). The colloidal nanoparticles solution was diluted with distilled water and put into a disposable glass cuvette for analysis (\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4.2. X-ray Diffraction (XRD) measurement.\u003c/strong\u003e The Physico-chemical crystalline nature of AgNPs was confirmed using X-Ray diffractometer (X\u0026lsquo;pert PRO, PAN analytical, Netherlands) operated by Cu K radiation tube (=\u0026thinsp;1.54 A˚) at 40 kV. Colloidal AgNPs solution was centrifuged at 20,000 rpm for 30 min at 4 c for powder phase yield, the precipitated AgNPs were dried, then bombarded by X-ray for phase analysis (\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4.3. Surface morphology determination.\u003c/strong\u003e Particle size and the actual shape of AgNPs were performed by High-Resolution Transmission Electron Microscope (HR-TEM) (Tecnai G2, FEI, Netherlands) under an accelerating voltage of 200 kV.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003e2.5. Effect of silver nanoparticles on virus infectivity\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.1. AgNPs Treatments.\u003c/strong\u003e Foliar applications of AgNPs were carried out under an insect-proof greenhouse with two protective and curative schemes, using six tested concentrations of AgNPs (50, 100, 150, 200, 250 and 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). Ten days old faba bean young plants (cv. Giza 843) were uniformly sprayed with the AgNPs concentrations 24 h pre (protective)- and 48 h (curative)- post virus challenge. The potted plants were mechanically inoculated with a cured sap of BYMV- infected plants and water-treated plants were served as a control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.2. Disease assessment.\u003c/strong\u003e The percentage of disease occurrence and severity of symptoms was assessed three weeks later using a numerical scale of 0\u0026ndash;4 grads, where 0\u0026thinsp;=\u0026thinsp;no visible symptom apparent; 1\u0026thinsp;=\u0026thinsp;mild chlorotic patterns; 2\u0026thinsp;=\u0026thinsp;mosaic patterns and dark green vein banding; 3\u0026thinsp;=\u0026thinsp;mosaic patterns, leaf distortion, and reduction in leaf size; 4\u0026thinsp;=\u0026thinsp;severe mosaic and stunting of the whole plant. Values of disease severity were estimated by the following formula (\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e):\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAfEAAACNCAYAAACnpUNzAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAACcJSURBVHhe7Z3bkRtHEkXpgmyQC/JBJihiPaAL/NpfeUAPZAEtkANyQB7IB26cEY/2MlXdDcwAGGDmnogKdL0ys7K6MtENSvPhaymllFIekibxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi9X58OHD5vl559//jZqG8Yw9tdff/3W8vXr77///tRW/u9ffPKo3Msavnz58vXHH398siXvtyO8Hyn3AGfmHPuPWJ3BR8P9eeRzsqJRsFydT58+ff3hhx++/vnnn99a/uaXX345KYn/9ddfT4G1SXzNH3/88fDBieT52mvgPsMG/Ikdv/3227ee0/j8+fNF78mX3OMvTeJzL1Zn8BxespZL8RbOyYpGwXJ1DAAzYXOoTkni8NKg9NbZC074bSYk9oQvUfeCQf41A6xfJJ7LpRMVe3ZJeafCl+3VXrzkDL7WWiardT06TeLlJhgg+TwFDtpPP/30NIeneEoGENozKPiFwHa+NAhBiYSlLN4MCMkMubTTn4mNvo8fP/4jkzHosc83DM6jbWKyVIYFnQZ9gyOy/FKzZxfw1OdrXz+3ghOy8KWJnDp6XMsEWZR8tZw+08/ux6yv1kVBHnLosy7OYbw6mZ8+zTWzHu3f82OCrNyzlAG0WeZ85NLOfPcTW3K+diT4XJv5dD0pz3ss5Zn0siA/94TC3Imy+RTHb+2poF//WJSDT5jDJ+3IybdrXOd5Yb9gay0Jfnntc/KoNImXm8EB47BlYF5BMGCcwWPWgWDEgRT6CMrgeKE9ZTHPBGJgAl+Hap/BgzqFsQYAg7l96FgFRfQSPHJcBl7mYCtyCaAGpz27XLu2zPoKdSOLTxP6CuUZhNUvyKKuT2cdcl3g3ltnfRlwaU8Zc8+xKZMGPmQdsuXHhDHKwGb0Uxdt2AJ9FG04mo/t2IEubKLP+w5SHmOQlT7ketqT9wWyVusE5Kasoz1NXAefCbrSXvytPMj14RvGymotCf2sH7kU5r7GOXlEtr1ayoXx4K+eHpJVgOGwZlAy0IgHlOCRCcrgOUvKEmV6yAlW2EtAwSaDA9A+Za4Cqk9iW8EJO1bzkmkXa5xzsn8L1sO4I/+rT2YdqKcPZ32u66g+1wj0O4Y10z+LTHkr2LO0UZ3cI1nfAvmr+XI0n76cP+XNOtdTnsmMPUxfTV5iq31T/pG9ybR9tZbkns7Jo7Ht1VKuAAfTb85bPCeJA0mKMSZeMIlvHVzaOewEEMbNsQQUAwxy0QEzIWxhQFI+umiTreC0Z9dzghM6mYNvsWfvSRw5yJNZB+q5/lmf6zqqqyPXQL9jVmtOprwVt07i3Cvc7/ibdkrOn/JmneuVPdiLXPq2ztK5tib28Zkc2cs9RRt+Zn7K31qL3Ms5eUS2vVrKhSH4cFDzcK4w8ZpoDCr5zdwnb+Gw+ipv9hFUmIteCoHPg8w4AxH6qCuHdoMk8+jLAMFaTOokR8okZaygb+WTPbvQw5pMPoyjfysxIxv/OJ46OrfG6z9tmnVgvutyf3Kdc13WZdaVoQ+xlTVad836n8+8H6a+FYwn2LNnjDP4y2qdCT6k0L+a7z45n7GMoY7O6aP0Icx62qPN+MB7jrHoWIEs7x84ZU+FNvoYk7r37HX/3B+/ZKz0KS+5h3PyqDSJl5tgEPBAHcGh5QBSOHwEqzyQHEaKQZ7xtjHOdmAOuukj6GafwYZ2Aw0FOOzIsi2TBushQNPOGPTPAAMp02IiMPDZluzZlbqzPxNKwnqn35GhHRN1adOsgwEz94c6a8p10XdUB9qwn0K7Pk28J+hn/SazlDf9mKTflJF+OZJBu/Y5bm/+no+oO35VB+z1vuV+yDoFWxybKIux+sg52jbrE+8/13hkb9rGHO45r2G1luQezsmj8l0Szxt0VVbg1OnYss01/cUN7bdMb+6tfeNgMEZy7jUgAGfyFA72W4a9znUTWLaCb7lv2EuSV7k8b/GcEHszxiYZn/2ilRz1J/+K8H57zIlcK7A38X3CDe/esId+2+RmWH1p2GrbuuleAt+AV/o4tKv2t4RPYUJQom0+GZf7hy+c1zgf5W2dE3MoZXW/0Ga7uTXz7VH/5KQkLj6p9ynicuDn1UafA/PzAFA3ObqfyV7ipI85l4L1cRixYVXeehLnC4yvESmcIdrKY8H5cg8b/y7PPZ4T4ugqFhKzTrkHWMOM7aukzBjHHfWvOCuJYzh9ewLLeXBDvMSf7kmCPJPjTOLU925Ab6JSSnnvEEszkZ+awGGVxJFFe5JtR/0rzkriQF8K5DoN9Rsri+V6fqOgz34xcVhSfvbhvPnKJedt2QzoYwzzp2PRpwzlO57ieH1DkdU4QI6+yb70V+qlZF3/5PpX60NW6oXcdPpS1hy7grnImOT6t8reHpRSyqNBzCT2EUdPTeCQsV4yHotxFY76V5ydxDHMBMEnYzWUORpgglWOjpBcIHNSBvMcS58ymGOSRX4ulvathSLLeSZX4Vr5Uzc6cizkJqI/68xFvrakLEAWba4Vcu3AeMYk9GvjJH2SIFcbJP1lX7YJ+tKml6CelpaWlnssp0A8zFh+CsTmGUepz5ibMf+of8W/epywlTToy8SWhs4kmNA+S8oBEz9FGSxoK9GkLEsmVdlaU+rLko7HxpynXa51Fm2dXxYk/QWMzzowJhPz7E/QufL3BHmuA3nKnLqAvpXPSynlvUE8JMYSE1f5ZYsZ62EVW81PcNS/4qwkbtJLw6ahXDOGojEmvC2U63iuTUwz0WoXYx1zCtipDJMW86fDJox1fYxXP3Yhcwvmrfqnv9CfdXAPvN67cRh35AfmZ6LGBuvonj5YtYF27ZXVfVNKKY8IsTDjK3FxLx4nM9YDsmZeyFxx1L/irCSOoNlH2zQUUMxY+7jeWjx96ahZB3TSTgHkrvQewSYoH3uUt4V6+cxEmO0rthw//bVK4sA4ZByt0XF7zIScc5A/+2k70ltKKW8ZYuDMQ3BqIp+xHlZ5gzHG46P+FSclcQVT5qLSUMZlQsgkxCfzE/to10gTq3qQpy3aAXMccL1yLu3pBGQ6D/tXSSyhP+cIbcxPnIu+2QdzY5FBnbXNtaRftmDutDdZ9eUc7Jk6aJtrLaWUcjoz1kvG39WD5FH/5LtelDJhVeib5HiUkoj43JpDwrKPYsIlidhmYuSadpPhnAMmOosLnzAu7ZrjUgZlop4VaRtl+oAi01/g2qevYNU22dtkdGwlY23B30l+USqllHIexuQsk8yFxNzJUX/SaH3HzC8bWzBuPk0/l0vKem34AsNa8ovfa4Id2LP1xeqWEBiw5dy9vjefnsMpttN36v7ciy+29pL6UQJ4D9zTubsGTeJ3yrnBgW9upyb9LS4h41TOCZZisDoV/wjDOXOuCWvm/143337cGv5PWP5vLvk8h2v4lPvgFonwFNvpO3V/rnl/nXM+OBf+384S6rfw671zL+fuWjSJ3xHcbBy85wYG5jz32ybJ+5bfVM8JlqJ/zgEd1wiyzwV7XjuY8Jed9Mlz/t/Ul/bpc+XxRzJW9tNG34ojXeckT7i0LwSZ59wnq7OBjD6J/825/nwkmsTLzSHg8Js8hcOVQZCgwxMObfn/TqadQ+gXHIoBioDtHGQnW0GWcY5HDtcZvG1z7qwD46nTl/Kyb2UPRXnYPRMOfa4nk9RKH9cr8J3ycwzzfCpZzaeNgk2pL1n5lDHOzfG2wUoebeypMqlD7umcI/iGeyh9xDWyjpK4/lMfuIZsA2Rqh8V93ZMnyF3tJzgv59K2dT6SlEvJJI4s2tJvro/CvPTRno2gnXPe3j7Rpx17/x/0HJcF8toxyZZdkPvGQwp79RZpEi83h8O4ClIcSBIMB86/He3flKaPQziTOIeXV4nU+Zyvhw2yE3UxR33IRh4gO19Rzjowljo6mO/fLlae9QwujHVd2IUPMrhgF230UxhrAJz66GP8BL36Vn0GV+XTrg8TbfZpnc+cD84VAyRtjGWOTHlzj2hzTVxzb4ByaHMtKwjU9PPp9QzmCXrmnutf95gxQh9jcj/o1+978uBoP6mzNuYzF7bOR4Jc5jJPHzkfvFe0E9/Mddi3ZyM+YY25Ps8IMHa1T+wB9bSP+SvwH4Vx6EKHcvL+UT8c2aVv6aNwzfi3yP93vZQbwoGah8pgKAQzDqdBmYPtIRbGEKCAYES/dUCHAWFCXwaWOXbqW+mnnkE769hN3WAJc92MZYw2m0TQRSH4EcAk5SN3JmHlZfsMoHOdiT7MRJjBGVZ+yj0iYMqUZz2hPu2xjXn4Jn04oR8bKbn3K7A9fWHyEK5zf2ad61nfk7e3n9a1OZPQ1DOZZ8V9T6jrN/3uvcOn98iejYyZds37kTlzn/AJcpTJvLwvkpWds+7945e8PbsYyxzHAvbs+fOR+X7XS7kRHKh5qAwIMg80fdQnBA8OLEEtxwM6UmYy+2Z96lvpn/qO6nPd9OUYrrXDksFoypusbJw6lb9Ce5I5fjWfeQRV+nL+lLeST33KI8mQXOhjXw3iK85N4ntr4Zo2IVnMJzoTIRzJw37bLO4na2JtyMT2KTftmEyfbfmVdmE8etCXc/dsBOxEjvPTrq19YgxjUyZlBX5FBv3M41pW65Itu5wz1552vyXW3inlyvCteR4qDm8+XRBIOIwGBpLEPNAeeg7ppZP41Eff1D/1HdXRQRGCIGPyqYigJqzdPpjyJlMeEOBS5p5PkM18fQ4GY8n56KGf/aSNPuaL8mTWYSYVZJrQGD/1JyRtdDLHZL6XyOfaZ901CHZwX3Ev0jdlH8nb209kUqcwJv2yOh/JlOtZSah7r/Cp7Y61b89G1o9P8QHr4lq79vYJechNtvaFccxnrj4R2ue6YM8u5jNH24Bxe/58ZP7tnVJuAAnS4M0BAw4dh486QYD+DC4EAfppYwxBhDEmENrp97Ua8ugnSBiUhOCQfbMOqY9CEKDuazyTvMHBuvpnHZSBPGxGp+sHAyxt9GMPbZD65noS5hhQGYsOx6/WmRg0mbeaP32aPmI8a6Wuj47qQBvymE/RxvSRPkjQjX0Z9Glj7XxOpu3TFxSuKYL+tE374Ege7O0ntutnfIDdgn+QRV/eH0K7fs97k3bwXsFGoN17gvH0nWJj2qEe6qx1b5/wP3XXxyfjVrgOxlHQ6Z56v0wf7NkF1ulnLmuirj/eEk3i5dXgIOaBBQ6/h3krENNnAHK8wcO5wIG27niZfVtj1Uc/7Vyri0/nnFIH2lLXKqi4JnyTtqS8uZ4EfzqWz/Tvnk+AfoKm8+f+rObv+cixW3VAfral/RTkrmBc2ib4b9U+bZ91baeoEztIALaTMPAPOo7kydZ+2m7ftJm2Vbus/J52KxvoR5ZtaQds2QjOo9018olde/uUOpG/Ahn4N5M4dZI32EaZbNkFaVv2z7W9BZrESyn/QLAjSZW/yac7IcnMtvI8SMQ8NSd8OZltZZue1lLKP/j6cvXk8x4hmfgamkKdJL71dFzOwy+NvsrniZwvTjxFl9NoEi+l/IPJqkH0//jaun65DvnanfIWX3lfkybxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5UFpEi/vjj///PPrr7/++lT++uuvb61fv/72229PbXxeGvW9Jq7v999//9byN7TPtiO2ZN2C5/oSW1/L5lKuRZN4eXeQuH/55ZevHz58+C4ZENxpu0YS//z585Ps1+Ljx49Pa6bMBPjzzz+flRT3ZJ0KPubL1HNA53N8ib4ff/zx2TZPLiWnlJfQJF7eJQRgktcPP/zwXTK5ZqJ9rSTOlxZ080mZT6LnPIkfyToV/P7cuX7Zeg7nfmHZ4o8//ni1/Swl6V1Y3iUEchM5T5aSgdkxknVfyfvUzpM2xeRmPVH2ly9fnubOJ1HnZV/qsX/rTYFjKSQZoY5u5SQkRNpNqPRTRxYysg+2ZDlvlZhdL7Yjl7HIwO85Z7V+yT7nT1a+onAtqySufav1rPyAvE+fPv3jB8eB87KtlGvSJF7eJQZan6hMej/99NPTJxioJesEcpIQ432tzNMl1yYn6iQRYS4yKIzLtwDI41Uvc+m3L/XwyTwS0YQEwxzlo4vkBMyjjk2ZqAAdyKYPlMMc9TFXO1eytMk1qxcYr3z6+KQggz6u0bm1fqAv/cw45k8Yxxh95dj0VyZx177y2Z4fKLTpBwpt6qbuZynXpkm8vEsMvkBANtBnwCeQZ7JY1Qn0JA9AHknDOokh5TGXOUKgN8nzmWOxyb6pZyZiyOQEXCMfpt2T9AVMWWn3lMWXn2kbyQxmH3OVM32xt/7ZR6LdWg925x6QXBlrPddGX37hmOs+xw/AWpWH7FxfKddi+2SX8oYhOGcwJwATdDNZzEC9qud45O3VZ9BPGxhHsY1rEhlMPSsywUDaOu2epB2ArpSVsqcs5pE0lYHN1O3bsnvayziKcrh2/bbL3npWOlPXlAX00eY6hLFp454fgC8w3Ed8eeOeKuUWbJ/sUt4wBOsM2AbxTAAzUK/qOR4Ze/UZ9NMGxlFso/jEPfWsyAQDaeu0e5J2ALpSVsqespiXSTxl8bll97R3b/22y956VjpTV8riTYF7TttLkziQvPny4ZfCUq7N9sku5Q1DsM6AzetWAi9FZqAmqWSd/kwYyNurM9ff3oHX3SYqnt588gTscezUs2L+Bssr6Je8Ts8ExFzrUxavj0l+iWNnX64pZdK2t37as2/uQ8I6UidJlbGr1+m89kevTB+e6gd0IN+9BOSmrFKuxfbJLuWNQsD1HyEZ3GEmB/pI6gZ7EkkG8qwrk/EkH+okARKKr1bp82lv6mcM/cikn75MYql3hb8TYyclxyOPur8xJ+hHl3ai0zXTZ7Iyia5kMd/kyGcms+zLNXFNQQ+2761fG1ybNqz8YR9yuWZdzAF0UMce1mY/n4yn2HfkB9rUwxxkayPymOvv46Vckybx8u4g4BJoKVwntCUEb9r4dJ5JShnUU2aOtQ4mK9pIgiSCJPu4FuVkclxB4nHsaj5lMu10vRT60GkdvLYOrAObaTPxSvalTerVN2DbXD9oF5+OW/mDdr9IcJ2JdK4N0EUxUds3x04/QI4HdDmGvlJuQZN4KeXNQAIliZfyXthN4rxq4hXRVlnBAXqEQ8Rh31rDc0AWMrfAl76Ku0fSF+7vlr2055PGJf1YynPhaZrX27zK7pPwy+Dtwl5MI8YbJ1Yc9ZfLcehhXiOxEb4yAjeYspe4yt/4ZegekzjBLveXw+ee0j5fWVKfbd4PDZzlNeE+5N6lzHu0nA7+4zxTVvE9Y4TxIznqL5flWUlcTE4N3sfc65P43FvqBkAOY9rMuK01mMhLKfcB53cVm4lFq3g+4TzPJP6cpJ395fK8KIm7YfeYnO6Ne0zi2DNtYj+3kviR/RzUe1tjKe+ZmchPTeBALJjJlzoyk2w76i+X50VJHOjjxpCZrNhAxrCJXKccxtFnvzDGdkrKzz5uTmSKXyosezcrulMucrzBnT8TUtq7ssnkJyln+mWucR407NF3sx9ybvoAmL/Vl9A/5bpPQL9rom2Onej/FcjVplVZHfLVuJaWlu/LEZwtzqbx7VSQPeMHsmZcZIzx8Ki/XJ4XJ3E2xw3ik7FuInMMzgZ45TAmkx5znZc3gsnOsfQpgzneZMhXF9DOvBXIpk+7HZttc93MSfn0MU/7KLmerCsr16QeSF20K8+1oXfqnrLTJ15rm2OTuR/iHIr2MlZb1Lcll3bGl1LuB+LHueeSs+y5F+QYF4QxxrOj/nJ5rvokvpdEaJ9lbrSJhqKMmdAEnSnLsnXjMj71zRtN3azBdWz5YK4TWdPG9Av92pfF+YxljDBPeSvZkv7Kot7EfT2FnM8c9KR/EtpW+11KeR2IF5xX4spWDFvBWc44BMia8YQxxs6j/nJ5XpTEDeS5aZmsgGvGUEw+Jr0tlOt4rk0M9lm0i7HnJA/syhtr3miZpPJ6hetRP7K1XdIvfM7DkTA2+1PeSragf6tv4r4egT7XPf2Qa5ZVG2AXfVvlVLtLKafDueLcCrFlK45NOJczTlGfZzVj0lF/uTwvSuLcELMvk1XC5jLWPq7z5kroy0Qw64BO2imA3JXeLRiLrYJ9Wc+Epa4te+3Xxikb0i+rGz1hLGOEeXlIpmzR5lPI9W3BetLvc06uWWjb8lMp5XYQM1Znkfixd+6Fs5xxCFYxBj3GgaP+cnmelcRNWpS5OZmsGJfJihvCPj7nZttHuzePN4V6kKct2gFzHHC9uokBXZkMZ3JUnrrQqy7JdaZu5841UJjj+DwgjHE+dmQfc/Sjc9UNc276HHJsghzmbrGa5xzXpH/AtlLK48NZzjgkxBfbiTsZN+Gov1yW3YiL89nIVVltTI43WfG5NcfEaDGhcAPYxhjl0k5JPZmEuGFsp2wlr2lT1ilTjjqmvazPpGoxmaYM15D2mPByDGQb41On/ps6nSvZR9kC+WlTsjUv7Xatwt5sySulPAYz/hl3kozBK476y+Woh985HLJ8mn4Jl5R1a7CbLyivbT9/QAQ75h9HuSX+MZD5x0yov6Z/brVHW+s/hXu5j8r7oUn8nUOwIfkSeJ7LJWScAsH1nMB6znhs5/+57WvA14K/qHULX26Bv3iK8k+IJtRf0z/n7hFrec6XIe7n1fpP4dL30WvdB+VxaBIvT6xemZ0KSecW8JrvnMB67vjXTlKCHa8VvNHtzyTTF/yt7PkTyq05Z4+4p5/rR3Scc+8kl7qP/HJcyh69Q8rDwO/tPCERmDM4b73+3BoPq/FbwZdxjEePuvIJb8rP+rSNz9Q764AdzFnpEgL87KNOAfu3yLGCLJIGbwNmn/L4XNXzOpnjJqydftfBNUVmfWuPGJN+RF+uJfWrc4VytpK4e6IuPlMvrGx0XtpBXTv0U+Jv047TR46d48v7pEm8PAQENJ6seFVJkDTAEshs8zUwwW5rPEHdV6UGeaFtlSB8xc2nepBrUFWWZJ2Aqz6eZO1DT9a/fPnyNB5oUxdz0ZWJgj7XlX38GU5ksXbmpU2iPZacjz3MoR3ZiX7WP9aZg171ZWKZduY/esR32oA/tZWxafeqnnuEDu1lHHWwbp9vELDV+4TiHqY9FO2ebO0n10KbNiKXPuUydrVfzEmdjHE8bRTakJs+TV+U98m/T3kpdwoByyAnBGQDNwEz66vxBE4Dt0FYuN4KivQxF5hPcDVh8UldtuqZLAnA1kluyobUBVybAEkiyOITsDeTI32uP9tl6uI668zPRJygK/3DNf7WnyQd+7XTNfKZ9bSD+e7DkS/nHiFjaz/nWvxiJ4w1uU+/UE9ZCfpz//ZsZEwm+PQRMM/94ovc3toBvX7ho1/7y/vl+zuklDuG4JeBdRXkcswcnxBcZ6DO4DuhLxMCeq1PO1b11DPtmvWpi6BtPwGfREA/xbpMf0zSbuA658z+BDvTP7OOjdb5zDVB9pOMVnqmPbOeMpLVfs61kKQZQxuFaxPstGdlv6z6UteWjfSvkrjQv1cH7EVGvrkp75vv75BS7pgZPFdBLsesgi1tBGwCIU9l2b8VfIE+gzRk0D4KvtRTz7Rr1qeunK/91LPI9Mck7YZp6+xP0J3+mXXssM5n2gXZv6Vn2jPrKQO43trPqYM+x1hM4nPsyn5Z9eV8+rSRtwR8WaCfdmxN+3NtR2sX3yiwZt/IlPfLv++QUu6UDJ4Ex/lqGQjKBE2Y4w1+vn6dwTiD74S+DPLotT6D7eq1aOqZeld25GtSnrZ91Us7wTtxPbAK+gnrT9nYSpvkuibYmf6Zdey2rq8T7FY3ffk06RqOfLnSsbWfuRbG5JO3OJfkmvYwLmUl6Mk9QAa6vA/TRnTma/rsg1zbXHvWtdNX+IDclFXeJ/+/Y0q5cwjaBlsDLJ8EVAIeyY6gZ6Cb4w361Ll2rgGSa78AJPQzz4Bp0Pa3TL9MUEc2wZW6cmnHDuskiEw+6MykoF3IomSCYQ51bGHNfJqYWDd6TVwrGK88ZbuOua4J69LvMOvYbMLSTtaGPXzOhOsa3Qs48mXu0dF+0sdYZFGwA5sYyzWymQvuAe3000d9BbZro3KmH7SRT/oY55rtm/uFLdS9f9MXzKHdvWMOsugr75sm8fIwEJwJZgRNAx1tPjXRbkCE1XjHEqhp89okQHGszD5lUIRgSp1ArVyTq2Op20dJG6wDMjI5mGiEOfZlEF/ZtUJbKeqEnI+O5MhuinXn8mkS4zPfmADrtM/EC1u+XOnQ5rSJa8Bv1JEjtuG/9Kv3Cn20q0tZCfJMxozBBu2fNtKOLgp7aj99c7+8pl30kbbmnFxXeb80iZdSyhmYWEu5B5rESynlDHgazp8GSnlNmsRLKeVEfGVPydfepbwWTeKllFLKg9IkXkoppTwoTeKllFLKg9IkXkoppTwoTeKllFLKg9IkXkoppTwoTeKllFLKg9IkXkoppTwoTeKllFLKg9IkXkoppTwoTeKllFLKg9IkXkoppTwoTeKllFLKg9IkXkoppTwoTeKllKvAn+38888/v9VOhzm///77d+U5ckp5DzSJl1Kuwo8//vj1p59++lY7nd9+++3rhw8fnub7t7upf/z48duIUoo0iZdSLg6J+JdffnlKvs95iiZx//rrr99qX5+ukVVK+Z6eilLKxeEpmuTN56dPn761ng5JnCdvXqV/+fLl6YmeLwallO9pEi+lXBQSL0kYSOAk8iR/687Cb+jCfF+nk8C5zv5Syt80iZdSLgqJl+RNYv78+fPTa3Cuhf5VySd26vN1+g8//PCtVkqRJvFSysXgaZmkncn5Of8obSZxXqn3N/FS/k1PRSnlIvAbOK++ScD+Y7a//vrrqc5TdD6N7+Fv6fM38ef8S/dS3jrfJXH/Bahl/pa1hf9JyB4eSmH83j9UOeVfoyLvVBufA8HkyM49Xjr/iHtf/7k8V5/zLJfEp8lTIelgw6kJ6xxYp/uda84n1iSTKfacs47nwL7pL/eQJ3PbTv0Hbikn5/KF4Bqgb2/P9DN2rDjqL+WaLCMeN+SpgdQDQDkVx5+q4xHJIPuW13kP4GOTFddbSe2R8ZwJyZw277OZgPDBbJsyyt9fdPDJyoeQ7fh0Juqj/lKuzYuTODwnOJyrAx7tgBhgz11nOR18e8m3Ede4x14q0/tIZuJm/fnFhfatLzL46y0mmlX8wU+n3Bv4K/0pz0naKzmlXJOHSeIcmEsG61vQJH59Lnlf8PPEpRPcc87GBJsyKR8l8fzZagXy3uI9mX4+NYHDVhKffodsO+ov5RaclMQzEPFJ4WaVo36gLW9u6szjoDknyd97uXYMJQ/R1DPHJgZpD23KWjEPt3UDBNczUEzZfK58aYGcY9usr5jrP2d9jHMM8yBtA+XwmXXXlXuXe0J92kUbn+pasaVvy9+pn5I6sz39DzlPe9IfOYexjsl5rjd9AfoQm+2zTB2uM/0zMWHzmaAPXfanrDl2gl3pqyTXuCorG+8JbGT97scpzPtOaJv3Dn7TB0f9pdyCZYbIm9OgZIF50+cYsN9gYp+BD2xzDIfOg8choC8PInOzbkDMYMS8PECOAWXmHIPsCtdA4TrrFOymcK2v5rrVmb5M+7jONTFW22hPf03m+s9dH2Bv6gfa/FQe11nPNcC0lX5tYJ7jvU9W7OmjrPwN874Axohy+IS0dfal3cBY+nO96M4x4HzXR/EeWK15+oux06ey5TNtpyiLsRSgzX7tE+deCvXcqhxxyphEf0w/0aY/hb13r476S7kFy7t93pxc58EwmHrTH/UD9Qxc1FPHPEgchAzOzJ3BmgNjQFWnwVNSLzIzAE+7J9Mm66mDuutAdq5Rm7Kf+izKczwlfbNFrh/OXR/g01xP6j1l/TCTUtoxZexxij7qaeO8L1zzLIyjb95DyfQfMJ72BHlJ2qN+bbaezDZsmz6Vub49tBNZ2rDSv/LrW8F1neozmPed0JZ7C9wf+vmov5RbsIzw8+acgcAg4U1/1A/UM9BTTx1zDgchD+IqmHFgZrKYgSmDMJ8ZpKfdE2Vq00oHddeBrlyja8p+ZW3BfOacEghy/XDu+gB96mJ8ru2U9cNc97SDa+YdresUfdT1J8z7ItczmWMn025g/JRH3fXmukGfa/PWHqTP9nxyZLNs7bv3oD6FrX0EdNG3VfZsfW2wT1jbKX6Ded8JPp37m/t21F/KLVhGeG7oDJQzEM3AcNQP1PPmpp46PEhCsMhDyNx5KDlEBi/np0zIQ4XMrWC3Qpmuw3oGv9SJrgxy+sH+1aFPkM8Y5x0Fg1w/nLs+UBefU98p64cZuKYdQvveuk7RRz33GFl5X9A37xM58sfK7rmnoF0w16IObd7SaTuyuN7iyGbABn0GOcf9zf60/62wWg9r37oXEv2RPgL8Ou8Hxrm3R/2l3ILlSeZGzMAyA8kMDEf9QD0DHvUMjqtEkAeQPuuO4wDlIeIauR6iGaxmkD4KkPNwW89DSl1fYVeOt+4Y9dkPjEEeJW1Tl2tdMdd/7vpEOa5DtEF7ref6IRMdfYyhIJM5uc9cb63pFH3U005kzUDNmNTJfHVql2Rf+s+2XFtCu+tL9Lk25x7MdSPDvi30Z/ogSfsl56zuAcanD947875Lsp37YN4LR/2lXJvvTjeHm5vSQpCZbQYFy3/+85/v6rN/1jPgZDvjhINguwHag0YhOBGErGdAynaKZPtqXTNIpj7Kf//73+/qW+tK273OtU291A26OdYAT1kFhrn+c9eXuJbkaP0GLkhfoBt7sQcYlz6xffIcf6ePbIP0J4VxyVZf6oCUP/dA/cm0ETvSlvQZMF6b98Bnq3HInjZI2jL1Io/+8v15pcx9zv1b3btH/aVcm+8jdynlZpCYSQJHmCguAQl9K/HfEtbUPy1aystpEi/llTjnyc03Fack/S18Or8HfAK+1v8PvZT3QpN4KTeExE3yem4yfe5TNF8C7uV1L19EsIW/bNbX+qW8jCbxUspN4Smc5M1n/7xoKS+jSbyUcjN4fc7bBD75O+Ev/YmglPdOk3gp5Wbwj/l4lc7rfX/nP+Vf6JdS1jSJl1JuBr+D8wqdRO7v4vfwr+VLeVSaxEspV4fX5/wGTtLO/7Ts06dPT0/jnz9//tZSSjmHJvFSytUhcfv0TeIW2yillPNpEi+llFIelCbxUkop5UFpEi+llFIelCbxUkop5SH5+vV/ygDXo4hdLasAAAAASUVORK5CYII=\" alt=\"\" /\u003e\u003c/p\u003e\n\u003cp\u003eWhere \u003cstrong\u003eA\u003c/strong\u003e is the mean average of DI or DS values in untreated control plants; \u003cstrong\u003eB\u003c/strong\u003e is the average values in each treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.3. Determination of virus accumulation content.\u003c/strong\u003e A newly emerged small leaves were collected 30 days post-inoculation to detect the BYMV accumulation and to further confirm the virus replication inhibition rate in AgNPs-treated and untreated plants using the double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) (\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e). The reactions were quantified at 405 nm in a microplate reader (BioTek, USA). Samples were considered positive when OD405 values were two times higher than the mean of the healthy control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.4. Transmission electron microscope.\u003c/strong\u003e The direct activity of AgNPs on viral particles was investigated in faba plants curatively treated with 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e compared to untreated control. The leaf-dip preparation method was performed to increase the probability of examination five days after virus inoculation. Briefly, the leaf samples of both treated and untreated plants were washed, disked and resuspended in deionized water to remove any surface-AgNPs attached to the leaf samples. The samples were ground in a drop of phosphate buffer pH 7.5 and 0.01% Na\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e3\u003c/sub\u003e. A 10 \u0026micro;l of leaf extracts were individually loaded on carbon-coated grids for 5 min, washed with distilled water and negatively stained with 2 % uranyl acetate (\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e). The grids were examined using a Jeol JEM1400 transmission electron microscope (TEM) (JEOL Co., Tokyo, Japan).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003e2.6. Enzyme activity assays\u003c/h2\u003e\n\u003cp\u003eFresh leaves (0.2g) from all treated and untreated plants were collected at 0, 24, 48, 72, 96, 120 and 144 h post-AgNPs spraying. The peroxidase (POD) and polyphenol oxidase (PPO) antioxidant enzyme activities were assayed using the methods described by Kar and Mishra (\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e). Changes in activities were expressed as nmol of guaiacol per mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e protein. min \u0026minus;\u0026thinsp;1. All experiments were performed in three biological replicates.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003e2.7. Protein pattern analysis\u003c/h2\u003e\n\u003cp\u003eProtein extract and separation were performed according to the procedure of Laemmli (\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e) with some modifications. Samples with 1 g of fresh leaves were collected from both AgNPs-treated and untreated plants 48 h after application. Leaf samples were ground in 0.5 ml Laemmli buffer, then centrifuged at 14,000 rpm for 20 min at 4\u0026deg;C. Protein contents were quantified against the bovine serum albumin (BSA) standards using a colorimetric (Bradford) protein assay protocol \u003cstrong\u003e(\u003c/strong\u003eThermo F. Scientific, USA). An equal amount of protein content for each sample (40 \u0026micro;g) was diluted with an equal volume of loading buffer (0.125 M Tris\u0026ndash;HCl, pH 6.8, 4% SDS, 10% glycerol, 1% 2-mercaptoethanol and 0.01% bromophenol blue dye). The mixture was incubated in a water bath for 3 min at 95\u0026deg;C and separated by electrophoresis using 10% sodium dodecyl sulfate-polyacrylamide (SDS\u0026ndash;PAGE) gel for 6 h. The gel was incubated in 1% nitric acid for 3 min and protein bands were visualized using 0.2% silver nitrate in a de-stain solution of 7% glacial acetic: 40 % methanol solution: 53 % distilled water solution (v/v).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003e2.8. PR-1 gene expression analysis using quantitative real time-PCR (qRT-PCR)\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003e2.8.1. cDNA synthesis.\u003c/strong\u003e Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen) protocol. The harvested RNA (2 \u0026micro;g) was primed with Oligo (dT) and converted into the first-strand cDNA by using COSMO cDNA synthesis kit (Willowfort, UK) according to the manufacturer\u0026rsquo;s protocol. The cDNA synthesis reaction was performed in a T-Gradient thermal cycler with initial annealing at 25\u0026deg;C for 10 min., followed by an extension phase at 45\u0026deg;C for 15 min.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8.2. qRT-PCR analysis.\u003c/strong\u003e Gene-specific primer encoding pathogenesis-related protein (PR-1 F/R) was designed according to Cheng \u003cem\u003eet al\u003c/em\u003e. (\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e). Meanwhile, the elongation factor 1- alpha was used as an endogens reference gene (ELF1A/F-R) (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The HERA SYBR Green qPCR kit (Willowfort, UK) was used for RT-qPCR analysis with 20\u0026micro;l reaction mixture consisting of 10\u0026micro;l SYBR green master mix, nuclease-free water (7.2\u0026micro;l), diluted cDNA template (2\u0026micro;l) and 0.5\u0026micro;l of each primer. The qRT-PCR program was performed as follows: 95\u0026deg;C for 2 min initially, followed by 40 cycles at 95\u0026deg;C for 1 min and 60\u0026deg;C for 30 s. The reaction was normalized with melting curve analysis at 65\u0026deg;C for 10 s for 61 cycles. The changes in gene expression were calculated based on the internal reference gene using the 2\u003csup\u003e\u003cstrong\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/strong\u003e\u003c/sup\u003e method (\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e). Each experiment was conducted in three biological replicates.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003e2.9. Effect on virus acquisition and transmission\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003e2.9.1. Aphid cultures.\u003c/strong\u003e Colonies of \u003cem\u003eAphis craccivora\u003c/em\u003e Koch. were collected from early grown faba bean fields at Giza Research Station, Agric. Res. Center (ARC), Egypt. The aphids were reared on cabbage seedlings under insect-proof cages for a long period of experimental time. Filial generations were used in subsequent as a source of non-viruliferous aphid cultures.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9.2. Treatments and virus acquisition assay.\u003c/strong\u003e The BYMV acquisition assay was done 1, 5- and 10 days post foliar spraying of AgNPs treatments (50, 100, 150, 200, 250 and 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) compared to untreated control. Aphids were starved for 1 h before deposited on a BYMV-free plant treated with AgNPs for a propping period of 3 h, which allow most of them to get in contact with AgNPs. The aphids of each treatment were separately moved to BYMV-infected plants and left to feed (2 h) for virus acquisition. At the end of 2 h, aphids were transferred individually as one aphid per healthy plant and were left for an inoculation feeding period of 24 h. The acquisition efficiency was also determined by leaving aphids to feed directly on BYMV-infected plants which were individually treated with the tested AgNPs rates. The percentage of the acquisition was computed as the number of aphids that transmitted the virus/ total number of aphids x100. Virus incidence in the symptomless plants was checked by back inoculation made on \u003cem\u003eCh. amaranticolor\u003c/em\u003e plants and also by using the DAS-ELISA technique.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9.3. Coat protein gene accumulation\u003c/strong\u003e. Leaf samples of faba bean plants were collected 30 days after acquisition assay for all AgNPs treatments sprayed 24 h. pre-acquisition. The total RNA extraction, the primer used and RT-PCR reaction were performed as mentioned above.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e\n\u003cp\u003eData were statistically analyzed using Completely Randomized Design (CRD) for analysis of variance (ANOVA) by the Assistat-statistics Software, Version 7.7 Beta (\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e). Each experiment was performed in three repeats.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv\u003e\n\u003ch2\u003e3.1. Virus isolation and propagation\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003eBean yellow mosaic virus\u003c/em\u003e was isolated from naturally infected faba bean plants showed BYMV-like symptoms. The isolated BYMV produced severe mosaic symptoms on faba bean plant and similar to those observed in the field (\u003cstrong\u003eFig.\u0026nbsp;1A,B\u003c/strong\u003e). The presence of BYMV isolate was confirmed by DAS-ELISA in mechanically inoculated plants and all samples were positive for BYMV. The virus titer was quantified with 1.206 OD and 0.743 OD in faba bean and \u003cem\u003eC. amaranticolur\u003c/em\u003e plants respectively, compared with 0.318 OD at negative control. Whereas, it was failed to react with antiserum specific for other viruses affecting faba bean plants.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.2. Molecular identification of BYMV\u003c/h2\u003e\n\u003cp\u003eThe BYMV isolate was confirmed using the RT-PCR molecular tool (\u003cstrong\u003eFig.\u0026nbsp;1C\u003c/strong\u003e). As illustrated by the agarose gel electrophoresis analysis, two samples of BYMV-infected plants produced a clear band at the expected amplicon size of 907 bp, however, no PCR products were achieved from healthy faba bean plants used as a negative control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.3. Characterization of silver nanoparticles\u003c/h2\u003e\n\u003cp\u003eThe physicochemical properties of the synthesized AgNPs were measured using different techniques. The size distribution profile and surface zeta potential were examined in AgNP colloidal aqueous solution. The synthesized nano-silver showed an excellent polydispersity index (PDI) 0.302, with a high negative surface area charge at a zeta potential of \u0026minus;\u0026thinsp;36.50 mV (\u003cstrong\u003eFig.\u0026nbsp;2A\u003c/strong\u003e). The average hydrodynamic size of the synthesized particles was found to be 7.43 nm with a range between 4.56 to 12.38 nm (\u003cstrong\u003eFig.\u0026nbsp;2B\u003c/strong\u003e). In this respect, the HR-TEM image indicates a well uniformed spherical crystal structure of AgNPs with average diameter size particles of 8.54 nm (\u003cstrong\u003eFig.\u0026nbsp;2D\u003c/strong\u003e). The crystalline fingerprint nature of silver nanoparticles was obtained by XRD. (\u003cstrong\u003eFig.\u0026nbsp;2C\u003c/strong\u003e). The XRD pattern showed four prominent peaks at 38.14, 44.36, 64.49 and 77.44 2\u0026theta; angles in crossbanding to (111), (200), (220) and (311) \u003cem\u003ehkl\u003c/em\u003e parameter respectively and based on Bragg\u0026rsquo;s reflection low.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.4. Effect of AgNPs on virus infectivity.\u003c/h2\u003e\n\u003cp\u003eSilver nanoparticles were superiorly found to exhibit antiviral activities against plant virus infection (\u003cstrong\u003eFig.\u0026nbsp;3A, B, C\u003c/strong\u003e). The AgNPs treatments applied 48 h post-inoculation had exhibited higher viricidal activity more than that exposed 24 h pre-inoculation (\u003cstrong\u003eFig.\u0026nbsp;3A, B)\u003c/strong\u003e. Water-treated plants inoculated with BYMV showed severe mosaic, yellowing and stunting symptoms (\u003cstrong\u003eFig.\u0026nbsp;3C)\u003c/strong\u003e. Noticeably, a complete reduction in virus infectivity was obtained by 200, 250 and 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e AgNPs either when applied pre- or post-virus challenge, while the rate of 100 and 150 mg l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e only exhibited a complete reduction in virus occurrence when sprayed 48 h post-inoculation. Further, the virus occurrence and disease severity were greatly decreased in the 50 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e treated plants by 74.67 % and 89.14 % respectively, over untreated control and more than that obtained when applied 24 h pre-inoculation (\u003cstrong\u003eFig.\u0026nbsp;3B\u003c/strong\u003e). In this respect, AgNPs display their ability to target the BYMV particles coat protein in treated plants, resulting in defeating the virus infectivity and disease proliferation (\u003cstrong\u003eFig.\u0026nbsp;4\u003c/strong\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.5. Effect of AgNPs on virus content\u003c/h2\u003e\n\u003cp\u003eVirus accumulation was dramatically affected by AgNPs treatments depending on its rate and time of exposure. As presented by \u003cstrong\u003eFig.\u0026nbsp;3 (D, E)\u003c/strong\u003e the highest virus titer was quantified with 1.504 OD in untreated positive control plants compared to 0.284 OD at healthy negative control. BYMV content was entirely arrested with 200, 250 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e AgNPs treatments when applied 24 h pre-inoculation, while 50, 100 and 150 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e rates significantly decreased the virus accumulation by 39.69 % (0.907 OD), 36.17% (0.960 OD) and 51.66% (0.728 OD) respectively (\u003cstrong\u003eFig.\u0026nbsp;3D\u003c/strong\u003e). However, the AgNPs treatments sprayed 48 h post-inoculation had produced a negative ELISA reaction against BYMV at all tested concentrations excepted for 50 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e albeit with a significant reduction in the virus content by 51.86% (0.724 OD) in 50 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e treated plants compared to untreated control (\u003cstrong\u003eFig.\u0026nbsp;3E)\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.6. Changes in oxidative enzyme activity\u003c/h2\u003e\n\u003cp\u003ePeroxidase (POD) and polyphenol oxidase (PPO) activity were considerably generated upon exposure to AgNPs applications as compared to control irrespective of concentrations (\u003cstrong\u003eFig.\u0026nbsp;5A\u003c/strong\u003e). Interestingly, the peak of PO activity stimulated by 150 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e spray was steadily increased at 24 h (2.04 fold) reaching its maximum with 3.57 fold at 144 h post-application. However, leaves treated with 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e showed a log-like phase of activity at 24 h (2.43 fold) and 48 h (4.26 fold), sharply decreased afterward at 144 h. Further, all AgNPs rates were constantly found to keep the activity peaks higher than either did of 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and untreated control at the end of the time course. However, the maximum increase in PPO activity was significantly observed in leaves treated with 250 and 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e over the untreated control, reaching its maximum with 2.92 and 2.25 at 120 and 72 h respectively. The PPO activity was not significantly affected upon exposure to 50 and 100 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e sprayings during the all-time course excepted at 72 h (0.65 fold) and 48 h (0.91 fold) respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.7. Changes in protein constituents\u003c/h2\u003e\n\u003cp\u003eFoliar spraying of AgNPs proved some alterations of protein profile in treated faba bean leaves compared to both untreated infected and healthy control plants. Two new protein bands with about 90 and 140 kDa were observed and more or less accumulated depending on the AgNPs rate, while the BYMV-inoculated plants produce two polypeptides of 55 and 90 kDa compared to healthy control. Interestingly, the intensity of protein bands was increased as the AgNPs concentrations increased in which the band intensity was markedly accumulated in 50, 100 and 200 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and start to decrease at 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e rate with a notable disappearance of some polypeptides which accumulated in other treatments (\u003cstrong\u003eFig.\u0026nbsp;5B\u003c/strong\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.8. Changes in gene expression level\u003c/h2\u003e\n\u003cp\u003eThe transcription level of the defense-related PR-1 gene involved in response to plant biotic and abiotic stress was measured by qRT-PCR in AgNPs-treated and untreated plants (\u003cstrong\u003eFig .5 C\u003c/strong\u003e). The gene expression levels were differentially promoted with the tested applications of AgNPs over the untreated plants. Following the 100 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e application, the fold change in gene expression was promoted with 8.51. The highest level of expression was generated with a 12.06 fold change in faba bean plants treated with 200 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e rate, while the lowest level of expression among the three tested concentrations was generated with a 5.36 fold over the control when the rate of AgNPs increased to 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.9. Effect on virus-vector interaction\u003c/h2\u003e\n\u003cp\u003eThe direct activity of AgNPs on the ability of vector aphid to acquire BYMV particles and transmit it to other healthy plants was excitingly investigated after exposure to AgNPs-treated plants (\u003cstrong\u003eFig.\u0026nbsp;6A, B, C\u003c/strong\u003e). Notably, a significant inhibition in virus acquisition and transmissibility was noted 1, 5 and 10 days after spraying with all tested concentrations compared to the untreated control, except for 50 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at 10 days (\u003cstrong\u003eFig .6 A\u003c/strong\u003e). The rate of acquisition was blocked totally by 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at 1 and 5 days after application, while a great inhibition,79.64 % was observed at 10 days compared to untreated control. However, the 250 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e application completely blocked the virus acquisition and transmission 1 day after spraying. Furthermore, the 150 and 200 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e applications produced a significant reduction in virus acquisition by 89.45 and 77.61% for 1 day to reach 61.32% and 57.05% at 10 days respectively, while the 50 and 100 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e treatments significantly reduced the virus acquisition for 1 day by 40.65% and 66.21% respectively. On the other hands, the AgNPs treatments applied to BYMV-infected plants strongly affect the aphid ability to acquire the virus 24 h post spraying, proved a complete inhibition in virus acquisition and transmission at rates of 150, 200, 250 and 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, while the 50 mg.l-1 and 100 mg.l-1 application greatly reduced the proportion of acquisition by 61.81 % and 86.91 % respectively (\u003cstrong\u003eFig.\u0026nbsp;6D\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eCoat protein gene accumulation was qualitatively measured using conventional RT-PCR reaction to confirm the efficacy of AgNPs on virus acquisition and transmissibility (\u003cstrong\u003eFig.\u0026nbsp;6B\u003c/strong\u003e). Exposure to 300 and 250 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e of AgNPs hadn\u0026rsquo;t exhibited any viral RNA reproducibility (lane 2 and 3 respectively) compared to control plants that produced a high-intensity band reflecting a higher accumulation of viral RNA compared to AgNPs-treated plants. However, the intensity of PCR bands was less than that of control at exposure to 150 and 200 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, while the CP gene accumulation bands for 50 and 100 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e rates were approximately similar in band intensity as control.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":" \u003cp\u003eThe control measures used to deter plant viruses are obtained during the pesticide application against vector, however, it is often ineffective with non-persistently transmitted viruses due to the short propping and subsequent inoculation time required for virus transmission by incoming viruliferous vectors (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Hence, searching for effective innovation technologies is urgently needed to prevent crop losses and maintain sustainable agriculture without going into a pesticide treadmill. The present research was planned to investigate the role of AgNPs capabilities in controlling BYMV disease either by testing its direct or indirect activity on virus infectivity and/or during the evaluation of AgNPs on aphid feeding behavior through the combating of virus acquisition and transmissibility by vector aphid from infected to healthy plants.\u003c/p\u003e \u003cp\u003eConcerning the effect of AgNPs on virus infectivity and host-virus interactions, the AgNPs proved a superior effect and highly prominent antiviral activities in curatively treated plants compared to the protective applications, the disease occurrence and virus accumulation content were entirely arrested at low rates of AgNPs in plants treated 48 h post-virus inoculation than those preventively exposed 24 h pre-inoculation. Generally, the AgNPs applied to the plant foliage are absorbed, dispersed into the plant cells and it was found to interact with many macromolecules, lipids, pectin, lignin and other cellular components (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Furthermore, AgNPs have a high protein-affinity that facilitates interacting with a wide array of host proteins and cellular entities (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Accordingly, these phenomena support our suggestion that the rate of free dispersed nanoparticles that are required to interfere with the virus units might be captured by plant proteins and other cellular components when plants are preventively treated 24 h ahead to virus inoculation. Conversely, the application of AgNPs after virus inoculation could increase the probability of a high number of nano-silver particles to target the viral proteins and/or the whole virus particle that eventually exhibit outstanding efficiency in suppressing BYMV disease compared to preventive applications of AgNPs applied at the same concentrations. The AgNPs-plant protein interactions are not documented clearly but other previous studies stated that the initial interaction between proteins and metal nanoparticles changes their \u003cem\u003ein vivo\u003c/em\u003e properties and has remarkably altered the mechanism of nanoparticle interaction with other cell targets (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs demonstrated in the present study, the transmission electron microscope confirms the ability of AgNPs to suppress viral infection in faba bean plants by targeting the BYMV particles directly when applied after virus inoculation. A potential notion for this may be due to the synthesized AgNPs have a surface area with negative charges, resulting in a high surface bio-reactivity to hold the viral capsid proteins which prominently contain a high positive charge. The results obtained herein are convergent with a previous finding that proved the ability of nano-silver particles to extensively aggregate and interfere with the viral envelope protein units of \u003cem\u003ePotato virus Y in vitro\u003c/em\u003e (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Thus, it is reasonable to argue that the AgNPs effects on the virus particles may be determined by the particle chemical nature, reactivity and the free dispersed amount of NPs present in the plant. Unfortunately, very limited reports have been conducted on the AgNPs-virus interactions and the mode of action of AgNP on virus particles still rather unambiguous in many plant, animal and human viruses. The underlying mechanisms of action of AgNPs have been proved as a novel therapeutic agent against some human and animal viruses (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). Due to the high affinity of Ag ions for nitrogen and sulfur, it is believed that it can disrupt the structure of many viral proteins by binding to amino and thiol groups. In this respect, Khandelwal \u003cem\u003eet al.\u003c/em\u003e (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e) documented that the antiviral activity of AgNPs and other metal nanoparticles might be attributed by interference with glycoproteins of the viral envelope which might ultimately prevent the virus invasion, uncoating of viral coat protein and the subsequent replication process of virus particles within the host cell. The small engineered size of NPs of 7\u0026ndash;20 nm was proved to have higher antiviral effects by binding to the viral nucleic acid, translated functional proteins and cellular factors during the virus replication (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). This supports the notion that the AgNPs particle size seems to be critical for its antiviral properties. To some extent, all this fact might point out the role of silver in controlling plant viruses. However, more studies are required to prove the direct underlying mechanism of action for AgNPs in combating plant viruses, since the plant viruses have a different nature than other animal and human viruses especially in their mode of infection and cell invading. Moreover and given that the role of plant plasmodesmata in transporting substances including invaded-viruses from cells to another and since the nanoparticles are easily dispersed in the plant through its intercellular structure channels, with particle size less than 40 nm (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e), we also envision that the AgNPs could affect the plasmodesmata protein factors and/or viral movement protein complex that facilities the virus cell-to-cell movement (\u003cb\u003eFig.\u0026nbsp;7A\u003c/b\u003e).\u003c/p\u003e \u003cp\u003eRegarding the AgNPs ability in promoting the plant defense mechanism against the virus invading, our findings indicate that the changes in enzymes activity, upregulation of PR-1 gene expression and protein accumulation was not associated with increasing the application rate of AgNPs, in which the highest tested concentration of AgNPs affects the POD activity peak and reduced the protein accumulation. Furthermore, the upregulation of the PR-1 gene was lower than that obtained at the lowest tested dose. This finding suggests that the antiviral activity of AgNPs in defeating BYMV is not strongly correlated with strengthened plant immunity against the virus and the direct inhibition depending on the reactivity of AgNPs to virus remained sufficient to arrest the virus infectivity, albeit a dual role by stimulating plant resistance may be obtained with low AgNPs concentrations. Generally, AgNPs have been found to increase the plant oxidative enzymes and up-regulated the immunity-related genes such as PR-1 with very low concentrations (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). The mechanism underlying the role of AgNPs to motivate some adaptive mechanisms in plant defense booster is mainly due to its potential to enhance the reactive oxygen species (ROS) in treated plants (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). In this respect, plants activate some enzymatic and non-enzymatic constituents as a scavenging system to cope with the toxic free radicals of oxygen to prevent cell damage. All previous reports have indicated that the ROS is increased with increasing the AgNPs concentrations and with reducing particle size (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Therefore and as the results reported herein, the sharp decrease in the peak of POD activity with the increasing of AgNPs rate is might be an indicator of removal of stressful conditions by other enzymatic scavenging systems, and since the faba bean plants have high phenolic content, the ongoing increase in oxidative enzymes like POD as a response for an excess generation of ROS could resulting in high oxidizing rate for phenolics that might ultimately affect the plant cell integrity. Consistent to results obtained herein concerning the protein accumulation and relative expression of PR-1 gene, previous studies have been differentially proved the AgNPs ability to up-regulate many biotic and abiotic-specific genes and increased protein accumulation in several treated plants at low rates, while considerable numbers of genes were down-regulated with increasing AgNPs rate (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). Arising from this fact is the AgNPs applied with high concentrations may damage the plant transcription machinery and genomic background in treated plants applied with high concentrations (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e), which could concurrently affect the transcription level of some defense-related genes, protein accumulation and the synthesis of viral polyproteins depending on the AgNPs rate.\u003c/p\u003e \u003cp\u003eThe first required step for virus transmission is the ability of vector insects to acquire the virus from an infected plant and transmit it to other healthy plants. To the best of our knowledge and according to the available literature, there is nothing prior study was conducted to investigate the AgNP activity against virus acquisition and subsequent transmission by vector aphids. Thus, for this study, it was of interest to decide whether AgNPs can effectuate the virus-vector interaction and disrupt the virus acquisition and transmission capabilities. Our results clearly showed that the AgNPs applied prior-the virus acquisition greatly affects the BYMV transmission 24 h soon after application, to reach 100 % at 250 and 300 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The inhibiting activity reduced with time, and the virus acquisition was effectively inhibited for 10 days by more than 50 % at all tested concentrations excepted at the rate of 50 and 100 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. No previous studies hypothesized the direct activity of AgNPs on virus-vector interaction, however, a few studies have elicited the activity of AgNPs and other metal nanomaterials on insect mortality, oviposition, feeding and larva development (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). Further, a trial conducted by Chakravarthy et al. (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e) stated that AgNPs applied at high concentration (2400 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) had damaged the whole insect digestive system leading to insect death, while the concentration of AgNPs lower than 50 mg,l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e caused chronic toxicity by affecting the reproduction, emergence and larval development (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenerally, non-persistent plant viruses including BYMV are retained in receptors present on the stylets common duct of insect mouthpart and are injected to the plant by salivating during brief intracellular punctures, these receptors are cuticular proteins that readily accessible all over the surface of the acrostylet responsible for the aphid transmission of potyviruses and many other plant viruses (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e). The current understanding of how AgNPs interfere with intracellular components inside the insect is almost non-existent, however, the known mechanism is that AgNPs can interact with insect protein involved in serval cellular functions (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Accordingly, we speculate that exposure of aphids to AgNPs treatments before virus acquisition may properly affect the cuticular proteins binding to aphid mouthpart, altering the ability of vector aphids to acquire the virus.\u003c/p\u003e \u003cp\u003eOn the other hand, our study illustrates the ability of AgNPs treatments to prevent aphids to acquire the virus from AgNPs-treated plants infected with BYMV, in which the acquisition and transmission were entirely inhabited as low concentration as 150 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Coat protein (CP) encapsidating the viral nucleic acid is the critical point in virus transmissibility by aphid vector in which the virus particles adhere to stylet mouthpart through motifs in CP and another viral protein called helper-component protein (HC-pro) that acts as a bridge between virus particles and the receptor proteins on insect stylet (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e), hence, lacking in aphid transmissibility for viruses may occur with a chemical or physical change in the virus particles and the configurational HC-Pro protein. Consequently, and as demonstrated in the current study, it is plausible to suggest that the inhibition in virus acquisition and transmissibility when AgNPs applied on BYMV-infected plants may be due to the ability of AgNPs to interfere with viral CP and HC-pro proteins before the aphid came in contact with the virus particles, which could sequester or prevent the virus particles to adhere to the receptors on stylet mouthpart (\u003cb\u003eFig.\u0026nbsp;7B\u003c/b\u003e).\u003c/p\u003e "},{"header":"5. Conclusion","content":" \u003cp\u003eIn conclusion, despite the available information about the antiviral capabilities of AgNPs and their toxicity against pests, no knowledge was elicited on its possibility to affect the virus -vector interactions. These results surprisingly cast a new light on the potentiality of AgNPs to influence the virus acquisition and transmission by vector insect, which could be attributable to either by affecting the insect stylet mouthpart and/or by subverting or interference with viral CP and HC-pro proteins involved in virus-aphid transmissibility. However, further expanded research on this initial study is needed to explore the actual mechanisms underlying the critical role of silver nanoparticles in the virus-vector interactome. Importantly, this work introduces a new approach to utilize such nanoparticles as a potential candidate against insect transmitted-plant viruses, which could offer a new alternative strategy to control plant viruses under field conditions. However, further research should be carried out to assess the environmental and health cost before abundantly use in the cropping system compared to those conventional pesticides that are widely used in the agricultural sector.\u003c/p\u003e "},{"header":"6. Declarations","content":"\u003ch2\u003eAcknowledgment\u003c/h2\u003e \u003cp\u003eThe authors gratefully would like to thank the Central Laboratory of Nanotechnology \u0026amp; Advanced Materials, Agricultural Research Center (ARC), Giza, Egypt, for providing some laboratory facilities for the characterization of synthesized silver nanoparticles.\u003c/p\u003e "},{"header":"7. References","content":"\u003col\u003e\n\u003cli\u003eSingh AK, Bharati RC, Manibhushan NC, Pedpati A (2013) An assessment of faba bean (\u003cem\u003eVicia faba\u003c/em\u003e L.) current status and future prospects. \u003cem\u003eAfrican J. Gric. Res.\u003c/em\u003e, 8 (50): 6634\u0026ndash;6641. https://academicjournals.org/article/article1387443711_Singh%20et%20al.pdf\u003c/li\u003e\n\u003cli\u003eRobinson GHJ, Balk J, Domoney C (2019) Improving pulse crops as a source of protein, starch and micronutrients. \u003cem\u003eNutrBull\u003c/em\u003e.,44(3):202\u0026ndash;215.\u0026nbsp;https://doi.org/10.1111/nbu.12399\u003c/li\u003e\n\u003cli\u003eMiteva E, Hristova D, Nenova V, Maneva S (2005) Arsenic as a factor affecting virus infection in tomato plants: Changes in plant growth, peroxidase activity and chloroplast pigments. \u003cem\u003eScientia Hortic.\u003c/em\u003e, 105: 343\u0026ndash;358. https://doi.org/10.1016/j.scienta.2005.01.026\u003c/li\u003e\n\u003cli\u003eSharma PN, Sharma V, Anuradha S, Rajput K, Sharma SK (2015) Identification and molecular characterization of \u003cem\u003eBean yellow mosaic virus\u003c/em\u003e infecting French bean in Himachal Pradesh. \u003cem\u003eVirusDisease\u003c/em\u003e, 26(4): 315\u0026ndash;318. doi: 10.1007/s13337-015-0270-z\u003c/li\u003e\n\u003cli\u003eEl-Bramawy MAE, El-Beshehy EKF (2011) The Resistance of Bean yellow mosaic virus (BYMV) in faba bean (\u003cem\u003eVicia faba\u003c/em\u003e L.) with diallel analysis. \u003cem\u003eJ. Biol. Life Sci.\u003c/em\u003e, 2 (1): 1\u0026ndash;15. DOI: 10.5296/jbls.v2i1.588\u003c/li\u003e\n\u003cli\u003eHampton RO, Jensen A, Hagel GT (2005) Attributes of Bean Yellow Mosaic Potyvirus Transmission from Clover to Snap Beans by Four Species of Aphids (\u003cem\u003eHomoptera: Aphididae\u003c/em\u003e). \u003cem\u003eJ. Eco. Entomol\u003c/em\u003e., 98(6): 1816\u0026ndash;1823. https://doi:10.1603/0022-0493-98.6.1816\u003c/li\u003e\n\u003cli\u003eSingh S, Singh BK, Ydava SM, Kupta AK (2014) Applications of nanotechnology in agriculture and their role in disease management. \u003cem\u003eRes. J. Nanosci. Nanotecnol\u003c/em\u003e., ISSN 1996\u0026ndash;5044. DOI: 10.3923/rjnn.2015.1.5\u003c/li\u003e\n\u003cli\u003ePrasad R, Bhattacharyya A, Nguyen QD (2017) Nanotechnology in Sustainable Agriculture: Recent Developments, Challenges, and Perspectives. \u003cem\u003eFront Microbiol\u003c/em\u003e., 8:1014. https://doi:10.3389/fmicb.2017.01014\u003c/li\u003e\n\u003cli\u003eLuca M (2018) Nanotechnology in Agriculture: New Opportunities and Perspectives, New Visions in Plant Science, IntechOpen, http://doi:10.5772/intechopen.74425\u003c/li\u003e\n\u003cli\u003eOsuwa JC, Anusionwu PC (2011) Some advances and prospects in nanotechnology: a review. \u003cem\u003eAsian J. Inform. technol.\u003c/em\u003e, 10 (2):96\u0026ndash;100. DOI: 10.3923/ajit.2011.96.100\u003c/li\u003e\n\u003cli\u003eBakshi M, Singh HB, Abhilash PC (2014) The unseen impact of nanoparticles: more or less?\u0026rdquo; \u003cem\u003eCurrent Science\u003c/em\u003e,106: (3)350\u0026ndash;352. https://www.jstor.org/stable/24099889\u003c/li\u003e\n\u003cli\u003eRai M, Yadav A, Gade A (2009) Silver nanoparticles as a new generation of antimicrobials. \u003cem\u003eBiotechnol. Advance\u003c/em\u003e, 27 (1): 76\u0026ndash;83. https://doi.org/10.1016/j.biotechadv.2008.09.002\u003c/li\u003e\n\u003cli\u003eChaloupka K, Malam Y, Seifalian AM (2010) Nanosilver as a new generation of nanoproducts in biomedical applications.\u0026rdquo; \u003cem\u003eTrends in Biotechnol.\u003c/em\u003e, 28 (11): 580\u0026ndash;588. https://doi.org/10.1016/j.tibtech.2010.07.006\u003c/li\u003e\n\u003cli\u003eElbeshehy EKF, Elazzazy AM, Aggelis G (2015) Silver nanoparticles synthesis mediated by new isolates of \u003cem\u003eBacillus spp\u003c/em\u003e., nanoparticle characterization and their activity against \u003cem\u003eBean yellow mosaic virus\u003c/em\u003e and human pathogens. \u003cem\u003eFront. Microbiol\u003c/em\u003e., 6:453\u0026ndash;465. DOI: 10.3389/fmicb.2015.00453\u003c/li\u003e\n\u003cli\u003eBurduşel AC, Gherasim O, Grumezescu AM, Mogoant,\u0026atilde; L, Ficai A, Andronescu E (2018) Biomedical applications of silver nanoparticles: an up-to-date overview. J. \u003cem\u003eNanomaterials\u003c/em\u003e 8:E681. http://doi:10.3390/nano8090681\u003c/li\u003e\n\u003cli\u003eJain D, Daima HK, Kachhwaha S, Kothari SL (2009) Synthesis of plant-mediated silver nanoparticles using papaya fruit extract and evaluation of their antimicrobial activities, \u003cem\u003eDig. J. Nanomaterial Biostruc.\u003c/em\u003e, 4 (3): 557\u0026ndash;653. https://chalcogen.ro/557_Jain.pdf\u003c/li\u003e\n\u003cli\u003eMishra S, Singh HB (2015) Biosynthesized silver nanoparticles as a nanoweapon against phytopathogens: exploring their scope and potential in agriculture. \u003cem\u003eAppl. Microbiol. Biotechnol\u003c/em\u003e., 99: 1097\u0026ndash;1107. https://pubmed.ncbi.nlm.nih.gov/25547832/\u003c/li\u003e\n\u003cli\u003eHuang W, Yan M, Duan H, Bi Y, Cheng X, Yu H (2020) Synergistic Antifungal Activity of Green Synthesized Silver Nanoparticles and Epoxiconazole against \u003cem\u003eSetosphaeria turcica\u003c/em\u003e. \u003cem\u003eJ. Nanomaterials\u003c/em\u003e. https://doi.org/10.1155/2020/9535432\u003c/li\u003e\n\u003cli\u003eNoshad A, Mudassar L, Hetherington C, Wahab H (2020) Biogenic AgNPs\u0026mdash;A Nano Weapon against Bacterial Canker of Tomato (BCT). \u003cem\u003eAdvances in Agriculture\u003c/em\u003e, (3): 1\u0026ndash;10, https://doi.org/10.1155/2020/9630785\u003c/li\u003e\n\u003cli\u003eJain D, Kothari SL (2014) Green Synthesis of Silver Nanoparticles and their Application in Plant Virus Inhibition. \u003cem\u003eMycol. Plant Pathol\u003c/em\u003e., 44(1): 21\u0026ndash;24. https://www.researchgate.net/publication/260981626\u003c/li\u003e\n\u003cli\u003eYang XX, Li CM, Huang CZ (2016) Curcumin modified silver nanoparticles for highly efficient inhibition of respiratory syncytial virus infection. \u003cem\u003eNanoscale\u003c/em\u003e, 8: 3040\u0026ndash;3048. DOI: 10.1039/C5NR07918G\u003c/li\u003e\n\u003cli\u003eClark MF, Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. \u003cem\u003eJ. Gen. Virol\u003c/em\u003e., 34:475\u0026ndash;483. https://doi.org/10.1099/0022-1317-34-3-475\u003c/li\u003e\n\u003cli\u003eKuhn CW (1964) Separation of cowpea virus mixtures. \u003cem\u003ePhytopathol.\u003c/em\u003e, 54:739\u0026ndash;740\u003c/li\u003e\n\u003cli\u003eAL-Khalaf M, Kumari SG, Kasem A, Makkouk KM, Shalaby AA, AL-Chaabi SA (2008) Molecular characterization of a \u003cem\u003eBean yellow mosaic virus\u003c/em\u003e isolate from Syria. Phytopathol Mediterr, 47: 282\u0026ndash;285. https://doi.org/10.14601/Phytopathol_Mediterr-2734\u003c/li\u003e\n\u003cli\u003eVan Dong P, Ha CH, Binh LT, Kaspom J (2012) Chemical synthesis and antibacterial activity of novel-shaped silver nanoparticles. \u003cem\u003eInt. Nano. Lett\u003c/em\u003e., 2, 9. https://doi.org/10.1186/2228-5326-2-9\u003c/li\u003e\n\u003cli\u003eRichard CM, Braydich-Stolle L, Schrand AM, Schlager J, Hussain SM (2008) Characterization of Nanomaterial Dispersion in Solution Prior to \u003cem\u003eIn Vitro\u003c/em\u003e Exposure Using Dynamic Light Scattering Technique. \u003cem\u003eToxicological Sciences\u003c/em\u003e, 101 (2): 239\u0026ndash;253. DOI: 10.1093/toxsci/kfm240\u003c/li\u003e\n\u003cli\u003ePhanjom DP, Zoremi E, Mazumder J, Saha M, Baruah SB (2012) Green synthesis of silver nanoparticles using leaf extract of \u003cem\u003eMyrica esculenta\u003c/em\u003e. \u003cem\u003eInt. J. NanoSci. Nanotechnol, 7\u003c/em\u003e: 991\u0026ndash;998. https://www.researchgate.net/publication/273762430\u003c/li\u003e\n\u003cli\u003eYang X, Liangyi K, Tien P (1996) Resistance of tomato infected with cucumber mosaic virus satellite RNA to potato spindle tuber viroid. \u003cem\u003eAnn. Appl. Biol.\u003c/em\u003e, 129: 543\u0026ndash;551.\u0026nbsp;https://doi.org/10.1111/j.1744-7348.1996.tb05775.x\u003c/li\u003e\n\u003cli\u003eCampos RE, Bejerman N, Nome C, Laguna IG, Pardina PR (2013) Bean Yellow Mosaic Virus in Soybean from Argentina. \u003cem\u003eJ. Phytopathol.\u003c/em\u003e, 162: 322\u0026ndash;325.\u0026nbsp;https://doi.org/10.1111/jph.12185\u003c/li\u003e\n\u003cli\u003eKar M, Mishra D (1976) Catalase, peroxidase, and polyphenol oxidase activities during rice leaf senescence. \u003cem\u003ePlant Physiol\u003c/em\u003e., 57:315\u0026ndash;319. Doi: 10.1104/pp.57.2.315\u003c/li\u003e\n\u003cli\u003eLaemmli UK (1970) Cleavage of structural proteins during the assembly of the head bacteriophage T4. \u003cem\u003eNature\u003c/em\u003e, 227: 680\u0026ndash;685. https://www.nature.com/articles/227680a0\u003c/li\u003e\n\u003cli\u003eCheng Y, Zhang H, Yao J, Wang X, Xu J, Han Q, Wei G, Huang L, Kang Z (2012) Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen. BMC Plant Biol 12:96. DOI:10.1186/1471-2229-12-96\u003c/li\u003e\n\u003cli\u003ePfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e 29 (9): 1\u0026ndash;45. DOI: 10.1093/nar/29.9.e45\u003c/li\u003e\n\u003cli\u003eSiliva FDA, Azevedo CA (2009) Principal Components Analysis in the Software Assistat-Statistical Attendance. In: world congress on computers in agriculture, 7, Reno-NV-USA: American Society of Agricultural and Biological Engineers. https://www.scirp.org/(S(i43dyn45teexjx455qlt3d2q)\u003c/li\u003e\n\u003cli\u003eKumari SG, Makkouk K (2007) Virus diseases of faba bean (Vicia faba L.) in Asia and Africa. \u003cem\u003ePlant viruses\u003c/em\u003e, 1(1): 93\u0026ndash;105. https://www.researchgate.net/publication/272293078_Virus_diseases_of_faba_bean_Vicia_faba_L_in_Asia_and_Africa\u003c/li\u003e\n\u003cli\u003eBragard C, Caciagli P, Lemaire O, Lopez-Moya JJ, MacFarlane S, Peters D, Susi P, Torrance L (2013) Status and prospects of plant virus control through interference with vector transmission. \u003cem\u003eAnnu. Rev. Phytopathol.\u003c/em\u003e, 51:177\u0026ndash;201. https://doi:10.1146/annurev-phyto-082712-102346\u003c/li\u003e\n\u003cli\u003eJones RAC (2014) Trends in plant virus epidemiology: Opportunities from new improved technologies. \u003cem\u003eVirus Res.\u003c/em\u003e, 186: 3\u0026ndash;19. DOI: 10.1016/j.virusres.2013.11.003\u003c/li\u003e\n\u003cli\u003eZuverza-Mena N, Armendariz R, Peralta-Videa JR, Gardea-Torresdey JL (2016) Effects of silver nanoparticles on radish sprouts: root growth reduction and modifications in the nutritional value. Front Plant Sci 7:90. Doi:10.3389/fpls.2016.00090\u003c/li\u003e\n\u003cli\u003eBanerjee V. and Das K (2013) Interaction of silver nanoparticles with proteins: A characteristic protein concentration-dependent profile of SPR signal. \u003cem\u003eColloids and surfaces. B, Biointerfaces\u003c/em\u003e. 11(1):71\u0026ndash;79. https://doi:10.1016/j.colsurfb.2013.04.052\u003c/li\u003e\n\u003cli\u003eRibeiro APC, Anbu S, Alegria ECBA, Fernandes AR, Baptista PV, Mendes R, Pombeiro AJL (2018) Evaluation of cell toxicity and DNA and protein binding of green synthesized silver nanoparticles. \u003cem\u003eBiomedicine and Pharmacotherapy\u003c/em\u003e, 101: 137\u0026ndash;144. https://doi:10.1016/j.biopha.2018.02.069\u003c/li\u003e\n\u003cli\u003eAbraham AN, Sharma TK, Bansal V, Shukla R Phytochemicals as Dynamic Surface Ligands To Control Nanoparticle-Protein Interactions. \u003cem\u003eACS Omega\u003c/em\u003e., 2018, 3(2): 2220\u0026ndash;2229. https://doi:10.1021/acsomega.7b01878\u003c/li\u003e\n\u003cli\u003eEl-Dougdoug N, Bondok KA (2018) Evaluation of silver nanoparticles as antiviral agent against \u003cem\u003eTomato mosaic virus\u003c/em\u003e (ToMv) and Potato virus Y in tomato plants. Middle East J Appl Sci, 8 (1):100\u0026ndash;111. http://www.curresweb.com/mejas/mejas/2018/100-111.pdf\u003c/li\u003e\n\u003cli\u003eNakamura S, Sato M, Sato Y, Ando N, Takayama T, Fujita M, Ishihara M (2019) Synthesis and Application of Silver Nanoparticles (Ag NPs) for the Prevention of Infection in Healthcare Workers. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e, 20, 3620; https://doi:10.3390/ijms20153620\u003c/li\u003e\n\u003cli\u003eKhandelwal N, Kaur G, Kumar N, Tiwari A (2014) Application of silver nanoparticles in viral inhibition: a new hope for antivirals. \u003cem\u003eDig. J. Nanomaterial Biostruct.\u003c/em\u003e 9: 175 \u0026ndash; 186. https://chalcogen.ro/175_Khandelwal.pdf\u003c/li\u003e\n\u003cli\u003eGaikwad S, Ingle A, Gade A, Rai M, Falanga A, Incoronato N, Russo L, Galdiero S, Galdiero M (2013) Antiviral activity of myco-synthesized silver nanoparticles against \u003cem\u003eherpes simplex virus\u003c/em\u003e and human parainfluenza virus type 3. Int J Nanomed 8: 4303\u0026ndash;4314. DOI: 10.2147/IJN.S50070\u003c/li\u003e\n\u003cli\u003eGeisler-Lee J, Wang Q, Yao Y, Zhang W, Geisler M, Li K, Huang Y, Chen Y, Kolmakov A, Ma X (2013) Phytotoxicity, accumulation and transport of silver nanoparticles by Arabidopsis thaliana. Nanotoxicol, 7: 323\u0026ndash;337. DOI:10.3109/17435390.2012.658094\u003c/li\u003e\n\u003cli\u003eMirzajani F, Askari H, Hamzelou S, Schober Y, Rompp A, Ghassempour A, Spengler B (2014) Proteomics study of silver nanoparticles toxicity on \u003cem\u003eBacillus thuringiensis. Ecotoxicol. Environ. Saf.\u003c/em\u003e, 100: 122\u0026ndash;130. https://doi.org/10.1016/j.ecoenv.2013.10.009\u003c/li\u003e\n\u003cli\u003eSingh S, Vishwakarma K, Singh S, Sharma S, Dubey NK, Singh VK, Liu S, Tripathi DK, Chauhan DK (2017) Understanding the plant and nanoparticle interface at transcriptomic and proteomic level: a concentric overview. \u003cem\u003ePlant Gene\u003c/em\u003e, http://dx.doi.org/10.1016/j.plgene.2017.03.006\u003c/li\u003e\n\u003cli\u003eRastogi A, Zivcak M, Sytar O, Kalaji H, Xiaolan H, Mbarki S, Brestic M (2017) Impact of metal and metal oxide nanoparticles on plant: A Critical Review. \u003cem\u003eFrontiers in Chemistry\u003c/em\u003e, 5: 78. 10.3389/fchem.2017.0007. https://doi.org/10.3389/fchem.2017.00078\u003c/li\u003e\n\u003cli\u003eKaveh R, Yue-Shen L, Ranjbar S, Tehrani R, Brueck C, Van Aken B (2013) Changes in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e gene expression in response to silver nanoparticles and silver ions. \u003cem\u003eEnviro. Sci. Technol\u003c/em\u003e., 47. 10.1021/es402209w. https://pubs.acs.org/doi/10.1021/es402209w\u003c/li\u003e\n\u003cli\u003eCvjetko P, Milo\u0026scaron;i\u0026acute;c A, Domijan AM, Vinkovic-Vrcek I, Tolic S, Peharec\u0026Scaron;tefanic P (2017) Toxicity of silver ions and differently coated silver nanoparticles in Allium cepa roots. \u003cem\u003eEcotoxicol. Environ. Saf.\u003c/em\u003e, 137:18\u0026ndash;28. https://doi:10.1016/j.ecoenv.2016.11.009\u003c/li\u003e\n\u003cli\u003eHawthorne J, Musante C, Sinha SK, White JC (2012) Accumulation and phytotoxicity of engineered nanoparticles to \u003cem\u003eCucurbita pepo\u003c/em\u003e. \u003cem\u003eInt. J. Phytoremediation.\u003c/em\u003e, 14:429\u0026ndash;442. https://doi:10.1080/15226514.2011.620903\u003c/li\u003e\n\u003cli\u003eSaha N, Dutta Gupta S (2017) Low-dose toxicity of biogenic silver nanoparticles fabricated by Swertia chirata on root tips and flower buds of Allium cepa. \u003cem\u003eJ. Hazard. Mater.\u003c/em\u003e, 330:18\u0026ndash;28. https://doi:10.1016/j.jhazmat.2017.01.021\u003c/li\u003e\n\u003cli\u003eBenelli G (2018) Mode of action of nanoparticles against insects. \u003cem\u003eEnvironm. Sci. Pollution Rese.\u003c/em\u003e, 25(13):1232\u0026ndash;1234. https://doi:10.1007/s11356-018-1850-4\u003c/li\u003e\n\u003cli\u003eChakravarthy A, Chandrashekharaiah K, Kandakoor SB, Bhattacharya A, Dhanabala K, Gurunatha K, Ramesh P (2012) Bioefficacy of inorganic nanoparticles CdS nano-Ag and nano-TiO2 against \u003cem\u003eSpodoptera litura\u003c/em\u003e (\u003cem\u003eLepidoptera: Noctuidae\u003c/em\u003e). \u003cem\u003eCurr. Biot.\u003c/em\u003e, 6(3): 271\u0026ndash;281. https://www.researchgate.net/publication/304354666\u003c/li\u003e\n\u003cli\u003eNair PMG, Park SY, Lee SW, Choi J (2011) Differential expression of ribosomal protein gene, gonadotrophin-releasing hormone gene and Balbiani ring protein gene in silver nanoparticles exposed Chironomus riparius. \u003cem\u003eAquat Toxicol.\u003c/em\u003e, 101:31\u0026ndash;37. DOI: 10.1016/j.aquatox.2010.08.013\u003c/li\u003e\n\u003cli\u003eDeshoux M, Monsion B, Uaest M (2018) Insect cuticular proteins and their role in transmission of phytoviruses.\u0026rdquo; \u003cem\u003eCurrent opinion in virol.\u003c/em\u003e, 33: 137\u0026ndash;143. https://doi:10.1016/j.coviro.2018.07.015\u003c/li\u003e\n\u003cli\u003eArmstrong N, Ramamoorthy M, Lyon D, Jones K, Duttaroy A (2013) Mechanism of silver nanoparticles action on insect pigmentation reveals intervention of copper homeostasis. \u003cem\u003ePLoS ONE\u003c/em\u003e 8(1): e53186. https://doi:10.1371/journal.pone.0053186\u003c/li\u003e\n\u003cli\u003eWhitfield AE, Falk BW, Rotenberg D (2015) Insect vector-mediated transmission of plant viruses. \u003cem\u003eVirol.\u003c/em\u003e, 479\u0026ndash;480:278\u0026ndash;289. https://doi.org/10.1016/j.virol.2015.03.026\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"archives-of-virology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"arvi","sideBox":"Learn more about [Archives of Virology](https://www.springer.com/journal/705)","snPcode":"705","submissionUrl":"https://submission.nature.com/new-submission/705/3","title":"Archives of Virology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"plant viruses, virus acquisition, antivirus, silver nanoparticles, PR-1 gene, faba bean","lastPublishedDoi":"10.21203/rs.3.rs-422790/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-422790/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSilver nanoparticles (AgNPs) are a potentially effective tool for deterring viral plant pathogens. This study was carried out to evaluate the efficacy of AgNPs to defeat \u003cem\u003eBean yellow mosaic virus\u003c/em\u003e (BYMV) on faba bean plants from the host, virus and vector aphid tripartite interactions side. The antiviral capabilities were evaluated during a foliar protective and curative scheme. Furthermore, the efficiency of AgNPs on virus acquisition and transmission by its vector aphid was investigated. Results indicated that the AgNPs had greatly exhibited curative viricidal activities for inactivation BYMV when applied 48 h post-virus inoculation. The disease occurrence was entirely inhibited with AgNPs rate as low as 100 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, while the infectivity was completely arrested when plants were preventively exposed to 200 mg.l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e 24 h pre-virus inoculation. AgNPs proved high bio-reactivity by binding to viral particles, suppressing their replication and accumulation within the plant tissues. Moreover, it was noticeably showed to upregulate the pathogenesis-related gene (PR-1) and promote the defense-related enzymes and protein profiles in treated plants irrespective of concentration. Exposure of aphids to AgNPs-treated plants before virus acquisition excitingly reduced the BYMV acquisition and transmission efficiency by 40.65% up to 100 % 24 h post-application and the virus acquisition was affected for 10 days by 6.89 Up to 79.64 % depending on the AgNPs rate. These results concluded that the AgNPs have a high curing viricidal activity by targeting the virus envelop, and more excitingly it can affect the virus-vector combination, suggesting that it may contribute to alleviating the natural disease occurrence and virus transmission under field conditions. Therefore, according to the available literature, this study provides the first report on the deterring activity of nanomaterials against plant virus acquisition and transmission by its vector insects.\u003c/p\u003e","manuscriptTitle":"Silver Nanoparticles as A Highly Viricidal Agent to Deter Plant-Infecting Viruses and Disrupt their Acquisition and Transmissibility by Vector Aphid","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-04-26 13:27:09","doi":"10.21203/rs.3.rs-422790/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision","date":"2021-05-19T17:27:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-04-21T00:00:00+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-04-19T00:00:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-04-17T00:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Archives of Virology","date":"2021-04-13T08:53:14+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"archives-of-virology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"arvi","sideBox":"Learn more about [Archives of Virology](https://www.springer.com/journal/705)","snPcode":"705","submissionUrl":"https://submission.nature.com/new-submission/705/3","title":"Archives of Virology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d0ae093d-5746-475d-8030-c3bed9c02357","owner":[],"postedDate":"April 26th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":3820496,"name":"Immunology"},{"id":3820497,"name":"General Microbiology"},{"id":3820498,"name":"Virology"}],"tags":[],"updatedAt":"2021-09-07T15:41:12+00:00","versionOfRecord":[],"versionCreatedAt":"2021-04-26 13:27:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-422790","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-422790","identity":"rs-422790","version":["v1"]},"buildId":"ApUGefWb6u5IBVtyqm6d5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-29T02:00:03.542394+00:00
License: CC-BY-4.0