LncRNA AL133415.1 promotes neuronal apoptosis and its association with Alzheimer's disease through the regulation of miR-125b/vimentin axis

LncRNA AL133415.1 promotes neuronal apoptosis and its association with Alzheimer's disease through the regulation of miR-125b/vimentin axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LncRNA AL133415.1 promotes neuronal apoptosis and its association with Alzheimer's disease through the regulation of miR-125b/vimentin axis Yi Cheng, Lihua Li, Ting Zou, Lei Zhang, Long Ma, xiaohui zhou This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3234501/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Accumulating studies have identified that long noncoding RNA (lncRNA) are novel regulators in Alzheimer’s disease (AD). The goal of this study is to examine the impact of LncRNAAL133415.1 on cell viability, neuronal apoptosis, and oxidative stress and to further investigate the molecular mechanisms in AD. Methods In our study, we transfected control overexpression, lncRNA AL133415.1 overexpression, control siRNA, and lncRNA AL133415.1 siRNA into an SH-SY5Y-based AD cell model that was established using Aβ42 insult. We then measured cell viability and apoptosis using a CCK-8 assay and apoptosis marker expressions. Oxidative stress was assessed using a reactive oxygen species assay Kit and RT-qPCR was used to make observations. Total proteins were extracted and quantified using Western blot assays. We also determined the expression of Vimentin in each group. Results Transcriptome analysis revealed that vimentin (VIM) is a cis-target gene regulated by lncRNA AL133415.1. TargetScan database showed that VIM is a promising candidate target gene for miR-138-5p. In AD cell model, overexpression of lncRNA AL133415.1 inhibited cell viability and promoted cell apoptosis, while silencing lncRNA AL133415.1 had the opposite effect. Similarly, overexpression of lncRNA AL133415.1 inhibited Vimentin expression, while silencing lncRNA AL133415.1 promoted Vimentin expression. Overexpression of miR-138-5p also inhibited Vimentin expression, while inhibition of miR-138-5p expression promoted Vimentin expression. The levels of ROS were reduced in the lncRNA AL133415.1 silence group and increased in the lncRNA AL133415.1 overexpression group. Conversely, SOD levels were increased in the lncRNA AL133415.1 silence group and decreased in the lncRNA AL133415.1 overexpression group. Conclusion LncRNA AL133415.1 may interact with miR-138-5p to increase neuron cell death and reduce the expression of Vimentin in AD. Alzheimer's disease lncRNAAL133415.1 miR-138-5p Vimentin Neuroinflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Alzheimer’s disease (AD) is a prevalent neurodegenerative condition. With around 50 million dementia patients globally, one-third of them reside in China[ 1 ]. AD represents 80% of dementia cases in individuals over 65 and is the fifth leading cause of death in China[ 2 , 3 ]. In Xinjiang, the AD prevalence rate is 3.66%[ 4 ]. Symptoms include memory impairment, fever, amnesia, agnosia, visual-spatial ability impairment, personality changes, and emotional disturbance[ 5 ]. While there is no cure or prevention for AD, early intervention may delay neuronal destruction and enhance patients’ quality of life and symptoms[ 6 ]. A more profound understanding of AD’s pathogenesis is crucial to identify the involved cellular and molecular mechanisms and suitable biomarkers and therapeutic targets to improve prognosis. LncRNAs are one of the most common non-coding RNAs (ncRNAs) that are longer than 200 nucleotides [ 7 ]. They play a crucial role in various biological phenomena, including epigenetics, gene expression regulation, and essential biological processes in different diseases[ 8 ]. Recent studies have shown that several lncRNAs are dysregulated in plasma samples of AD patients[ 9 ]. For example, the knockdown of lncRNA BC200 significantly suppressed BACE1 expression in the SH-SY5Y cell model, and BC200 levels were significantly reduced in neurons of AD brains[ 10 ]. Additionally, lncRNA 51A was found to be overexpressed in both in vitro models and AD patients[ 11 ]. LncRNA AL133415.1 is located on chromosome 10p13, and its role in the mechanism of AD has not been reported. Vimentin (VIM) is a 57 kDa type III IF protein mainly expressed in interstitial cell types and plays an important role in various pathophysiological conditions, including aging[ 12 ]. VIM regulates a wide range of fundamental cellular functions,has close relationship with cellular senescence[ 13 ]. The oxidized form of vimentin, along with its mRNA and protein levels, increases in senescent cells[ 14 ]. Studies have shown that vimentin expression is present in the brain regions of AD transgenic mice and AD patients and plays a crucial role in the mechanism of neuronal injury response in the AD brain[ 15 ]. In a pilot study, we conducted transcriptomic analysis to determine the relationship between lncRNA AL133415.1 and VIM. The results indicated that VIM is a potential candidate target gene of lncRNA AL133415.1. We hypothesized that lncRNA AL133415.1 might play a vital role in AD pathology. This study aims to explore the role of lncRNA AL133415.1 in regulating neuronal apoptosis, cell viability, and oxidative stress and further explore the molecular mechanism of lncRNA AL133415.1 and VIM in AD. Materials and methods Cell culture The human neuroblastoma cell line (SH-SY5Y) was purchased from Wuhan ProCell Company. DMEM/F12 basal medium and fetal bovine serum (FBS) were sourced from Gibco (Carlsbad, CA, USA), while penicillin-streptomycin solution (P/S) was acquired from BI (BEIT HAEMEK, ISRAEL). SH-SY5Y cells were grown in DMEM/F12 basal medium with 15% FBS and 1% P/S under 5% CO 2 and 95% air at 37°C. Constructing an AD model As per a previous study [ 15 ], Aβ42 was obtained from Qyaobio Company, Ltd (Shanghai, China) and dissolved in 1 mM dimethyl sulfoxide (DMSO) using sonication. SH-SY5Y cells were then treated with 10 µM oligomerized Aβ42 peptide for 48 hours to create an SH-SY5Y AD cell model. The cell viability between each AD model and its corresponding control group was measured with Cell Counting Kit-8 (CCK-8) (Proteintech, USA) to confirm the establishment of each AD model. The total RNA extraction Total RNA was isolated from cells by TRIzol reagent (Invitrogen, CA, USA) following the instructions. The samples were stored at -80°C refrigerator. A NanoDrop 2000 spectrophotometer (NanoDrop Products, Wilmington, DE, USA) was used to evaluate the quantity of RNA. Real-time PCR validation After extracting RNA, cDNA was reverse transcribed using a Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Lithuania, EU). Real-time polymerase chain reaction (RT-PCR) was then performed using an ABI Quant Studio ™ 6 (Applied Biosystems, Carlsbad, USA) and a Quanti Nova SYBR Green PCR kit (QIAGEN Bio, Shanghai, China). The PCR reaction conditions were as follows: initial activation at 95°C for 2 min, followed by 40 cycles at 95°C for 5 s, 58°C for 30 s, and 95°C for 15 s. Primer sequences are shown in Table 1 . All samples were run in triplicate with U6 (miRNA) and GAPDH (mRNA and lncRNA) used as reference genes. The 2 -ΔΔCt method was used for quantification. Table 1 Primer sequence for qPCR. Gene Primer sequences(5→3༇) VIM F: TGCAGGACTCGGTGGACTTCTC R: AGTTGGCGAAGCGGTCATTCAG Mir-138-5p F: GCGAGCTGGTGTTGTGAATC R: AGTGCAGGGTCCGAGGTATT LncRNA AL133415.1 F: CTTCACAGGTGAGGGACTGC R: AGGCTCAGATTCAGGAACAGC GAPDH F: ACTTTGGTATCGTGGAAGGACTCAT R: GTTTTTCTAGACGGCAGGTCAGG U6 F: ACTTTGGTATCGTGGAAGGACTCAT R: GTTTTTCTAGACGGCAGGTCAGG Notes: F, forward; R, reverse. Transfection In order to explore the effects of lncRNA AL133415.1 on cellular AD model functions including apoptosis and inflammation, lncRNA AL133415.1 overexpression plasmid, control overexpression plasmid, lncRNA AL133415.1 siRNA plasmid, and siRNA control plasmid were constructed by Jiangsu Kaiji Biotechnology Company (Nanjing, China) using FC-4953 and FV-073 plasmids. These plasmids were then transfected into the SH-SY5Y AD model, and the cells were divided into four groups based on the transfected plasmids: lncRNA AL133415.1_NC group, lncRNA AL133415.1 group, siRNA_NC group, and siRNA_group. MiR-138-5p mimic (5′-AGCUGGUGUUGUGAAUCAGGCCG-3′) and negative control (NC) mimic (5′-UCACAACCUCCUAGAAAGAGUAGA-3′), as well as miR-138-5p inhibitor (5′-CGGCCUGAUUCACAACACCAGCU-3 ′) and negative control (NC) inhibitor (5′-UCUACUCUUUCUAGGAGGUUGUGA-3′) (KaiJi, China), were transfected into the SH-SY5Y AD model using Lipofectamine 3000 Reagent (Invitrogen, USA). The cells were then divided into four groups based on transfection: miR-138-5p mimics group, mimics NC group, miR-138-5p inhibitors group, and inhibitors NC group. Cell viability assay Cell viability was detected by CCK-8 assay (Proteintech, USA). Cell suspensions were seeded in 96-well plates and pre-incubated for 4 hours at 37°C and 5% CO 2 . Then, 10 µl of CCK-8 was added to each well and incubated at 37°C for 2 hours. The plate was analyzed with a microplate reader (Thermo, USA) at 450 nm. Detection of indicators of oxidative stress The reactive oxygen species assay kit (Beyotime, China), total superoxide dismutase assay kit (Beyotime, China), and lipid peroxidation MDA assay kit (Beyotime, China) were used to measure intracellular reactive oxygen species (ROS), the level of cellular superoxide was tested for dismutase (SOD), and intracellular malondialdehyde (MDA) in SH-SY5Y cells following the instructions of the kits. Western blot (WB) After collecting the cells, total protein was extracted using Lysis Buffer (Sigma, USA) and quantified using a BCA Protein Assay Kit (Keygen Biotech, China). Proteins were then separated on SDS-PAGE precast gels (Keygen Biotech, China) and transferred to nitrocellulose membranes (Millipore, USA) using a Trans-Blot Turbo Protein Transfer System (Bio-rad, USA). The membranes were then blocked with Western Blocking Buffer for 2 hours on a shaker and incubated with primary antibodies at 4°C overnight. Subsequently, membranes was incubated with the suitable secondary antibody for 2 hours at room temperature with shaking. Finally, proteins were visualized using a G: BOXChemiXR5 system (SYNGENE, UN). Confocal laser scanning microscopy After adding two drops of methanol solution, the procedure was carried out at 15°C for 10 minutes. The cells were then stained with a DAPI kit from Keygen BioTECH (China) for 5 minutes at room temperature. Confocal laser scanning microscope from Olympus (Japan) was used to colletc images. The relationship between LncRNA AL133415.1 and MiR-138-5p To explore the relationship between the LncRNA AL133415.1 and MiR-138-5p, DIANA-LncBase V3.0 software was used to analyze their interrelationships. Statistical analysis The data was analyzed using the Stata11.0 program from Stata Corp (College Station, TX). Continuous variables were presented as mean and standard deviation. Student’s t-test was used to compare data between two groups, while one-way ANOVA with post hoc Turkey’s t-test was used for multigroup analysis. P -value < 0.05 was considered statistically significant. Results AD cell model The expression of Tau and p-Tau proteins were detected to verify the construction of the AD cell model.The model group showed an increase in Tau and p-Tau protein expression compared with the control group (p1 < 0.05, p2 < 0.001, respectively) (Fig. 1 A), indicating that the model was successfully established. The cell death rate was measured using the CCK-8 method and was found to be 24.55% in the model group, while cell viability in the control group remained unchanged. Expression of lncRNA AL133415.1 and miR-138-5p after transfection After transfection with plasmids, lncRNA AL133415.1 expression was found to be higher in the lncRNA_AL133415.1 group than in the lncRNA_NC group ( P < 0.001), while it was lower in the siRNA group than in the sirNC group ( P < 0.001) in the AD model (Fig. 1 B). In contrast, miR-138-5p expression was higher in the miR-138-5p mimics group compared with NC group ( P < 0.001), but lower in the miR-138-5p inhibitors group compared with NC group (P < 0.001) in the AD model (Fig. 1 B), indicating successful transfection. The viability of SH-SY5Y cells after transfection The CCK-8 assay results showed that cell viability was lower in the Aβ42 insult group than in the control group in both the LncRNA AL133415.1 and miR-138-5p groups (both P < 0.001). Cell viability was higher in the siRNA group than in the sirNC group ( P < 0.001), but lower in the lncRNA_AL133415.1 group than in the lncRNA_NC group ( P < 0.001) (Fig. 2 A). However, cell viability was lower in the miR-138-5p mimics group compared with group ( P < 0.001), but higher in the miR-138-5p inhibitors group compared with NC group ( P < 0.001) (Fig. 2 B). Apoptosis of SH-SY5Y cells transfected with lncRNA AL133415.1 The apoptosis of cells was detected by the Annexin V-FITC/PI assay and flow cytometry. Compared to the control group, the apoptosis rate of SH-SY5Y cells induced by Aβ42 was higher, indicating that Aβ42 significantly promoted apoptosis in SH-SY5Y cells ( P < 0.001). The apoptosis rate was also higher in both the siRNA and lncRNA_AL133415.1 groups compared with control group (both P 0.05), but higher in the lncRNA_AL133415.1 group compared with lncRNA_NC group ( P > 0.05) (Fig. 3 ). Apoptosis of SH-SY5Y cells transfected with miR-138-5p The apoptosis of cells in each group was measured using the Annexin V-FITC/PI assay and flow cytometry. Compared to the control group, the apoptosis rate of SH-SY5Y cells induced by Aβ42 was higher, indicating that Aβ42 significantly promoted apoptosis in SH-SY5Y cells (P < 0.001). The apoptosis rate was higher in the miR-138-5p mimics group compared with mimics NC group ( P 0.05). However, the apoptosis rate was higher in both the miR-138-5p inhibitors and miR-138-5p mimics groups compared with control group (both P < 0.001) (Fig. 3 ). Oxidative stress after transfection of SH-SY5Y cells To investigate whether LncRNA AL133415.1 regulated oxidative stress in AD, oxidative stress indices including ROS, MDA, and SOD were measured using DCFH-DA methods and commercial assay kits. The results showed that ROS levels were lower in the siRNA group than in the sirNC group and in the miR-138-5p inhibitors group than in the inhibitors NC group (both P < 0.001), but higher in the lncRNA_AL133415.1 group than in the lncRNA_NC group and in the miR-138-5p mimics group than in the mimics NC group (both P < 0.001) (Fig. 4 A). MDA levels were found to be lower in the siRNA group than in the sirNC group and in the miR-138-5p inhibitors group than in the inhibitors NC group (both P < 0.001), but higher in the lncRNA_AL133415.1 group than in the lncRNA_NC group and in the miR-138-5p mimics group than in the mimics NC group (both P < 0.001) (Fig. 4 B). In contrast, SOD levels were higher in the siRNA group than in the sirNC group and in the miR-138-5p inhibitors group than in the inhibitors NC group (both P < 0.001), but lower in the lncRNA_AL133415.1 group than in the lncRNA_NC group and in the miR-138-5p mimics group than in the mimics NC group (both P < 0.001) (Fig. 4 C). Expression of VIM after lncRNA AL133415.1 transfection After transfection with plasmids, VIM expression was found to be higher in the siRNA group compared with sirNC group ( P < 0.001), but lower in the lncRNA_AL133415.1 group than in the lncRNA_NC group ( P < 0.001). However, VIM expression was lower in the Aβ42 insult group compared with control group ( P < 0.001). The levels of VIM protein followed a similar trend to that of VIM gene expression between groups (both P < 0.001) (Fig. 5 A). These results show that overexpression of lncRNA AL133415.1 inhibited VIM expression, while inhibition of lncRNA AL133415.1 expression promoted VIM expression. Expression of VIM after miR-138-5p transfection After transfection with plasmids, VIM expression was found to be higher in the miR-138-5p inhibitors group compared with inhibitors NC group ( P < 0.001), but lower in the miR-138-5p mimics group compared with mimics NC group ( P < 0.001). However, VIM expression was lower in the Aβ42 insult group than in the control group ( P < 0.001). The levels of VIM protein followed a similar trend to that of VIM gene expression between groups (both P < 0.001) (Fig. 5 C). These findings suggest that overexpression of miR-138-5p inhibited VIM expression, while inhibition of miR-138-5p expression promoted VIM expression. Measuring VIM expression using confocal laser fluorescence microscopy (CLSM) after lncRNA AL133415.1 transfection DAPI staining in the nuclear region showed blue fluorescence, while vimentin protein showed green fluorescence. The merged image revealed localization of green fluorescence in the nuclear periphery region. CLSM results indicated that VIM protein expression in SH-SY5Y cells was significantly reduced after treatment with Aβ42. VIM protein expression was higher in the siRNA group than in the sirNC group, but lower in the LncRNA AL133415.1 group than in the lncRNA_NC group (Fig. 6 A). This trend was consistent with the results obtained using the WB method. Using CLSM to investigate the effect of lncRNA AL133415.1 transfection on VIM expression The expression of VIM protein in SH-SY5Y cells was significantly reduced after treatment with Aβ42, as shown by CLSM. In the group treated with miR-138-5p inhibitors, VIM protein expression increased compared with inhibitors NC group. However, in the group treated with miR-138-5p mimics, VIM protein expression decreased compared with mimics NC group (Fig. 6 B). These results were consistent with those obtained using the WB method. Using DIANA-LncBase sofeware to investigate the relationship between lncRNA AL133415.1 and MiR-138-5p The study used DIANA-LncBase V3.0 software to analyze the interrelationship between LncRNA AL133415.1 and MiR-138-5p. After entering LncRNA AL133415.1 (ENSG00000234961) in LncRNA input box, it was found that there were five miRNAs(miR-106b-5p, miR-1301-3p, miR-17-5p, and miR-20b-5p, respectively.) had relations with this LncRNA, All of the above miRNAs were validated by one experiment and supported by one literature with LncRNA AL133415.1, and all were expressed in combination in cell lines with high confidence of binding score. A total of 765 validated genes with binding to miR-138-5p were retrieved by entering MiR-138-5p in miRNA, and there was no AL133415.1 gene among them(Fig. 7 ). Discussion AD is a a common neurological degeneration disease characterized by neuroinflammation, extracellular amyloid-β (Aβ) plaques, neurofibrillary tangles, and neuronal death [ 16 ]. Various risk factors, including genetic, environmental, immunological factors and depression, may contribute to the development of AD [ 17 , 18 ]. Despite extensive research into the mechanisms of AD, its pathogenesis remains unclear. lncRNAs may involve AD pathogenesis through their various biochemical and functional effects, including the level of translation, post-transcriptional, posttranslational regulation, and epigenetics [ 19 , 20 ]. LncRNAs expressed in plasma can participate in AD pathogenesis by regulating Aβ production, oxidative stress, synaptic damage and mitochondrial dysfunction[ 21 ]. LncRNA AL133415.1 is a novel lncRNA with limited information available on its role in neurodegenerative disorders. The functions and underlying mechanisms of lncRNA AL133415.1 in AD remain to be established. MiRNAs are small non-coding RNA molecules, made up of 19–25 nucleotides, that regulate protein expression by acting as translational repressors. Research suggests that miR-138-5p plays an crucial role in various types of cardiovascular diseases and cancers, including brain tumors[ 22 – 24 ]. The expression of miR-138-5p has been found to be downregulated compared to controls in tissues of AD [ 25 ]. As a result, some researchers have proposed using miRNAs as diagnostic biomarkers for AD. For example, the plasma level of miR-138-5p has been shown to be significantly different in AD patients compared to controls[ 26 ]. Using TargetScan Human software to predict potential target miRNAs for the vim gene, it was found that miR-138-5p is a promising candidate. Vimentin is a protein that has been linked to a wide range of diseases, including cataracts, cancer, fibrosis-related diseases, and aging[ 27 – 29 ]. It is believed to contribute to several post-translational modifications that can regulate its associated functional properties in these diseases[ 30 , 31 ]. Previous research has shown that vimentin is present in the brain and is mainly expressed in cells of the central nervous system[ 32 , 33 ]. Additionally, vimentin has been related to cell senescence, with increased expression of its mRNA and secretion of an oxidized form being linked to this process. This suggests that vimentin could serve as a potential marker for oxidative stress and play an important role in aging. Studies have shown that Vimentin is expressed by neurons in the brains of both AD transgenic mice (Tg2576) and the brain regions of AD patients. In AD brains, Vimentin expression plays an important part in the neuronal damage-response mechanism. Additionally, the expression of VIM has been found to increase around amyloid plaques in reactive astrocytes of AD patients[ 34 ]. Many studies have demonstrated a relationship between lncRNA and vimentin. For example, LINC00857 has been shown to increase colorectal cancer progression by sponging miR-1306 and regulating vimentin expression in cells[ 35 ]. Similarly, lnc-NLIPMT and lnc-PCTST have been found to play important roles in regulating vimentin expression[ 36 , 37 ]. In hepatocellular carcinoma, vimentin may also play a role in the tumor suppressor function of lncRNA-ELF209[ 38 ]. The relationship between lncRNAs AL133415.1, miR-138-5p, and vimentin in AD is currently not well understood. In our study, we investigated the expression of lncRNA AL133415.1 and miR-138-5p in relation to vimentin. Our results showed that overexpression of LncRNA AL133415.1 could inhibit vimentin expression, while inhibition of LncRNA AL133415.1 expression could promote VIM expression. We also explored the relationship between miR-138-5p and vimentin and found that overexpression of miR-138-5p could suppress vim expression, while inhibition of miR-138-5p expression could promote vim expression. CLSM confirmed that changes in vimentin protein expression mirrored changes in gene expression. These data suggest that lncRNA AL133415.1 and miR-138-5p are involved in the development and etiology of AD. We also performed a CCK-8 assay and found that lncRNA AL133415.1 and miR-138-5p could significantly reduce the viability of SH-SY5Y cells in vitro. Flow cytometry analysis showed that both lncRNA AL133415.1 and miR-138-5p could significantly increase neuronal apoptosis in AD model SH-SY5Y cells, suggesting that these lncRNAs may be involved in AD etiology by affecting neuronal apoptosis. Research has shown that oxidative stress is an potential influence factor in the occurrence of AD[39]. Silencing lncRNA p21 has been found to decrease ROS generation and increase SOD activity in SH-SY5Y cells[ 40 ]. However, the role of lncRNA AL133415.1 and miR-138-5p in oxidative stress in AD is not yet well understood. To explore this further, we detected the levels of oxidative stress markers (including ROS, MDA, and SOD) and found that ROS and MDA levels were decreased in the siRNA and miR-138-5p groups, but increased in the lncRNA_AL133415.1 and miR-138-5p mimics groups. Conversely, SOD levels were increased in the siRNA and miR-138-5p inhibitors groups but decreased in the lncRNA AL133415.1 and miR-138-5p mimics groups. These findings show that LncRNA AL133415.1 and miR-138-5p may play an important part in the pathogenesis of AD by affecting oxidative stress. In our study, we found that lncRNA AL133415.1 can affect vimentin expression by sponging miR-138-5p. This may explain why inhibiting lncRNA AL133415.1 in SH-SY5Y cells can significantly decrease cell viability and increase apoptosis. Our findings suggest that the lncRNA AL133415.1/miR-138-5p/vimentin axis could be a novel target for the treatment of AD in furture. Our study has some limitations. We only investigated the relationship between lncRNA AL133415.1, miR-138-5p, and vimentin in AD cell models. In future research, we plan to measure the expression levels of miR-138-5p and vimentin and explore their relationship in clinical samples. Additionally, we intend to further investigate the sponge effect of lncRNA AL133415.1 on miR-138-5p. In summary, our study suggests that lncRNA AL133415.1 is a novel long noncoding RNA that may interact with miR-138-5p to promote neuronal apoptosis. By sponging miR-138-5p, lncRNA AL133415.1 can regulate vimentin expression in cells. These results show that lncRNA AL133415.1 could be a potential therapeutic target for AD. Declarations Acknowledgments Declared none. Data availability The data supporting this study can be obtained from the corresponding author upon reasonable request. Funding This research was supported by grants from the National Natural Science Foundation of Xinjiang Uygur Autonomous Region (No.2022D01C232). Competing Interests All authors (Yi Cheng, Lihua Li,Ting Zou, Lei Zhang, Chang Yang, Long Ma, and Xiaohui Zhou) declare no conflict of interest. Author Contributions All authors contributed to the study's conception and design. Material preparation, data collection, and analysis were performed by Yi Cheng, Lihua Li,Ting Zou, Lei Zhang, Long Ma, and Xiaohui Zhou . The first draft of the manuscript was written by Yi Cheng and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Consent for Publication All authors agree to publish this study. References Association., A.s., 2020 Alzheimer’s disease facts and figures. Alzheimer’s Dement, 2020. 16 : p. 391-460. Anand, R., K.D. Gill, and A.A. Mahdi, Therapeutics of Alzheimer's disease: Past, present and future. Neuropharmacology, 2014. 76 Pt A : p. 27-50. Jia, L., et al., Dementia in China: epidemiology, clinical management, and research advances. Lancet Neurol, 2020. 19 (1): p. 81-92. Xiaohui Zhou, Y.h., Xiaoning Zhou, Guli Za, Epidemiological survey of Alzheimer's disease and vascular dementia in Uygur and Han ethnic groups in Xinjiang Uygur Autonomous Region. Chinese Journal of Neurology, 2008. 41 : p. 797-801. Kalra, J. and A. Khan, Reducing Abeta load and tau phosphorylation: Emerging perspective for treating Alzheimer's disease. Eur J Pharmacol, 2015. 764 : p. 571-581. Scheltens, P., et al., Alzheimer's disease. Lancet, 2016. 388 (10043): p. 505-17. Wang, L.K., et al., Dissection of functional lncRNAs in Alzheimer's disease by construction and analysis of lncRNA-mRNA networks based on competitive endogenous RNAs. Biochem Biophys Res Commun, 2017. 485 (3): p. 569-576. Iyer, M.K., et al., The landscape of long noncoding RNAs in the human transcriptome. Nat Genet, 2015. 47 (3): p. 199-208. Crist, A.M., et al., Transcriptomic analysis to identify genes associated with selective hippocampal vulnerability in Alzheimer's disease. Nat Commun, 2021. 12 (1): p. 2311. Liu, N.X. and Q.H. Li, LncRNA BC200 regulates neuron apoptosis and neuroinflammation via PI3K/AKT pathway in Alzheimer's disease. J Biol Regul Homeost Agents, 2020. 34 (6): p. 2255-2261. Cao, Q., et al., Exosomal long noncoding RNAs in aging and age-related diseases. IUBMB Life, 2019. 71 (12): p. 1846-1856. Danielsson F, Peterson M K, Caldeira Araújo H, et al. Vimentin Diversity in Health and Disease[J]. Cells, 2018, 7(10). Satelli, A. and S. Li, Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol Life Sci, 2011. 68 (18): p. 3033-46. Tanaka, H., et al., Cytokinetic Failure-induced Tetraploidy Develops into Aneuploidy, Triggering Skin Aging in Phosphovimentin-deficient Mice. J Biol Chem, 2015. 290 (21): p. 12984-98. Levin, E.C., et al., Neuronal expression of vimentin in the Alzheimer's disease brain may be part of a generalized dendritic damage-response mechanism. Brain Res, 2009. 1298 : p. 194-207. Nie, J., et al., Dendrobium alkaloids prevent Abeta25-35-induced neuronal and synaptic loss via promoting neurotrophic factors expression in mice. PeerJ, 2016. 4 : p. e2739. Tolppanen, A.M., H. Taipale, and S. Hartikainen, Head or brain injuries and Alzheimer's disease: A nested case-control register study. Alzheimers Dement, 2017. 13 (12): p. 1371-1379. Vijayan, M. and P.H. Reddy, Stroke, Vascular Dementia, and Alzheimer's Disease: Molecular Links. J Alzheimers Dis, 2016. 54 (2): p. 427-43. Zhang, Z., Long non-coding RNAs in Alzheimer's disease. Curr Top Med Chem, 2016. 16 (5): p. 511-9. Cortini, F., F. Roma, and C. Villa, Emerging roles of long non-coding RNAs in the pathogenesis of Alzheimer's disease. Ageing Res Rev, 2019. 50 : p. 19-26. Courboulin, A., et al., MicroRNA networks in pulmonary arterial hypertension: share mechanisms with cancer? Curr Opin Oncol, 2016. 28 (1): p. 72-82. Muñoz-Rodríguez, J.L., et al., Differentially expressed microRNAs in postpartum breast cancer in Hispanic women. PLoS One, 2015. 10 (4): p. e0124340. Li, J., et al., Species-specific mutual regulation of p53 and miR-138 between human, rat and mouse. Sci Rep, 2016. 6 : p. 26187. Siegel, G., et al., A functional screen implicates microRNA-138-dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. Nat Cell Biol, 2009. 11 (6): p. 705-16. Dobricic, V., et al., Differential microRNA expression analyses across two brain regions in Alzheimer's disease. Transl Psychiatry, 2022. 12 (1): p. 352. Lugli, G., et al., Plasma Exosomal miRNAs in Persons with and without Alzheimer Disease: Altered Expression and Prospects for Biomarkers. PLoS One, 2015. 10 (10): p. e0139233. Henderson, P., et al., A role for vimentin in Crohn disease. Autophagy, 2012. 8 (11): p. 1695-6. Virtakoivu, R., et al., Vimentin-ERK Signaling Uncouples Slug Gene Regulatory Function. Cancer Res, 2015. 75 (11): p. 2349-62. Richardson, A.M., et al., Vimentin Is Required for Lung Adenocarcinoma Metastasis via Heterotypic Tumor Cell-Cancer-Associated Fibroblast Interactions during Collective Invasion. Clin Cancer Res, 2018. 24 (2): p. 420-432. Shi, A.M., et al., Vimentin and post-translational modifications in cell motility during cancer - a review. Eur Rev Med Pharmacol Sci, 2016. 20 (12): p. 2603-6. Bouamrani, A., et al., Increased phosphorylation of vimentin in noninfiltrative meningiomas. PLoS One, 2010. 5 (2): p. e9238. Ramaekers, F.C., et al., Lenticular intermediate-sized filaments: biosynthesis and interaction with plasma membrane. Proc Natl Acad Sci U S A, 1982. 79 (10): p. 3208-12. Zhu, H., et al., Enterovirus A71 VP1 Variation A289T Decreases the Central Nervous System Infectivity via Attenuation of Interactions between VP1 and Vimentin In Vitro and In Vivo. Viruses, 2019. 11 (5). Kamphuis, W., et al., GFAP and vimentin deficiency alters gene expression in astrocytes and microglia in wild-type mice and changes the transcriptional response of reactive glia in mouse model for Alzheimer's disease. Glia, 2015. 63 (6): p. 1036-56. Chang, N., et al., Long Noncoding RNA LINC00857 Promotes Proliferation, Migration, and Invasion of Colorectal Cancer Cell through miR-1306/Vimentin Axis. Comput Math Methods Med, 2021. 2021 : p. 5525763. Zhang, F., et al., Long Non-Coding RNA NLIPMT as a Tumor Suppressor and Inhibitor of Cell Proliferation and Metastasis in Papillary Thyroid Carcinoma. Cancer Manag Res, 2020. 12 : p. 10311-10319. Wang, Y., et al., Long non-coding RNA lnc-PCTST predicts prognosis through inhibiting progression of pancreatic cancer by downregulation of TACC-3. Int J Cancer, 2018. 143 (12): p. 3143-3154. Yang, Y., et al., HNRNPAB-regulated lncRNA-ELF209 inhibits the malignancy of hepatocellular carcinoma. Int J Cancer, 2020. 146 (1): p. 169-180. Butterfield, D.A. and B. Halliwell, Oxidative stress, dysfunctional glucose metabolism and Alzheimer disease. Nat Rev Neurosci, 2019. 20 (3): p. 148-160. Ding, X.M., et al., Long non-coding RNA-p21 regulates MPP(+)-induced neuronal injury by targeting miR-625 and derepressing TRPM2 in SH-SY5Y cells. Chem Biol Interact, 2019. 307 : p. 73-81. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3234501","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":224791968,"identity":"f9ec685f-793b-4c59-a530-8cd4a9ccfd65","order_by":0,"name":"Yi Cheng","email":"","orcid":"","institution":"The First Affiliated Hospital of Xinjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Cheng","suffix":""},{"id":224791971,"identity":"e036f699-fcc1-4ebd-bf76-af2cc7b0daaa","order_by":1,"name":"Lihua Li","email":"","orcid":"","institution":"Maternal and Child Care Service Center of Urumqi，China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lihua","middleName":"","lastName":"Li","suffix":""},{"id":224791973,"identity":"33e8a59b-8860-4014-8ee8-710247340fde","order_by":2,"name":"Ting Zou","email":"","orcid":"","institution":"The First Affiliated Hospital of Xinjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Zou","suffix":""},{"id":224791975,"identity":"269302cb-3573-406c-a7c2-2f1b51a8ec91","order_by":3,"name":"Lei Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of Xinjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Zhang","suffix":""},{"id":224791978,"identity":"08ddc564-bbd3-487d-ad1e-859163b2d6d7","order_by":4,"name":"Long Ma","email":"","orcid":"","institution":"Xinjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Long","middleName":"","lastName":"Ma","suffix":""},{"id":224791980,"identity":"01659af9-e1b4-4db9-8bf4-38b595c04f38","order_by":5,"name":"xiaohui zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYDACCRBhAEKMjY9/VNgwsJGipdmY4UwasVogutikGdsOE3aX/OzmY9I8BXZy5hLJzcYFZ87b80k3P2D4UbENpxbGOcfSJGcYJBtbzkhsfDyj4nZim8wxA8aeM7dxamGWyDGT+GDAnLjhRmKzAc+Z2wlsEgkGzIxtuLWwgbQkGNSDtLRJ8Lads2eTSP+AVwsPxJbDYC3SvG0HGNskcvDbIiGRlmw5w+C4scGZh82GM84kA+3KKTiIzy/yM5IP3ub5Uy1ncDz94YMPFXb28jPSNz74UYFbC3ZwgET1o2AUjIJRMArQAACmG1UlRiu2BwAAAABJRU5ErkJggg==","orcid":"","institution":"The First Affiliated Hospital of Xinjiang Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"xiaohui","middleName":"","lastName":"zhou","suffix":""}],"badges":[],"createdAt":"2023-08-04 11:14:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3234501/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3234501/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":41443788,"identity":"ad7bad66-1677-4b46-ad62-6f18e4a0cffc","added_by":"auto","created_at":"2023-08-11 14:20:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":222848,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of Tau, p-Tau, LncRNA AL133415.1, and miR-138-5p in an SH-SY5Y AD model. We found that the relative protein expression of Tau and p-Tau changed after transfection (A). Similarly, the expression of lncRNA AL133415.1 (B) and miR-138-5p (C) also changed after transfection. * stands for \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05. ** stands for \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/7cbc8fb4e3a8a7e402c75c89.png"},{"id":41445927,"identity":"5328d9d5-3511-43b1-abb8-fc622a5c776b","added_by":"auto","created_at":"2023-08-11 14:36:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":229472,"visible":true,"origin":"","legend":"\u003cp\u003eThe cell viability of SH-SY5Y cells after Aβ42 insult and transfection.\u003c/p\u003e\n\u003cp\u003e(A) Transfection by lncRNA AL133415.1. (B) Transfection by miR-138-5p. * stands for \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05. ** stands for \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/954d6d8663439134bdd5dfff.png"},{"id":41445186,"identity":"f8f46a59-e5b7-492b-91e6-894b67939d97","added_by":"auto","created_at":"2023-08-11 14:28:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":730291,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of lncRNA AL133415.1 and miR-138-5p on cell apoptosis of SH-SY5Y cells treated by Aβ42. (A) The representative images of flow cytometry were shown. (B) The analysis of flow cytometry. * stands for \u003cem\u003eP\u0026lt;\u003c/em\u003e0.001, **\u003cem\u003e \u003c/em\u003estands for \u003cem\u003eP\u0026lt;\u003c/em\u003e0.05.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/4638fbb9a40f70b3095c03dd.png"},{"id":41443786,"identity":"d5407b42-181f-4619-b43d-f13f3970d422","added_by":"auto","created_at":"2023-08-11 14:20:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":332677,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of ROS, MDA, and SOD in different groups. (A) ROS. (B) MDA. (C) SOD. *\u003cem\u003eP\u0026lt;\u003c/em\u003e0.001. siRNA: lncRNA AL133415.1 inhibitors_group, sirNC: lncRNA AL133415.1 inhibitors_control group, lncRNA_ AL133415.1: lncRNA_ AL133415.1 overexpression group, lncRNA_NC: lncRNA_ AL133415.1 overexpression control group, miR-138-5p mimics group: miR-138-5p overexpression group, mimics NC: miR-138-5p overexpression control group, miR-138-5p inhibitors: miR-138-5p silence group, inhibitors NC: miR-138-5p silence control group.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/3e45f0a9fb5542f860998c8a.png"},{"id":41445188,"identity":"af531ad7-0ef4-46e5-9a2e-6d0906bfe510","added_by":"auto","created_at":"2023-08-11 14:28:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":423068,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of VIM in protein and mRNA levels in SH-SY5Y after overexpression and knockdown of lncRNA AL133415.1 and miR-138-5p.(A) The VIM protein expressions in SH-SY5Y after overexpression and knockdown of lncRNA AL133415.1 (B) The expression of VIM in SH-SY5Y after overexpression and knockdown of lncRNA AL133415.1 (C) The VIM protein expressions in SH-SY5Y after overexpression and knockdown of miR-138-5p(D) The expression of VIM in SH-SY5Y after overexpression and knockdown of miR-138-5p.* \u003cem\u003eP\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/688be7bc9085a5856f977b7e.png"},{"id":41443784,"identity":"5cb46540-e3b9-4b36-b147-344dee866cd8","added_by":"auto","created_at":"2023-08-11 14:20:26","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":543907,"visible":true,"origin":"","legend":"\u003cp\u003eConfocal laser scanning microscopy method for examining the expression of Vim protein after overexpression and knockdown of lncRNA AL133415.1 and miR-138-5p. (A) lncRNA AL133415.1. (B) miR-138-5p.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/8d52b4523457f2120451963f.png"},{"id":41443791,"identity":"b63d1ce9-7ded-4928-a168-13e954b695e5","added_by":"auto","created_at":"2023-08-11 14:20:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":206660,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe interaction between MiR-138-5p and LncRNA AL133415.1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e（A）Correlation analysis between MiR-138-5p and LncRNA AL133415.1.（B）The analysis of miRNA related to LncRNA AL133415.1.（C）The List of miRNA associated with LncRNA AL133415.1. (D) The List of miRNA associated with MiR-138-5p.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/bfe3ccf73c48e7f297e54251.png"},{"id":42190174,"identity":"8fb973a4-b638-467d-a461-28db0ea7960b","added_by":"auto","created_at":"2023-08-27 05:07:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1388160,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3234501/v1/db554ea6-b365-4e01-97a2-a19e9b6b0d45.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"LncRNA AL133415.1 promotes neuronal apoptosis and its association with Alzheimer's disease through the regulation of miR-125b/vimentin axis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlzheimer\u0026rsquo;s disease (AD) is a prevalent neurodegenerative condition. With around 50\u0026nbsp;million dementia patients globally, one-third of them reside in China[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. AD represents 80% of dementia cases in individuals over 65 and is the fifth leading cause of death in China[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In Xinjiang, the AD prevalence rate is 3.66%[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Symptoms include memory impairment, fever, amnesia, agnosia, visual-spatial ability impairment, personality changes, and emotional disturbance[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. While there is no cure or prevention for AD, early intervention may delay neuronal destruction and enhance patients\u0026rsquo; quality of life and symptoms[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. A more profound understanding of AD\u0026rsquo;s pathogenesis is crucial to identify the involved cellular and molecular mechanisms and suitable biomarkers and therapeutic targets to improve prognosis.\u003c/p\u003e \u003cp\u003eLncRNAs are one of the most common non-coding RNAs (ncRNAs) that are longer than 200 nucleotides [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. They play a crucial role in various biological phenomena, including epigenetics, gene expression regulation, and essential biological processes in different diseases[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Recent studies have shown that several lncRNAs are dysregulated in plasma samples of AD patients[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. For example, the knockdown of lncRNA BC200 significantly suppressed BACE1 expression in the SH-SY5Y cell model, and BC200 levels were significantly reduced in neurons of AD brains[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Additionally, lncRNA 51A was found to be overexpressed in both in vitro models and AD patients[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLncRNA AL133415.1 is located on chromosome 10p13, and its role in the mechanism of AD has not been reported. Vimentin (VIM) is a 57 kDa type III IF protein mainly expressed in interstitial cell types and plays an important role in various pathophysiological conditions, including aging[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. VIM regulates a wide range of fundamental cellular functions,has close relationship with cellular senescence[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The oxidized form of vimentin, along with its mRNA and protein levels, increases in senescent cells[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Studies have shown that vimentin expression is present in the brain regions of AD transgenic mice and AD patients and plays a crucial role in the mechanism of neuronal injury response in the AD brain[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn a pilot study, we conducted transcriptomic analysis to determine the relationship between lncRNA AL133415.1 and VIM. The results indicated that VIM is a potential candidate target gene of lncRNA AL133415.1. We hypothesized that lncRNA AL133415.1 might play a vital role in AD pathology. This study aims to explore the role of lncRNA AL133415.1 in regulating neuronal apoptosis, cell viability, and oxidative stress and further explore the molecular mechanism of lncRNA AL133415.1 and VIM in AD.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eThe human neuroblastoma cell line (SH-SY5Y) was purchased from Wuhan ProCell Company. DMEM/F12 basal medium and fetal bovine serum (FBS) were sourced from Gibco (Carlsbad, CA, USA), while penicillin-streptomycin solution (P/S) was acquired from BI (BEIT HAEMEK, ISRAEL). SH-SY5Y cells were grown in DMEM/F12 basal medium with 15% FBS and 1% P/S under 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% air at 37\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eConstructing an AD model\u003c/h2\u003e \u003cp\u003eAs per a previous study [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], Aβ42 was obtained from Qyaobio Company, Ltd (Shanghai, China) and dissolved in 1 mM dimethyl sulfoxide (DMSO) using sonication. SH-SY5Y cells were then treated with 10 \u0026micro;M oligomerized Aβ42 peptide for 48 hours to create an SH-SY5Y AD cell model. The cell viability between each AD model and its corresponding control group was measured with Cell Counting Kit-8 (CCK-8) (Proteintech, USA) to confirm the establishment of each AD model.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eThe total RNA extraction\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from cells by TRIzol reagent (Invitrogen, CA, USA) following the instructions. The samples were stored at -80\u0026deg;C refrigerator. A NanoDrop 2000 spectrophotometer (NanoDrop Products, Wilmington, DE, USA) was used to evaluate the quantity of RNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eReal-time PCR validation\u003c/h2\u003e \u003cp\u003eAfter extracting RNA, cDNA was reverse transcribed using a Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Lithuania, EU). Real-time polymerase chain reaction (RT-PCR) was then performed using an ABI Quant Studio\u003csup\u003e\u0026trade;\u003c/sup\u003e 6 (Applied Biosystems, Carlsbad, USA) and a Quanti Nova SYBR Green PCR kit (QIAGEN Bio, Shanghai, China). The PCR reaction conditions were as follows: initial activation at 95\u0026deg;C for 2 min, followed by 40 cycles at 95\u0026deg;C for 5 s, 58\u0026deg;C for 30 s, and 95\u0026deg;C for 15 s. Primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. All samples were run in triplicate with U6 (miRNA) and GAPDH (mRNA and lncRNA) used as reference genes. The 2\u003csup\u003e-ΔΔCt\u003c/sup\u003e method was used for quantification.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence for qPCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences(5\u0026rarr;3༇)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eVIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCAGGACTCGGTGGACTTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGTTGGCGAAGCGGTCATTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMir-138-5p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCGAGCTGGTGTTGTGAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGTGCAGGGTCCGAGGTATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLncRNA AL133415.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTTCACAGGTGAGGGACTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGGCTCAGATTCAGGAACAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACTTTGGTATCGTGGAAGGACTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GTTTTTCTAGACGGCAGGTCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACTTTGGTATCGTGGAAGGACTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GTTTTTCTAGACGGCAGGTCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eNotes: F, forward; R, reverse.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTransfection\u003c/h2\u003e \u003cp\u003eIn order to explore the effects of lncRNA AL133415.1 on cellular AD model functions including apoptosis and inflammation, lncRNA AL133415.1 overexpression plasmid, control overexpression plasmid, lncRNA AL133415.1 siRNA plasmid, and siRNA control plasmid were constructed by Jiangsu Kaiji Biotechnology Company (Nanjing, China) using FC-4953 and FV-073 plasmids. These plasmids were then transfected into the SH-SY5Y AD model, and the cells were divided into four groups based on the transfected plasmids: lncRNA AL133415.1_NC group, lncRNA AL133415.1 group, siRNA_NC group, and siRNA_group. MiR-138-5p mimic (5\u0026prime;-AGCUGGUGUUGUGAAUCAGGCCG-3\u0026prime;) and negative control (NC) mimic (5\u0026prime;-UCACAACCUCCUAGAAAGAGUAGA-3\u0026prime;), as well as miR-138-5p inhibitor (5\u0026prime;-CGGCCUGAUUCACAACACCAGCU-3 \u0026prime;) and negative control (NC) inhibitor (5\u0026prime;-UCUACUCUUUCUAGGAGGUUGUGA-3\u0026prime;) (KaiJi, China), were transfected into the SH-SY5Y AD model using Lipofectamine 3000 Reagent (Invitrogen, USA). The cells were then divided into four groups based on transfection: miR-138-5p mimics group, mimics NC group, miR-138-5p inhibitors group, and inhibitors NC group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eCell viability was detected by CCK-8 assay (Proteintech, USA). Cell suspensions were seeded in 96-well plates and pre-incubated for 4 hours at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Then, 10 \u0026micro;l of CCK-8 was added to each well and incubated at 37\u0026deg;C for 2 hours. The plate was analyzed with a microplate reader (Thermo, USA) at 450 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eDetection of indicators of oxidative stress\u003c/h2\u003e \u003cp\u003eThe reactive oxygen species assay kit (Beyotime, China), total superoxide dismutase assay kit (Beyotime, China), and lipid peroxidation MDA assay kit (Beyotime, China) were used to measure intracellular reactive oxygen species (ROS), the level of cellular superoxide was tested for dismutase (SOD), and intracellular malondialdehyde (MDA) in SH-SY5Y cells following the instructions of the kits.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot (WB)\u003c/h2\u003e \u003cp\u003eAfter collecting the cells, total protein was extracted using Lysis Buffer (Sigma, USA) and quantified using a BCA Protein Assay Kit (Keygen Biotech, China). Proteins were then separated on SDS-PAGE precast gels (Keygen Biotech, China) and transferred to nitrocellulose membranes (Millipore, USA) using a Trans-Blot Turbo Protein Transfer System (Bio-rad, USA). The membranes were then blocked with Western Blocking Buffer for 2 hours on a shaker and incubated with primary antibodies at 4\u0026deg;C overnight. Subsequently, membranes was incubated with the suitable secondary antibody for 2 hours at room temperature with shaking. Finally, proteins were visualized using a G: BOXChemiXR5 system (SYNGENE, UN).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eConfocal laser scanning microscopy\u003c/h2\u003e \u003cp\u003eAfter adding two drops of methanol solution, the procedure was carried out at 15\u0026deg;C for 10 minutes. The cells were then stained with a DAPI kit from Keygen BioTECH (China) for 5 minutes at room temperature. Confocal laser scanning microscope from Olympus (Japan) was used to colletc images.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eThe relationship between LncRNA AL133415.1 and MiR-138-5p\u003c/h2\u003e \u003cp\u003eTo explore the relationship between the LncRNA AL133415.1 and MiR-138-5p, DIANA-LncBase V3.0 software was used to analyze their interrelationships.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data was analyzed using the Stata11.0 program from Stata Corp (College Station, TX). Continuous variables were presented as mean and standard deviation. Student\u0026rsquo;s t-test was used to compare data between two groups, while one-way ANOVA with post hoc Turkey\u0026rsquo;s t-test was used for multigroup analysis. \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eAD cell model\u003c/h2\u003e \u003cp\u003eThe expression of Tau and p-Tau proteins were detected to verify the construction of the AD cell model.The model group showed an increase in Tau and p-Tau protein expression compared with the control group (p1\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p2\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), indicating that the model was successfully established. The cell death rate was measured using the CCK-8 method and was found to be 24.55% in the model group, while cell viability in the control group remained unchanged.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eExpression of lncRNA AL133415.1 and miR-138-5p after transfection\u003c/h2\u003e \u003cp\u003eAfter transfection with plasmids, lncRNA AL133415.1 expression was found to be higher in the lncRNA_AL133415.1 group than in the lncRNA_NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while it was lower in the siRNA group than in the sirNC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the AD model (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). In contrast, miR-138-5p expression was higher in the miR-138-5p mimics group compared with NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but lower in the miR-138-5p inhibitors group compared with NC group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the AD model (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), indicating successful transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eThe viability of SH-SY5Y cells after transfection\u003c/h2\u003e \u003cp\u003eThe CCK-8 assay results showed that cell viability was lower in the Aβ42 insult group than in the control group in both the LncRNA AL133415.1 and miR-138-5p groups (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Cell viability was higher in the siRNA group than in the sirNC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but lower in the lncRNA_AL133415.1 group than in the lncRNA_NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). However, cell viability was lower in the miR-138-5p mimics group compared with group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but higher in the miR-138-5p inhibitors group compared with NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eApoptosis of SH-SY5Y cells transfected with lncRNA AL133415.1\u003c/h2\u003e \u003cp\u003eThe apoptosis of cells was detected by the Annexin V-FITC/PI assay and flow cytometry. Compared to the control group, the apoptosis rate of SH-SY5Y cells induced by Aβ42 was higher, indicating that Aβ42 significantly promoted apoptosis in SH-SY5Y cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The apoptosis rate was also higher in both the siRNA and lncRNA_AL133415.1 groups compared with control group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, the apoptosis rate was lower in the siRNA group than in the sirNC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), but higher in the lncRNA_AL133415.1 group compared with lncRNA_NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eApoptosis of SH-SY5Y cells transfected with miR-138-5p\u003c/h2\u003e \u003cp\u003eThe apoptosis of cells in each group was measured using the Annexin V-FITC/PI assay and flow cytometry. Compared to the control group, the apoptosis rate of SH-SY5Y cells induced by Aβ42 was higher, indicating that Aβ42 significantly promoted apoptosis in SH-SY5Y cells \u003cem\u003e(P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The apoptosis rate was higher in the miR-138-5p mimics group compared with mimics NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but lower in the miR-138-5p inhibitors group compared with inhibitors NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, the apoptosis rate was higher in both the miR-138-5p inhibitors and miR-138-5p mimics groups compared with control group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eOxidative stress after transfection of SH-SY5Y cells\u003c/h2\u003e \u003cp\u003eTo investigate whether LncRNA AL133415.1 regulated oxidative stress in AD, oxidative stress indices including ROS, MDA, and SOD were measured using DCFH-DA methods and commercial assay kits. The results showed that ROS levels were lower in the siRNA group than in the sirNC group and in the miR-138-5p inhibitors group than in the inhibitors NC group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but higher in the lncRNA_AL133415.1 group than in the lncRNA_NC group and in the miR-138-5p mimics group than in the mimics NC group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMDA levels were found to be lower in the siRNA group than in the sirNC group and in the miR-138-5p inhibitors group than in the inhibitors NC group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but higher in the lncRNA_AL133415.1 group than in the lncRNA_NC group and in the miR-138-5p mimics group than in the mimics NC group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In contrast, SOD levels were higher in the siRNA group than in the sirNC group and in the miR-138-5p inhibitors group than in the inhibitors NC group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but lower in the lncRNA_AL133415.1 group than in the lncRNA_NC group and in the miR-138-5p mimics group than in the mimics NC group (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eExpression of VIM after lncRNA AL133415.1 transfection\u003c/h2\u003e \u003cp\u003eAfter transfection with plasmids, VIM expression was found to be higher in the siRNA group compared with sirNC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but lower in the lncRNA_AL133415.1 group than in the lncRNA_NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, VIM expression was lower in the Aβ42 insult group compared with control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The levels of VIM protein followed a similar trend to that of VIM gene expression between groups (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). These results show that overexpression of lncRNA AL133415.1 inhibited VIM expression, while inhibition of lncRNA AL133415.1 expression promoted VIM expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eExpression of VIM after miR-138-5p transfection\u003c/h2\u003e \u003cp\u003eAfter transfection with plasmids, VIM expression was found to be higher in the miR-138-5p inhibitors group compared with inhibitors NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), but lower in the miR-138-5p mimics group compared with mimics NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, VIM expression was lower in the Aβ42 insult group than in the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The levels of VIM protein followed a similar trend to that of VIM gene expression between groups (both \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). These findings suggest that overexpression of miR-138-5p inhibited VIM expression, while inhibition of miR-138-5p expression promoted VIM expression.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eMeasuring VIM expression using confocal laser fluorescence microscopy (CLSM) after lncRNA AL133415.1 transfection\u003c/h2\u003e \u003cp\u003eDAPI staining in the nuclear region showed blue fluorescence, while vimentin protein showed green fluorescence. The merged image revealed localization of green fluorescence in the nuclear periphery region. CLSM results indicated that VIM protein expression in SH-SY5Y cells was significantly reduced after treatment with Aβ42. VIM protein expression was higher in the siRNA group than in the sirNC group, but lower in the LncRNA AL133415.1 group than in the lncRNA_NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). This trend was consistent with the results obtained using the WB method.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eUsing CLSM to investigate the effect of lncRNA AL133415.1 transfection on VIM expression\u003c/h2\u003e \u003cp\u003eThe expression of VIM protein in SH-SY5Y cells was significantly reduced after treatment with Aβ42, as shown by CLSM. In the group treated with miR-138-5p inhibitors, VIM protein expression increased compared with inhibitors NC group. However, in the group treated with miR-138-5p mimics, VIM protein expression decreased compared with mimics NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). These results were consistent with those obtained using the WB method.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eUsing DIANA-LncBase sofeware to investigate the relationship between lncRNA AL133415.1 and MiR-138-5p\u003c/h2\u003e \u003cp\u003eThe study used DIANA-LncBase V3.0 software to analyze the interrelationship between LncRNA AL133415.1 and MiR-138-5p. After entering LncRNA AL133415.1 (ENSG00000234961) in LncRNA input box, it was found that there were five miRNAs(miR-106b-5p, miR-1301-3p, miR-17-5p, and miR-20b-5p, respectively.) had relations with this LncRNA, All of the above miRNAs were validated by one experiment and supported by one literature with LncRNA AL133415.1, and all were expressed in combination in cell lines with high confidence of binding score. A total of 765 validated genes with binding to miR-138-5p were retrieved by entering MiR-138-5p in miRNA, and there was no AL133415.1 gene among them(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAD is a a common neurological degeneration disease characterized by neuroinflammation, extracellular amyloid-β (Aβ) plaques, neurofibrillary tangles, and neuronal death [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Various risk factors, including genetic, environmental, immunological factors and depression, may contribute to the development of AD [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Despite extensive research into the mechanisms of AD, its pathogenesis remains unclear. lncRNAs may involve AD pathogenesis through their various biochemical and functional effects, including the level of translation, post-transcriptional, posttranslational regulation, and epigenetics [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. LncRNAs expressed in plasma can participate in AD pathogenesis by regulating Aβ production, oxidative stress, synaptic damage and mitochondrial dysfunction[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. LncRNA AL133415.1 is a novel lncRNA with limited information available on its role in neurodegenerative disorders. The functions and underlying mechanisms of lncRNA AL133415.1 in AD remain to be established.\u003c/p\u003e \u003cp\u003eMiRNAs are small non-coding RNA molecules, made up of 19\u0026ndash;25 nucleotides, that regulate protein expression by acting as translational repressors. Research suggests that miR-138-5p plays an crucial role in various types of cardiovascular diseases and cancers, including brain tumors[\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The expression of miR-138-5p has been found to be downregulated compared to controls in tissues of AD [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. As a result, some researchers have proposed using miRNAs as diagnostic biomarkers for AD. For example, the plasma level of miR-138-5p has been shown to be significantly different in AD patients compared to controls[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Using TargetScan Human software to predict potential target miRNAs for the vim gene, it was found that miR-138-5p is a promising candidate.\u003c/p\u003e \u003cp\u003eVimentin is a protein that has been linked to a wide range of diseases, including cataracts, cancer, fibrosis-related diseases, and aging[\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. It is believed to contribute to several post-translational modifications that can regulate its associated functional properties in these diseases[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Previous research has shown that vimentin is present in the brain and is mainly expressed in cells of the central nervous system[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Additionally, vimentin has been related to cell senescence, with increased expression of its mRNA and secretion of an oxidized form being linked to this process. This suggests that vimentin could serve as a potential marker for oxidative stress and play an important role in aging.\u003c/p\u003e \u003cp\u003eStudies have shown that Vimentin is expressed by neurons in the brains of both AD transgenic mice (Tg2576) and the brain regions of AD patients. In AD brains, Vimentin expression plays an important part in the neuronal damage-response mechanism. Additionally, the expression of VIM has been found to increase around amyloid plaques in reactive astrocytes of AD patients[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMany studies have demonstrated a relationship between lncRNA and vimentin. For example, LINC00857 has been shown to increase colorectal cancer progression by sponging miR-1306 and regulating vimentin expression in cells[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Similarly, lnc-NLIPMT and lnc-PCTST have been found to play important roles in regulating vimentin expression[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In hepatocellular carcinoma, vimentin may also play a role in the tumor suppressor function of lncRNA-ELF209[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The relationship between lncRNAs AL133415.1, miR-138-5p, and vimentin in AD is currently not well understood. In our study, we investigated the expression of lncRNA AL133415.1 and miR-138-5p in relation to vimentin. Our results showed that overexpression of LncRNA AL133415.1 could inhibit vimentin expression, while inhibition of LncRNA AL133415.1 expression could promote VIM expression. We also explored the relationship between miR-138-5p and vimentin and found that overexpression of miR-138-5p could suppress vim expression, while inhibition of miR-138-5p expression could promote vim expression. CLSM confirmed that changes in vimentin protein expression mirrored changes in gene expression. These data suggest that lncRNA AL133415.1 and miR-138-5p are involved in the development and etiology of AD. We also performed a CCK-8 assay and found that lncRNA AL133415.1 and miR-138-5p could significantly reduce the viability of SH-SY5Y cells in vitro. Flow cytometry analysis showed that both lncRNA AL133415.1 and miR-138-5p could significantly increase neuronal apoptosis in AD model SH-SY5Y cells, suggesting that these lncRNAs may be involved in AD etiology by affecting neuronal apoptosis.\u003c/p\u003e \u003cp\u003eResearch has shown that oxidative stress is an potential influence factor in the occurrence of AD[39]. Silencing lncRNA p21 has been found to decrease ROS generation and increase SOD activity in SH-SY5Y cells[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. However, the role of lncRNA AL133415.1 and miR-138-5p in oxidative stress in AD is not yet well understood. To explore this further, we detected the levels of oxidative stress markers (including ROS, MDA, and SOD) and found that ROS and MDA levels were decreased in the siRNA and miR-138-5p groups, but increased in the lncRNA_AL133415.1 and miR-138-5p mimics groups. Conversely, SOD levels were increased in the siRNA and miR-138-5p inhibitors groups but decreased in the lncRNA AL133415.1 and miR-138-5p mimics groups. These findings show that LncRNA AL133415.1 and miR-138-5p may play an important part in the pathogenesis of AD by affecting oxidative stress.\u003c/p\u003e \u003cp\u003eIn our study, we found that lncRNA AL133415.1 can affect vimentin expression by sponging miR-138-5p. This may explain why inhibiting lncRNA AL133415.1 in SH-SY5Y cells can significantly decrease cell viability and increase apoptosis. Our findings suggest that the lncRNA AL133415.1/miR-138-5p/vimentin axis could be a novel target for the treatment of AD in furture.\u003c/p\u003e \u003cp\u003eOur study has some limitations. We only investigated the relationship between lncRNA AL133415.1, miR-138-5p, and vimentin in AD cell models. In future research, we plan to measure the expression levels of miR-138-5p and vimentin and explore their relationship in clinical samples. Additionally, we intend to further investigate the sponge effect of lncRNA AL133415.1 on miR-138-5p.\u003c/p\u003e \u003cp\u003eIn summary, our study suggests that lncRNA AL133415.1 is a novel long noncoding RNA that may interact with miR-138-5p to promote neuronal apoptosis. By sponging miR-138-5p, lncRNA AL133415.1 can regulate vimentin expression in cells. These results show that lncRNA AL133415.1 could be a potential therapeutic target for AD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDeclared none.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Data availability\u003c/p\u003e\n\u003cp\u003eThe data supporting this study can be obtained from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by grants from the National Natural Science Foundation of Xinjiang Uygur Autonomous Region (No.2022D01C232).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors (Yi Cheng, Lihua Li,Ting Zou, Lei Zhang, Chang Yang,\u0026nbsp;Long Ma, and Xiaohui Zhou) declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAll authors contributed to the study\u0026apos;s conception and design. Material preparation, data collection, and analysis were performed by\u0026nbsp;\u003c/em\u003eYi Cheng, Lihua Li,Ting Zou, Lei Zhang,\u0026nbsp;Long Ma, and Xiaohui Zhou\u003cem\u003e. The first draft of the manuscript was written by\u0026nbsp;\u003c/em\u003eYi Cheng\u003cem\u003e\u0026nbsp;and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cstrong\u003eConsent for Publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agree to publish this study.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAssociation., A.s., \u003cem\u003e2020 Alzheimer\u0026rsquo;s disease facts \u003cem\u003eand figures.\u003c/em\u003e Alzheimer\u0026rsquo;s Dement, 2020. \u003cstrong\u003e16\u003c/strong\u003e: p. 391-460.\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003eAnand, R., K.D. Gill, and A.A. Mahdi, \u003cem\u003eTherapeutics of Alzheimer\u0026apos;s disease: Past, present and future.\u003c/em\u003e Neuropharmacology, 2014. \u003cstrong\u003e76 Pt A\u003c/strong\u003e: p. 27-50.\u003c/li\u003e\n\u003cli\u003eJia, L., et al., \u003cem\u003eDementia in China: epidemiology, clinical management, and research advances.\u003c/em\u003e Lancet Neurol, 2020. \u003cstrong\u003e19\u003c/strong\u003e(1): p. 81-92.\u003c/li\u003e\n\u003cli\u003eXiaohui Zhou, Y.h., Xiaoning Zhou, Guli Za, \u003cem\u003eEpidemiological survey of Alzheimer\u0026apos;s disease and vascular dementia in Uygur and Han ethnic groups in Xinjiang Uygur Autonomous Region.\u003c/em\u003e Chinese Journal of Neurology, 2008. \u003cstrong\u003e41\u003c/strong\u003e: p. 797-801.\u003c/li\u003e\n\u003cli\u003eKalra, J. and A. Khan, \u003cem\u003eReducing Abeta load and tau phosphorylation: Emerging perspective for treating Alzheimer\u0026apos;s disease.\u003c/em\u003e Eur J Pharmacol, 2015. \u003cstrong\u003e764\u003c/strong\u003e: p. 571-581.\u003c/li\u003e\n\u003cli\u003eScheltens, P., et al., \u003cem\u003eAlzheimer\u0026apos;s disease.\u003c/em\u003e Lancet, 2016. \u003cstrong\u003e388\u003c/strong\u003e(10043): p. 505-17.\u003c/li\u003e\n\u003cli\u003eWang, L.K., et al., \u003cem\u003eDissection of functional lncRNAs in Alzheimer\u0026apos;s disease by construction and analysis of lncRNA-mRNA networks based on competitive endogenous RNAs.\u003c/em\u003e Biochem Biophys Res Commun, 2017. \u003cstrong\u003e485\u003c/strong\u003e(3): p. 569-576.\u003c/li\u003e\n\u003cli\u003eIyer, M.K., et al., \u003cem\u003eThe landscape of long noncoding RNAs in the human transcriptome.\u003c/em\u003e Nat Genet, 2015. \u003cstrong\u003e47\u003c/strong\u003e(3): p. 199-208.\u003c/li\u003e\n\u003cli\u003eCrist, A.M., et al., \u003cem\u003eTranscriptomic analysis to identify genes associated with selective hippocampal vulnerability in Alzheimer\u0026apos;s disease.\u003c/em\u003e Nat Commun, 2021. \u003cstrong\u003e12\u003c/strong\u003e(1): p. 2311.\u003c/li\u003e\n\u003cli\u003eLiu, N.X. and Q.H. Li, \u003cem\u003eLncRNA BC200 regulates neuron apoptosis and neuroinflammation via PI3K/AKT pathway in Alzheimer\u0026apos;s disease.\u003c/em\u003e J Biol Regul Homeost Agents, 2020. \u003cstrong\u003e34\u003c/strong\u003e(6): p. 2255-2261.\u003c/li\u003e\n\u003cli\u003eCao, Q., et al., \u003cem\u003eExosomal long noncoding RNAs in aging and age-related diseases.\u003c/em\u003e IUBMB Life, 2019. \u003cstrong\u003e71\u003c/strong\u003e(12): p. 1846-1856.\u003c/li\u003e\n\u003cli\u003eDanielsson F, Peterson M K, Caldeira Ara\u0026uacute;jo H, et al. Vimentin Diversity in Health and Disease[J]. Cells, 2018, 7(10). \u003c/li\u003e\n\u003cli\u003eSatelli, A. and S. Li, \u003cem\u003eVimentin in cancer and its potential as a molecular target for cancer therapy.\u003c/em\u003e Cell Mol Life Sci, 2011. \u003cstrong\u003e68\u003c/strong\u003e(18): p. 3033-46.\u003c/li\u003e\n\u003cli\u003eTanaka, H., et al., \u003cem\u003eCytokinetic Failure-induced Tetraploidy Develops into Aneuploidy, Triggering Skin Aging in Phosphovimentin-deficient Mice.\u003c/em\u003e J Biol Chem, 2015. \u003cstrong\u003e290\u003c/strong\u003e(21): p. 12984-98.\u003c/li\u003e\n\u003cli\u003eLevin, E.C., et al., \u003cem\u003eNeuronal expression of vimentin in the Alzheimer\u0026apos;s disease brain may be part of a generalized dendritic damage-response mechanism.\u003c/em\u003e Brain Res, 2009. \u003cstrong\u003e1298\u003c/strong\u003e: p. 194-207.\u003c/li\u003e\n\u003cli\u003eNie, J., et al., \u003cem\u003eDendrobium alkaloids prevent Abeta25-35-induced neuronal and synaptic loss via promoting neurotrophic factors expression in mice.\u003c/em\u003e PeerJ, 2016. \u003cstrong\u003e4\u003c/strong\u003e: p. e2739.\u003c/li\u003e\n\u003cli\u003eTolppanen, A.M., H. Taipale, and S. Hartikainen, \u003cem\u003eHead or brain injuries and Alzheimer\u0026apos;s disease: A nested case-control register study.\u003c/em\u003e Alzheimers Dement, 2017. \u003cstrong\u003e13\u003c/strong\u003e(12): p. 1371-1379.\u003c/li\u003e\n\u003cli\u003eVijayan, M. and P.H. Reddy, \u003cem\u003eStroke, Vascular Dementia, and Alzheimer\u0026apos;s Disease: Molecular Links.\u003c/em\u003e J Alzheimers Dis, 2016. \u003cstrong\u003e54\u003c/strong\u003e(2): p. 427-43.\u003c/li\u003e\n\u003cli\u003eZhang, Z., \u003cem\u003eLong non-coding RNAs in Alzheimer\u0026apos;s disease.\u003c/em\u003e Curr Top Med Chem, 2016. \u003cstrong\u003e16\u003c/strong\u003e(5): p. 511-9.\u003c/li\u003e\n\u003cli\u003eCortini, F., F. Roma, and C. Villa, \u003cem\u003eEmerging roles of long non-coding RNAs in the pathogenesis of Alzheimer\u0026apos;s disease.\u003c/em\u003e Ageing Res Rev, 2019. \u003cstrong\u003e50\u003c/strong\u003e: p. 19-26.\u003c/li\u003e\n\u003cli\u003eCourboulin, A., et al., \u003cem\u003eMicroRNA networks in pulmonary arterial hypertension: share mechanisms with cancer?\u003c/em\u003e Curr Opin Oncol, 2016. \u003cstrong\u003e28\u003c/strong\u003e(1): p. 72-82.\u003c/li\u003e\n\u003cli\u003eMu\u0026ntilde;oz-Rodr\u0026iacute;guez, J.L., et al., \u003cem\u003eDifferentially expressed microRNAs in postpartum breast cancer in Hispanic women.\u003c/em\u003e PLoS One, 2015. \u003cstrong\u003e10\u003c/strong\u003e(4): p. e0124340.\u003c/li\u003e\n\u003cli\u003eLi, J., et al., \u003cem\u003eSpecies-specific mutual regulation of p53 and miR-138 between human, rat and mouse.\u003c/em\u003e Sci Rep, 2016. \u003cstrong\u003e6\u003c/strong\u003e: p. 26187.\u003c/li\u003e\n\u003cli\u003eSiegel, G., et al., \u003cem\u003eA functional screen implicates microRNA-138-dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis.\u003c/em\u003e Nat Cell Biol, 2009. \u003cstrong\u003e11\u003c/strong\u003e(6): p. 705-16.\u003c/li\u003e\n\u003cli\u003eDobricic, V., et al., \u003cem\u003eDifferential microRNA expression analyses across two brain regions in Alzheimer\u0026apos;s disease.\u003c/em\u003e Transl Psychiatry, 2022. \u003cstrong\u003e12\u003c/strong\u003e(1): p. 352.\u003c/li\u003e\n\u003cli\u003eLugli, G., et al., \u003cem\u003ePlasma Exosomal miRNAs in Persons with and without Alzheimer Disease: Altered Expression and Prospects for Biomarkers.\u003c/em\u003e PLoS One, 2015. \u003cstrong\u003e10\u003c/strong\u003e(10): p. e0139233.\u003c/li\u003e\n\u003cli\u003eHenderson, P., et al., \u003cem\u003eA role for vimentin in Crohn disease.\u003c/em\u003e Autophagy, 2012. \u003cstrong\u003e8\u003c/strong\u003e(11): p. 1695-6.\u003c/li\u003e\n\u003cli\u003eVirtakoivu, R., et al., \u003cem\u003eVimentin-ERK Signaling Uncouples Slug Gene Regulatory Function.\u003c/em\u003e Cancer Res, 2015. \u003cstrong\u003e75\u003c/strong\u003e(11): p. 2349-62.\u003c/li\u003e\n\u003cli\u003eRichardson, A.M., et al., \u003cem\u003eVimentin Is Required for Lung Adenocarcinoma Metastasis via Heterotypic Tumor Cell-Cancer-Associated Fibroblast Interactions during Collective Invasion.\u003c/em\u003e Clin Cancer Res, 2018. \u003cstrong\u003e24\u003c/strong\u003e(2): p. 420-432.\u003c/li\u003e\n\u003cli\u003eShi, A.M., et al., \u003cem\u003eVimentin and post-translational modifications in cell motility during cancer - a review.\u003c/em\u003e Eur Rev Med Pharmacol Sci, 2016. \u003cstrong\u003e20\u003c/strong\u003e(12): p. 2603-6.\u003c/li\u003e\n\u003cli\u003eBouamrani, A., et al., \u003cem\u003eIncreased phosphorylation of vimentin in noninfiltrative meningiomas.\u003c/em\u003e PLoS One, 2010. \u003cstrong\u003e5\u003c/strong\u003e(2): p. e9238.\u003c/li\u003e\n\u003cli\u003eRamaekers, F.C., et al., \u003cem\u003eLenticular intermediate-sized filaments: biosynthesis and interaction with plasma membrane.\u003c/em\u003e Proc Natl Acad Sci U S A, 1982. \u003cstrong\u003e79\u003c/strong\u003e(10): p. 3208-12.\u003c/li\u003e\n\u003cli\u003eZhu, H., et al., \u003cem\u003eEnterovirus A71 VP1 Variation A289T Decreases the Central Nervous System Infectivity via Attenuation of Interactions between VP1 and Vimentin In Vitro and In Vivo.\u003c/em\u003e Viruses, 2019. \u003cstrong\u003e11\u003c/strong\u003e(5).\u003c/li\u003e\n\u003cli\u003eKamphuis, W., et al., \u003cem\u003eGFAP and vimentin deficiency alters gene expression in astrocytes and microglia in wild-type mice and changes the transcriptional response of reactive glia in mouse model for Alzheimer\u0026apos;s disease.\u003c/em\u003e Glia, 2015. \u003cstrong\u003e63\u003c/strong\u003e(6): p. 1036-56.\u003c/li\u003e\n\u003cli\u003eChang, N., et al., \u003cem\u003eLong Noncoding RNA LINC00857 Promotes Proliferation, Migration, and Invasion of Colorectal Cancer Cell through miR-1306/Vimentin Axis.\u003c/em\u003e Comput Math Methods Med, 2021. \u003cstrong\u003e2021\u003c/strong\u003e: p. 5525763.\u003c/li\u003e\n\u003cli\u003eZhang, F., et al., \u003cem\u003eLong Non-Coding RNA NLIPMT as a Tumor Suppressor and Inhibitor of Cell Proliferation and Metastasis in Papillary Thyroid Carcinoma.\u003c/em\u003e Cancer Manag Res, 2020. \u003cstrong\u003e12\u003c/strong\u003e: p. 10311-10319.\u003c/li\u003e\n\u003cli\u003eWang, Y., et al., \u003cem\u003eLong non-coding RNA lnc-PCTST predicts prognosis through inhibiting progression of pancreatic cancer by downregulation of TACC-3.\u003c/em\u003e Int J Cancer, 2018. \u003cstrong\u003e143\u003c/strong\u003e(12): p. 3143-3154.\u003c/li\u003e\n\u003cli\u003eYang, Y., et al., \u003cem\u003eHNRNPAB-regulated lncRNA-ELF209 inhibits the malignancy of hepatocellular carcinoma.\u003c/em\u003e Int J Cancer, 2020. \u003cstrong\u003e146\u003c/strong\u003e(1): p. 169-180.\u003c/li\u003e\n\u003cli\u003eButterfield, D.A. and B. Halliwell, \u003cem\u003eOxidative stress, dysfunctional glucose metabolism and Alzheimer disease.\u003c/em\u003e Nat Rev Neurosci, 2019. \u003cstrong\u003e20\u003c/strong\u003e(3): p. 148-160.\u003c/li\u003e\n\u003cli\u003eDing, X.M., et al., \u003cem\u003eLong non-coding RNA-p21 regulates MPP(+)-induced neuronal injury by targeting miR-625 and derepressing TRPM2 in SH-SY5Y cells.\u003c/em\u003e Chem Biol Interact, 2019. \u003cstrong\u003e307\u003c/strong\u003e: p. 73-81.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Alzheimer's disease, lncRNAAL133415.1, miR-138-5p, Vimentin, Neuroinflammation","lastPublishedDoi":"10.21203/rs.3.rs-3234501/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3234501/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eAccumulating studies have identified that long noncoding RNA (lncRNA) are novel regulators in Alzheimer\u0026rsquo;s disease (AD). The goal of this study is to examine the impact of LncRNAAL133415.1 on cell viability, neuronal apoptosis, and oxidative stress and to further investigate the molecular mechanisms in AD.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn our study, we transfected control overexpression, lncRNA AL133415.1 overexpression, control siRNA, and lncRNA AL133415.1 siRNA into an SH-SY5Y-based AD cell model that was established using Aβ42 insult. We then measured cell viability and apoptosis using a CCK-8 assay and apoptosis marker expressions. Oxidative stress was assessed using a reactive oxygen species assay Kit and RT-qPCR was used to make observations. Total proteins were extracted and quantified using Western blot assays. We also determined the expression of Vimentin in each group.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eTranscriptome analysis revealed that vimentin (VIM) is a cis-target gene regulated by lncRNA AL133415.1. TargetScan database showed that VIM is a promising candidate target gene for miR-138-5p. In AD cell model, overexpression of lncRNA AL133415.1 inhibited cell viability and promoted cell apoptosis, while silencing lncRNA AL133415.1 had the opposite effect. Similarly, overexpression of lncRNA AL133415.1 inhibited Vimentin expression, while silencing lncRNA AL133415.1 promoted Vimentin expression. Overexpression of miR-138-5p also inhibited Vimentin expression, while inhibition of miR-138-5p expression promoted Vimentin expression. The levels of ROS were reduced in the lncRNA AL133415.1 silence group and increased in the lncRNA AL133415.1 overexpression group. Conversely, SOD levels were increased in the lncRNA AL133415.1 silence group and decreased in the lncRNA AL133415.1 overexpression group.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eLncRNA AL133415.1 may interact with miR-138-5p to increase neuron cell death and reduce the expression of Vimentin in AD.\u003c/p\u003e","manuscriptTitle":"LncRNA AL133415.1 promotes neuronal apoptosis and its association with Alzheimer's disease through the regulation of miR-125b/vimentin axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-08-11 14:20:22","doi":"10.21203/rs.3.rs-3234501/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5c437183-85e0-4e00-9d6c-bb5d664cfa2d","owner":[],"postedDate":"August 11th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-12-21T11:59:19+00:00","versionOfRecord":[],"versionCreatedAt":"2023-08-11 14:20:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3234501","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3234501","identity":"rs-3234501","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}