Effects of Δ motY mutations on motility behavior of Pseudomonas aeruginosa chimeric periplasmic stator variants

Effects of ΔmotY mutations on motility behavior of Pseudomonas aeruginosa chimeric periplasmic stator variants | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search Confirmatory Results Effects of Δ motY mutations on motility behavior of Pseudomonas aeruginosa chimeric periplasmic stator variants Nicola Ferguson , Mahika Desai , Joscelyn Flores Silva , Hoa Nguyen , Bruce Rodenborn , Orrin Shindell , Frank Healy doi: https://doi.org/10.1101/2025.11.06.686970 Nicola Ferguson 1 Department of Biology, Trinity University , San Antonio, Texas, 78212 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mahika Desai 1 Department of Biology, Trinity University , San Antonio, Texas, 78212 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Joscelyn Flores Silva 1 Department of Biology, Trinity University , San Antonio, Texas, 78212 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hoa Nguyen 2 Department of Mathematics, Trinity University , San Antonio, Texas, 78212 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Bruce Rodenborn 3 Physics Program, Centre College of Kentucky , Danville, Kentucky, 40422 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Orrin Shindell 4 Department of Physics and Astronomy, Trinity University , San Antonio, Texas, 78212 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Frank Healy 1 Department of Biology, Trinity University , San Antonio, Texas, 78212 USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: fhealy{at}trinity.edu Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Pseudomonas aeruginosa utilizes dual flagellar stator systems for motility; and dual stator bacteria possess auxiliary flagellar rotor ring components in their periplasm. In P. aeruginosa MotAB and MotCD comprise the dual stator system and MotY is the auxiliary periplasmic ring component. We investigated motility of strains and their isogenic Δ motY derivatives which expressed chimeric MotB/MotD periplasmic domains and characterized differences in motility behaviors. We found in general motility is severely impaired in strains carrying motY deletions and which express C-terminal periplasmic regions of MotD, compared with strains expressing MotB C-terminal counterparts. Motility in soft agar is slightly increased in strains expressing N-terminal MotB transmembrane domains and MotD C-terminal periplasmic plug, PGB, and extensions, but motility is severely impaired in Δ motY strains. Addition of the extended 24-residue C-terminus of MotB to the C-terminus of MotD does not significantly affect either motility or compensate for the deleterious effect of Δ motY mutation, but does significantly increase motility in motY+ backgrounds. The soft agar motility results for organisms with wild type MotAB stators was not different from those with MotAB stators carrying 24 residue MotB C-terminal deletions; however, motility of these mutants was significantly lower in Δ motY mutants compared to Δ motY mutants expressing wild type MotAB stators. We discuss contributions of stator functional domains to motility and the effects of Δ motY deletion. Lastly, we speculate on possible mechanistic roles for the two stator plug types based on thermodynamic considerations related to differences in composition of the hydrophobic surfaces of the two amphipathic helices. IMPORTANCE Pseudomonas aeruginosa uses two torque-generating stators, MotAB and MotCD, to drive flagellar rotation. Dual stator bacteria have additional rotor components; in P. aeruginosa , this component has been identified as MotY. This study investigates the interaction between the C-terminal plug and periplasmic regions of the MotB and MotD components of the MotAB and MotCD stator complexes with MotY. Motility assays of periplasmic chimeric strains expressing variants with MotB and MotD C-terminal plug and peptidoglycan binding domains reveal an enhanced sensitivity of MotD C-terminus to MotY deletions. These data suggest that critical interactions, either direct or indirect, must take place between the basal body MotY ring complex and MotD periplasmic regions for proper function of the MotCD stator in flagellar motility. INTRODUCTION Many bacteria use flagella to propel themselves through fluid environments and across surfaces ( 1 ). The flagellum is a macromolecular reversible rotary nanomachine consisting of an extended filament propeller connected to a basal body motor through a flexible universal joint hook. Extensive genetic, biochemical and structural studies of the Salmonella basal body motor assembly reveal a central axial rod passing through a series of rings embedded in the cell surface. These include the C (cytoplasmic), MS (membrane/supramembrane), P (peptidoglycan), and L (lipopolysaccharide) rings. ( 2 ). Flagella are powered by ion flow, with filament rotational energy originating from ion transduction through membrane-diffusible stators. The stator consists of two proteins present in a heptameric A 5 B 2 stoichiometry, referred to as MotAB, MotCD, PomAB, etc. ( 3 , 4 ). Motor rotation occurs through the association of stator complexes with the C ring. The Escherichia coli flagellar motors recruit up to a maximum of about a dozen stators, in a load-dependent manner, to drive motor rotation ( 5 , 6 ). MotA contains four transmembrane (TM) helices, and each of five MotA peptides associates into a truncated pentagonal cone, which contacts the C ring. The A 5 pentamer surrounds the N-terminal TM helices of the central MotB dimer and extends into the periplasm. The MotB TM helix is followed by a plug helix, a disordered linker region and C-terminal peptidoglycan binding domain (PGB). A critical aspartate residue located within the MotB TM region is required for ion transport (corresponding to D33 in both S. enterica and P. aeruginosa ) ( 7 ). The plug helix prevents ion flow through freely diffusing stators not associated with the rotor ( 8 ). Comparison of plugged and unplugged states in the Campylobacter jejuni MotAB complex reveal a variety of conformational changes that take place to create a transmembrane ion channel and initiate proton flow. Concomitant with motor recruitment of a stator unit, MotB PGB self-dimerizes to anchor the membrane-diffusible unit in association with the motor ( 9 – 11 ). Many bacteria, such as Salmonella sp., utilize a single torque-generating stator complex, some species use dual stator systems and do so in different ways and contexts ( 12 , 13 ). Vibrio and Shewanella spp. have Na+ dependent PomAB stators in addition to H+ dependent MotAB stator ( 14 , 15 ). Pseudomonas aeruginosa expresses two H+ driven stators, MotAB and MotCD (C 5 D 2 ) ( 16 , 17 ). Different motility phenotypes are observed between P aeruginosa strains expressing one stator or the other. P. aeruginosa PA01 Δ motCD strains swim faster than Δ motAB strains, while MotCD stators are required for motility in viscous environments and along surfaces ( 16 ). In P. aeruginosa PA14, swimming speeds are similar for both stators in low viscosity fluid media; however, in high viscosity media, Δ motCD mutants are non-motile, indicating that MotCD is required for motility in high viscosity environments ( 17 ). MotAB and MotCD stator dynamics studies show MotCD-driven rotational speeds are lower than those of MotAB ( 18 ). While MotB and MotD exhibit overall sequence and structural similarities, there are notable differences in the periplasmic domains of these proteins. The linker region between the helix plug and PGB is 17 residues longer in MotB than in MotD; and the C-terminal extension beyond the PGB in MotB is 38 residues longer than that of MotD ( Figure 1 ). Download figure Open in new tab Figure 1. Structural and sequence features of P. aeruginosa MotB/MotD periplasmic domains and chimeric strains. (A) Comparison of S. typhimurium MotB (St MotB) periplasmic structure (PDB 2ZVY ( 35 )) with P. aeruginosa MotB and MotD periplasmic structure models. N-terminal transmembrane domains are omitted; periplasmic linker sequence between plug helix and helix 3, and C-terminal extensions beyond PGB are shown as dashed lines. Select secondary structural feature labels of St MotB are shown. (B) Structure-based alignment of P. aeruginosa MotB and MotD C-terminal periplasmic region using Salmonella typhimurium MotB PDB 2Z0V. (C) Composition of inducible Tn7-integrated chimeric stator constructs. Components originating from MotAB are shown in gray, components originating from MotCD are shown in white. In addition to the canonical rotor C, MS, L and P rings, electron microscopy and electron cryo-tomography (ECT) studies reveal accessory features in the periplasmic regions of basal body complexes of bacteria with dual stator systems, such as P. aeruginosa . A structure situated below the LP ring system was identified in V. alginolyticus and named the T ring, comprising MotX and MotY ( 19 ). Analysis of V. alginolyticus Δ motX and Δ motY mutants shows that the PomAB stator system requires MotX and MotY for incorporation or stabilization of the PomAB stator in the motor. Structural studies have demonstrated that MotY is required for MotX recruitment to the basal body, and MotY prevents breakdown of MotX ( 20 , 21 ). ECT studies and bioinformatic analysis of dual stator system bacteria show a correlation between the presence of dual stator systems, elaborations around the basal body P ring region, and the occurrence of motY homologs in dual stator organism genomes. ECT-derived basal body structures from Shewanella oneidensis , Legionella pneumophila , and P. aeruginosa show elaborated motY -encoded structures below the LP ring system, variously described as T rings or decorated P rings. Previous genetic studies in P. aeruginosa PA01 demonstrated that MotY was required for MotCD-dependent motility ( 16 ). In bead-based assays using flagellar filament stubs to study MotY:stator interaction dynamics, FRET analysis of MotY donor-MotB/MotD acceptor energy transfer shows strong molecular interactions between MotY and both MotB and MotD ( 18 , 22 ). Significant differences in motor rotation speeds and switching rates between wild type P. aeruginosa and isogenic Δ motY strains are observed; and a 30% decrease in pole-localized stator fluorescence is seen relative to wild type strain. Swimming plate assays showed that Δ motAB Δ motY strains were essentially non-motile, similar to Δ motB Δ motCD strains. Collectively, these results show MotAB and MotCD participate in critical interactions with T ring MotY. MotY plays a role in regulating motor torque and switching rates, though it remains unclear how the P. aeruginosa MotAB/CD dual stator system might participate in this process. And while MotY also plays a role in some aspect of stator recruitment and/or stabilization, the manner through which MotY:stator interactions take place is unknown. To investigate stator:MotY interactions in this dual stator system, we constructed stator variant strains expressing inducible chimeric alleles of motB and motD , where periplasmic domains of one subunit are exchanged with its counterpart. These strains and their isogenic Δ motY derivatives were then used in soft agar, liquid medium, and swarming assays to investigate interactions of MotY with periplasmic regions of MotB and MotD. RESULTS To investigate periplasmic interactions between MotY and MotAB and MotCD complexes and their effect on cell motility, a Δ motAB Δ motCD stator mutant was used as host for Tn7-mediated integration of rhamnose-inducible chimeric stator constructs. The stator variant strains were designed to compare the impact on motility phenotype of C-terminal regions MotB and MotD in motY+/- genetic backgrounds. Strain construction terminology is illustrated in Figure 1C , showing strains MotABD1, MotABD2, MotCDB1, and Mot CDB2, with swapped chimeric regions; strain MotABtr, with truncated MotB C-terminal extension; and strains MotCDadd and MotCDadd2, which express motD fused to a 24-(MotCDadd) or 38-(MotCDadd2) residue C-terminal tail of MotB. Growth of all strains was similar to wild type PA01 in L broth and VBMM citrate media. Differential soft agar motility responses The results of soft agar motility experiments are presented first in Figures 2 and 3 . Based on diameters of soft agar motility zones, strains could be divided into six groups: 1) weakly motile; 2) MotAB-type; 3) MotCD-type; and 4) dual-type. A fifth group consisted of ABD1 and CDB1Δ motY , with motility zones that were consistently intermediate between MotAB-type and MotCD-type. (compare Figure 2 panels F and G; and panels F and K). A sixth category consisted of strain MotCDadd and MotCDadd2, which displayed soft agar swimming behaviors that were intermediate between MotCD-type and wild-type. Motility of wild type PA01 and strains expressing single stators, and their Δ motY counterparts is shown in Figure 2 panels A-D; motility of PA14 Δ motAB and Δ motCD strains is shown in Figure 2 panel E. Motilities of the Tn7:: motAB and Tn7:: motCD single stator constructs were similar to PA01 strains expressing single stators (compare Figure 2 panels B and J, and Figure 3 columns 3 and 11; and Figure 2 panels C and F, and Figure 3 columns 5 and 10). The Δ motAB Δ motCD host strain carrying the control Tn7 vector was non-motile (compare Figure 2 panels D, F, and J). Download figure Open in new tab Figure 2. Motility behavior of MotB/MotD chimeric stator strains and ΔmotY derivatives on 0.3% motility agar. Pinpoint inocula were incubated for 22 hr at 37C. Panels are arranged vertically: left column, normal stator configuration (zero, one, or two stators); center column, chimeric MotAB strains withTn7:motAB control shown in panel F; right column, chimeric MotCD strains with Tn7:motCD control shown in panel J. Panel A bar = 15 mm. Download figure Open in new tab Figure 3. Soft agar motility analysis of stator variant strains. Experiment was done as described in Figure 2 . ImageJ tools were used to measure diameters of radial colony expansion. Values represent means ± standard deviation (n=3). Significant differences were assessed using the Student’s t-test assuming equal variances; t = 3.86, p = 0.018. The effect on motility of the motY deletion between the two stators was striking, and similar to previously reported findings ( 16 ). The Δ motY effect on motility was severe in all strains expressing MotD periplasmic regions compared with strains expressing MotB periplasmic regions ( Figure 2 compare Δ motY mutants in panels B, G, and H with Δ motY mutants in panels C, K, and L). Motility of Δ motY mutants expressing the single MotCD stator complex is severely impaired, compared to the motility effect in cells expressing the single MotAB stator in Δ motY backgrounds (compare Figure 2 panels B and C; Figure 3 compare columns 3 and 4 versus columns 5 and 6). We next compared motility behavior of the stator variants and their Δ motY derivatives. While the strain MotABD1 motility was greater than strain MotAB, the deleterious effect of Δ motY on strain MotABD1, which expressed the MotD periplasmic domain (including MotD plug), was considerably greater than the effect of Δ motY on motility of the MotAB strain (compare Figure 2 panels C and G; Figure 3 compare columns 5 and 6 versus columns 12 and 13). Also, the motility of strain MotABD2, expressing the MotD periplasmic linker and C-terminus, was similar to that of the MotAB strain, and motility in this variant was more adversely affected in Δ motY mutants compared to MotAB strains (compare Figure 2 panels C and H; Figure 3 compare columns 5 and 6 versus columns 14 and 15). It is notable from these observations that the severity of the Δ motY motility impairment is greater in chimeric strains expressing MotD plug domains. The effect of the Δ motY mutation on motility was less severe in stator variant strains carrying MotB periplasmic regions. The motility of strain MotCDB1, expressing MotB plug and C-terminus, was similar to that of the MotCD strain, but the deleterious effect of Δ motY in the MotCD strain was considerably greater than the effect of the Δ motY mutation in the MotCDB1 strain ( Figure 2 compare panels B and K; Figure 3 compare columns 3 and 4 versus columns 18 and 19). We also see increased sensitivity of Δ motY mutants to motility impairment in chimeric strains expressing the MotD plug helix domain in MotCDB1 and MotCBD2 strains. The Δ motY motility impairment of MotCDB1 (MotB plug) is less severe than the Δ motY impairment effect on MotCDB2 (MotD plug). The effect of Δ motY mutation on MotAB stator variant with truncated C-terminus is shown in Figure 2 panel I. In the MotABtr strain, with a deletion of 24 residues from the MotB C-terminus, motility values were similar to those of MotAB and MotAB Δ motY strains. However, the motility of the MotABtr Δ motY strain was considerably impaired relative to MotAB, MotABtr and MotAB Δ motY strains (compare Figure 2 panels C and I; Figure 3 compare columns 5 and 6 versus columns 16 and 17). The motility of MotCDadd, which MotD carries the 24 C-terminal residues of MotB, was consistently greater than the motility of the MotCD strain; however, the effect of Δ motY mutation was similar for MotCD and MotCDadd (compare Figure 2 panels B and M, and Figure 3 columns 3 and 22). The motility of the MotCDadd2 strain carrying the extended 38-residue MotB C-terminus was slightly but reproducibly lower than MotCDadd. Isogenic Δ motY derivatives of both MotCDadd and MotCDadd2 strains were non-motile in the soft agar swimming assay. MotB/MotD periplasmic domain and motY effects on swimming in liquid media and swarming motility Swimming trajectories for each of the strains were recorded in liquid media and the data are presented in Figure 4 . Trajectories were distributed over a broad range for MotAB, Δ motCD Δ motY , and MotABD1 (compare Figure 4 columns 4 – 6). Swimming was significantly impaired in the MotABD2 strain (MotB plug and MotD C-terminus). Compared with their MotB counterparts, swimming speeds were low for all strains expressing MotD N-termini, but differences in the effect of Δ motY were observed. MotCD Δ motY, MotABD1 Δ motY , and MotABD2 Δ motY strains were non-motile, indicating that MotD C-terminal domain requires MotY for motility in liquid media. Swimming speeds for MotCDB1 and MotCDB2 strains were similar to their isogenic Δ motY counterparts. Swimming speeds of MotABtr and MotABtrΔ motY strains were similar to the wild type, indicating that the MotB C-terminal extension is not required for swimming in liquid media. The MotCDadd Δ motY strain (with partial 24-residue MotB C-terminal extension) was non-motile. Motility was not completely abolished, but was severely impaired in MotCDadd2 Δ motY strains (with full 38-residue MotB C-terminal extension). Download figure Open in new tab Figure 4. Summary swimming data in motility medium. Trajectories of exponential phase cultures of cells grown on motility medium were acquired on a Zeiss Axioscop II using darkfield optics and analyzed using ImageJ plug-ins. At least ten trajectories were acquired and analyzed for each strain. Stator variant strains ΔmotAB ΔmotY, Tn7::motCDadd ΔmotY, Tn7::ABD1 ΔmotY, Tn7::ABD2 ΔmotY were non-motile under these conditions. Swarming behavior of stator variants is presented in Figure 5 . Wild-type strain PA01 displayed the simple circular swarming pattern typical for the strain (strain PA14 swarming is shown for comparison, panels M-O) ( 23 ). Swarming is severely impaired or abolished in Δ motY strains. MotAB variants with MotB N-termini were non-motile. Swarming behavior in MotCDB1 strains expressing MotD N-terminus with MotB plug and extended C-terminus was similar to strains expressing MotCD; however, swarming was impaired in MotCDB2 strains expressing MotD N-terminus and plug region with MotB C-terminus. Swarming motility in MotCDadd strains was slightly better than MotCD strains. Download figure Open in new tab Figure 5. Swarming motility of stator variants. Top panels, P. aeruginosa PA01 strains, arranged vertically: left column, normal stators (zero, one or two stators) and Δ motY derivatives; center column, MotAB and MotAB Δ motY chimeric stator strains; left column, MotCD and MotCD Δ motY chimeric strains. These panels show growth on M9 glutamate swarming media ( 45 ); M9 aspartate and casamino acids swarm media ( 23 ) produced similar results. Plates were incubated for about 22 hr at 37C and imaged. Bottom three panels M – O, swarm behavior of P. aeruginosa PA14 wild-type and dual stator Δ motABCD strains on M, M9 glutamate; N, M9 aspartate; and O, casamino acids swarm media. DISCUSSION In P. aeruginosa and some other bacteria, the torque forces that drive flagellar motility are provided by two distinct stator complexes. Additionally, these dual stator organisms possess auxiliary flagellar ring components, such as MotY, in the periplasmic space. To explore periplasmic flagellar motor-stator interactions in the P. aeruginosa dual stator system, we created strains expressing rhamnose-inducible chimeric variants of MotB and MotD periplasmic domains and their isogenic Δ motY derivatives. Numerous studies have been done using organisms expressing stators of various chimeric composition (e.g., 16, 24–27). In this work we have selected the model dual stator organism to investigate the roles of MotB/MotD periplasmic functional domains in motility and their interactions, either direct or indirect, with MotY. This approach may provide new insights into mechanistic aspects of stator function regarding the specific roles played by MotB/MotD periplasmic domains in flagellar dynamics. Indeed, it is likely that modular domains in dual stator organisms would undergo an optimization suited to and directed towards optimal activity under the conditions in which it operates (e.g., surfaces, fluid viscosity, Na+ or H+, etc.). Thus, characterizing the contributions of functional domains to motility behavior could inform our understanding of flagellar dynamics. Motility in soft agar assays was greater, and swimming speeds were generally higher, in strains expressing MotB with MotD plug and MotD C-terminus (MotABD1). This effect was reversed in soft agar assays with strains that expressed MotB N-termini including MotB plug, with MotD C-termini (MotABD2). In the liquid swimming assay, swimming speeds for strains expressing MotB N-termini including the MotB plug, with MotD C-termini (MotABD2) were lower than that of normal MotAB strains. On the other hand, substitution of MotB plugs in chimeric strains expressing MotD N-termini made no observable differences in motility. Motility was similar for strains expressing MotCD stators with either MotD or MotB plugs. The behavior of strains MotABD2 and MotCDB2, which expressed chimeric N-terminal PGB, was similar to strains expressing non-chimeric PGB. On the other hand, in both cases the motility behavior of isogenic Δ motY derivatives was significantly impaired. However, no significant differences in motility were observed between strains expressing MotAB and their isogenic Δ motY derivatives. This observation could be explained by proposing that the extended length of the MotB C-terminus compared to MotD contributes to stator function in a MotY-independent manner. MotB is 51 residues longer than MotD, most of this extended length (38 residues) occurs at the C-terminus. Our findings support the idea that this disordered end contributes to some aspect of MotAB flagellar activity and does not require MotY. An extended 38-residue C-terminus would have a theoretical maximum length of about 13 nm ( 28 ); this could provide opportunities for critical interactions across a periplasmic space with a width on the order of 10 – 20 nm ( 29 ). The data suggest MotAB activity has an absolute requirement for either MotY or the extended C-terminus, as motility of MotABtr Δ motY strains was severely impaired. In our analysis of MotB/MotD sequences, the MotB homolog in dual stator organisms is typically longer than its MotD counterpart. We uncovered a plug effect in both soft agar and liquid swimming motility tests. Motility of MotABD1, a MotAB stator with MotD plug, was better than MotABD2, a MotAB stator with MotB plug. Motility of the ABD1 strain was also consistently higher than strains expressing normal MotAB complexes. Interestingly, the motilities of strains MotCDB1 and MotCDB2 were both similar to one another and to strains expressing normal MotCD stators, but the effect of the Δ motY mutation on motility of MotCDB2, expressing the MotD plug, was more severe than the effect of the Δ motY mutation on MotCDB1, which expresses the MotB plug. Thus, somehow the impact of the Δ motY deletion is greater in strains expressing MotD plugs. Genetic and biochemical studies of the Escherichia coli MotB stator component show that the plug adopts an amphipathic alpha helical structure ( 8 ). In the plugged state, the MotB dimer can function in trans, with the ion channel for MotB 1 closed by the MotB 2 plug. The helix is proposed to embed itself in the hydrophobic membrane surface along a hydrophobic face of the amphipathic helix, thus obstructing ion flow through a MotA/MotB transmembrane channel. Electron cryo-tomography studies have identified a likely channel which, in the plugged state, is obstructed by a conserved MotA phenylalanine residue, F186 in the C. jejuni structure ( 4 ); a corresponding site in the P. aeruginosa model is F210. Structures of unplugged complexes show the phenylalanine side chain position rotated in such a way as to leave the transmembrane channel open. In its activated state, it has been proposed that the MotB plugs are displaced from the membrane and form an association between their respective hydrophobic faces ( 8 ). We analyzed the properties of plug helices from both stator forms of several dual stator organisms. Helical wheel plot analysis was used to identify and characterize differences between the MotB and MotD plugs, and results are shown in Figure 6 . The amphipathic hydrophobic helical surfaces and opposing hydrophilic faces of MotB and MotD are depicted alongside the S. typhimurium MotB structure (panel A). By comparison, the helices are largely unremarkable except for the occurrence of a basic lysine residue on the MotB hydrophobic surface (panel B). Download figure Open in new tab Figure 6. Helical wheel plot analysis and sequence alignments of amphipathic plug helices for dual stator system organisms. (A) Helical wheel plots for P. aeruginosa MotD (Pa MotD), S. typhimurium MotB (St MotB), and P. aeruginosa MotB (Pa MotB). Polar uncharged residues are white, nonpolar residues are light gray, acidic residue are dark gray, and basic residues are black. Hydrophobic helical face is indicated with gray arc along lower right quadrant of St MotB wheel. (B) Sequence alignments of MotB/MotD stators for dual stator organisms. S. typhimurium -type stators have nonpolar residues in hydrophobic surface position four, whereas P. aeruginosa MotB-type stators have Arg or Lys residues in position four (highlighted). A recent comprehensive structural and phylogenetic analysis of bacterial stators identified two structural evolutionary lineages, flagellar ion transporters (FIT) and generic ion transporters (GIT) ( 30 ). Characterization of 107 FITs revealed several shared features among flagellar stator proteins and absent in GITs: 1) extended cytoplasmic domain with at least four helices comprising the torque-generating interface; 2) a square four-helix fold transmembrane domain in the MotA subunit; 3) MotB subunit plug and linker domains; and 4) expanded peptidoglycan binding domain. FITs diverged structurally into TGI4 and TGI5 groups, based upon the presence of four (TGI4) or five (TGI5) helices within the stator torque-generating interface. TGI5 stators, e.g., E. coli MotAB, are mostly restricted to members of the Pseudomonadota. TGI4 stators include Na+-driven systems such as V. alginolyticus PomAB. Our limited analysis of dual stator plug composition revealed that the MotB-type stators carry lysine residues in the fourth position of the plug helix ( Figure 6 , panel A). Logo analysis of the 107 stator dataset show high bit scores for lysine or arginine at this position in MotB-type stators ( 30 ). This strong correlation across multiply divergent stator evolutionary histories and gene transfer phenomena would suggest that the occurrence of a basic residue on the hydrophobic surface plays some specific role in flagellar activity; and conversely, the specific functionality of plug helices with hydrophobic surfaces characterized by strictly nonpolar residues may be dependent on the surface being exclusively hydrophobic. Since we find stator plugs with nonpolar and basic residues at position four in the stator complexes of dual stator organisms, we propose that in dual stator organisms, the composition of the plug at position four might play an important role in some mechanistic aspect of flagellar activity. We explored this proposal by addressing bioenergetic properties of the two helix types. We used the neural network-based model PMIpred ( 31 ) to estimate free energies of interaction of the nonpolar and lysine-containing amphipathic helices. In addition to providing estimates for hydrophobicity and hydrophobic moment, the model also assesses propensities for interactions with curved surfaces. Helices with lower free energies which bind curved surfaces are “sensors”, whereas helices with stronger energies (“binders”) exhibit non-selectivity. PMIpred analysis of plug helices is shown in Figure 7 . Plugs with lysine occupying position four typically have lower free energies with a curvature-sensing component; plugs with nonpolar residues at position four do not exhibit curvature selectivity. Download figure Open in new tab Figure 7. PMIpred modeling analysis of MotB/D plug helices. The protein-membrane interaction neural network model PMIpred ( 31 ) was used to predict free energies of membrane-associative interactions for MotB/D proteins listed in Figure 6 based on amino acid type at helix position four: either nonpolar at position four; or a lysine or arginine at position four, K/R). (A) Predicted curvature-sensing free energy, ΔΔF_adj, adjusted for charge effects. (B) Predicted membrane-spanning free energy, ΔF_sm(R=50), which estimates the free energy for a vesicle with radius = 50 nm. We are intrigued by the idea that differences in the thermodynamic properties of the two plug types, and the observation of “plug effects” in our motility behavior assays, would suggest that some mechanistic aspect of the differential behavior of stators in dual stator bacteria is governed by the interfacial membrane dynamics of the two stator types. For example, at the channel activation stage, could plug type be sensitive to differences in local membrane properties? Or, following activation, could stator turnover dynamics be regulated by changes in membrane properties? The divergence of plug types based on structural changes which significantly affect thermodynamic properties could represent an interesting example of an evolutionary mechanistic specialization of periplasmic amphipathic helices. MATERIALS AND METHODS Bacterial strains, plasmids and media Strains and plasmids used in this work are given in Table 1 . Pseudomonas aeruginosa strain PA01 (JJHO MPA01 re-sequenced) was a gift from Joe Harrison; PA14 strains were a gift from George O’Toole; Escherichia coli strain S17.1 and plasmid pTNS2 (Addgene plasmid #64968) were gifts from Herbert Schweizer. Bacterial strains were routinely cultured on lysogeny broth (per liter: peptone, 10 g; yeast extract, 5 g; sodium chloride, 5 g). Liquid motility media contained (per liter) 5 g peptone, and 5 g sodium chloride; soft agar motility plates consisted of motility media plus 0.3% agar. Swarm media was prepared with casein hydrolysate ( 23 ) and M8 glucose medium with 0.05% aspartate or glutamate ( 45 ), amended with 0.55% agar. VBMM was prepared as described by Choi and Schweizer ( 46 ); NSLB was prepared with 300 mM sucrose as described by Hmelo et. al. ( 47 ). Antibiotics were included where appropriate at the following concentrations: ampicillin, 100 ug/mL ( E. coli ); gentamicin, 10 ug/mL ( E. coli ) and 30 ug/mL ( P. aeruginosa ). Stator expression in pJM220 Tn7 insertion strains was induced with addition of rhamnose to 0.3 mM in plate media, and 3 mM in liquid media. View this table: View inline View popup Download powerpoint Table 1. Bacterial strains and plasmids used in this study. Construction of strains P aeruginosa PA01 ΔmotAB and ΔmotCD single stator and ΔmotABΔmotCD deletion mutants were constructed using previously published methods ( 47 ). One kb PCR amplification products flanking the motAB and motCD loci were joined in plasmid pEX18Gm, and plasmids were used to transform E. coli S17.1 ( supplementary table ).Transformants and cultures of P. aeruginosa PA01 were collected on filters for conjugal mating as described ( 47 ). Merodiploid PA01 transconjugants were selected on VBMM medium containing gentamicin; and single-crossover deletion mutants were selected on NSLB medium containing sucrose. Silicon-based platform synthesis was used to generate stator motAB , motCD and stator variant constructs (Twist Bioscience). Figure 1 illustrates the stator variant constructs. Ribosome binding site sequence 5’CCGTTTACAGAGAGGAGAACG was added to the 5’ ends of motA and motC open reading frames. Variant constructs carrying motA retained the motAB intergenic region. ABD1 carries the N-terminal TM helix domain through MotB Ser47 and the remaining C-terminal sequence is that of MotD, from the plug region Ile 41 through the remainder of the MotD sequence. ABD2 contains the MotB TM and MotB plug through Gln 61, and the remainder of the sequence is that of MotD from Gln 59 to the end of the sequence. Variant constructs carrying motC retained the motCD intergenic region. CDB1 carries the N-terminal MotD TM through Ser 40, and the remaining sequence is that of MotB, including plug (Pro 50 – Gln 61), linker, PGB and extended C-terminus. CDB2 contains the MotD TM and MotD plug, and the remainder of the expressed protein is that of MotB, including linker, PGB, and extended C-terminus. CDadd expresses MotCD with the additional 24 C-terminal residues of MotB (from Asp 324 to Asp 347); CDadd2 expresses the 38-residue MotB C-terminal extension. ABtr expresses MotAB with the MotB C-terminal 24 residues removed. All stator variant constructs were cloned into the PstI site of pJM220 under transcriptional control of the PrhaBAD promoter ( 48 ). Strain L48 ( ΔmotABΔmotCD ) was used as host for Tn7-mediated transposition of pJM220 derivatives carrying stator constructs using electroporation with helper plasmid pTNS2 ( 46 ). View this table: View inline View popup Download powerpoint Supplementary Table. Oligonucleotides used for construction of PA01 stator mutants. View this table: View inline View popup Download powerpoint Supplementary Table 1. PMIpred free energy values for amphipathic stator plug helices. Motility assays For soft agar motility assays, toothpick inoculum from a fresh overnight plate culture or 3 uL of an overnight L broth culture were transferred to plates and plates were incubated for about 20 hr at 37C before imaging. Swarm plates were inoculated as previously described ( 23 ) and imaged after about 24 hr of growth at 37C. Images were processed using ImageJ. Overnight or exponential phase cultures in liquid motility medium were used for swimming assays. Wet mounts were prepared using a small volume of cell culture and observed using dark field optics with a Zeiss Axioscop 2 equipped with a camera (Thorlabs 1501M-USB). Swimming trajectories were recorded and analyzed using ImageJ particle tracking plug-in. ACKNOWLEDGMENTS We thank Joe Harrison and George O’Toole for providing strains. This research was supported by National Science Foundation grants PHY-2210609 and PHY-2210610. REFERENCES 1. ↵ Sowa Y , Berry RM . 2008 . Bacterial flagellar motor . Quarterly Reviews of Biophysics 41 : 103 – 132 . OpenUrl CrossRef PubMed Web of Science 2. ↵ Johnson S , Furlong EJ , Deme JC , Nord AL , Caesar JJE , Chevance FFV , Berry RM , Hughes KT , Lea SM . 2021 . Molecular structure of the intact bacterial flagellar basal body . Nat Microbiol 6 : 712 – 721 . OpenUrl PubMed 3. ↵ Deme JC , Johnson S , Vickery O , Aron A , Monkhouse H , Griffiths T , James RH , Berks BC , Coulton JW , Stansfeld PJ , Lea SM . 2020 . Structures of the stator complex that drives rotation of the bacterial flagellum . Nat Microbiol 5 : 1553 – 1564 . OpenUrl PubMed 4. ↵ Santiveri M , Roa-Eguiara A , Kühne C , Wadhwa N , Hu H , Berg HC , Erhardt M , Taylor NMI . 2020 . Structure and Function of Stator Units of the Bacterial Flagellar Motor . Cell 183 : 244 – 257 .e16. OpenUrl CrossRef PubMed 5. ↵ Reid SW , Leake MC , Chandler JH , Lo C-J , Armitage JP , Berry RM . 2006 . The maximum number of torque-generating units in the flagellar motor of Escherichia coli is at least 11 . PNAS 103 : 8066 – 8071 . OpenUrl Abstract / FREE Full Text 6. ↵ Tipping MJ , Delalez NJ , Lim R , Berry RM , Armitage JP . 2013 . Load-Dependent Assembly of the Bacterial Flagellar Motor . mBio 4 : e00551 – 13 . OpenUrl CrossRef PubMed 7. ↵ Zhou J , Sharp LL , Tang HL , Lloyd SA , Billings S , Braun TF , Blair DF . 1998 . Function of Protonatable Residues in the Flagellar Motor of Escherichia coli: a Critical Role for Asp 32 of MotB . Journal of Bacteriology 180 : 2729 – 2735 . OpenUrl Abstract / FREE Full Text 8. ↵ Hosking ER , Vogt C , Bakker EP , Manson MD . 2006 . The Escherichia coli MotAB Proton Channel Unplugged . Journal of Molecular Biology 364 : 921 – 937 . OpenUrl CrossRef PubMed Web of Science 9. ↵ O’Neill J , Xie M , Hijnen M , Roujeinikova A . 2011 . Role of the MotB linker in the assembly and activation of the bacterial flagellar motor . Acta Cryst D 67 : 1009 – 1016 . OpenUrl CrossRef PubMed Web of Science 10. Roujeinikova A . 2008 . Crystal structure of the cell wall anchor domain of MotB, a stator component of the bacterial flagellar motor: Implications for peptidoglycan recognition . Proceedings of the National Academy of Sciences 105 : 10348 – 10353 . OpenUrl Abstract / FREE Full Text 11. ↵ Zhu S , Takao M , Li N , Sakuma M , Nishino Y , Homma M , Kojima S , Imada K . 2014 . Conformational change in the periplamic region of the flagellar stator coupled with the assembly around the rotor . Proceedings of the National Academy of Sciences 111 : 13523 – 13528 . OpenUrl Abstract / FREE Full Text 12. ↵ McCarter LL . 2004 . Dual Flagellar Systems Enable Motility under Different Circumstances . MIP 7 : 18 – 29 . OpenUrl 13. ↵ Thormann KM , Paulick A 2010 . Tuning the flagellar motor . Microbiology 156 : 1275 – 1283 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Paulick A , Delalez NJ , Brenzinger S , Steel BC , Berry RM , Armitage JP , Thormann KM . 2015 . Dual stator dynamics in the Shewanella oneidensis MR-1 flagellar motor . Molecular Microbiology 96 : 993 – 1001 . OpenUrl CrossRef PubMed 15. ↵ Yorimitsu T , Kojima M , Yakushi T , Homma M . 2004 . Multimeric Structure of the PomA/PomB Channel Complex in the Na+-Driven Flagellar Motor of Vibrio alginolyticus . J Biochem 135 : 43 – 51 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Doyle TB , Hawkins AC , McCarter LL . 2004 . The Complex Flagellar Torque Generator of Pseudomonas aeruginosa . J Bacteriol 186 : 6341 – 6350 . OpenUrl Abstract / FREE Full Text 17. ↵ Toutain CM , Zegans ME , O’Toole GA . 2005 . Evidence for Two Flagellar Stators and Their Role in the Motility of Pseudomonas aeruginosa . Journal of Bacteriology 187 : 771 – 777 . OpenUrl Abstract / FREE Full Text 18. ↵ Wu Z , Tian M , Zhang R , Yuan J . 2021 . Dynamics of the two stator systems in the flagellar motor of Pseudomonas aeruginosa studied by a bead assay . Appl Environ Microbiol AEM 0167421 . 19. ↵ Terashima H , Fukuoka H , Yakushi T , Kojima S , Homma M . 2006 . The Vibrio motor proteins, MotX and MotY, are associated with the basal body of Na+-driven flagella and required for stator formation . Molecular Microbiology 62 : 1170 – 1180 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Yagasaki J , Okabe M , Kurebayashi R , Yakushi T , Homma M . 2006 . Roles of the Intramolecular Disulfide Bridge in MotX and MotY, the Specific Proteins for Sodium-Driven Motors in Vibrio spp . Journal of Bacteriology 188 : 5308 – 5314 . OpenUrl Abstract / FREE Full Text 21. ↵ Kojima S , Shinohara A , Terashima H , Yakushi T , Sakuma M , Homma M , Namba K , Imada K . 2008 . Insights into the stator assembly of the Vibrio flagellar motor from the crystal structure of MotY . Proceedings of the National Academy of Sciences 105 : 7696 – 7701 . OpenUrl Abstract / FREE Full Text 22. ↵ Fu S , Tian M , Chen M , Wu Z , Zhang R , Yuan J . 2024 . MotY modulates proton-driven flagellar motor output in Pseudomonas aeruginosa . BMC Microbiol 24 : 461 . OpenUrl PubMed 23. ↵ Ha D-G , Kuchma SL , O’Toole GA . 2014 . Plate-Based Assay for Swarming Motility in Pseudomonas aeruginosa , p. 67 – 72 . In Filloux , A , Ramos , J-L (eds.), Pseudomonas Methods and Protocols. Springer , New York, NY . 24. Asai Y , Yakushi T , Kawagishi I , Homma M . 2003 . Ion-coupling Determinants of Na+-driven and H+-driven Flagellar Motors . Journal of Molecular Biology 327 : 453 – 463 . OpenUrl CrossRef PubMed Web of Science 25. Ridone P , Baker MAB . 2024 . Hybrid Exb/Mot stators require substitutions distant from the chimeric pore to power flagellar rotation . Journal of Bacteriology 206 : e00140 – 24 . OpenUrl PubMed 26. Nishino Y , Onoue Y , Kojima S , Homma M . 2015 . Functional chimeras of flagellar stator proteins between E. coli MotB and Vibrio PomB at the periplasmic region in Vibrio or E. coli . MicrobiologyOpen 4 : 323 – 331 . OpenUrl CrossRef PubMed 27. Inoue Y , Lo C-J , Fukuoka H , Takahashi H , Sowa Y , Pilizota T , Wadhams GH , Homma M , Berry RM , Ishijima A . 2008 . Torque–Speed Relationships of Na+-driven Chimeric Flagellar Motors in Escherichia coli . Journal of Molecular Biology 376 : 1251 – 1259 . OpenUrl CrossRef PubMed Web of Science 28. ↵ Sigel H , Martin B . 1982 . Coordinating properties of the amide bond. Stability and structure of metal ion complexes of peptides and related ligands . Chemical Reviews 82 : 385 – 426 . OpenUrl CrossRef Web of Science 29. ↵ Matias VRF , Al-Amoudi A , Dubochet J , Beveridge TJ . 2003 . Cryo-Transmission Electron Microscopy of Frozen-Hydrated Sections of Escherichia coli and Pseudomonas aeruginosa . Journal of Bacteriology 185 : 6112 – 6118 . OpenUrl Abstract / FREE Full Text 30. ↵ Puente-Lelievre C , Ridone P , Douglas J , Amritkar K , Kaçar B , Baker MAB , Matzke NJ . Evolution and structural diversity of the MotAB stator: insights into the origins of bacterial flagellar motility . mBio 16 : e03824 – 24 . 31. ↵ van Hilten N , Verwei N , Methorst J , Nase C , Bernatavicius A , Risselada HJ . 2024 . PMIpred: a physics-informed web server for quantitative protein–membrane interaction prediction . Bioinformatics 40 : btae069 . OpenUrl PubMed 32. Rhodospirillum centenum Utilizes Separate Motor and Switch Components To Control Lateral and Polar Flagellum Rotation . https://journals.asm.org/doi/epdf/10.1128/jb.184.9.2429-2438.2002 . Retrieved 27 October 2025. 33. Brenzinger S , Dewenter L , Delalez NJ , Leicht O , Berndt V , Paulick A , Berry RM , Thanbichler M , Armitage JP , Maier B , Thormann KM . 2016 . Mutations targeting the plug-domain of the hewanella oneidensis proton-driven stator allow swimming at increased viscosity and under anaerobic conditions . Molecular Microbiology 102 : 925 – 938 . OpenUrl CrossRef PubMed 34. Leake MC , Chandler JH , Wadhams GH , Bai F , Berry RM , Armitage JP . 2006 . Stoichiometry and turnover in single, functioning membrane protein complexes . Nature 443 : 355 – 358 . OpenUrl CrossRef PubMed Web of Science 35. ↵ Kojima S , Imada K , Sakuma M , Sudo Y , Kojima C , Minamino T , Homma M , Namba K . Stator assembly and activation mechanism of the flagellar motor by the periplasmic region of MotB . 36. de Anda J , Kuchma SL , Webster SS , Boromand A , Lewis KA , Lee CK , Contreras M , Medeiros Pereira VF , Schmidt W , Hogan DA , O’Hern CS , O’Toole GA , Wong GCL . 2024 . How P. aeruginosa cells with diverse stator composition collectively swarm . mBio 15 : e03322 – 23 . OpenUrl PubMed 37. Yakushi T , Hattori N , Homma M . 2005 . Deletion analysis of the carboxyl-terminal region of the PomB component of the vibrio alginolyticus polar flagellar motor . J Bacteriol 187 : 778 – 784 . OpenUrl Abstract / FREE Full Text 38. Manson MD , Tedesco P , Berg HC , Harold FM , Drift CV der . 1977 . A protonmotive force drives bacterial flagella . PNAS 74 : 3060 – 3064 . OpenUrl Abstract / FREE Full Text 39. Li N , Kojima S , Homma M . 2011 . Characterization of the Periplasmic Region of PomB, a Na+-Driven Flagellar Stator Protein in Vibrio alginolyticus . Journal of Bacteriology 193 : 3773 – 3784 . OpenUrl Abstract / FREE Full Text 40. Koch B , Jensen LE , Nybroe O . 2001 . A panel of Tn7-based vectors for insertion of the gfp marker gene or for delivery of cloned DNA into Gram-negative bacteria at a neutral chromosomal site . J Microbiol Methods 45 : 187 – 195 . OpenUrl CrossRef PubMed Web of Science 41. Stolz B , Berg HC . 1991 . Evidence for interactions between MotA and MotB, torque-generating elements of the flagellar motor of Escherichia coli . Journal of Bacteriology 173 : 7033 – 7037 . OpenUrl Abstract / FREE Full Text 42. Kojima S , Furukawa Y , Matsunami H , Minamino T , Namba K . 2008 . Characterization of the Periplasmic Domain of MotB and Implications for Its Role in the Stator Assembly of the Bacterial Flagellar Motor . Journal of Bacteriology 190 : 3314 – 3322 . OpenUrl Abstract / FREE Full Text 43. Abergel C , Walburger A , Chenivesse S , Lazdunski C . 2001 . Crystallization and preliminary crystallographic study of the peptidoglycan-associated lipoprotein from Escherichia coli . Acta Crystallogr D Biol Crystallogr 57 : 317 – 319 . OpenUrl CrossRef PubMed 44. Wojdyla JA , Cutts E , Kaminska R , Papadakos G , Hopper JTS , Stansfeld PJ , Staunton D , Robinson CV , Kleanthous C . 2015 . Structure and Function of the Escherichia coli Tol-Pal Stator Protein TolR * . Journal of Biological Chemistry 290 : 26675 – 26687 . OpenUrl Abstract / FREE Full Text 45. ↵ Köhler T , Curty LK , Barja F , van Delden C , Pechère JC . 2000 . Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili . J Bacteriol 182 : 5990 – 5996 . OpenUrl Abstract / FREE Full Text 46. ↵ Choi K-H , Schweizer HP . 2006 . mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. 1 . Nat Protoc 1 : 153 – 161 . OpenUrl CrossRef PubMed 47. ↵ Hmelo LR , Borlee BR , Almblad H , Love ME , Randall TE , Tseng BS , Lin C , Irie Y , Storek KM , Yang JJ , Siehnel RJ , Howell PL , Singh PK , Tolker-Nielsen T , Parsek MR , Schweizer HP , Harrison JJ . 2015 . Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange . Nat Protoc 10 : 1820 – 1841 . OpenUrl CrossRef PubMed 48. ↵ Meisner J , Goldberg JB . 2016 . The Escherichia coli rhaSR-PrhaBAD Inducible Promoter System Allows Tightly Controlled Gene Expression over a Wide Range in Pseudomonas aeruginosa . Applied and Environmental Microbiology 82 : 6715 – 6727 . OpenUrl Abstract / FREE Full Text 49. Harrison JJ , Almblad H , Irie Y , Wolter DJ , Eggleston HC , Randall TE , Kitzman JO , Stackhouse B , Emerson JC , Mcnamara S , Larsen TJ , Shendure J , Hoffman LR , Wozniak DJ , Parsek MR . 2020 . Elevated exopolysaccharide levels in Pseudomonas aeruginosa flagellar mutants have implications for biofilm growth and chronic infections . PLOS Genetics 16 : e1008848 . OpenUrl 50. Simon R , Priefer U , Pühler A . 1983 . A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria . Nat Biotechnol 1 : 784 – 791 . OpenUrl CrossRef PubMed 51. Hoang TT , Karkhoff-Schweizer RR , Kutchma AJ , Schweizer HP . 1998 . A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants . Gene 212 : 77 – 86 . OpenUrl CrossRef PubMed Web of Science 52. Choi K-H , Gaynor JB , White KG , Lopez C , Bosio CM , Karkhoff-Schweizer RR , Schweizer HP . 2005 . A Tn7-based broad-range bacterial cloning and expression system . Nat Methods 2 : 443 – 448 . OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted November 07, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Effects of ΔmotY mutations on motility behavior of Pseudomonas aeruginosa chimeric periplasmic stator variants Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Effects of Δ motY mutations on motility behavior of Pseudomonas aeruginosa chimeric periplasmic stator variants Nicola Ferguson , Mahika Desai , Joscelyn Flores Silva , Hoa Nguyen , Bruce Rodenborn , Orrin Shindell , Frank Healy bioRxiv 2025.11.06.686970; doi: https://doi.org/10.1101/2025.11.06.686970 Share This Article: Copy Citation Tools Effects of Δ motY mutations on motility behavior of Pseudomonas aeruginosa chimeric periplasmic stator variants Nicola Ferguson , Mahika Desai , Joscelyn Flores Silva , Hoa Nguyen , Bruce Rodenborn , Orrin Shindell , Frank Healy bioRxiv 2025.11.06.686970; doi: https://doi.org/10.1101/2025.11.06.686970 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41937) Biophysics (21452) Cancer Biology (18588) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15156) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)