Identification and in vitro characterization of a novel porcine parvovirus 6 in Russia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification and in vitro characterization of a novel porcine parvovirus 6 in Russia Alina Komina, Afshona Anoyatbekova, Nikita Krasnikov, Anton Yuzhakov This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3228149/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Sep, 2023 Read the published version in Veterinary Research Communications → Version 1 posted 7 You are reading this latest preprint version Abstract Porcine parvovirus 6 (PPV6) was first identified in aborted swine fetuses in China in 2014. Since its identification, an increased number of PPV6 cases have been reported in many countries with developed pig breeding. In this study, the first identification of porcine parvovirus 6 in Russia, its phylogenetic analysis, and its characterization in vitro are reported. During the investigation, 521 serum samples collected from pigs of different ages from seven regions of the Russian Federation were tested. In four regions, the DNA of the virus was detected. The overall prevalence of porcine parvovirus 6 in Russia was 9.4%. Fattening pigs were the group with the most frequent detection of the virus genome. Phylogenetic analysis of the Russian isolate detected in a domestic boar indicated high homology with strains from Spain. In vitro studies revealed that PPV6 mostly replicates in SPEV and SK cell cultures and, to a lesser extent, in ST. Our results demonstrated that PPV6 induced typical apoptotic features in cells, including DNA fragmentation, chromatin margination, nuclear condensation, pyknosis of nuclei, symplast formation, and various pathological mitoses. porcine parvovirus 6 cell cultures PCR pigs virus isolation phylogenetic analysis Sanger sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Parvoviruses are non-enveloped, single-stranded DNA viruses of the family Parvoviridae that infect animals of various species and humans worldwide (Cotmore et al. 2019 ; Jager et al. 2021 ; Streck and Truyen 2020 ). For the pig industry, porcine parvovirus type 1 (PPV1) is of great interest due to the significant economic losses (Jager et al. 2021 ; Streck and Truyen 2020 ). The infection with PPV1 is contagious and causes severe reproductive failure in sows (Mészáros et al. 2017 ; Streck and Truyen 2020 ). Through the introduction of modern molecular genetic diagnostic methods into veterinary practice, it became possible to detect new types of porcine parvoviruses (PPV2-PPV8). All these parvoviruses have been found in pigs of various ages in different countries (Cságola et al. 2012 ; Jager et al. 2021 ; Kim et al. 2021 ; Miłek et al. 2019 ; Schirtzinger et al. 2015 ; Streck et al. 2015 ). In the Russian Federation, the circulation of novel porcine parvoviruses has not been described. Unlike PPV1, the precise role of other identified porcine parvoviruses in the infectious pathology of swine has not yet been defined (Miłek et al. 2019 ; Schirtzinger et al. 2015 ). However, many studies have reported their co-infection with porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circovirus 2 (PCV-2) in pigs manifesting post-weaning multisystemic wasting syndrome (Kim et al. 2022 ; Miłek et al. 2020 ; Opriessnig et al. 2014 ). The Parvoviridae family is divided into three subfamilies: Parvovirinae, Densovirinae , and Hamaparvovirinae. In turn, the subfamily Parvovirinae includes eight genera (Cotmore et al. 2019 ). All known porcine parvoviruses are subdivided into four genera in the subfamily Parvovirinae: Protoparvovirus (PPV1), Tetraparvovirus (PPV2, PPV3), Copiparvovirus (PPV4, PPV5, and PPV6), and Chapparvovirus (PPV7) (Cotmore et al. 2019 ; Jager et al. 2021 ). Recently, an unclassified porcine parvovirus, provisionally named PPV8, was discovered in China (Guo et al. 2022 ). Of all the novel porcine parvoviruses, only porcine parvovirus type 6 (PPV6) was originally detected as a pathogen in aborted pig fetuses in China (Ni et al. 2014 ). However, its association with clinical manifestations of the disease is ambiguous, as PPV6 DNA has been detected in both clinically ill and healthy pigs (Kim et al. 2021 ). Since its first discovery, PPV6 has been confirmed in Brazil, South Korea, Spain, Poland, the USA, and Canada (Cui et al. 2017 ; Kim et al. 2021 ; Miłek et al. 2019 ; Schirtzinger et al. 2015 ; Streck et al. 2015 ). The PPV6 genome (~ 6100 bp) contains two open reading frames (ORFs). ORF1 encodes a nonstructural protein (NS1) of 662 amino acids that functions as a viral replicase. ORF2 encodes the putative capsid protein (VP1) that is predicted to be 1189 amino acids in length (Cotmore et al. 2019 ; Jager et al. 2021 ; Mészáros et al. 2017 ; Streck and Truyen 2020 ). Despite the prevalence of PPV6 in many countries, the virus has not been isolated in cell cultures, and all of Koch's postulates have not been fulfilled yet. In this article, we describe the first identification of PPV6, its prevalence in pig farms in some regions of Russia, and its characterization in vitro . Materials and methods Samples Five hundred twenty-one serum samples from pigs of different ages collected in the years between 2021 and 2022 from seven industrial pig farms located in Kemerovo, Tomsk, Vologda, Sverdlovsk Regions, the Republic of Buryatia, and Krasnoyarsk Krai were analyzed. Samples were stored at – 70 0 C. Nucleic acid Extraction and Real-Time PCR (qPCR) Nucleic acid was extracted by the commercial kit "RIBO-prep RNA/DNA Kit" (InterLabService, Russia) following the manufacturer’s instructions and stored at − 20 0 C. Real-time PCR was used to detect PPV6 in serum samples and to monitor the virus replication in vitro using the primers and probes described in the article (Cui et al. 2017 ). The samples with Ct ≤ 35 were considered positive. For differential diagnosis, serum samples and cell cultures were analyzed for the presence of PCV-2, PRRSV, CSFV (classical swine fever virus), and BVDV (bovine viral diarrhea virus) using commercial PCR kits (Vetbiochem, Russia). For PPV1-PPV6 detection, we used primers and probes from the available published data (Ni et al. 2014 ; Xiao et al. 2013a ; Xiao et al. 2012 ; Xiao et al. 2013b ). Sequencing Sequencing was conducted according to the Sanger method using self-designed, specific primers for the capsid protein gene (Table 1 ). Table 1 Designed primers for sequencing the PPV6 capsid gene. Primers were designed based on the reference sequence PPV6 isolate TJ (NC023860). Primer pair Primer Sequence (5'-3') Product Size Ta ℃ PPV6-F1 GTTTCCTGACGACGCTGTG 904 bp (2159–3062) 60,5 PPV6- R1 GACAAAGAAGGCGTCTGCG PPV6- F2 GTTCCCTTGTATGCAACAGG 895 bp (3005–3899) 56,0 PPV6- R2 CCGTCTTCAGTTGATCCAG PPV6- F3 GATCCAGAAACTCCAGGG 861 bp (3817–4677) 58,0 PPV6- R3 CCCGCCTCGAATAAGAGT PPV6-F4 GCGGTTCAGGGTACACTTTC 631 bp (4592–5222) 60,5 PPV6- R4 CTGACATTGAGATCACTCCAGG PPV6- F5 GTGGTCACGGCTAATGC 725 bp (5143–5867) 54,5 PPV6- R5 CATACAGTAGGCGGAGC The 25 µl reaction mixture contained 5 µl of extracted DNA, 2.5 µl of 10X Taq Buffer (Alpha ferment, Russia), 0.5 µl of dNTPs mix (New England Biolabs, NEB, USA), 14.75 µl of Nuclease-Free water, 0.25 µl Taq Polymerase (Alpha ferment, Russia), and 10 pM each of forward and reverse primers. The PCR thermal cycle was as follows: 95°C for 2 min; 30 cycles of: 95°C for 30s, 54.5–60.5°C for 30s, 72°C for 90s. The PCR products were analyzed on a 1% agarose gel containing Tris-acetate buffer solution (pH 8.0) and ethidium bromide (0.5 µg/mL). The amplified fragments from agarose gel were purified by the commercial kit for DNA purification from agarose gel (Evrogen, Russia) according to the manufacturer’s instructions. The purified DNA was sequenced by the Big Dye 3.1 Terminator Cycle Sequencing Kit (Applied Biosystems, USA) and carried out on the ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, USA). Alignment and Phylogenetic Analysis Multiple sequence alignment was performed using the MAFFT method in UGENE (v. 45.1) software. A phylogenetic tree was constructed by the Maximum Likelihood method and the General Time Reversible (G + I) model in MEGA 7.0 (Kumar et al. 2016 ). The robustness of the tree topology was evaluated by 1000 bootstrap replications. Cell Cultures and Virus Isolation Continuous cell cultures: SPEV (porcine embryonic kidney cell line), SK (swine kidney), and ST (swine testis) from the "Collection of Cell Cultures of the Federal State Budget Scientific Institution "Federal Scientific Center VIEV", (Moscow, Russia) were used. These cell lines were cultured in the 25 cm2 tissue culture flasks’ surface area (Corning, USA) at 37°C with 5% CO2. Minimum Essential Medium Eagle (PanEko, Russia) was used for ST and SK cultivation and the 199 Medium (PanEko, Russia) for SPEV, respectively. Once a confluent monolayer was formed, the growth medium was decanted from the flasks, and the monolayer was washed twice with medium and treated with a mixture of 0.25% trypsin (PanEko, Russia) and 0.02% Versene (PanEko, Russia) in the ratio 1:5. The cell suspension at a concentration of 10 4 -10 5 cells/ml was resuspended in medium supplemented with 1% penicillin/streptomycin (BioNit, BiAgro, Russia) and 10% heat-inactivated bovine serum (Biosera, France) and further used for virus isolation. The PPV6 positive serum sample was centrifuged at 2500 x g for 10 min, then the supernatant was added to the cell suspension (in the ratio 1:50) and seeded into the 24-well culture plates (Nunc, Thermo Scientific, USA). Preliminary adsorption of cells with the virus was not carried out. After 4–5 days of cultivation at 37°C in a 5% CO 2 atmosphere, when the monolayer formed, virus was harvested by three freeze-thaw cycles (-70°C and + 8°C), followed by the removal of cellular debris by centrifugation at 3000 x g for 15 minutes. The supernatant was aliquoted and identified as passage No. 1. Six serial passages were performed, and PPV6 replication was confirmed by qPCR. Cytological investigation Using the above-mentioned method, we infected cell cultures on sterile coverslips in a 6-well plate (Nunc, Thermo Scientific, USA) and incubated them at 37°C with 5% CO 2 .After a confluent monolayer formed, the growth medium was gently replaced (the monolayer was not washed). Infected PPV6 and mock-infected coverslips were fixed in a fixative (ethyl alcohol and Azure-Eosin dye in a ratio of 15:1) for 30 minutes at room temperature. Coverslips were then thoroughly washed with distilled water and stained with Azure-Eosin (Sigma, Aldrich, USA), according to the Giemsa staining method. The stained coverslips were dried at room temperature and placed in a synthetic balm (Bio-Optica, BioMount, Italy). Cells were viewed at 20X–100X magnification on a Zeiss Axio Scope 1 light microscope (Carl Zeiss Microscopy GmbH, Germany). An ADF PRO 08 camera with a suitable microscope interface was used to obtain images. For acridine orange staining (AO), PPV6-infected and mock-infected cells were seeded into 24-well plates. After forming a confluent monolayer, the cells were fixed and stained in accordance with Bartzatt R. ( 2016 ) guidelines. For dark field microscopic examination, an ultraviolet microscope, the Zeiss Axio Scope 1 (Carl Zeiss Microscopy GmbH, Germany), in the wavelengths between 505 and 530 nm, was utilized. Results Identification and prevalence of PPV6 in the investigated regions A total of 521 serum samples from piglets, sows, and boars from seven pig farms in seven regions of Russia were screened during the period 2021–2022. The genome of PPV6 was detected in four regions (Table 2 ). The prevalence varied between different ages, with the highest found in 19 piglets aged 120–171 days (32.2%) and nine sows 2–3 years old (20.9%) in Krasnoyarsk Krai. In the Tomsk Region, PPV6 DNA was found in the blood sera of 13 piglets at the age of 176 days (14.3%); in the Kemerovo Region, it was found in 7 blood sera (11.9%) from boars imported to the farm for reproduction. In the Moscow Region, only one positive case (2.4%) was identified. However, PPV6 was not detected in a number of regions (Vologda and Sverdlovsk Regions, and the Republic of Buryatia). The overall PPV6 prevalence in the studied regions of Russia was 9.4% (n = 521). Table 2 Detection of PPV6 DNA in pig farms during 2021 to 2022. Region/pig farm Age Category Positive/ Total tested (prevalence %) Total prevalence in pig farm Vologda Region Not determined 0/38 (0%) 0/38 (0%) Republic of Buryatia Sows 0/20 (0%) 0/93 (0%) Weaned piglets 0/30 (0%) Fattening pigs 0/43 (0%) Moscow Region Not determined 1/42 (2,4%) 1/42 (2.4%) Kemerovo Region Sows 0/8 (0%) 7/59 (11.9%) Boars, age is not determined 7/51 (13.7%) Tomsk Region Fattening pigs 13/91 (14.3%) 13/91 (14.3%) Sverdlovsk Region Fattening pigs 0/44 (0%) 0/44 (0%) Krasnoyarsk Krai Sows 9/43 (20.9%) 28/154 (18.2%) Weaned piglets 0/52 (0%) Fattening pigs 19/59 (32.2%) Age Category: Sows (aged 2–3 years), fattening piglets (aged 3–9 months), weaned piglets (aged 20–60 days) Phylogenetic Analysis of PPV6 isolate The complete nucleotide sequence of the PPV6 capsid protein (Kem-8 isolate) was obtained from a PPV6-positive serum sample of the boar from the Kemerovo region. The sequence was 3567 bp in size and deposited at GenBank (OR001791). The obtained sequence was phylogenetically analyzed with 38 reference strains presented in GenBank (Fig. 1 ). The Kem-8 isolate was closely related to the reference strains; the identity between them varied from 95–100% at the level of ORF2 nucleotides. Phylogenetic analysis showed that this isolate was grouped in the same clade as European isolates from Spain and Poland. Its nucleotide identity with the Spanish isolate 3456/2012 (MH558679) was 100%, and with the Polish strains K13-8 (KX384813) and K17-3 (KX384821), it was 98%. Porcine parvovirus 6 isolation and in vitro characterization For virus isolation, the Kem-8 PPV6-positive sample (Ct value of 16.23) was used. All cell cultures were confirmed to be free of contamination with PCV2, CSFV, BVDV, PRRSV, and PPV1-6 before being used for PPV6 isolation. Six consecutive passages in the continuous cell cultures (SPEV, ST, and PK) were carried out. During a light microscope examination of PPV6-infected cell cultures, we observed the natural processes of cell growth, which were indistinguishable from those in mock-infected ones. Only a small number of non-adherent cells floating in the growth medium were noted. By qPCR, we have evaluated the replication of PPV6 in vitro . When cell cultures were cultivated for 4–5 days post-infection, the Ct values ranged between 16.48 and 16.99 in SPEV and 16.69 and 17.09 in SK cell cultures, respectively. In the case of prolonged cultivation up to 6–7 days, there was a progressive loss (Ct 24–27) of PPV6 in cell cultures. In the ST, PPV6 accumulated in smaller amounts (Ct 23.62–24), and the amount of viral DNA decreased with each passage. Cytomorphological changes in PPV6-infected cell cultures Acridine Orange Staining. To evaluate the replication of PPV6 in infected cell cultures, we applied acridine orange staining. Typical apoptotic features, such as changes in the nucleus shape and its condensation, were observed in PPV6-infected cells, which acquired a more intense yellow-green color compared to mock-infected ones that had a uniform green color (Fig. 2 ). In addition, destructive DNA fragmentation was noticeable in the PPV6infected cells. The chromatin in these cells was irregularly distributed throughout the cytoplasm. The virus mostly replicated in cell cultures of SPEV and SK and, to a lesser extent, in ST (Fig. 2 ). Azure-Eosin Staining To determine the morphological changes in cells caused by PPV6, we applied Azure-Eosin Giemsa staining method. It was observed that in PPV6-infected SK cells (Fig. 3 B), the cell nuclei, increasing in size, acquired a brighter color compared to the mock-infected ones (Fig. 3 A). Mock-infected SK cells contained polygonal epithelial-like cells with round or oval nuclei. The ratio of the nucleus and cytoplasm was 1:1. The nuclei contained 1–3 nucleoli. Vacuoles of various sizes were in the cytoplasm. The large vacuoles were located near the nucleus. Cell borders were clearly defined. There were cells in the population that contained two nuclei. In some PPV6-infected cells, the shape and size of the nuclei and nucleoli had changed. It was noticed that the nucleoli in the affected cells also increased in size. Moreover, chromatin margination and clumping inside the nuclei (Fig. 3 D) and some pathological mitoses were observed. In binuclear cells, an enlargement of nuclei and cytoplasm, and karyorrhexis were noticed (Fig. 3 C). In some cells, colchicine-like metaphases and lagging of chromosomes in metaphase, which are characteristic of tumor cells, were observed. In others, swelling of the chromosomes and their clumping were noted. The examination of mock-infected SPEV cell cultures revealed mainly epithelial-like cells. There were also 6–12 small cells grouped together. The cytoplasm of the cells was homogeneous, foamy, and vacuolated. Cell nuclei were round or oval with 2–5 nucleoli. Also, in mock-infected SPEV, there were cells with enlarged nuclei as well as binuclear cells with light, fine-grained cytoplasm. Cells with enlarged nuclei contained only 1–3 nucleoli. A multi-layer growth of the culture was observed. Morphological changes in the PPV6-infected SPEV cells were almost the same as in the SK. However, in some nuclei, the integrity of the nuclear membrane was broken. The nucleoli in such cells were swollen and enlarged, and their shape was changed. Karyopyknosis and a multinucleated giant cell in which the nucleus was disintegrated into small parts (Fig. 4 C) were found. In addition to nuclear condensation and chromatin margination, clumping of binuclear cells was noted. Obvious vacuolization in the cell’ cytoplasm and the formation of symplasts were also observed (Fig. 4 D), which, as a rule, were small and contained three to five nuclei. Discussion Despite its recent discovery in 2014 in China, the PPV6 has been found in many countries around the world (Kim et al. 2021 ; Miłek et al. 2019 ; Ni et al. 2014 ; Schirtzinger et al. 2015 ). During the large-scale studies in Poland, PPV6 was identified on 16 farms out of 19 and was the second most detected virus in 10.7% (n = 150) of oral fluids pools, 10.0% (n = 254) of serum pools, and 3.6% (n = 252) of fecal pools (Miłek et al. 2019 ). A high detection rate of PPV6 (21.5%; n = 1000) was also demonstrated in South Korea by Kim S.C. et al. (2022). In addition, 16.3% (n = 171) of positive cases were reported in China (Ni et al. 2014 ). However, there is no data on the PPV6 circulation in Russia. Consequently, the purpose of our study was to investigate whether the virus was circulating in pig farms in Russia and study its prevalence in some regions. The results of our studies showed that 9.4% (n = 521) of tested samples were positive for PPV6. Viral DNA was found in four regions out of seven: 18.2% (n = 154) in the Krasnoyarsk Krai, 14.3% (n = 91) in Tomsk, 11.9% (n = 59) in Kemerovo, and 2.4% (n = 42) in the Moscow Regions, respectively. Phylogenetic analysis of the capsid protein gene of the Kem-8 isolate showed complete nucleotide identity with the Spanish isolate 3456/2012 (MH558679), which is close to the Polish isolates. The 3456/2012 isolate from Spain was detected in pools of tissue from healthy animals, and the association between PPV6 infection and clinical manifestations in pigs has not been reported (Franzo et al. 2019 ). The clade also included the Canadian isolate SK CA (MH820262), the US isolates KSU4-NE (KR709265) and KSU7-SD (KR709268). It is known that the application of contaminated semen could lead to rapid pathogen transmission and disease outbreaks among sows (Maes et al. 2016 ). During PPV1 infection, it has been confirmed that boars excrete the virus with semen and play a certain role in the virus dissemination (Maes et al. 2016 ; Mengeling and Cutlip 1976 ). For PPV6, these data have not been studied. The detection of PPV6 in boars imported for reproduction is of scientific interest and highlights the particular need to test them for various viral infections, including novel parvoviruses, before being used in insemination. The serum samples from Krasnoyarsk Krai were obtained from pigs of three different age groups: weaned piglets, fattening piglets, and sows. Therefore, we decided to analyze the spread of PPV6 among them. We determined that the PPV6 prevalence in fattening piglets (aged 3–9 months) was 32.2% (n = 59) and in sows (aged 2–3 years) − 20.9% (n = 43), respectively. In weaned piglets (aged 20–60 days), the PPV6 DNA was not detected. Similar results of PPV6 distribution among fattening piglets were reported in the investigations of Miłek D. et al. ( 2019 ) and Ni J et al. ( 2014 ). A low prevalence of PPV6 among weaned piglets (3.6%) and sows (10.5%) and a high prevalence among fattening piglets (21.5–36.5%) were determined in the studies of Kim S.C. et al. (2022). It can be speculated that the significant prevalence of PPV6 among fattening piglets is due to the decrease in maternal antibodies level (Miłek et al. 2019 ). It is assumed, that a significantly higher virus detection rate in sows may indicate a chronic course of the infection (Miłek et al. 2019 ). However, the pathogenic role of PPV6 in the porcine organism has not been determined yet, as the virus has never been isolated in cell cultures and the experimental infection of pigs has not been carried out. Ni J. et al. ( 2014 ) attempted to isolate PPV6 in PK-15, Vero, and Marc-145 cell cultures. However, the virus did not replicate in these cultures. In order to identify the cell system that provides the highest accumulation of the virus, we carried out PPV6 isolation in the continuous cell cultures (SPEV, SK and ST). As the concentration of viral DNA in the Kem-8 sample was the highest, we decided to use it for virus isolation. It is known that for the reproduction of parvoviruses in cell cultures, components of the DNA-synthesizing apparatus of the host cell, in particular alpha and gamma DNA polymerases, which are synthesized in the S-phase of the cell cycle, are needed (Mészáros et al. 2017 ; Orlyankin et al. 1984 ). Therefore, cell cultures with high mitotic activity are required for virus isolation. Consequently, the infection of cell cultures must be carried out at the time of the cells’ seeding or 20–24 h after it (Elias et al. 2004 ; Orlyankin et al. 1984 ). We introduced PPV6 to the cell suspension at the time of seeding in the plate without prior adsorption of the virus by cells. In each cell line, we conducted six serial passages. For each new passage of the virus, a cell lysate from the previous passage obtained by three cycles of freezing and thawing was used. During microscopic examination, we did not observe obvious differences between infected and mock-infected cell cultures. In the case of PPV1 infection, the cytopathogenic effect (CPE) in cell culture appeared when cells were infected with a high multiplicity of infection (MOI) At low MOI, CPE does not appear (Fernandes et al. 2017; Orlyankin et al. 1984 ). It is known that cell apoptosis is a hallmark of all known parvoviruses (Jager et al. 2021 ; Mészáros et al. 2017 ; Streck and Truyen 2020 ; Zhang et al. 2015 ; Zhao et al. 2016 ). To identify, whether the apoptotic changes occurred in infected cell cultures, we applied acridine orange staining. This dye, when embedded in a DNA molecule, helps to detect apoptotic cells by the characteristic bright yellow-green glow of the nucleus. Viable cells exhibit diffuse green fluorescence (Bartzatt 2016 ; Zhao et al. 2016 ). We also observed a bright yellow-green DNA fluorescence in infected cell cultures, which indicated an increase in the amount of DNA in the nuclei of infected cell cultures compared to the mock-infected ones. In the ST cell culture, apoptosis was less manifest. By qPCR, we also determined that PPV6 did not accumulate in this culture as the level of Ct increased with each passage. So, further investigation of PPV6 in this culture was suspended. The qPCR results showed that the most promising cultures for PPV6 isolation are SPEV and SK. During virus cultivation, it is very important to pay attention to the cells’ concentration and to their division process, as in cell culture with a formed monolayer, PPV6 does not replicate. These results are consistent with the literature data reporting that parvoviruses practically do not replicate in cell cultures with a complete monolayer (Mészáros et al. 2017 ; Orlyankin et al. 1984 ; Streck et al. 2015 ; Zhang et al. 2015 ). Staining of infected cells with Azure-Eosin allowed us to study in detail the morphological changes that occurred in PPV6-infected cells. We observed common signs of PPV6 infection in SPEV and SK cell cultures as swelling or enlargement of nuclei and nucleoli; pyknosis of nuclei; DNA fragmentation, chromatin margination, nuclear condensation; formation of symplasts containing 5 to 7 nuclei; and an increase in the number of various pathological mitoses. In some infected cells, we have also noted colchicine-like metaphases and metaphase lagging, which are characteristics of tumor cells. It is known that H-1 parvovirus has the ability to selectively infect and lyse cancer cells and is widely used in oncological therapy (Telerman et al. 1993 ). At the same time, there is no data on the oncotropism of PPV6, and its application in oncotherapy warrants further investigation. Conclusions In the presented study, we have identified PPV6 in pig herds in Russia. To the best of our knowledge, this is the first report on the identification of PPV6 in the country. The finding of PPV6 in boar-sire emphasizes the necessity to analyze the semen in order to clarify whether the virus can be transmitted through insemination, which might play a significant role in the virus distribution. The isolation and in vitro characterization of PPV6 is the first major step that will enable us to study this novel parvovirus, its interaction with the pig immune system, its pathogenesis, and its effect on the pork industry. In addition, further epidemiological studies are required on the possible routes of the virus entry and spread in swine herds. Declarations Compliance with ethical standards Ethics Statement The samples used in this study originated from pig submissions to the Laboratory of Biochemistry and Molecular Biology of the Federal State Budget Scientific Institution “Federal Scientific Center VIEV” for diagnostic studies. The protocol for this study was approved by the Ethical and Animal Welfare Committee of the Federal State Budget Scientific Institution “Federal Scientific Center VIEV”, (Moscow, Russia). Conflicts of interest . The authors declare that no conflicts of interest exist. Declarations. The study was carried out within the framework of State Assignment No. FGUG-2022-00010 of the Federal State Budget Scientific Institution “Federal Scientific Center VIEV”, Moscow, Russia. Data availability statement . The capsid protein of PPV6 of the Kem8 isolate was deposited in GenBank under accession numbers OR001791. Author contributions. Conceptualization, AK, AM, NK and AG; AK, AM, and AG conceived and designed the study. AK and AM conducted the experiments. AK, AM, NK and AG analyzed the data and wrote the original draft. All authors have reviewed and approved the final manuscript. References Bartzatt R (2016) Acridine orange staining of virus infected host cells to monitor proliferation of viral infection Chemistry Faculty Publications 27 Cotmore SF, Agbandje-McKenna M, Canuti M, Chiorini JA, Eis-Hubinger AM, Hughes J, Mietzsch M, Modha S, Ogliastro M, Pénzes JJ, Pintel DJ, Qiu J, Soderlund-Venermo M, Tattersall P, Tijssen P (2019) Ictv Report Consortium. ICTV Virus Taxonomy Profile: Parvoviridae. J Gen Virol 100(3):367–368. 10.1099/jgv.0.001212 Cságola A, Lőrincz M, Cadar D, Tombácz K, Biksi I, Tuboly T (2012) Detection, prevalence and analysis of emerging porcine parvovirus infections. ArchVirol 157:1003–1010. 10.1007/s00705-012-1257-3 Cui J, Fan J, Gerber PF, Biernacka K, Stadejek T, Xiao CT (2017) Opriessnig T. First identification of porcine parvovirus 6 in Poland. Virus Genes 53:100–104. 10.1007/s11262-016-1386-y Elias D, Eliasova E, Paulik S, Pistl J (2004) Isolation of four strains of porcine parvovirus in Slovak Republic. Bulletin- Veterinary Institute in Pulawy 48(2):85–88 Fernandes S, Boisvert M, Szelei J, Tijssen P (2014) Differential replication of two porcine parvovirus strains in bovine cell lines ensues from initial DNA processing and NS1 expression. J Gen Virol 95(Pt 4):910–921. 10.1099/vir.0.059741-0 Franzo G, Kekarainen T, Llorens A, Correa-Fiz F, Segalés J (2019) Exploratory metagenomic analyses of periweaning failure-to-thrive syndrome-affected pigs. Vet Rec. 5;184(1):25. doi: 10.1136/vr.105125 Guo Y, Yan G, Chen S, Han H, Li J, Zhang H, Luo S, Liu M, Wu Q, Li Q, Tu C, Huang L, Gong W (2022) Identification and genomic characterization of a novel porcine parvovirus in China. Front Vet Sci. 2022 9:1009103. doi: 10.3389/fvets.2022.1009103 Jager MC, Tomlinson JE, Lopez-Astacio RA, Parrish CR, Van de Walle GR (2021) Small but mighty: old and new parvoviruses of veterinary significance. Virol J 18(1):210. 10.1186/s12985-021-01677-y Kim SC, Jeong CG, Nazki S, Lee SI, Baek YC, Jung YJ, Kim WI (2021) Evaluation of a multiplex PCR method for the detection of porcine parvovirus types 1 through 7 using various field samples. PLoS ONE 16(1):e0245699. 10.1371/journal.pone.0245699 Kim SC, Kim JH, Kim JY, Park GS, Jeong CG, Kim WI (2022) Prevalence of porcine parvovirus 1 through 7 (PPV1-PPV7) and co-factor association with PCV2 and PRRSV in Korea. BMC Vet Res 18(1):133. 10.1186/s12917-022-03236-1 Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33:1870–1874 Maes D, Van Soom A, Appeltant R, Arsenakis I, Nauwynck H (2016) Porcine semen as a vector for transmission of viral pathogens. Theriogenology 85(1):27–38. 10.1016/j.theriogenology.2015.09.046 Mengeling WL, Cutlip RC (1976) Reproductive disease experimentally induced by exposing pregnant gilts to porcine parvovirus. Am J Vet Res 37(12):1393–1400 Mészáros I, Olasz F, Cságola A, Tijssen P, Zádori Z (2017) Biology of Porcine Parvovirus (Ungulate parvovirus 1). Viruses 9(12):393. 10.3390/v9120393 Miłek D, Woźniak A, Guzowska M, Stadejek T (2019) Detection Patterns of Porcine Parvovirus (PPV) and Novel Porcine Parvoviruses 2 through 6 (PPV2-PPV6) in Polish Swine Farms. Viruses 24(5):474. 10.3390/v11050474 Miłek D, Woźniak A, Podgórska K, Stadejek T (2020) Do porcine parvoviruses 1 through 7 (PPV1-PPV7) have an impact on porcine circovirus type 2 (PCV2) viremia in pigs? Vet Microbiol 242:108613. 10.1016/j.vetmic.2020.108613 Ni J, Qiao C, Han X, Han T, Kang W, Zi Z, Cao Z, Zhai X, Cai X (2014) Identification and genomic characterization of a novel porcine parvovirus (PPV6) in China. Virol J 11:203. 10.1186/s12985-014-0203-2 Opriessnig T, Xiao C-T, Gerber PF, Halbur PG (2014) Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease. VetMicrobiol 173:9–16. 10.1016/j.vetmic.2014.06.024 Orlyankin BG, Kosheleva LV, Savich OM (1984) Isolation and study of some biological properties of porcine parvovirus. Bull VIEV 55:98–100 [In Russian] Schirtzinger EE, Suddith AW, Hause BM, Hesse RA (2015) First identification of porcine parvovirus 6 in North America by viral metagenomic sequencing of serum from pigs infected with porcine reproductive and respiratory syndrome virus. Virol J 12:170. 10.1186/s12985-015-0401-6 Streck AF, Canal CW, Truyen U (2015) Molecular epidemiology and evolution of porcine parvoviruses. Infect Genet Evol 36:300–306. 10.1016/j.meegid.2015.10.007 Streck AF, Truyen U (2020) Porcine Parvovirus. Curr Issues Mol Biol 37:33–46. 10.21775/cimb.037.033 Telerman A, Tuynder M, Dupressoir T, Robaye B, Sigaux F, Shaulian E, Oren M, Rommelaere J, Amson R (1993) A model for tumor suppression using H-1 parvovirus Proc Natl AcadSci U S A. 90(18):8702–8706. 10.1073/pnas.90.18.8702 Xiao CT, Gerber PF, Giménez-Lirola LG, Halbur PG, Opriessnig T (2013a) Characterization of porcine parvovirus type 2 (PPV2) which is highly prevalent in the USA. Vet Microbiol 25(3–4):325–330. 10.1016/j.vetmic.2012.07.038 Xiao CT, Giménez-Lirola LG, Halbur PG, Opriessnig T (2012) Increasing porcine PARV4 prevalence with pig age in the U.S. pig population. Vet Microbiol. 7;160(3–4):290-6. doi: 10.1016/j.vetmic.2012.05.038 Xiao CT, Giménez-Lirola LG, Jiang YH, Halbur PG, Opriessnig T (2013b) Characterization of a novel porcine parvovirus tentatively designated PPV5. PLoS One. 7;8(6):e65312. doi: 10.1371/journal.pone.0065312 Zhang H, Huang Y, Du Q, Luo X, Zhang L, Zhao X, Tong D (2015) Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway. BiochemBiophys Res Commun 9(2):649–655. 10.1016/j.bbrc.2014.12.011 Zhao X, Xiang H, Bai X, Fei N, Huang Y, Song X, Zhang H, Zhang L, Tong D (2016) Porcine parvovirus infection activates mitochondria-mediated apoptotic signaling pathway by inducing ROS accumulation. Virol J 13:26. 10.1186/s12985-016-0480-z Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 29 Sep, 2023 Read the published version in Veterinary Research Communications → Version 1 posted Editorial decision: Major revision 29 Aug, 2023 Reviews received at journal 25 Aug, 2023 Reviewers agreed at journal 07 Aug, 2023 Reviewers invited by journal 04 Aug, 2023 Editor assigned by journal 02 Aug, 2023 Submission checks completed at journal 02 Aug, 2023 First submitted to journal 02 Aug, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3228149","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":223666625,"identity":"b4d7d3c9-e4a2-4db0-a2d6-8f96ad6801ec","order_by":0,"name":"Alina Komina","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYBACCSA+AGbxMINoZpK0sCUQrwUCeHgMiNMi2d6deLighkGegefMN4mfO6zlDA7wPpPAp0Wa5+yGwzOOMRg28PZuk+w9k24s2cBuhleLnETuhsM8bAyMDfy82yR42w4n9jOwsRGh5R+DfQM/zzPJv22H69sIaZEGaeFtY0hs4O1hkwbaksBPSItkD9AvvH0SyW08x4ytZdvSDWc2szFb4NMicbx382eebza2/TzJD2++bbOWNzjexngDnxaYTgY2BgYWiHuIiBo4YP5AguJRMApGwSgYQQAAvns+4KcQ958AAAAASUVORK5CYII=","orcid":"","institution":"Federal State Budget Scientific Institution “Federal Scientific Center VIEV”","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Alina","middleName":"","lastName":"Komina","suffix":""},{"id":223666626,"identity":"1182d78b-608c-495f-99f3-0d939bfe3879","order_by":1,"name":"Afshona Anoyatbekova","email":"","orcid":"","institution":"Federal State Budget Scientific Institution “Federal Scientific Center VIEV”","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Afshona","middleName":"","lastName":"Anoyatbekova","suffix":""},{"id":223666627,"identity":"ef047f33-c406-4401-90bc-f5524e47a116","order_by":2,"name":"Nikita Krasnikov","email":"","orcid":"","institution":"Federal State Budget Scientific Institution “Federal Scientific Center VIEV”","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nikita","middleName":"","lastName":"Krasnikov","suffix":""},{"id":223666628,"identity":"885d5e29-d9fb-41d1-bfb8-59ef55328e11","order_by":3,"name":"Anton Yuzhakov","email":"","orcid":"","institution":"Federal State Budget Scientific Institution “Federal Scientific Center VIEV”","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anton","middleName":"","lastName":"Yuzhakov","suffix":""}],"badges":[],"createdAt":"2023-08-02 13:44:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3228149/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3228149/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11259-023-10226-7","type":"published","date":"2023-09-29T15:01:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":41263589,"identity":"9e1e9ed8-fb1c-4d1c-825b-230f5238af9a","added_by":"auto","created_at":"2023-08-08 17:32:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":19291,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree based on the alignment of the complete nucleotide sequence of the capsid protein gene of the PPV6 Kem-8 isolate (marked with a black circle). The resulting tree was midpoint-rooted, and the scale bar indicates the substitution rates. The topology of the trees was confirmed by 1000 bootstrap replications. Node supports are shown at each node.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3228149/v1/978225b5deaa0c4c5665977b.png"},{"id":41263592,"identity":"a834aa05-5b83-43b9-af8b-5297efae4d3b","added_by":"auto","created_at":"2023-08-08 17:32:04","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":119067,"visible":true,"origin":"","legend":"\u003cp\u003ePPV6-infected and mock-infected cells under fluorescence microscopy after AO staining, magnification 200x. (А) mock-infected cell culture ST; (B) PPV6-infected ST; (С) mock-infected SK; (D) PPV6-infected SK; (E) mock‑infected SPEV; (F) PPV6-infected SPEV. PPV6-infected cells are stained bright yellow-green, some of which are indicated by arrows.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3228149/v1/bfb18b4cb92d63e32f18dd91.jpg"},{"id":41263591,"identity":"aebcf784-8e11-4a10-ba51-12baa3db22ef","added_by":"auto","created_at":"2023-08-08 17:32:04","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":87011,"visible":true,"origin":"","legend":"\u003cp\u003eCytological staining of the PPV6-infected and mock infected SK with Azure-Eosin according to Giemsa staining method. (А) mock-infected SK, magnification 200х; (B) PPV6-infected SK, magnification 200х; (С) Enlargement of the nucleus and cytoplasm of the binuclear cell (1C) and karyorrhexis (2C) in the SK culture, magnification 1000х; (D) chromatin margination and clumping inside the cytoplasm magnification 1000х\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3228149/v1/27338a4ca1f6c7bfbdef6b79.jpg"},{"id":41263590,"identity":"259af900-bf99-4e32-8e97-4cd4d13c524d","added_by":"auto","created_at":"2023-08-08 17:32:04","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":106743,"visible":true,"origin":"","legend":"\u003cp\u003eCytological staining of the PPV6-infected and mock- infected SPEV with Azure-Eosin according to Giemsa staining method. (А) mock-infected SPEV, magnification 630x; (B) PPV6-infected SPEV, magnification 400х; (С) Multinucleated giant cell with enlarged cytoplasm and disintegration of the nucleus into small parts, magnification 1000х; (D) Karyopyknotic cells - homogeneous, intensely stained, and wrinkled nucleus (1D) and the formation of symplast (2D), magnification 1000х\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3228149/v1/4c8e3af446ad03918c037666.jpg"},{"id":43974532,"identity":"ff1285ca-eb98-479a-9a56-aa7c83af5a5a","added_by":"auto","created_at":"2023-10-02 15:08:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":623200,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3228149/v1/a4daa85e-6db7-4ea7-9183-86e1cbf38560.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification and in vitro characterization of a novel porcine parvovirus 6 in Russia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eParvoviruses are non-enveloped, single-stranded DNA viruses of the family \u003cem\u003eParvoviridae\u003c/em\u003e that infect animals of various species and humans worldwide (Cotmore et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Jager et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Streck and Truyen \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). For the pig industry, porcine parvovirus type 1 (PPV1) is of great interest due to the significant economic losses (Jager et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Streck and Truyen \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The infection with PPV1 is contagious and causes severe reproductive failure in sows (M\u0026eacute;sz\u0026aacute;ros et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Streck and Truyen \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Through the introduction of modern molecular genetic diagnostic methods into veterinary practice, it became possible to detect new types of porcine parvoviruses (PPV2-PPV8). All these parvoviruses have been found in pigs of various ages in different countries (Cs\u0026aacute;gola et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Jager et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Miłek et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Schirtzinger et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Streck et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In the Russian Federation, the circulation of novel porcine parvoviruses has not been described. Unlike PPV1, the precise role of other identified porcine parvoviruses in the infectious pathology of swine has not yet been defined (Miłek et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Schirtzinger et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, many studies have reported their co-infection with porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circovirus 2 (PCV-2) in pigs manifesting post-weaning multisystemic wasting syndrome (Kim et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Miłek et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Opriessnig et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eParvoviridae\u003c/em\u003e family is divided into three subfamilies: \u003cem\u003eParvovirinae, Densovirinae\u003c/em\u003e, and Hamaparvovirinae. In turn, the subfamily \u003cem\u003eParvovirinae\u003c/em\u003e includes eight genera (Cotmore et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). All known porcine parvoviruses are subdivided into four genera in the subfamily \u003cem\u003eParvovirinae: Protoparvovirus\u003c/em\u003e (PPV1), \u003cem\u003eTetraparvovirus\u003c/em\u003e (PPV2, PPV3), \u003cem\u003eCopiparvovirus\u003c/em\u003e(PPV4, PPV5, and PPV6), and \u003cem\u003eChapparvovirus\u003c/em\u003e (PPV7) (Cotmore et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Jager et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Recently, an unclassified porcine parvovirus, provisionally named PPV8, was discovered in China (Guo et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOf all the novel porcine parvoviruses, only porcine parvovirus type 6 (PPV6) was originally detected as a pathogen in aborted pig fetuses in China (Ni et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). However, its association with clinical manifestations of the disease is ambiguous, as PPV6 DNA has been detected in both clinically ill and healthy pigs (Kim et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Since its first discovery, PPV6 has been confirmed in Brazil, South Korea, Spain, Poland, the USA, and Canada (Cui et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Miłek et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Schirtzinger et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Streck et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The PPV6 genome (~\u0026thinsp;6100 bp) contains two open reading frames (ORFs). ORF1 encodes a nonstructural protein (NS1) of 662 amino acids that functions as a viral replicase. ORF2 encodes the putative capsid protein (VP1) that is predicted to be 1189 amino acids in length (Cotmore et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Jager et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; M\u0026eacute;sz\u0026aacute;ros et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Streck and Truyen \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Despite the prevalence of PPV6 in many countries, the virus has not been isolated in cell cultures, and all of Koch's postulates have not been fulfilled yet.\u003c/p\u003e \u003cp\u003eIn this article, we describe the first identification of PPV6, its prevalence in pig farms in some regions of Russia, and its characterization \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSamples\u003c/h2\u003e \u003cp\u003eFive hundred twenty-one serum samples from pigs of different ages collected in the years between 2021 and 2022 from seven industrial pig farms located in Kemerovo, Tomsk, Vologda, Sverdlovsk Regions, the Republic of Buryatia, and Krasnoyarsk Krai were analyzed. Samples were stored at \u0026ndash; 70\u003csup\u003e0\u003c/sup\u003e C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eNucleic acid Extraction and Real-Time PCR (qPCR)\u003c/h2\u003e \u003cp\u003eNucleic acid was extracted by the commercial kit \"RIBO-prep RNA/DNA Kit\" (InterLabService, Russia) following the manufacturer\u0026rsquo;s instructions and stored at \u0026minus;\u0026thinsp;20\u003csup\u003e0\u003c/sup\u003eC. Real-time PCR was used to detect PPV6 in serum samples and to monitor the virus replication \u003cem\u003ein vitro\u003c/em\u003e using the primers and probes described in the article (Cui et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The samples with Ct\u0026thinsp;\u0026le;\u0026thinsp;35 were considered positive. For differential diagnosis, serum samples and cell cultures were analyzed for the presence of PCV-2, PRRSV, CSFV (classical swine fever virus), and BVDV (bovine viral diarrhea virus) using commercial PCR kits (Vetbiochem, Russia). For PPV1-PPV6 detection, we used primers and probes from the available published data (Ni et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Xiao et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2013a\u003c/span\u003e; Xiao et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Xiao et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2013b\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSequencing\u003c/h2\u003e \u003cp\u003eSequencing was conducted according to the Sanger method using self-designed, specific primers for the capsid protein gene (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDesigned primers for sequencing the PPV6 capsid gene. Primers were designed based on the reference sequence PPV6 isolate TJ (NC023860).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer pair\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct Size\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTa ℃\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTTCCTGACGACGCTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e904 bp (2159\u0026ndash;3062)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60,5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACAAAGAAGGCGTCTGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTCCCTTGTATGCAACAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e895 bp (3005\u0026ndash;3899)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e56,0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGTCTTCAGTTGATCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCCAGAAACTCCAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e861 bp (3817\u0026ndash;4677)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58,0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- R3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCGCCTCGAATAAGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6-F4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGGTTCAGGGTACACTTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e631 bp (4592\u0026ndash;5222)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60,5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- R4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGACATTGAGATCACTCCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- F5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGGTCACGGCTAATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e725 bp (5143\u0026ndash;5867)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e54,5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPV6- R5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATACAGTAGGCGGAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe 25 \u0026micro;l reaction mixture contained 5 \u0026micro;l of extracted DNA, 2.5 \u0026micro;l of 10X Taq Buffer (Alpha ferment, Russia), 0.5 \u0026micro;l of dNTPs mix (New England Biolabs, NEB, USA), 14.75 \u0026micro;l of Nuclease-Free water, 0.25 \u0026micro;l Taq Polymerase (Alpha ferment, Russia), and 10 pM each of forward and reverse primers. The PCR thermal cycle was as follows: 95\u0026deg;C for 2 min; 30 cycles of: 95\u0026deg;C for 30s, 54.5\u0026ndash;60.5\u0026deg;C for 30s, 72\u0026deg;C for 90s. The PCR products were analyzed on a 1% agarose gel containing Tris-acetate buffer solution (pH 8.0) and ethidium bromide (0.5 \u0026micro;g/mL). The amplified fragments from agarose gel were purified by the commercial kit for DNA purification from agarose gel (Evrogen, Russia) according to the manufacturer\u0026rsquo;s instructions. The purified DNA was sequenced by the Big Dye 3.1 Terminator Cycle Sequencing Kit (Applied Biosystems, USA) and carried out on the ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAlignment and Phylogenetic Analysis\u003c/h2\u003e \u003cp\u003eMultiple sequence alignment was performed using the MAFFT method in UGENE (v. 45.1) software. A phylogenetic tree was constructed by the Maximum Likelihood method and the General Time Reversible (G\u0026thinsp;+\u0026thinsp;I) model in MEGA 7.0 (Kumar et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The robustness of the tree topology was evaluated by 1000 bootstrap replications.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell Cultures and Virus Isolation\u003c/h2\u003e \u003cp\u003eContinuous cell cultures: SPEV (porcine embryonic kidney cell line), SK (swine kidney), and ST (swine testis) from the \"Collection of Cell Cultures of the Federal State Budget Scientific Institution \"Federal Scientific Center VIEV\", (Moscow, Russia) were used. These cell lines were cultured in the 25 cm2 tissue culture flasks\u0026rsquo; surface area (Corning, USA) at 37\u0026deg;C with 5% CO2. Minimum Essential Medium Eagle (PanEko, Russia) was used for ST and SK cultivation and the 199 Medium (PanEko, Russia) for SPEV, respectively. Once a confluent monolayer was formed, the growth medium was decanted from the flasks, and the monolayer was washed twice with medium and treated with a mixture of 0.25% trypsin (PanEko, Russia) and 0.02% Versene (PanEko, Russia) in the ratio 1:5. The cell suspension at a concentration of 10\u003csup\u003e4\u003c/sup\u003e-10\u003csup\u003e5\u003c/sup\u003e cells/ml was resuspended in medium supplemented with 1% penicillin/streptomycin (BioNit, BiAgro, Russia) and 10% heat-inactivated bovine serum (Biosera, France) and further used for virus isolation. The PPV6 positive serum sample was centrifuged at 2500 x g for 10 min, then the supernatant was added to the cell suspension (in the ratio 1:50) and seeded into the 24-well culture plates (Nunc, Thermo Scientific, USA). Preliminary adsorption of cells with the virus was not carried out. After 4\u0026ndash;5 days of cultivation at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere, when the monolayer formed, virus was harvested by three freeze-thaw cycles (-70\u0026deg;C and +\u0026thinsp;8\u0026deg;C), followed by the removal of cellular debris by centrifugation at 3000 x g for 15 minutes. The supernatant was aliquoted and identified as passage No. 1. Six serial passages were performed, and PPV6 replication was confirmed by qPCR.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCytological investigation\u003c/h2\u003e \u003cp\u003eUsing the above-mentioned method, we infected cell cultures on sterile coverslips in a 6-well plate (Nunc, Thermo Scientific, USA) and incubated them at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e.After a confluent monolayer formed, the growth medium was gently replaced (the monolayer was not washed). Infected PPV6 and mock-infected coverslips were fixed in a fixative (ethyl alcohol and Azure-Eosin dye in a ratio of 15:1) for 30 minutes at room temperature. Coverslips were then thoroughly washed with distilled water and stained with Azure-Eosin (Sigma, Aldrich, USA), according to the Giemsa staining method. The stained coverslips were dried at room temperature and placed in a synthetic balm (Bio-Optica, BioMount, Italy). Cells were viewed at 20X\u0026ndash;100X magnification on a Zeiss Axio Scope 1 light microscope (Carl Zeiss Microscopy GmbH, Germany). An ADF PRO 08 camera with a suitable microscope interface was used to obtain images.\u003c/p\u003e \u003cp\u003eFor acridine orange staining (AO), PPV6-infected and mock-infected cells were seeded into 24-well plates. After forming a confluent monolayer, the cells were fixed and stained in accordance with Bartzatt R. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) guidelines. For dark field microscopic examination, an ultraviolet microscope, the Zeiss Axio Scope 1 (Carl Zeiss Microscopy GmbH, Germany), in the wavelengths between 505 and 530 nm, was utilized.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eIdentification and prevalence of PPV6 in the investigated regions\u003c/h2\u003e \u003cp\u003eA total of 521 serum samples from piglets, sows, and boars from seven pig farms in seven regions of Russia were screened during the period 2021\u0026ndash;2022. The genome of PPV6 was detected in four regions (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The prevalence varied between different ages, with the highest found in 19 piglets aged 120\u0026ndash;171 days (32.2%) and nine sows 2\u0026ndash;3 years old (20.9%) in Krasnoyarsk Krai. In the Tomsk Region, PPV6 DNA was found in the blood sera of 13 piglets at the age of 176 days (14.3%); in the Kemerovo Region, it was found in 7 blood sera (11.9%) from boars imported to the farm for reproduction. In the Moscow Region, only one positive case (2.4%) was identified. However, PPV6 was not detected in a number of regions (Vologda and Sverdlovsk Regions, and the Republic of Buryatia). The overall PPV6 prevalence in the studied regions of Russia was 9.4% (n\u0026thinsp;=\u0026thinsp;521).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetection of PPV6 DNA in pig farms during 2021 to 2022.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRegion/pig farm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAge Category\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePositive/ Total tested (prevalence %)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTotal prevalence\u003c/p\u003e \u003cp\u003ein pig farm\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVologda Region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNot determined\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/38 (0%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/38 (0%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eRepublic of Buryatia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSows\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/20 (0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0/93 (0%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWeaned piglets\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/30 (0%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFattening pigs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/43 (0%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMoscow Region\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNot determined\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/42 (2,4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/42 (2.4%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eKemerovo Region\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSows\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/8 (0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e7/59 (11.9%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBoars, age is not determined\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7/51 (13.7%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTomsk Region\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFattening pigs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13/91 (14.3%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13/91 (14.3%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSverdlovsk Region\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFattening pigs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/44 (0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/44 (0%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eKrasnoyarsk Krai\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSows\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9/43 (20.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e28/154 (18.2%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWeaned piglets\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/52 (0%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFattening pigs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19/59 (32.2%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eAge Category: Sows (aged 2\u0026ndash;3 years), fattening piglets (aged 3\u0026ndash;9 months), weaned piglets (aged 20\u0026ndash;60 days)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic Analysis of PPV6 isolate\u003c/h2\u003e \u003cp\u003eThe complete nucleotide sequence of the PPV6 capsid protein (Kem-8 isolate) was obtained from a PPV6-positive serum sample of the boar from the Kemerovo region. The sequence was 3567 bp in size and deposited at GenBank (OR001791). The obtained sequence was phylogenetically analyzed with 38 reference strains presented in GenBank (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The Kem-8 isolate was closely related to the reference strains; the identity between them varied from 95\u0026ndash;100% at the level of ORF2 nucleotides. Phylogenetic analysis showed that this isolate was grouped in the same clade as European isolates from Spain and Poland. Its nucleotide identity with the Spanish isolate 3456/2012 (MH558679) was 100%, and with the Polish strains K13-8 (KX384813) and K17-3 (KX384821), it was 98%.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePorcine parvovirus 6 isolation and\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003echaracterization\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFor virus isolation, the Kem-8 PPV6-positive sample (Ct value of 16.23) was used. All cell cultures were confirmed to be free of contamination with PCV2, CSFV, BVDV, PRRSV, and PPV1-6 before being used for PPV6 isolation. Six consecutive passages in the continuous cell cultures (SPEV, ST, and PK) were carried out. During a light microscope examination of PPV6-infected cell cultures, we observed the natural processes of cell growth, which were indistinguishable from those in mock-infected ones. Only a small number of non-adherent cells floating in the growth medium were noted. By qPCR, we have evaluated the replication of PPV6 \u003cem\u003ein vitro\u003c/em\u003e. When cell cultures were cultivated for 4\u0026ndash;5 days post-infection, the Ct values ranged between 16.48 and 16.99 in SPEV and 16.69 and 17.09 in SK cell cultures, respectively. In the case of prolonged cultivation up to 6\u0026ndash;7 days, there was a progressive loss (Ct 24\u0026ndash;27) of PPV6 in cell cultures. In the ST, PPV6 accumulated in smaller amounts (Ct 23.62\u0026ndash;24), and the amount of viral DNA decreased with each passage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCytomorphological changes in PPV6-infected cell cultures\u003c/h2\u003e \u003cp\u003e \u003cb\u003eAcridine Orange Staining.\u003c/b\u003e To evaluate the replication of PPV6 in infected cell cultures, we applied acridine orange staining. Typical apoptotic features, such as changes in the nucleus shape and its condensation, were observed in PPV6-infected cells, which acquired a more intense yellow-green color compared to mock-infected ones that had a uniform green color (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In addition, destructive DNA fragmentation was noticeable in the PPV6infected cells. The chromatin in these cells was irregularly distributed throughout the cytoplasm. The virus mostly replicated in cell cultures of SPEV and SK and, to a lesser extent, in ST (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eAzure-Eosin Staining\u003c/h2\u003e \u003cp\u003eTo determine the morphological changes in cells caused by PPV6, we applied Azure-Eosin Giemsa staining method. It was observed that in PPV6-infected SK cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), the cell nuclei, increasing in size, acquired a brighter color compared to the mock-infected ones (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Mock-infected SK cells contained polygonal epithelial-like cells with round or oval nuclei. The ratio of the nucleus and cytoplasm was 1:1. The nuclei contained 1\u0026ndash;3 nucleoli. Vacuoles of various sizes were in the cytoplasm. The large vacuoles were located near the nucleus. Cell borders were clearly defined. There were cells in the population that contained two nuclei. In some PPV6-infected cells, the shape and size of the nuclei and nucleoli had changed. It was noticed that the nucleoli in the affected cells also increased in size. Moreover, chromatin margination and clumping inside the nuclei (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) and some pathological mitoses were observed. In binuclear cells, an enlargement of nuclei and cytoplasm, and karyorrhexis were noticed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In some cells, colchicine-like metaphases and lagging of chromosomes in metaphase, which are characteristic of tumor cells, were observed. In others, swelling of the chromosomes and their clumping were noted.\u003c/p\u003e \u003cp\u003eThe examination of mock-infected SPEV cell cultures revealed mainly epithelial-like cells. There were also 6\u0026ndash;12 small cells grouped together. The cytoplasm of the cells was homogeneous, foamy, and vacuolated. Cell nuclei were round or oval with 2\u0026ndash;5 nucleoli. Also, in mock-infected SPEV, there were cells with enlarged nuclei as well as binuclear cells with light, fine-grained cytoplasm. Cells with enlarged nuclei contained only 1\u0026ndash;3 nucleoli. A multi-layer growth of the culture was observed. Morphological changes in the PPV6-infected SPEV cells were almost the same as in the SK. However, in some nuclei, the integrity of the nuclear membrane was broken. The nucleoli in such cells were swollen and enlarged, and their shape was changed. Karyopyknosis and a multinucleated giant cell in which the nucleus was disintegrated into small parts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) were found. In addition to nuclear condensation and chromatin margination, clumping of binuclear cells was noted. Obvious vacuolization in the cell\u0026rsquo; cytoplasm and the formation of symplasts were also observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), which, as a rule, were small and contained three to five nuclei.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDespite its recent discovery in 2014 in China, the PPV6 has been found in many countries around the world (Kim et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Miłek et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ni et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Schirtzinger et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). During the large-scale studies in Poland, PPV6 was identified on 16 farms out of 19 and was the second most detected virus in 10.7% (n\u0026thinsp;=\u0026thinsp;150) of oral fluids pools, 10.0% (n\u0026thinsp;=\u0026thinsp;254) of serum pools, and 3.6% (n\u0026thinsp;=\u0026thinsp;252) of fecal pools (Miłek et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). A high detection rate of PPV6 (21.5%; n\u0026thinsp;=\u0026thinsp;1000) was also demonstrated in South Korea by Kim S.C. et al. (2022). In addition, 16.3% (n\u0026thinsp;=\u0026thinsp;171) of positive cases were reported in China (Ni et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). However, there is no data on the PPV6 circulation in Russia. Consequently, the purpose of our study was to investigate whether the virus was circulating in pig farms in Russia and study its prevalence in some regions.\u003c/p\u003e \u003cp\u003eThe results of our studies showed that 9.4% (n\u0026thinsp;=\u0026thinsp;521) of tested samples were positive for PPV6. Viral DNA was found in four regions out of seven: 18.2% (n\u0026thinsp;=\u0026thinsp;154) in the Krasnoyarsk Krai, 14.3% (n\u0026thinsp;=\u0026thinsp;91) in Tomsk, 11.9% (n\u0026thinsp;=\u0026thinsp;59) in Kemerovo, and 2.4% (n\u0026thinsp;=\u0026thinsp;42) in the Moscow Regions, respectively. Phylogenetic analysis of the capsid protein gene of the Kem-8 isolate showed complete nucleotide identity with the Spanish isolate 3456/2012 (MH558679), which is close to the Polish isolates. The 3456/2012 isolate from Spain was detected in pools of tissue from healthy animals, and the association between PPV6 infection and clinical manifestations in pigs has not been reported (Franzo et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The clade also included the Canadian isolate SK CA (MH820262), the US isolates KSU4-NE (KR709265) and KSU7-SD (KR709268).\u003c/p\u003e \u003cp\u003eIt is known that the application of contaminated semen could lead to rapid pathogen transmission and disease outbreaks among sows (Maes et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). During PPV1 infection, it has been confirmed that boars excrete the virus with semen and play a certain role in the virus dissemination (Maes et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Mengeling and Cutlip \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1976\u003c/span\u003e). For PPV6, these data have not been studied. The detection of PPV6 in boars imported for reproduction is of scientific interest and highlights the particular need to test them for various viral infections, including novel parvoviruses, before being used in insemination.\u003c/p\u003e \u003cp\u003eThe serum samples from Krasnoyarsk Krai were obtained from pigs of three different age groups: weaned piglets, fattening piglets, and sows. Therefore, we decided to analyze the spread of PPV6 among them. We determined that the PPV6 prevalence in fattening piglets (aged 3\u0026ndash;9 months) was 32.2% (n\u0026thinsp;=\u0026thinsp;59) and in sows (aged 2\u0026ndash;3 years) \u0026minus;\u0026thinsp;20.9% (n\u0026thinsp;=\u0026thinsp;43), respectively. In weaned piglets (aged 20\u0026ndash;60 days), the PPV6 DNA was not detected. Similar results of PPV6 distribution among fattening piglets were reported in the investigations of Miłek D. et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and Ni J et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). A low prevalence of PPV6 among weaned piglets (3.6%) and sows (10.5%) and a high prevalence among fattening piglets (21.5\u0026ndash;36.5%) were determined in the studies of Kim S.C. et al. (2022). It can be speculated that the significant prevalence of PPV6 among fattening piglets is due to the decrease in maternal antibodies level (Miłek et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). It is assumed, that a significantly higher virus detection rate in sows may indicate a chronic course of the infection (Miłek et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, the pathogenic role of PPV6 in the porcine organism has not been determined yet, as the virus has never been isolated in cell cultures and the experimental infection of pigs has not been carried out.\u003c/p\u003e \u003cp\u003eNi J. et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) attempted to isolate PPV6 in PK-15, Vero, and Marc-145 cell cultures. However, the virus did not replicate in these cultures. In order to identify the cell system that provides the highest accumulation of the virus, we carried out PPV6 isolation in the continuous cell cultures (SPEV, SK and ST). As the concentration of viral DNA in the Kem-8 sample was the highest, we decided to use it for virus isolation. It is known that for the reproduction of parvoviruses in cell cultures, components of the DNA-synthesizing apparatus of the host cell, in particular alpha and gamma DNA polymerases, which are synthesized in the S-phase of the cell cycle, are needed (M\u0026eacute;sz\u0026aacute;ros et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Orlyankin et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1984\u003c/span\u003e). Therefore, cell cultures with high mitotic activity are required for virus isolation. Consequently, the infection of cell cultures must be carried out at the time of the cells\u0026rsquo; seeding or 20\u0026ndash;24 h after it (Elias et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Orlyankin et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1984\u003c/span\u003e). We introduced PPV6 to the cell suspension at the time of seeding in the plate without prior adsorption of the virus by cells. In each cell line, we conducted six serial passages. For each new passage of the virus, a cell lysate from the previous passage obtained by three cycles of freezing and thawing was used. During microscopic examination, we did not observe obvious differences between infected and mock-infected cell cultures. In the case of PPV1 infection, the cytopathogenic effect (CPE) in cell culture appeared when cells were infected with a high multiplicity of infection (MOI) At low MOI, CPE does not appear (Fernandes et al. 2017; Orlyankin et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1984\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIt is known that cell apoptosis is a hallmark of all known parvoviruses (Jager et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; M\u0026eacute;sz\u0026aacute;ros et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Streck and Truyen \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). To identify, whether the apoptotic changes occurred in infected cell cultures, we applied acridine orange staining. This dye, when embedded in a DNA molecule, helps to detect apoptotic cells by the characteristic bright yellow-green glow of the nucleus. Viable cells exhibit diffuse green fluorescence (Bartzatt \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). We also observed a bright yellow-green DNA fluorescence in infected cell cultures, which indicated an increase in the amount of DNA in the nuclei of infected cell cultures compared to the mock-infected ones. In the ST cell culture, apoptosis was less manifest. By qPCR, we also determined that PPV6 did not accumulate in this culture as the level of Ct increased with each passage. So, further investigation of PPV6 in this culture was suspended. The qPCR results showed that the most promising cultures for PPV6 isolation are SPEV and SK. During virus cultivation, it is very important to pay attention to the cells\u0026rsquo; concentration and to their division process, as in cell culture with a formed monolayer, PPV6 does not replicate. These results are consistent with the literature data reporting that parvoviruses practically do not replicate in cell cultures with a complete monolayer (M\u0026eacute;sz\u0026aacute;ros et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Orlyankin et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Streck et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStaining of infected cells with Azure-Eosin allowed us to study in detail the morphological changes that occurred in PPV6-infected cells. We observed common signs of PPV6 infection in SPEV and SK cell cultures as swelling or enlargement of nuclei and nucleoli; pyknosis of nuclei; DNA fragmentation, chromatin margination, nuclear condensation; formation of symplasts containing 5 to 7 nuclei; and an increase in the number of various pathological mitoses. In some infected cells, we have also noted colchicine-like metaphases and metaphase lagging, which are characteristics of tumor cells. It is known that H-1 parvovirus has the ability to selectively infect and lyse cancer cells and is widely used in oncological therapy (Telerman et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). At the same time, there is no data on the oncotropism of PPV6, and its application in oncotherapy warrants further investigation.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn the presented study, we have identified PPV6 in pig herds in Russia. To the best of our knowledge, this is the first report on the identification of PPV6 in the country. The finding of PPV6 in boar-sire emphasizes the necessity to analyze the semen in order to clarify whether the virus can be transmitted through insemination, which might play a significant role in the virus distribution. The isolation and \u003cem\u003ein vitro\u003c/em\u003e characterization of PPV6 is the first major step that will enable us to study this novel parvovirus, its interaction with the pig immune system, its pathogenesis, and its effect on the pork industry. In addition, further epidemiological studies are required on the possible routes of the virus entry and spread in swine herds.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe samples used in this study originated from pig submissions to the Laboratory of Biochemistry and Molecular Biology of the Federal State Budget Scientific Institution \u0026ldquo;Federal Scientific Center VIEV\u0026rdquo; for diagnostic studies. The protocol for this study was approved by the Ethical and Animal Welfare Committee of the Federal State Budget Scientific Institution \u0026ldquo;Federal Scientific Center VIEV\u0026rdquo;, (Moscow, Russia).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e. The authors declare that no conflicts of interest exist.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations.\u003c/strong\u003e The study was carried out within the framework of State Assignment No. FGUG-2022-00010 of the Federal State Budget Scientific Institution \u0026ldquo;Federal Scientific Center VIEV\u0026rdquo;, Moscow, Russia.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e. The capsid protein of PPV6 of the Kem8 isolate was deposited in GenBank under accession numbers OR001791.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions.\u003c/strong\u003e Conceptualization, AK, AM, NK and AG; AK, AM, and AG conceived and designed the study. AK and AM conducted the experiments. AK, AM, NK and AG analyzed the data and wrote the original draft. All authors have reviewed and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBartzatt R (2016) Acridine orange staining of virus infected host cells to monitor proliferation of viral infection Chemistry Faculty Publications 27\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCotmore SF, Agbandje-McKenna M, Canuti M, Chiorini JA, Eis-Hubinger AM, Hughes J, Mietzsch M, Modha S, Ogliastro M, P\u0026eacute;nzes JJ, Pintel DJ, Qiu J, Soderlund-Venermo M, Tattersall P, Tijssen P (2019) Ictv Report Consortium. ICTV Virus Taxonomy Profile: Parvoviridae. J Gen Virol 100(3):367\u0026ndash;368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/jgv.0.001212\u003c/span\u003e\u003cspan address=\"10.1099/jgv.0.001212\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCs\u0026aacute;gola A, Lőrincz M, Cadar D, Tomb\u0026aacute;cz K, Biksi I, Tuboly T (2012) Detection, prevalence and analysis of emerging porcine parvovirus infections. ArchVirol 157:1003\u0026ndash;1010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00705-012-1257-3\u003c/span\u003e\u003cspan address=\"10.1007/s00705-012-1257-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui J, Fan J, Gerber PF, Biernacka K, Stadejek T, Xiao CT (2017) Opriessnig T. First identification of porcine parvovirus 6 in Poland. Virus Genes 53:100\u0026ndash;104. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11262-016-1386-y\u003c/span\u003e\u003cspan address=\"10.1007/s11262-016-1386-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElias D, Eliasova E, Paulik S, Pistl J (2004) Isolation of four strains of porcine parvovirus in Slovak Republic. Bulletin- Veterinary Institute in Pulawy 48(2):85\u0026ndash;88\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernandes S, Boisvert M, Szelei J, Tijssen P (2014) Differential replication of two porcine parvovirus strains in bovine cell lines ensues from initial DNA processing and NS1 expression. J Gen Virol 95(Pt 4):910\u0026ndash;921. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/vir.0.059741-0\u003c/span\u003e\u003cspan address=\"10.1099/vir.0.059741-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranzo G, Kekarainen T, Llorens A, Correa-Fiz F, Segal\u0026eacute;s J (2019) Exploratory metagenomic analyses of periweaning failure-to-thrive syndrome-affected pigs. Vet Rec. 5;184(1):25. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/vr.105125\u003c/span\u003e\u003cspan address=\"10.1136/vr.105125\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Y, Yan G, Chen S, Han H, Li J, Zhang H, Luo S, Liu M, Wu Q, Li Q, Tu C, Huang L, Gong W (2022) Identification and genomic characterization of a novel porcine parvovirus in China. Front Vet Sci. 2022 9:1009103. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fvets.2022.1009103\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2022.1009103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJager MC, Tomlinson JE, Lopez-Astacio RA, Parrish CR, Van de Walle GR (2021) Small but mighty: old and new parvoviruses of veterinary significance. Virol J 18(1):210. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12985-021-01677-y\u003c/span\u003e\u003cspan address=\"10.1186/s12985-021-01677-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim SC, Jeong CG, Nazki S, Lee SI, Baek YC, Jung YJ, Kim WI (2021) Evaluation of a multiplex PCR method for the detection of porcine parvovirus types 1 through 7 using various field samples. PLoS ONE 16(1):e0245699. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0245699\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0245699\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim SC, Kim JH, Kim JY, Park GS, Jeong CG, Kim WI (2022) Prevalence of porcine parvovirus 1 through 7 (PPV1-PPV7) and co-factor association with PCV2 and PRRSV in Korea. BMC Vet Res 18(1):133. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12917-022-03236-1\u003c/span\u003e\u003cspan address=\"10.1186/s12917-022-03236-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33:1870\u0026ndash;1874\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaes D, Van Soom A, Appeltant R, Arsenakis I, Nauwynck H (2016) Porcine semen as a vector for transmission of viral pathogens. Theriogenology 85(1):27\u0026ndash;38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.theriogenology.2015.09.046\u003c/span\u003e\u003cspan address=\"10.1016/j.theriogenology.2015.09.046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMengeling WL, Cutlip RC (1976) Reproductive disease experimentally induced by exposing pregnant gilts to porcine parvovirus. Am J Vet Res 37(12):1393\u0026ndash;1400\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026eacute;sz\u0026aacute;ros I, Olasz F, Cs\u0026aacute;gola A, Tijssen P, Z\u0026aacute;dori Z (2017) Biology of Porcine Parvovirus (Ungulate parvovirus 1). Viruses 9(12):393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v9120393\u003c/span\u003e\u003cspan address=\"10.3390/v9120393\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiłek D, Woźniak A, Guzowska M, Stadejek T (2019) Detection Patterns of Porcine Parvovirus (PPV) and Novel Porcine Parvoviruses 2 through 6 (PPV2-PPV6) in Polish Swine Farms. Viruses 24(5):474. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v11050474\u003c/span\u003e\u003cspan address=\"10.3390/v11050474\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiłek D, Woźniak A, Podg\u0026oacute;rska K, Stadejek T (2020) Do porcine parvoviruses 1 through 7 (PPV1-PPV7) have an impact on porcine circovirus type 2 (PCV2) viremia in pigs? Vet Microbiol 242:108613. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetmic.2020.108613\u003c/span\u003e\u003cspan address=\"10.1016/j.vetmic.2020.108613\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNi J, Qiao C, Han X, Han T, Kang W, Zi Z, Cao Z, Zhai X, Cai X (2014) Identification and genomic characterization of a novel porcine parvovirus (PPV6) in China. Virol J 11:203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12985-014-0203-2\u003c/span\u003e\u003cspan address=\"10.1186/s12985-014-0203-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOpriessnig T, Xiao C-T, Gerber PF, Halbur PG (2014) Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease. VetMicrobiol 173:9\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetmic.2014.06.024\u003c/span\u003e\u003cspan address=\"10.1016/j.vetmic.2014.06.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrlyankin BG, Kosheleva LV, Savich OM (1984) Isolation and study of some biological properties of porcine parvovirus. Bull VIEV 55:98\u0026ndash;100 [In Russian]\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchirtzinger EE, Suddith AW, Hause BM, Hesse RA (2015) First identification of porcine parvovirus 6 in North America by viral metagenomic sequencing of serum from pigs infected with porcine reproductive and respiratory syndrome virus. Virol J 12:170. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12985-015-0401-6\u003c/span\u003e\u003cspan address=\"10.1186/s12985-015-0401-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStreck AF, Canal CW, Truyen U (2015) Molecular epidemiology and evolution of porcine parvoviruses. Infect Genet Evol 36:300\u0026ndash;306. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.meegid.2015.10.007\u003c/span\u003e\u003cspan address=\"10.1016/j.meegid.2015.10.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStreck AF, Truyen U (2020) Porcine Parvovirus. Curr Issues Mol Biol 37:33\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.21775/cimb.037.033\u003c/span\u003e\u003cspan address=\"10.21775/cimb.037.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTelerman A, Tuynder M, Dupressoir T, Robaye B, Sigaux F, Shaulian E, Oren M, Rommelaere J, Amson R (1993) A model for tumor suppression using H-1 parvovirus Proc Natl AcadSci U S A. 90(18):8702\u0026ndash;8706. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.90.18.8702\u003c/span\u003e\u003cspan address=\"10.1073/pnas.90.18.8702\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao CT, Gerber PF, Gim\u0026eacute;nez-Lirola LG, Halbur PG, Opriessnig T (2013a) Characterization of porcine parvovirus type 2 (PPV2) which is highly prevalent in the USA. Vet Microbiol 25(3\u0026ndash;4):325\u0026ndash;330. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetmic.2012.07.038\u003c/span\u003e\u003cspan address=\"10.1016/j.vetmic.2012.07.038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao CT, Gim\u0026eacute;nez-Lirola LG, Halbur PG, Opriessnig T (2012) Increasing porcine PARV4 prevalence with pig age in the U.S. pig population. Vet Microbiol. 7;160(3\u0026ndash;4):290-6. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetmic.2012.05.038\u003c/span\u003e\u003cspan address=\"10.1016/j.vetmic.2012.05.038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao CT, Gim\u0026eacute;nez-Lirola LG, Jiang YH, Halbur PG, Opriessnig T (2013b) Characterization of a novel porcine parvovirus tentatively designated PPV5. PLoS One. 7;8(6):e65312. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0065312\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0065312\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Huang Y, Du Q, Luo X, Zhang L, Zhao X, Tong D (2015) Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway. BiochemBiophys Res Commun 9(2):649\u0026ndash;655. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2014.12.011\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2014.12.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Xiang H, Bai X, Fei N, Huang Y, Song X, Zhang H, Zhang L, Tong D (2016) Porcine parvovirus infection activates mitochondria-mediated apoptotic signaling pathway by inducing ROS accumulation. Virol J 13:26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12985-016-0480-z\u003c/span\u003e\u003cspan address=\"10.1186/s12985-016-0480-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"porcine parvovirus 6, cell cultures, PCR, pigs, virus isolation, phylogenetic analysis, Sanger sequencing","lastPublishedDoi":"10.21203/rs.3.rs-3228149/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3228149/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePorcine parvovirus 6 (PPV6) was first identified in aborted swine fetuses in China in 2014. Since its identification, an increased number of PPV6 cases have been reported in many countries with developed pig breeding. In this study, the first identification of porcine parvovirus 6 in Russia, its phylogenetic analysis, and its characterization \u003cem\u003ein vitro\u003c/em\u003e are reported. During the investigation, 521 serum samples collected from pigs of different ages from seven regions of the Russian Federation were tested. In four regions, the DNA of the virus was detected. The overall prevalence of porcine parvovirus 6 in Russia was 9.4%. Fattening pigs were the group with the most frequent detection of the virus genome. Phylogenetic analysis of the Russian isolate detected in a domestic boar indicated high homology with strains from Spain. \u003cem\u003eIn vitro\u003c/em\u003e studies revealed that PPV6 mostly replicates in SPEV and SK cell cultures and, to a lesser extent, in ST. Our results demonstrated that PPV6 induced typical apoptotic features in cells, including DNA fragmentation, chromatin margination, nuclear condensation, pyknosis of nuclei, symplast formation, and various pathological mitoses.\u003c/p\u003e","manuscriptTitle":"Identification and in vitro characterization of a novel porcine parvovirus 6 in Russia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-08-08 17:31:59","doi":"10.21203/rs.3.rs-3228149/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2023-08-29T07:27:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-08-25T12:36:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"eeae4ec0-daf4-44bf-8ee9-4d2e25ee7fa0","date":"2023-08-07T16:24:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-08-04T16:05:15+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-08-03T03:44:46+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-08-03T03:44:46+00:00","index":"","fulltext":""},{"type":"submitted","content":"Veterinary Research Communications","date":"2023-08-02T13:38:14+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"b1478fae-7962-4180-a729-78a54db4a1e5","owner":[],"postedDate":"August 8th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-02T15:05:02+00:00","versionOfRecord":{"articleIdentity":"rs-3228149","link":"https://doi.org/10.1007/s11259-023-10226-7","journal":{"identity":"veterinary-research-communications","isVorOnly":false,"title":"Veterinary Research Communications"},"publishedOn":"2023-09-29 15:01:50","publishedOnDateReadable":"September 29th, 2023"},"versionCreatedAt":"2023-08-08 17:31:59","video":"","vorDoi":"10.1007/s11259-023-10226-7","vorDoiUrl":"https://doi.org/10.1007/s11259-023-10226-7","workflowStages":[]},"version":"v1","identity":"rs-3228149","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3228149","identity":"rs-3228149","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.