Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex

Immunoprecipitation and mass spectrometry... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/3-178" }, "headline": "Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and...", "datePublished": "2014-07-30T16:50:32", "dateModified": "2014-07-30T16:50:32", "author": [ { "@type": "Person", "name": "Namsuk Kim" }, { "@type": "Person", "name": "Dario Acampora" }, { "@type": "Person", "name": "Florent Dingli" }, { "@type": "Person", "name": "Damarys Loew" }, { "@type": "Person", "name": "Antonio Simeone" }, { "@type": "Person", "name": "Alain Prochiantz" }, { "@type": "Person", "name": "Ariel A. Di Nardo" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Plasticity in the visual cerebral cortex is regulated by the internalization of Otx2 homeoprotein into parvalbumin neurons in cortical layers II/III and IV. However the Otx2 locus is not active in these neurons and the protein is imported from external sources, including the choroid plexus. Because Otx1 and Otx2 may have redundant functions, we wanted to verify if part of the staining in parvalbumin neurons corresponds to Otx1 transported from cortical layer V neurons. It is demonstrated here that Otx staining in layer IV cells is maintained in Otx1-null mice. The immunoprecipitation of extracts from finely dissected granular and supragranular cortex (layers I-IV) gave immunoblots with a band corresponding to Otx2 and not Otx1. Moreover, high-resolution mass spectrometry analysis after immunoprecipitation identifies two peptides within the Otx2 homeodomain. One of these peptides is specific for Otx2 and is not found in Otx1. These results unambiguously establish that the staining in parvalbumin neurons revealed with the anti-Otx2 antibodies used in our previous studies identifies non-cell autonomous Otx2." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/3-178", "name": "Immunoprecipitation and mass spectrometry identify non-cell autonomous..." } } ] } Home Browse Immunoprecipitation and mass spectrometry identify non-cell autonomous... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Kim N, Acampora D, Dingli F et al. Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.12688/f1000research.4869.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] Namsuk Kim 1 , Dario Acampora 2,3 , Florent Dingli 4 , [...] Damarys Loew 4 , Antonio Simeone 2,3 , Alain Prochiantz 1 , Ariel A. Di Nardo 1 Namsuk Kim 1 , Dario Acampora 2,3 , [...] Florent Dingli 4 , Damarys Loew 4 , Antonio Simeone 2,3 , Alain Prochiantz 1 , Ariel A. Di Nardo 1 PUBLISHED 30 Jul 2014 Author details Author details 1 CIRB, CNRS UMR 7241 / INSERM U1050, College de France, 11 place Marcelin Berthelot, 75231 Paris Cedex 05, France 2 Institute of Genetics and Biophysics, Via Pietro Castellino 111, 80131 Napoli, Italy 3 IRCCS Neuromed, 86077 Pozzilli (IS), Italy 4 Institut Curie, Centre de Recherche, Laboratoire de Spectrométrie de Masse Protéomique, 75248 Paris Cedex 05, France OPEN PEER REVIEW DETAILS REVIEWER STATUS Abstract Plasticity in the visual cerebral cortex is regulated by the internalization of Otx2 homeoprotein into parvalbumin neurons in cortical layers II/III and IV. However the Otx2 locus is not active in these neurons and the protein is imported from external sources, including the choroid plexus. Because Otx1 and Otx2 may have redundant functions, we wanted to verify if part of the staining in parvalbumin neurons corresponds to Otx1 transported from cortical layer V neurons. It is demonstrated here that Otx staining in layer IV cells is maintained in Otx1 -null mice. The immunoprecipitation of extracts from finely dissected granular and supragranular cortex (layers I-IV) gave immunoblots with a band corresponding to Otx2 and not Otx1. Moreover, high-resolution mass spectrometry analysis after immunoprecipitation identifies two peptides within the Otx2 homeodomain. One of these peptides is specific for Otx2 and is not found in Otx1. These results unambiguously establish that the staining in parvalbumin neurons revealed with the anti-Otx2 antibodies used in our previous studies identifies non-cell autonomous Otx2. READ ALL READ LESS Corresponding Author(s) Alain Prochiantz ( [email protected] ) Ariel A. Di Nardo ( [email protected] ) Close Corresponding authors: Alain Prochiantz, Ariel A. Di Nardo Competing interests: No competing interests were disclosed. Grant information: This work was supported by the Région Ile-de-France, the FRM, GRL Program n°2009-00424, ANR grant BRAINEVER n° 11-BLAN-069467, and ERC Advanced Grant HOMEOSIGN n°339379. Copyright: © 2014 Kim N et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). How to cite: Kim N, Acampora D, Dingli F et al. Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.12688/f1000research.4869.1 ) First published: 30 Jul 2014, 3 :178 ( https://doi.org/10.12688/f1000research.4869.1 ) Latest published: 30 Jul 2014, 3 :178 ( https://doi.org/10.12688/f1000research.4869.1 ) Introduction Neural circuits generated during embryonic development are remodeled by environmental inputs during periods of heightened plasticity in postnatal development 1 . These critical periods are limited to specific windows of time that are different for each sensory system. In the visual system, the primary visual cortex is subjected to a critical period for ocular dominance plasticity during which connections from a weak or absent eye can be permanently overtaken by the strong eye 2 . The integrated action between inhibitory and excitatory circuits determines critical period onset, with a major role being played by the maturation of fast-spiking parvalbumin (FSPV) interneurons 3 . We have shown that Otx2 homeoprotein helps determine critical period timing by signaling FSPV cells in mice 4 . Conditional knock-down in heterozygous floxed mice just prior to normal critical period timing is sufficient to delay onset, while cortical infusion of recombinant Otx2 protein accelerates both onset and closure 4 . Remarkably, Otx2 protein in the cortex is non-cell autonomous. The Otx2 locus is silent, as shown by PCR, in situ hybridization and Otx2 +/GFP mice, while Otx2 protein is detectable by immunohistochemistry and immunoblot 4 , 5 . We have shown that cortical infusion of recombinant Otx2 protein results in specific uptake by FSPV cells, while injection in the retina results in its transport along the visual pathway and into these same cells 4 . Blocking extracellular Otx2 through infusion of antibodies or specific peptides reduces uptake of endogenous Otx2 in FSPV cells 4 , 6 . Furthermore, we recently showed that the choroid plexus expresses Otx2 and secretes it into the cerebrospinal fluid 5 . Conditional knockdown of Otx2 expression in the choroid plexus results in reduced cortical levels of Otx2 protein. Needless to say, all of these approaches that alter Otx2 protein levels in the visual cortex have resulted in changes in cortical plasticity timing 7 . An outstanding question is whether cortical Otx1 homeoprotein also plays a role in the critical period. Indeed, Otx1 is expressed in the cerebral cortex during development and continues to be expressed by layer V neurons in the adult 8 . It is thus possible that it is secreted by layer V cells and transferred into above granular and supragranular layers where Otx2 protein is detected. Unfortunately, most antibodies (commercial and academic) for Otx1 and Otx2 are pan-Otx thereby ruling out immunohistochemical approaches for conclusive evidence. Since genetic manipulation of the Otx2 locus has resulted in reduced protein in layer IV visual cortex 7 , we sought confirmation whether Otx1 is also present in these layers in the adult by using Otx1 knockout mice and proteomic approaches. Methods Animals All experiments were conducted in accordance with European Union Council Directives (86/609/EEC) and conform to Directive 2010/63/EU of the European Parliament. This study falls under project #00704.02 authorized by the French Ministry of Research. Adult male C57Bl/6J mice (Janvier) aged 2 to 3 months were used throughout this study and euthanized by cervical dislocation. Otx1 knockout mice, in which Otx1 is replaced with lacZ gene, have been previously described 14 . Adult (~3 months) male Otx1 LacZ/LacZ mice were fixed by intracardiac perfusion. Quantitative RT-PCR Total RNA from frozen tissue samples were extracted by using RNeasy Mini kits (Qiagen) and were reverse transcribed (~400 ng) with Superscript II and oligo-dT primers (Invitrogen). For real-time PCR, samples were analyzed with a LightCycler Instrument (Roche) and SYBR green (Sigma) detection with the following primers: Otx2-forward ATTCACGTTTCATGACCAACAG; Otx2-reverse ATTGACTCCGTATGAGCGGTAT; Otx1-forward GAACCTTCCTTCTCCGAAATCT; Otx1-reverse GATCTTCACATCGGACAAATCA; GAPDH-forward TGACGTGCCGCCTGGAGAAAC; GAPDH-reverse CCGGCATCGAAGGTGGAAGAG. The experiment was performed in duplicate. For calculating fold expression, gene-to-GAPDH ratios were determined by using the 2 -∆∆Ct method referenced to Otx1 expression in the lateral geniculate nucleus (LGN). Immunoprecipitation and immunoblots Dissected tissue was lysed in 100 mM Tris-HCl, pH 7.4, 10 mM EDTA, 150 mM NaCl, 1% Triton X-100, and protease inhibitor (Roche) then triturated (22G and 26G needles). Lysates were centrifuged at 16,000 × g for 10 min at 4°C and supernatants were incubated either directly with antibodies or with antibody-coupled Dynabeads (Life Technologies) at 4°C for 16 h. For samples with uncoupled antibodies, Protein A Dynabeads (Life Technologies) were added and incubated at 4°C for 1 h. Proteins were eluted with 2X SDS sample buffer after five washes with lysis buffer. Antibodies were rabbit polycolonal IgG (Abcam ab27478) and anti-Otx2 (rabbit polyclonal, Abcam ab21990) and were coupled to Dynabeads according to manufacturer instructions (Life Technologies). For immunoblots, samples were separated on NuPAGE 4%–12% Bis-Tris precast gels (Invitrogen) and transferred onto PVDF membrane. Membranes were incubated overnight at 4°C with anti-Otx2 (rabbit polyclonal, 1/1,000, Abcam ab21990) and then with HRP-coupled anti-rabbit IgG (1/2,000, GE Healthcare NA934) 1 h at RT. Immunohistochemistry For immunostaining, 50 µm floating sections were incubated with anti-Otx2 (rat polyclonal, 1/200, in-house) and biotinylated-WFA (1/100, Sigma L1516) in TBS, 1% Triton-X, 0.2% Tween-20, 10% fetal calf serum, overnight at 4°C. Sections were extensively washed at RT, incubated 2 h at RT with anti-rat Alexa Fluor-488 (Molecular Probes A21208, 1/2,000) and streptavidin Alexa Fluor-546 (Molecular Probes S11225, 1/2,000), washed again and finally mounted in Fluoromount medium (SouthernBiotech). Images were acquired with an Eclipse 90i microscope (Nikon). Mass spectrometry analysis After immunoprecipitation, proteins were separated on SDS–PAGE gels (Invitrogen) and stained with colloidal blue staining (LabSafe GEL BlueTM GBiosciences). Gel slices were excised and proteins were reduced with 10 mM DTT prior to alkylation with 55 mM iodoacetamide. After washing and shrinking the gel pieces with 100% MeCN, in-gel digestion was performed using trypsin (Promega) overnight in 25 mM NH4HCO3 at 30°C. Peptides were extracted and analyzed by nano-LC-MS/MS using an Ultimate 3000 system (Dionex S.A.) coupled to an Orbitrap Fusion mass spectrometer (Q-OT-qIT, Thermo Fisher Scientific). Samples were loaded on a C18 precolumn (300 µm inner diameter × 5 mm; Dionex) at 20 µl/min in 5% MeCN, 0.1% TFA. After a desalting for 3 min, the precolumn was switched on the C18 column (75 μm i.d. × 50 cm, packed with C18 PepMap™, 3 μm, 100 Å; LC Packings) equilibrated in solvent A (2% MeCN, 0.1% HCO2H). Bound peptides were eluted using a 150 min linear gradient (from 5 to 30% (v/v)) of solvent B (80% MeCN, 0.085% HCO2H) at a 150 nl/min flow rate and an oven temperature of 40°C. We acquired Survey MS scans in the Orbitrap on the 400–1500 m/z range with the resolution set to a value of 240,000 and a 4 × 105 ion count target. Each scan was recalibrated in real time by co-injecting an internal standard from ambient air into the C-trap. Tandem MS was performed by isolation at 1.6 Th with the quadrupole, HCD fragmentation with normalized collision energy of 35, and rapid scan MS analysis in the ion trap. The MS2 ion count target was set to 104 and the max injection time was 200 ms. Only those precursors with charge state 2–7 were sampled for MS2. The dynamic exclusion duration was set to 60 s with a 10 ppm tolerance around the selected precursor and its isotopes. The instrument was run in top speed mode with 3 s cycles. Data were acquired using the Xcalibur software (v 3.0.63) and the resulting spectra were interrogated by the MascotTM Software through Proteome Discoverer (v 1.4.0.288, Thermo Scientific) with the SwissProt Mus musculus database (20140402, 16,671 sequences). We set carbamidomethyle cysteine, oxidation of methionine and N-terminal acetylation as variable modifications. We set specificity of trypsin digestion and allowed 2 missed cleavage sites and we set the mass tolerances in MS and MS/MS to 2 ppm and 0.5 Da, respectively. The resulting Mascot files were further processed by using myProMS (v 3.0) 15 and the estimated false discovery rate (FDR) by automatically filtering the Mascot score of all peptide identifications was less than 0.5%. Results Dataset 1. Quantitative PCR and mass spectrometry data of Otx2 homeoprotein in the mouse visual cortex. qPCR data : This excel file (“brain qpcr otx data”) contains two worksheets. One worksheet has the Ct values for GAPDH, Otx2 and Otx1 obtained from extracts of different brain structures (LGN, Visual Cortex, Superior Colliculus and Cerebellum). Also included are the delta-Ct calculations. The second sheet contains the normalisation calculations and corresponding graph of expression values. Mass spectroscoy data : This Mascot .dat file (“F022130_part.dat”) contains the experiment description and the data pertaining to the 2 peptides that match Otx2 protein. Otx1 locus but not Otx2 locus is active in the mouse visual cortex We compared the expression of the Otx1 and Otx2 loci of various brain regions by performing quantitative PCR ( Figure 1A ). While both mRNA were detected in thalamic and cerebellar structures, only Otx1 mRNA was found in the visual cortex. This result confirms the previously reported absence of GFP expression in the visual cortex of Otx2 +/GFP knockout mice and lack of signal in the visual cortex of wild type mice after Otx2 in situ hybridization, even though Otx2 antibodies label FSPV cells 4 . These cells are enwrapped by a dense extracellular matrix called perineuronal nets (PNNs) when localized to layer IV of the cortex ( Figure 1B ). Otx1 locus is active in layer V 8 . In immunohistochemical analysis of Otx1 knockout mouse, almost all Otx signal is lost in layer V while signal from Otx2 protein continues in PNN-labeled cells ( Figure 1B ). However, we cannot preclude that some Otx1 is also present in layer IV cells in wild type mice. Figure 1. Expression of Otx1 and Otx2 in adult mouse brain. ( A ) Analysis of Otx1 and Otx2 expression by quantitative RT-PCR on extracts from lateral geniculate nucleus (LGN), visual cortex (V Cx), superior colliculus (S Col) and cerebellum (Cb). The fold-difference in expression is calculated relative to Otx1 in LGN. The Otx2 locus is silent in visual cortex. ( B ) Non-cell autonomous Otx2 is found in visual cortex. Immunostaining in wild type mice reveals Otx1/2 cells in layers IV and V of visual cortex, including cells with perineuronal nets (stained by WFA lectin) enriched in layer IV. Staining for Otx2 persists in Otx1 null mice (Otx1 KO). Scale bar, 50 µm. Otx2 protein but not Otx1 protein is found in granular and supragranular layers of visual cortex In order to analyze Otx homeoprotein distribution in the visual cortex, we turned to immunoprecipitation (IP) experiments. We first performed IP on whole visual cortex extracts, which showed both Otx1 and Otx2 protein ( Figure 2A ). This result is confirmed by IP of choroid plexus, which strongly expresses Otx2 but only very weakly expresses Otx1. To analyze granular and supragranular content, we dissected and extracted the superior layers of posterior adult mouse cortex ( Figure 2B ) and performed IP by using cross-linked magnetic beads. Immunoblot analysis detected only Otx2 but not Otx1 protein ( Figure 2C ). This result was confirmed by mass spectrometry analysis on these extracts, which identified 2 Otx2 peptides (6.6% coverage with 100% specificity, Figure 2D ). While this number of peptides is low, it was expected given that Otx2 is predicted to be poorly ionizable. Furthermore, identification has an error of 1 protein in 20,000 (19,999 are true) with a FDR of less than 0.5% for 2 peptides in our database of 16,671 sequences, thus the chance of misinterpretation is very low. These peptides are 100% specific for Otx2 and they have the same ions as the reference spectrum from a sample of purified Otx2 protein. While the second peptide is also specific for Otx1 and Crx homeoproteins, the first peptide is unique for Otx2 ( Figure 2D ). These results confirm that the homeoprotein localized in granular and supragranular FSPV cells is indeed Otx2 and not Otx1. Figure 2. Otx2 protein in the granular and supragranular layers of adult mouse visual cortex. ( A ) Immunoblots for Otx1/2 of immunoprecipitation (IP) experiments on extracts from visual cortex and choroid plexus. ( B ) Diagram of finely dissected region for extracts containing granular (IV) and supragranular (I-III) layers of visual cortex. ( C ) Immunoblot for Otx1/2 of samples from IP using cross-linked magnetic beads and finely dissected extracts. Choroid plexus (Ch Pl) extract was used to control for Otx2 migration velocity. ( D ) The peptides (red, bold) matching Otx2 protein identified by high-resolution mass spectrometry. Only the homeodomain sequence of Otx2 (amino acids 38–97) is shown. The amino acid differing in Otx1 is highlighted in green, while amino acids that differ in Crx are highlighted in green and in yellow. Discussion The non-cell autonomous activity of homeoprotein transcription factors is now well established. There are clear phenotypes with recently developed in vivo single-chain secreted antibodies that neutralize extracellular homeoproteins yet leave intact cell autonomous activities 9 – 11 . Non-autonomy can also be demonstrated by comparing mRNA and protein expression. Indeed, the absence of mRNA in presence of the protein argues in favor of non-cell autonomy. However, when the receiving territory is a short distance from the producing territory, one could invoke the possibility of cell migration or mRNA instability to bring into question the reality of homeoprotein transfer. In the visual system, Otx2 protein is found in the visual cortex far from two potential sources of Otx2 (where the Otx2 locus is active), namely the eye and the choroid plexus 5 , 12 . Indeed, the Otx2 locus is not active in the adult cerebral cortex as verified by using the Otx2 +/GFP mouse, quantitative RT-PCR and in situ hybridization 4 . In addition, conditional Otx2 ablation in the choroid plexus reduces its content in FSPV cells, further supporting non-cell autonomy 5 . However, since most Otx1 and Otx2 antibodies are pan-Otx antibodies, it was still conceivable that some of the protein seen in FSPV cells by immunohistochemistry could correspond to Otx1 expressed in layer V of the cerebral cortex and transferred into PV cells. The present study shows that the staining in layer IV is maintained in the Otx1 knockout mouse and that IP experiments of layers I-IV give immunoblot bands with expected Otx2 size and can be used to identified Otx2 by mass spectrometry. These results confirm that FSPV cells in granular and supragranular layers of the cerebral cortex only contain non-cell autonomous Otx2 and do not contain Otx1. It may seem surprising that Otx1 expressed in layer V is not secreted and internalized by FSPV cells. Indeed the protein presents a homeodomain nearly identical to that of Otx2 and thus contains the two sequences necessary for internalization and secretion (for review see 7 ). However, previous studies have demonstrated that homeoproteins are transported from the basolateral to the apical side of polarized cells and thus into the axon 7 , 13 . Given their polarity and orientation, the pyramidal cells of layer V that express Otx1 are thus very unlikely to release it at the level of FSPV cells. In contrast, the choroid plexus epithelial cells present their apical surface toward the ventricles allowing Otx2 secretion into the cerebral spinal fluid. In conclusion, this study demonstrates that Otx2 is the only non-cell autonomous Otx family protein in the granular and supragranular FSPV cells. Data availability F1000Research : Dataset 1. Quantitative PCR and mass spectrometry data of Otx2 homeoprotein in the mouse visual cortex, 10.5256/f1000research.4869.d33384 16 Author contributions NK and AAD carried out experimental work DA and AS made Otx1 knockout mice DF carried out the mass spectroscopy experimental work LD supervised mass spectroscopy and proteomic data analysis AP and AAD conceived the ideas of the study, designed protocols, and drafted the manuscript All authors read, critically revised, and approved the final manuscript Competing interests No competing interests were disclosed. Grant information This work was supported by the Région Ile-de-France, the FRM, GRL Program n°2009-00424, ANR grant BRAINEVER n° 11-BLAN-069467, and ERC Advanced Grant HOMEOSIGN n°339379. Faculty Opinions recommended References 1. Hensch TK: Critical period plasticity in local cortical circuits. Nat Rev Neurosci. 2005; 6 (11): 877–88. PubMed Abstract | Publisher Full Text 2. Morishita H, Hensch TK: Critical period revisited: impact on vision. Curr Opin Neurobiol. 2008; 18 (1): 101–7. PubMed Abstract | Publisher Full Text 3. Hensch TK, Fagiolini M: Excitatory-inhibitory balance and critical period plasticity in developing visual cortex. Prog Brain Res. 2005; 147 : 115–24. PubMed Abstract | Publisher Full Text 4. Sugiyama S, Di Nardo AA, Aizawa S, et al. : Experience-dependent transfer of Otx2 homeoprotein into the visual cortex activates postnatal plasticity. Cell. 2008; 134 (3): 508–20. PubMed Abstract | Publisher Full Text 5. Spatazza J, Lee HHC, Di Nardo AA, et al. : Choroid-plexus-derived Otx2 homeoprotein constrains adult cortical plasticity. Cell Rep. 2013; 3 (6): 1815–23. PubMed Abstract | Publisher Full Text 6. Beurdeley M, Spatazza J, Lee HHC, et al. : Otx2 binding to perineuronal nets persistently regulates plasticity in the mature visual cortex. J Neurosci. 2012; 32 (27): 9429–37. PubMed Abstract | Publisher Full Text | Free Full Text 7. Spatazza J, Di Lullo E, Joliot A, et al. : Homeoprotein signaling in development, health, and disease: a shaking of dogmas offers challenges and promises from bench to bed. Pharmacol Rev. 2013; 65 (1): 90–104. PubMed Abstract | Publisher Full Text 8. Frantz GD, Weimann JM, Levin ME, et al. : Otx1 and Otx2 define layers and regions in developing cerebral cortex and cerebellum. J Neurosci. 1994; 14 (10): 5725–40. PubMed Abstract 9. Lesaffre B, Joliot A, Prochiantz A, et al. : Direct non-cell autonomous Pax6 activity regulates eye development in the zebrafish. Neural Dev. 2007; 2 : 2. PubMed Abstract | Publisher Full Text | Free Full Text 10. Wizenmann A, Brunet I, Lam JSY, et al. : Extracellular Engrailed participates in the topographic guidance of retinal axons in vivo . Neuron. 2009; 64 (3): 355–66. PubMed Abstract | Publisher Full Text 11. Layalle S, Volovitch M, Mugat B, et al. : Engrailed homeoprotein acts as a signaling molecule in the developing fly. Development. 2011; 138 (11): 2315–23. PubMed Abstract | Publisher Full Text 12. Sugiyama S, Prochiantz A, Hensch TK: From brain formation to plasticity: insights on Otx2 homeoprotein. Dev Growth Differ. 2009; 51 (3): 369–77. PubMed Abstract | Publisher Full Text 13. Dupont E, Prochiantz A, Joliot A: Identification of a signal peptide for unconventional secretion. J Biol Chem. 2007; 282 (12): 8994–9000. PubMed Abstract | Publisher Full Text 14. Acampora D, Mazan S, Avantaggiato V, et al. : Epilepsy and brain abnormalities in mice lacking the Otx1 gene. Nat Genet. 1996; 14 (2): 218–22. PubMed Abstract | Publisher Full Text 15. Poullet P, Carpentier S, Barillot E: myProMS, a web server for management and validation of mass spectrometry-based proteomic data. Proteomics. 2007; 7 (15): 2553–6. PubMed Abstract | Publisher Full Text 16. Kim N, Acampora D, Dingli F, et al. : Quantitative PCR and mass spectrometry data of Otx2 homeoprotein in the mouse visual cortex. F1000Research. 2014. Data Source Comments on this article Comments (2) Version 1 VERSION 1 PUBLISHED 30 Jul 2014 Author Response 20 Apr 2015 Ariel Di Nardo , CIRB, CNRS UMR 7241 / INSERM U1050, College de France, 11 place Marcelin Berthelot, 75231 Paris Cedex 05, France 20 Apr 2015 Author Response We thank Pierre Godement for his insightful reading of our article. We are well aware that the rat antibody recognizes both Otx1 and Otx2 (as it was produced in our laboratory ... Continue reading We thank Pierre Godement for his insightful reading of our article. We are well aware that the rat antibody recognizes both Otx1 and Otx2 (as it was produced in our laboratory and kindly provided to Pierre Godement through Marion Wassef). Indeed, the Otx1 knockout mouse contains a truncated form of Otx1. In a previous study to which Pierre Godement makes reference, protein staining with an Otx1-specific antibody is extremely faint and non-nuclear throughout all cortical layers of the homozygous Otx1 knockout mouse ( Weimann et al ., 1999 ). While it is possible that our antibody also recognizes a truncated form of Otx1, Figure 1B clearly shows that staining in layer V (a bona fide site of Otx1 expression) is decreased in the knockout as compared to wild type. Furthermore, we continue to find nuclear staining in other cortical layers, contrary to what was found with the Otx1 antibody. This link contains the raw microscope images and includes an image of the heterozygous Otx1 mouse visual cortex, which shows similar staining to wild type. (Ratio of Otx cells in infragranular versus supragranular layers in these images is 1.43, 1.46, and 1.11 for WT, het, and homozygote mice, respectively.) We have not stained for PV (since it was not necessary in the context of this paper) but have used the WFA lectin (that recognizes the PNNs surrounding PV-cells). Contrary to what Pierre Godement writes, we did not say in Sugiyama et al. (2008) that the Otx2 antibody stains "all parvalbumin positive" cells. Figure 1J and page 3 of the article clearly state that 71.4 +/- 0.5% of Otx2-positive cells are PV-positive and that 78.9 +/- 1.7% of the PV-positive cells are Otx2-positive. One must indeed be cautious with pan-Otx antibodies; genetic evidence for non-cell autonomous cortical Otx2 is paramount. In Sugiyama et al. (2008), in addition to using 6 different Otx2 antibodies, we recombined Otx2 by crossing Otx2 floxed mouse with a CamKII-Cre mouse and lost Otx2 staining in PV-cells. Because CamKII is not expressed in PV-cells, this demonstrated the non-cell autonomous accumulation of Otx2. In addition, we have identified the choroid plexus as a source of Otx2. Recombining the Otx2 locus specifically in this structure reduced the amount of Otx2 in cortical PV-cells and reopened plasticity in the adult ( Spatazza et al. , 2013 ). It is correct that immunoprecipitation (IP) gels show Otx2 with an apparent MW just under 40 kD. This is where Otx2 runs under our conditions (NuPAGE 4%-12%, MES buffer). This link contains the full western blots corresponding to Figures 2A and 2C. Along with the IPs from visual cortex and choroid plexus, the full blot corresponding to Figure 2A includes an extract from retina (a primary structure strongly expressing Otx2). The velocity for Otx2 is identical for all 3 structures. MW markers and samples from an IP with another pan-Otx antibody (Millipore AB9566) are also included. No in situ studies have shown Otx1 mRNA expression above layer V in the cortex, but the presence of Otx1 protein due to transfer between the layers is a possibility. Our mass spectroscopy analysis of supgranular layer IPs found two peptides corresponding to Otx1 and Otx2, but also one peptide unique for Otx2 (Dataset 1 and Figure 2D). In Figure 2C (supragranular layers), we only find one band migrating with the Otx2 velocity and recognized by Otx antibodies (IP and western blot). It is based on this result that we conclude there is no Otx1 in these layers. The questions of Otx2 amount, location and provenance are not within the scope of this article. Finally, Pierre Godement raises two additional points. First is that he has made plasticity-related observations concerning axon guidance based on the regulation of extracellular matrix protein expression by Otx2 ( Nguyen Ba-Charvet et al ., 1998 ). We agree with this potential impact on cortical plasticity and indeed cited this work in Sugiyama et al. (2008) . Second, Pierre Godement proposes that it is Otx1 that regulates the termination of the critical period and not Otx2. We do not exclude that Otx1 and many other proteins participate in critical period regulation but we maintain that Otx2 is a primary factor in the regulation of postnatal and adult cortical plasticity. Whether Otx1 is involved still awaits demonstration. In conclusion, we sincerely thank Pierre Godement for giving us the opportunity to discuss some points that may not have been explained with enough clarity. We thank Pierre Godement for his insightful reading of our article. We are well aware that the rat antibody recognizes both Otx1 and Otx2 (as it was produced in our laboratory and kindly provided to Pierre Godement through Marion Wassef). Indeed, the Otx1 knockout mouse contains a truncated form of Otx1. In a previous study to which Pierre Godement makes reference, protein staining with an Otx1-specific antibody is extremely faint and non-nuclear throughout all cortical layers of the homozygous Otx1 knockout mouse ( Weimann et al ., 1999 ). While it is possible that our antibody also recognizes a truncated form of Otx1, Figure 1B clearly shows that staining in layer V (a bona fide site of Otx1 expression) is decreased in the knockout as compared to wild type. Furthermore, we continue to find nuclear staining in other cortical layers, contrary to what was found with the Otx1 antibody. This link contains the raw microscope images and includes an image of the heterozygous Otx1 mouse visual cortex, which shows similar staining to wild type. (Ratio of Otx cells in infragranular versus supragranular layers in these images is 1.43, 1.46, and 1.11 for WT, het, and homozygote mice, respectively.) We have not stained for PV (since it was not necessary in the context of this paper) but have used the WFA lectin (that recognizes the PNNs surrounding PV-cells). Contrary to what Pierre Godement writes, we did not say in Sugiyama et al. (2008) that the Otx2 antibody stains "all parvalbumin positive" cells. Figure 1J and page 3 of the article clearly state that 71.4 +/- 0.5% of Otx2-positive cells are PV-positive and that 78.9 +/- 1.7% of the PV-positive cells are Otx2-positive. One must indeed be cautious with pan-Otx antibodies; genetic evidence for non-cell autonomous cortical Otx2 is paramount. In Sugiyama et al. (2008), in addition to using 6 different Otx2 antibodies, we recombined Otx2 by crossing Otx2 floxed mouse with a CamKII-Cre mouse and lost Otx2 staining in PV-cells. Because CamKII is not expressed in PV-cells, this demonstrated the non-cell autonomous accumulation of Otx2. In addition, we have identified the choroid plexus as a source of Otx2. Recombining the Otx2 locus specifically in this structure reduced the amount of Otx2 in cortical PV-cells and reopened plasticity in the adult ( Spatazza et al. , 2013 ). It is correct that immunoprecipitation (IP) gels show Otx2 with an apparent MW just under 40 kD. This is where Otx2 runs under our conditions (NuPAGE 4%-12%, MES buffer). This link contains the full western blots corresponding to Figures 2A and 2C. Along with the IPs from visual cortex and choroid plexus, the full blot corresponding to Figure 2A includes an extract from retina (a primary structure strongly expressing Otx2). The velocity for Otx2 is identical for all 3 structures. MW markers and samples from an IP with another pan-Otx antibody (Millipore AB9566) are also included. No in situ studies have shown Otx1 mRNA expression above layer V in the cortex, but the presence of Otx1 protein due to transfer between the layers is a possibility. Our mass spectroscopy analysis of supgranular layer IPs found two peptides corresponding to Otx1 and Otx2, but also one peptide unique for Otx2 (Dataset 1 and Figure 2D). In Figure 2C (supragranular layers), we only find one band migrating with the Otx2 velocity and recognized by Otx antibodies (IP and western blot). It is based on this result that we conclude there is no Otx1 in these layers. The questions of Otx2 amount, location and provenance are not within the scope of this article. Finally, Pierre Godement raises two additional points. First is that he has made plasticity-related observations concerning axon guidance based on the regulation of extracellular matrix protein expression by Otx2 ( Nguyen Ba-Charvet et al ., 1998 ). We agree with this potential impact on cortical plasticity and indeed cited this work in Sugiyama et al. (2008) . Second, Pierre Godement proposes that it is Otx1 that regulates the termination of the critical period and not Otx2. We do not exclude that Otx1 and many other proteins participate in critical period regulation but we maintain that Otx2 is a primary factor in the regulation of postnatal and adult cortical plasticity. Whether Otx1 is involved still awaits demonstration. In conclusion, we sincerely thank Pierre Godement for giving us the opportunity to discuss some points that may not have been explained with enough clarity. Competing Interests: No competing interests were disclosed. Close Report a concern Reader Comment 16 Apr 2015 Pierre Godement , IGFL, Ecole Normale Supérieure de Lyon, UMR5242 CNRS, France 16 Apr 2015 Reader Comment The data reported here could lead to alternative conclusions in accordance to previous studies. In the Otx1 knockout mice used here ( Acampora et al ., 1996 ) it has been shown that a ... Continue reading The data reported here could lead to alternative conclusions in accordance to previous studies. In the Otx1 knockout mice used here ( Acampora et al ., 1996 ) it has been shown that a truncated OTX1 RNA and protein are expressed throughout all layers in the cerebral cortex ( Weimann et al. , 1999 ). The positive nuclei in the KO in Figure 1B could correspond to this residual OTX1 protein rather than to OTX2, which cannot be distinguished one from another using the antibody. I also find – but maybe I am in error – that the magnifications (or is it the contrast?) of the left (WT) and the right (KO) panels in Figure 1B appear different (higher mag on the right side) therefore I think the authors could make available raw pictures, which would also provide more detail. One would also like to know if in the KO cells labeled with the OTX2 antibody are all parvalbumin positive as claimed previously ( Sugiyama et al. , 2008 ) - from the picture this seems unlikely and this does not support the conclusions. As for the specificity problem the authors know from already published studies ( Fossat et al. , 2007 ) as well as from my own unpublished findings that the rat anti-OTX2 antibody used here labels OTX1 as well as OTX2 and it is too bad that this was not addressed in the original publication from this group ( Sugiyama et al. , 2008 ) and specificity checks did not include western blots against the 3 proteins of the OTX family. This would have stimulated the critical sense of the general reader. But neither can they be found in the present one. In the original publication which stimulated these studies ( Nothias et al ., 1998 ) it was already evident in my view that the “OTX2” labeling described in the cortex of juvenile mice was in fact OTX1 protein, visible in some large layer 5 pyramidal cells. Another specific comment I have is from Figure 2A immunoprecipitated OTX2 appears to run at least at 39 kd (this is a 4-10% acrylamide gel) which is very odd – OTX2 runs as a doublet at 32-35 kd and OTX1 runs at 42-44 kd (see for instance Acampora et al. , 1998 ; Fossat et al. , 2007 ). In both this figure and Figure 2C the protein ladder is missing. There also seem to exist some uncertainties as concerns specificity for the Abcam anti-OTX2 antibody (ab21990) used in the IPs as judged from the many users’ questions on the manufacturer‘s website. The fact remains that so far in situ studies have not detected mRNA for OTX1 above layer 5 in cortex, where OTX immunopositivity is detected – though they did not exclude it ( Frantz et al. , 1994 ). But I think it is dangerous to make strong conclusions from negative results especially as concerns in situ studies in adult brain – such labeling might be hard to conclusively demonstrate and OTX mRNAs and proteins are known to be expressed at very variable levels, sometimes quite low. Nevertheless, the spectrometry data appear to show that some OTX2 protein can be found in cortex. But this would not give a clue as to the amount, location of the protein nor its provenance. I would like to suggest that it is OTX1 protein, endogenously expressed in several neuronal populations throughout cortex, and which has extensive functional homology to OTX2 ( Acampora et al. , 1999 ) which is involved in the phenomena – plasticity, regulation in particular termination of the critical period – which were attributed to transported OTX2. Several years ago we suggested that OTX2 might be involved in restricting axon growth in the embryonic forebrain inside narrow conduits which are bordered by areas with high proteoglycan expression (as is also a particularity of perineuronal nets around parvalbumin-positive, fast-spiking cortical neurons) ( Nguyen Ba-Charvet et al. , 1998 ). Conceptually but also mechanistically one might find parallels in both phenomena (a restriction in growth, and plasticity) – finding transcriptional targets of the OTX proteins shared by these two phenomena is now a subject for future studies. The data reported here could lead to alternative conclusions in accordance to previous studies. In the Otx1 knockout mice used here ( Acampora et al ., 1996 ) it has been shown that a truncated OTX1 RNA and protein are expressed throughout all layers in the cerebral cortex ( Weimann et al. , 1999 ). The positive nuclei in the KO in Figure 1B could correspond to this residual OTX1 protein rather than to OTX2, which cannot be distinguished one from another using the antibody. I also find – but maybe I am in error – that the magnifications (or is it the contrast?) of the left (WT) and the right (KO) panels in Figure 1B appear different (higher mag on the right side) therefore I think the authors could make available raw pictures, which would also provide more detail. One would also like to know if in the KO cells labeled with the OTX2 antibody are all parvalbumin positive as claimed previously ( Sugiyama et al. , 2008 ) - from the picture this seems unlikely and this does not support the conclusions. As for the specificity problem the authors know from already published studies ( Fossat et al. , 2007 ) as well as from my own unpublished findings that the rat anti-OTX2 antibody used here labels OTX1 as well as OTX2 and it is too bad that this was not addressed in the original publication from this group ( Sugiyama et al. , 2008 ) and specificity checks did not include western blots against the 3 proteins of the OTX family. This would have stimulated the critical sense of the general reader. But neither can they be found in the present one. In the original publication which stimulated these studies ( Nothias et al ., 1998 ) it was already evident in my view that the “OTX2” labeling described in the cortex of juvenile mice was in fact OTX1 protein, visible in some large layer 5 pyramidal cells. Another specific comment I have is from Figure 2A immunoprecipitated OTX2 appears to run at least at 39 kd (this is a 4-10% acrylamide gel) which is very odd – OTX2 runs as a doublet at 32-35 kd and OTX1 runs at 42-44 kd (see for instance Acampora et al. , 1998 ; Fossat et al. , 2007 ). In both this figure and Figure 2C the protein ladder is missing. There also seem to exist some uncertainties as concerns specificity for the Abcam anti-OTX2 antibody (ab21990) used in the IPs as judged from the many users’ questions on the manufacturer‘s website. The fact remains that so far in situ studies have not detected mRNA for OTX1 above layer 5 in cortex, where OTX immunopositivity is detected – though they did not exclude it ( Frantz et al. , 1994 ). But I think it is dangerous to make strong conclusions from negative results especially as concerns in situ studies in adult brain – such labeling might be hard to conclusively demonstrate and OTX mRNAs and proteins are known to be expressed at very variable levels, sometimes quite low. Nevertheless, the spectrometry data appear to show that some OTX2 protein can be found in cortex. But this would not give a clue as to the amount, location of the protein nor its provenance. I would like to suggest that it is OTX1 protein, endogenously expressed in several neuronal populations throughout cortex, and which has extensive functional homology to OTX2 ( Acampora et al. , 1999 ) which is involved in the phenomena – plasticity, regulation in particular termination of the critical period – which were attributed to transported OTX2. Several years ago we suggested that OTX2 might be involved in restricting axon growth in the embryonic forebrain inside narrow conduits which are bordered by areas with high proteoglycan expression (as is also a particularity of perineuronal nets around parvalbumin-positive, fast-spiking cortical neurons) ( Nguyen Ba-Charvet et al. , 1998 ). Conceptually but also mechanistically one might find parallels in both phenomena (a restriction in growth, and plasticity) – finding transcriptional targets of the OTX proteins shared by these two phenomena is now a subject for future studies. Competing Interests: No competing interests were disclosed. Close Report a concern Comment ADD YOUR COMMENT Author details Author details 1 CIRB, CNRS UMR 7241 / INSERM U1050, College de France, 11 place Marcelin Berthelot, 75231 Paris Cedex 05, France 2 Institute of Genetics and Biophysics, Via Pietro Castellino 111, 80131 Napoli, Italy 3 IRCCS Neuromed, 86077 Pozzilli (IS), Italy 4 Institut Curie, Centre de Recherche, Laboratoire de Spectrométrie de Masse Protéomique, 75248 Paris Cedex 05, France Competing interests No competing interests were disclosed. Grant information This work was supported by the Région Ile-de-France, the FRM, GRL Program n°2009-00424, ANR grant BRAINEVER n° 11-BLAN-069467, and ERC Advanced Grant HOMEOSIGN n°339379. Article Versions (1) version 1 Published: 30 Jul 2014, 3:178 https://doi.org/10.12688/f1000research.4869.1 Copyright © 2014 Kim N et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Kim N, Acampora D, Dingli F et al. Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.12688/f1000research.4869.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 30 Jul 2014 Views 0 Cite How to cite this report: Bovolenta P. Reviewer Report For: Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.5256/f1000research.5197.r5636 ) The direct URL for this report is: https://f1000research.com/articles/3-178/v1#referee-response-5636 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 08 Aug 2014 Paola Bovolenta , Centro de Biología Molecular Severo Ochoa, CSIC-UAM, Universidad Autonoma de Madrid, Madrid, Spain Approved VIEWS 0 https://doi.org/10.5256/f1000research.5197.r5636 Studies, mostly from A. Prochiantz’s laboratory, have demonstrated that the transcription factor (TF) Otx2, produced by external sources such as the choroid plexus, is internalized into parvalbumin neurons of layers II/III and IV of the visual cortex, thereby controlling its ... Continue reading READ ALL Studies, mostly from A. Prochiantz’s laboratory, have demonstrated that the transcription factor (TF) Otx2, produced by external sources such as the choroid plexus, is internalized into parvalbumin neurons of layers II/III and IV of the visual cortex, thereby controlling its plasticity. So far these studies had not ruled out the possibility that part of this effect could be mediated by Otx1, a closely related TF, which may act redundantly with Otx2. In this study, the authors combined the use of Otx1 -/- mice with immunoprecipitation from layers I-IV extracts and high-resolution mass spectrometry analysis to demonstrate the sole presence of Otx2 peptides in these layers. The study thus demonstrates that Otx2 is the only non-cell autonomous Otx family member functional in fast-spiking parvalbumin cells of layers I-IV of the visual cortex. This is a clear and well-executed study that solves an existing concern. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Bovolenta P. Reviewer Report For: Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.5256/f1000research.5197.r5636 ) The direct URL for this report is: https://f1000research.com/articles/3-178/v1#referee-response-5636 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Gage F. Reviewer Report For: Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.5256/f1000research.5197.r5640 ) The direct URL for this report is: https://f1000research.com/articles/3-178/v1#referee-response-5640 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 04 Aug 2014 Fred Gage , Laboratory of Genetics, Salk Institute for Biological Studies, La Jolla, CA, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.5197.r5640 The authors address an issue that is unresolved in the literature. Is the Otx found in the cortex, and responsible in part of cortical plasticity, cortical derived Otx1 or choroid plexus derived Otx2? The problem exists because the antibodies used ... Continue reading READ ALL The authors address an issue that is unresolved in the literature. Is the Otx found in the cortex, and responsible in part of cortical plasticity, cortical derived Otx1 or choroid plexus derived Otx2? The problem exists because the antibodies used previously can not distinguish between the two. In the present study using Otx1 KO mice and a variety of measures, the authors prove Otx2 is the protein in the cortical cells and that this therefore is a cell non- autonomous phenomenon. The one question I have relates to figure 1B, which suggests there is greater Otx2 staining in the Otx1 KO mouse cortex. If this is a reliable observation the authors should comment. The low peptide coverage in the MASS SPEC could be a concern but the authors address that and in addition the other supporting data decrease the concern. This is a clear, straightforward manuscript that adds important and definitive information to the existing literature Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Gage F. Reviewer Report For: Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.5256/f1000research.5197.r5640 ) The direct URL for this report is: https://f1000research.com/articles/3-178/v1#referee-response-5640 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (2) Version 1 VERSION 1 PUBLISHED 30 Jul 2014 Author Response 20 Apr 2015 Ariel Di Nardo , CIRB, CNRS UMR 7241 / INSERM U1050, College de France, 11 place Marcelin Berthelot, 75231 Paris Cedex 05, France 20 Apr 2015 Author Response We thank Pierre Godement for his insightful reading of our article. We are well aware that the rat antibody recognizes both Otx1 and Otx2 (as it was produced in our laboratory ... Continue reading We thank Pierre Godement for his insightful reading of our article. We are well aware that the rat antibody recognizes both Otx1 and Otx2 (as it was produced in our laboratory and kindly provided to Pierre Godement through Marion Wassef). Indeed, the Otx1 knockout mouse contains a truncated form of Otx1. In a previous study to which Pierre Godement makes reference, protein staining with an Otx1-specific antibody is extremely faint and non-nuclear throughout all cortical layers of the homozygous Otx1 knockout mouse ( Weimann et al ., 1999 ). While it is possible that our antibody also recognizes a truncated form of Otx1, Figure 1B clearly shows that staining in layer V (a bona fide site of Otx1 expression) is decreased in the knockout as compared to wild type. Furthermore, we continue to find nuclear staining in other cortical layers, contrary to what was found with the Otx1 antibody. This link contains the raw microscope images and includes an image of the heterozygous Otx1 mouse visual cortex, which shows similar staining to wild type. (Ratio of Otx cells in infragranular versus supragranular layers in these images is 1.43, 1.46, and 1.11 for WT, het, and homozygote mice, respectively.) We have not stained for PV (since it was not necessary in the context of this paper) but have used the WFA lectin (that recognizes the PNNs surrounding PV-cells). Contrary to what Pierre Godement writes, we did not say in Sugiyama et al. (2008) that the Otx2 antibody stains "all parvalbumin positive" cells. Figure 1J and page 3 of the article clearly state that 71.4 +/- 0.5% of Otx2-positive cells are PV-positive and that 78.9 +/- 1.7% of the PV-positive cells are Otx2-positive. One must indeed be cautious with pan-Otx antibodies; genetic evidence for non-cell autonomous cortical Otx2 is paramount. In Sugiyama et al. (2008), in addition to using 6 different Otx2 antibodies, we recombined Otx2 by crossing Otx2 floxed mouse with a CamKII-Cre mouse and lost Otx2 staining in PV-cells. Because CamKII is not expressed in PV-cells, this demonstrated the non-cell autonomous accumulation of Otx2. In addition, we have identified the choroid plexus as a source of Otx2. Recombining the Otx2 locus specifically in this structure reduced the amount of Otx2 in cortical PV-cells and reopened plasticity in the adult ( Spatazza et al. , 2013 ). It is correct that immunoprecipitation (IP) gels show Otx2 with an apparent MW just under 40 kD. This is where Otx2 runs under our conditions (NuPAGE 4%-12%, MES buffer). This link contains the full western blots corresponding to Figures 2A and 2C. Along with the IPs from visual cortex and choroid plexus, the full blot corresponding to Figure 2A includes an extract from retina (a primary structure strongly expressing Otx2). The velocity for Otx2 is identical for all 3 structures. MW markers and samples from an IP with another pan-Otx antibody (Millipore AB9566) are also included. No in situ studies have shown Otx1 mRNA expression above layer V in the cortex, but the presence of Otx1 protein due to transfer between the layers is a possibility. Our mass spectroscopy analysis of supgranular layer IPs found two peptides corresponding to Otx1 and Otx2, but also one peptide unique for Otx2 (Dataset 1 and Figure 2D). In Figure 2C (supragranular layers), we only find one band migrating with the Otx2 velocity and recognized by Otx antibodies (IP and western blot). It is based on this result that we conclude there is no Otx1 in these layers. The questions of Otx2 amount, location and provenance are not within the scope of this article. Finally, Pierre Godement raises two additional points. First is that he has made plasticity-related observations concerning axon guidance based on the regulation of extracellular matrix protein expression by Otx2 ( Nguyen Ba-Charvet et al ., 1998 ). We agree with this potential impact on cortical plasticity and indeed cited this work in Sugiyama et al. (2008) . Second, Pierre Godement proposes that it is Otx1 that regulates the termination of the critical period and not Otx2. We do not exclude that Otx1 and many other proteins participate in critical period regulation but we maintain that Otx2 is a primary factor in the regulation of postnatal and adult cortical plasticity. Whether Otx1 is involved still awaits demonstration. In conclusion, we sincerely thank Pierre Godement for giving us the opportunity to discuss some points that may not have been explained with enough clarity. We thank Pierre Godement for his insightful reading of our article. We are well aware that the rat antibody recognizes both Otx1 and Otx2 (as it was produced in our laboratory and kindly provided to Pierre Godement through Marion Wassef). Indeed, the Otx1 knockout mouse contains a truncated form of Otx1. In a previous study to which Pierre Godement makes reference, protein staining with an Otx1-specific antibody is extremely faint and non-nuclear throughout all cortical layers of the homozygous Otx1 knockout mouse ( Weimann et al ., 1999 ). While it is possible that our antibody also recognizes a truncated form of Otx1, Figure 1B clearly shows that staining in layer V (a bona fide site of Otx1 expression) is decreased in the knockout as compared to wild type. Furthermore, we continue to find nuclear staining in other cortical layers, contrary to what was found with the Otx1 antibody. This link contains the raw microscope images and includes an image of the heterozygous Otx1 mouse visual cortex, which shows similar staining to wild type. (Ratio of Otx cells in infragranular versus supragranular layers in these images is 1.43, 1.46, and 1.11 for WT, het, and homozygote mice, respectively.) We have not stained for PV (since it was not necessary in the context of this paper) but have used the WFA lectin (that recognizes the PNNs surrounding PV-cells). Contrary to what Pierre Godement writes, we did not say in Sugiyama et al. (2008) that the Otx2 antibody stains "all parvalbumin positive" cells. Figure 1J and page 3 of the article clearly state that 71.4 +/- 0.5% of Otx2-positive cells are PV-positive and that 78.9 +/- 1.7% of the PV-positive cells are Otx2-positive. One must indeed be cautious with pan-Otx antibodies; genetic evidence for non-cell autonomous cortical Otx2 is paramount. In Sugiyama et al. (2008), in addition to using 6 different Otx2 antibodies, we recombined Otx2 by crossing Otx2 floxed mouse with a CamKII-Cre mouse and lost Otx2 staining in PV-cells. Because CamKII is not expressed in PV-cells, this demonstrated the non-cell autonomous accumulation of Otx2. In addition, we have identified the choroid plexus as a source of Otx2. Recombining the Otx2 locus specifically in this structure reduced the amount of Otx2 in cortical PV-cells and reopened plasticity in the adult ( Spatazza et al. , 2013 ). It is correct that immunoprecipitation (IP) gels show Otx2 with an apparent MW just under 40 kD. This is where Otx2 runs under our conditions (NuPAGE 4%-12%, MES buffer). This link contains the full western blots corresponding to Figures 2A and 2C. Along with the IPs from visual cortex and choroid plexus, the full blot corresponding to Figure 2A includes an extract from retina (a primary structure strongly expressing Otx2). The velocity for Otx2 is identical for all 3 structures. MW markers and samples from an IP with another pan-Otx antibody (Millipore AB9566) are also included. No in situ studies have shown Otx1 mRNA expression above layer V in the cortex, but the presence of Otx1 protein due to transfer between the layers is a possibility. Our mass spectroscopy analysis of supgranular layer IPs found two peptides corresponding to Otx1 and Otx2, but also one peptide unique for Otx2 (Dataset 1 and Figure 2D). In Figure 2C (supragranular layers), we only find one band migrating with the Otx2 velocity and recognized by Otx antibodies (IP and western blot). It is based on this result that we conclude there is no Otx1 in these layers. The questions of Otx2 amount, location and provenance are not within the scope of this article. Finally, Pierre Godement raises two additional points. First is that he has made plasticity-related observations concerning axon guidance based on the regulation of extracellular matrix protein expression by Otx2 ( Nguyen Ba-Charvet et al ., 1998 ). We agree with this potential impact on cortical plasticity and indeed cited this work in Sugiyama et al. (2008) . Second, Pierre Godement proposes that it is Otx1 that regulates the termination of the critical period and not Otx2. We do not exclude that Otx1 and many other proteins participate in critical period regulation but we maintain that Otx2 is a primary factor in the regulation of postnatal and adult cortical plasticity. Whether Otx1 is involved still awaits demonstration. In conclusion, we sincerely thank Pierre Godement for giving us the opportunity to discuss some points that may not have been explained with enough clarity. Competing Interests: No competing interests were disclosed. Close Report a concern Reader Comment 16 Apr 2015 Pierre Godement , IGFL, Ecole Normale Supérieure de Lyon, UMR5242 CNRS, France 16 Apr 2015 Reader Comment The data reported here could lead to alternative conclusions in accordance to previous studies. In the Otx1 knockout mice used here ( Acampora et al ., 1996 ) it has been shown that a ... Continue reading The data reported here could lead to alternative conclusions in accordance to previous studies. In the Otx1 knockout mice used here ( Acampora et al ., 1996 ) it has been shown that a truncated OTX1 RNA and protein are expressed throughout all layers in the cerebral cortex ( Weimann et al. , 1999 ). The positive nuclei in the KO in Figure 1B could correspond to this residual OTX1 protein rather than to OTX2, which cannot be distinguished one from another using the antibody. I also find – but maybe I am in error – that the magnifications (or is it the contrast?) of the left (WT) and the right (KO) panels in Figure 1B appear different (higher mag on the right side) therefore I think the authors could make available raw pictures, which would also provide more detail. One would also like to know if in the KO cells labeled with the OTX2 antibody are all parvalbumin positive as claimed previously ( Sugiyama et al. , 2008 ) - from the picture this seems unlikely and this does not support the conclusions. As for the specificity problem the authors know from already published studies ( Fossat et al. , 2007 ) as well as from my own unpublished findings that the rat anti-OTX2 antibody used here labels OTX1 as well as OTX2 and it is too bad that this was not addressed in the original publication from this group ( Sugiyama et al. , 2008 ) and specificity checks did not include western blots against the 3 proteins of the OTX family. This would have stimulated the critical sense of the general reader. But neither can they be found in the present one. In the original publication which stimulated these studies ( Nothias et al ., 1998 ) it was already evident in my view that the “OTX2” labeling described in the cortex of juvenile mice was in fact OTX1 protein, visible in some large layer 5 pyramidal cells. Another specific comment I have is from Figure 2A immunoprecipitated OTX2 appears to run at least at 39 kd (this is a 4-10% acrylamide gel) which is very odd – OTX2 runs as a doublet at 32-35 kd and OTX1 runs at 42-44 kd (see for instance Acampora et al. , 1998 ; Fossat et al. , 2007 ). In both this figure and Figure 2C the protein ladder is missing. There also seem to exist some uncertainties as concerns specificity for the Abcam anti-OTX2 antibody (ab21990) used in the IPs as judged from the many users’ questions on the manufacturer‘s website. The fact remains that so far in situ studies have not detected mRNA for OTX1 above layer 5 in cortex, where OTX immunopositivity is detected – though they did not exclude it ( Frantz et al. , 1994 ). But I think it is dangerous to make strong conclusions from negative results especially as concerns in situ studies in adult brain – such labeling might be hard to conclusively demonstrate and OTX mRNAs and proteins are known to be expressed at very variable levels, sometimes quite low. Nevertheless, the spectrometry data appear to show that some OTX2 protein can be found in cortex. But this would not give a clue as to the amount, location of the protein nor its provenance. I would like to suggest that it is OTX1 protein, endogenously expressed in several neuronal populations throughout cortex, and which has extensive functional homology to OTX2 ( Acampora et al. , 1999 ) which is involved in the phenomena – plasticity, regulation in particular termination of the critical period – which were attributed to transported OTX2. Several years ago we suggested that OTX2 might be involved in restricting axon growth in the embryonic forebrain inside narrow conduits which are bordered by areas with high proteoglycan expression (as is also a particularity of perineuronal nets around parvalbumin-positive, fast-spiking cortical neurons) ( Nguyen Ba-Charvet et al. , 1998 ). Conceptually but also mechanistically one might find parallels in both phenomena (a restriction in growth, and plasticity) – finding transcriptional targets of the OTX proteins shared by these two phenomena is now a subject for future studies. The data reported here could lead to alternative conclusions in accordance to previous studies. In the Otx1 knockout mice used here ( Acampora et al ., 1996 ) it has been shown that a truncated OTX1 RNA and protein are expressed throughout all layers in the cerebral cortex ( Weimann et al. , 1999 ). The positive nuclei in the KO in Figure 1B could correspond to this residual OTX1 protein rather than to OTX2, which cannot be distinguished one from another using the antibody. I also find – but maybe I am in error – that the magnifications (or is it the contrast?) of the left (WT) and the right (KO) panels in Figure 1B appear different (higher mag on the right side) therefore I think the authors could make available raw pictures, which would also provide more detail. One would also like to know if in the KO cells labeled with the OTX2 antibody are all parvalbumin positive as claimed previously ( Sugiyama et al. , 2008 ) - from the picture this seems unlikely and this does not support the conclusions. As for the specificity problem the authors know from already published studies ( Fossat et al. , 2007 ) as well as from my own unpublished findings that the rat anti-OTX2 antibody used here labels OTX1 as well as OTX2 and it is too bad that this was not addressed in the original publication from this group ( Sugiyama et al. , 2008 ) and specificity checks did not include western blots against the 3 proteins of the OTX family. This would have stimulated the critical sense of the general reader. But neither can they be found in the present one. In the original publication which stimulated these studies ( Nothias et al ., 1998 ) it was already evident in my view that the “OTX2” labeling described in the cortex of juvenile mice was in fact OTX1 protein, visible in some large layer 5 pyramidal cells. Another specific comment I have is from Figure 2A immunoprecipitated OTX2 appears to run at least at 39 kd (this is a 4-10% acrylamide gel) which is very odd – OTX2 runs as a doublet at 32-35 kd and OTX1 runs at 42-44 kd (see for instance Acampora et al. , 1998 ; Fossat et al. , 2007 ). In both this figure and Figure 2C the protein ladder is missing. There also seem to exist some uncertainties as concerns specificity for the Abcam anti-OTX2 antibody (ab21990) used in the IPs as judged from the many users’ questions on the manufacturer‘s website. The fact remains that so far in situ studies have not detected mRNA for OTX1 above layer 5 in cortex, where OTX immunopositivity is detected – though they did not exclude it ( Frantz et al. , 1994 ). But I think it is dangerous to make strong conclusions from negative results especially as concerns in situ studies in adult brain – such labeling might be hard to conclusively demonstrate and OTX mRNAs and proteins are known to be expressed at very variable levels, sometimes quite low. Nevertheless, the spectrometry data appear to show that some OTX2 protein can be found in cortex. But this would not give a clue as to the amount, location of the protein nor its provenance. I would like to suggest that it is OTX1 protein, endogenously expressed in several neuronal populations throughout cortex, and which has extensive functional homology to OTX2 ( Acampora et al. , 1999 ) which is involved in the phenomena – plasticity, regulation in particular termination of the critical period – which were attributed to transported OTX2. Several years ago we suggested that OTX2 might be involved in restricting axon growth in the embryonic forebrain inside narrow conduits which are bordered by areas with high proteoglycan expression (as is also a particularity of perineuronal nets around parvalbumin-positive, fast-spiking cortical neurons) ( Nguyen Ba-Charvet et al. , 1998 ). Conceptually but also mechanistically one might find parallels in both phenomena (a restriction in growth, and plasticity) – finding transcriptional targets of the OTX proteins shared by these two phenomena is now a subject for future studies. Competing Interests: No competing interests were disclosed. Close Report a concern Comment ADD YOUR COMMENT keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 1 30 Jul 14 read read Fred Gage , Salk Institute for Biological Studies, La Jolla, CA, USA Paola Bovolenta , Universidad Autonoma de Madrid, Madrid, Spain Comments on this article All Comments (2) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2014 Bovolenta P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 08 Aug 2014 | for Version 1 Paola Bovolenta , Centro de Biología Molecular Severo Ochoa, CSIC-UAM, Universidad Autonoma de Madrid, Madrid, Spain 0 Views copyright © 2014 Bovolenta P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Studies, mostly from A. Prochiantz’s laboratory, have demonstrated that the transcription factor (TF) Otx2, produced by external sources such as the choroid plexus, is internalized into parvalbumin neurons of layers II/III and IV of the visual cortex, thereby controlling its plasticity. So far these studies had not ruled out the possibility that part of this effect could be mediated by Otx1, a closely related TF, which may act redundantly with Otx2. In this study, the authors combined the use of Otx1 -/- mice with immunoprecipitation from layers I-IV extracts and high-resolution mass spectrometry analysis to demonstrate the sole presence of Otx2 peptides in these layers. The study thus demonstrates that Otx2 is the only non-cell autonomous Otx family member functional in fast-spiking parvalbumin cells of layers I-IV of the visual cortex. This is a clear and well-executed study that solves an existing concern. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Bovolenta P. Peer Review Report For: Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.5256/f1000research.5197.r5636) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-178/v1#referee-response-5636 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2014 Gage F. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 04 Aug 2014 | for Version 1 Fred Gage , Laboratory of Genetics, Salk Institute for Biological Studies, La Jolla, CA, USA 0 Views copyright © 2014 Gage F. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors address an issue that is unresolved in the literature. Is the Otx found in the cortex, and responsible in part of cortical plasticity, cortical derived Otx1 or choroid plexus derived Otx2? The problem exists because the antibodies used previously can not distinguish between the two. In the present study using Otx1 KO mice and a variety of measures, the authors prove Otx2 is the protein in the cortical cells and that this therefore is a cell non- autonomous phenomenon. The one question I have relates to figure 1B, which suggests there is greater Otx2 staining in the Otx1 KO mouse cortex. If this is a reliable observation the authors should comment. The low peptide coverage in the MASS SPEC could be a concern but the authors address that and in addition the other supporting data decrease the concern. This is a clear, straightforward manuscript that adds important and definitive information to the existing literature Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Gage F. Peer Review Report For: Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex [version 1; peer review: 2 approved] . F1000Research 2014, 3 :178 ( https://doi.org/10.5256/f1000research.5197.r5640) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-178/v1#referee-response-5640 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Click here to access the data. The problem Spreadsheet data files may not format correctly if your computer is using different default delimiters (symbols used to separate values into separate cells) - a spreadsheet created in one region is sometimes misinterpreted by computers in other regions. You can change the regional settings on your computer so that the spreadsheet can be interpreted correctly. How to fix it Save downloaded CSV file Open spreadsheet program (e.g. Excel) Click the ‘Data’ tab at the top Click the ‘From text’ icon (top left) Browse for downloaded CSV file, click ‘Import’ Ensure ‘Delimited’ radio button is selected, click ‘Next’ Check one of the appropriate delimiter checkboxes (you can visualize the formatting by looking at the data preview below these options) Click ‘Finish’ Downloaded data do not display as expected? Download the data Dataset citation: Kim N, Acampora D, Dingli F et al. . Dataset 1 in: Immunoprecipitation and mass spectrometry identify non-cell autonomous Otx2 homeoprotein in the granular and supragranular layers of mouse visual cortex. F1000Research 2014, 3 :178 (https://doi.org/10.5256/f1000research.4869.d33384) Close Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Immunoprecipitation and mass spectrometry...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/3-178/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/3-178/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/3-178/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Kim N et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/3-178/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/3-178", templates : { twitter : "Immunoprecipitation and mass spectrometry identify non-cell autonomous.... Kim N et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/3-178/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/4869/5197") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "5197"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "5634": 0, "5636": 73, "5639": 0, "5640": 84, "5631": 0, "5679": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "f4a7f683-20c6-4756-be41-0a4b12610a12"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });