Deletion of pagL and arnT genes that involved in LPS structure and charge modulation in Salmonella genome confer reduced endotoxicity and retained efficient protection against wild-type S. Gallinarium challenge in chicken

Deletion of pagL and arnT genes that involved in LPS structure and charge modulation in Salmonella genome confer reduced endotoxicity and retained efficient protection against wild-type S. Gallinarium challenge in chicken | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Deletion of pagL and arnT genes that involved in LPS structure and charge modulation in Salmonella genome confer reduced endotoxicity and retained efficient protection against wild-type S. Gallinarium challenge in chicken Ram Prasad Aganja, Jun Kwon, Amal Senevirathne, John Hwa Lee This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4589217/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Jan, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Abstract Fowl typhoid (FT) poses a significant threat to the poultry industry, especially in developing regions, causing substantial economic losses. Caused by Salmonella Gallinarium, FT can be prevented by vaccination, but existing vaccines like the SG9R strain have limitations, including residual virulence and potential reversion of pathogenicity. This study aims to develop safer and more effective SG vaccine strains through targeted genetic modifications, focusing on genes involved in lipopolysaccharide (LPS) biosynthesis and modification. We evaluated two novel mutant SG strains, JOL3015 and JOL3016, carrying in-frame deletions in Δ lon Δ rfaL Δ arnT and Δ lon Δ rfaL Δ pagL respectively. Intramuscular immunization with JOL3015 and JOL3016 strains showed minimal impact on the growth of 4-week-old young birds, significantly increased antigen-specific IgY, sIgA secretion, and CD4 + and CD8 + T cell responses, while inducing lower proinflammatory cytokine levels than SG9R. Histopathological evaluations revealed substantial protection in immunized birds, with minimal tissue damage and inflammatory responses, reducing the in vivo bacterial burden. None of the immunized birds died, highlighting the significant safety and protection conferred by the selected genetic modifications. Our results indicate that JOL3016 provided comparable protective outcomes on par with SG9R, yet with significantly lower endotoxicity responses during the lethal challenge with SG WT JOL422. The novel detoxified SG strains, particularly JOL3016, offer a promising alternative to existing vaccines for FT. They provide effective protection with minimal impact on poultry growth, minimizing the risks associated with reversion and endotoxicity. This study highlights the potential of genetically engineered vaccine strains in improving poultry health and productivity, emphasizing the importance of continued research. Fowl typhoid Salmonella Gallinarium genetic modification lipopolysaccharide biosynthesis vaccine Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Fowl typhoid (FT) is a severe systemic disease affecting chickens of all age groups, caused by Salmonella enterica serovar Gallinarum ( Salmonella Gallinarum, SG), with a global prevalence of 8.54%, Asia residing at the top [ 1 ]. The severity of the disease is influenced by various factors, including host age, host susceptibility, nutrition, flock management, and bacterial virulence. The disease imposes a significant threat to the poultry industry, causing up to 100% mortality and substantial economic losses [ 2 ]. Current control measures include strict biosecurity regulations, antibiotic use, and vaccination. However, maintaining biosecurity is costly and challenging for poultry operations while long-term antibiotic use can lead to the development of multi-drug resistant strains. Hence, vaccination is one of the most effective control strategy, with options including live, inactivated, and subunit vaccines. Although FT has been eradicated from commercial poultry in developed countries, it is still prevalent in most developing countries. This ongoing issue underscores the need for effective and accessible vaccination strategies to mitigate the impact of FT on global poultry production [ 3 ]. The live attenuated SG9R strain, a semi-rough strain with limited information on its attenuation, serves as a commercial vaccine for FT. However, it has been reported to cause systemic disease, liver and spleen pathology, and bacterial persistence for several weeks in young chickens, which could affect the productivity of young birds [ 4 ]. Additionally, SG9R vaccination has been associated with residual virulence in newly hatched chickens, limited protection, and vertical transmission [ 5 ]. Despite the control and eradication policy for FT launched in Korea as early as 1970s, the disease remains prevalent among poultry flocks [ 6 ]. To address this gap, a safer SG vaccine can be developed through bacterial strain manipulation using genetic engineering. It is a known fact that bacterial lipopolysaccharides (LPS) initiate proinflammatory immune responses and endotoxicity, which can be lethal to the host, especially at a young age [ 7 ]. Lipid A and its acyl chains in LPS play a central role in triggering inflammatory cytokines. Hexa-acylated lipid A stimulates a maximum proinflammatory response via the TLR4-MD2-CD14 pathway, while tetra- or penta-acylated species significantly reduce immunostimulatory responses [ 8 ]. Thus, lipid A-derived endotoxicity can be mitigated by its structural remodeling. In the present context, the PhoP/PhoQ-activated gene (pagL) encodes deacylase, which modifies lipid A by removing R-3-hydroxy myristate attached at position 3, maintaining bacterial virulence. Therefore, pagL deletion can confer detoxification of lipid A, reducing endotoxicity [ 9 ]. Similarly, arnT (L-Ara4N transferase) modifies LPS by adding 4-amino-4-deoxy-L-arabinose (L-Ara4N) to lipid A’s phosphate groups, altering the charge and structure of the LPS, contributing to bacterial survival and immune evasion [ 10 ]. Hence, arnT represents a potential target for regulating the virulence of SG strains. Furthermore, the precise and permanent deletion of such genes eliminates the risk of reverting SG wild-type (WT) strains to a virulent form, making this strategy a safe and effective for developing vaccine candidates. Therefore, remodeling the LPS structure holds promising potential for generating avirulent SG strains for vaccine development. Furthermore, serological diagnosis of Salmonella infection relies on detecting LPS-specific antibodies against the O-antigen, a method often interfered with by field infections, making it challenging to differentiate infected from vaccinated animals (DIVA). The DIVA concept is crucial for effective vaccination strategies. Monitoring salmonellosis and ensuring ideal vaccination necessitates the capability to differentiate infected from vaccinated animals, a feat that can be achieved through LPS truncation via O-antigen modification. Thus, targeting the deletion of rfaL , which encodes O-antigen ligase, aims to lower LPS-specific antibodies compared to wild-type infection [ 11 ]. Ultimately, this strategy aids in differentiating infected from vaccinated animals by quantifying antibody levels using enzyme-linked immunosorbent assay (ELISA). The Lon protease serves as a global regulator that controls the expression of virulence genes located in Salmonella pathogenicity island I (SPI-1) during the early stages of systemic infection. Dysregulation of the Lon protease, a negative regulator of SPI-1 genes, results in increased expression and coordination of early virulence genes [ 12 ]. Attenuating SG through lon gene deletion renders the strain hyper-immunogenic with reduced virulence [ 13 ]. This targeted genetic modification not only enhances the immunogenicity of the strain but also contributes to its safety profile, making it a promising candidate for vaccine development against Salmonella infection. This study aimed to comprehensively evaluate the safety and protective efficacy of attenuated SG strains engineered through the targeted deletion of the lon gene to reduce virulence. Additionally, rfaL gene deletion was pursued to enhance the capability for monitoring salmonellosis using DIVA principles. Furthermore, the strains underwent detoxification processes to yield SG strains with Δ lon Δ rfaL Δ pagL and Δ lon Δ rfaL Δ arnT modifications. Through comparative assessments, the study scrutinized the protective potential of these engineered strains against wild-type challenge, revealing a notable safety and efficacy profile when compared to a commercial vaccine strain, SG9R. These findings underscore the promise of genetically engineered SG strains as viable candidates for advanced vaccine development, offering enhanced safety, efficacy, and monitoring capabilities in combating Salmonella infection in poultry populations. Methods Bacterial strains, plasmids, and growth conditions All bacterial strains were routinely grown in Luria Bertani (BD, Sparks, MD, USA) medium with agitation at 37°C using appropriate antibiotics as selection markers wherever applicable. All the bacterial strains and plasmids used in the present study are listed in Table 1. In this study, an attenuated SG strain was developed with the deletion of lon , rfaL, and arnT or pagL genes as a therapeutic strain for Salmonellosis. For this, the SG 914 strain ( Δlon ) [14] was engineered to develop the SG JOL3015 strain ( Δlon ΔrfaL ΔarnT ) and SG JOL3016 strain ( Δlon ΔrfaL Δ pagL ) applying the λ red recombination technique described elsewhere with modifications [15]. This recombineering approach inserts a chloramphenicol resistance (cat R ) gene into the chromosome by replacing the target gene. Briefly, the parent SG strain was transformed with a helper plasmid, pKD46, and induced to express recombinase with L-arabinose for homologous recombination. The linear DNA cassette of the cat R gene flanked by a rfaL gene homologous sequence was amplified from pKD3 and electroporated (Harvard Apparatus, USA) in pKD46-transformed Salmonella . The rfaL -deleted mutant colonies were screened by plating on LB media containing chloramphenicol. Colonies were confirmed by inner primers and transformed with pCP20 plasmid to eliminate the FRT-flanked catR through flippase production. The cat R deletion was confirmed by flanking primers, as listed in Table 2. The procedure was reprised to include arnT and pagL deletion in the respective strains. A commercially available vaccine SG9R was procured (9R VAC®, Komipharm International Co. Ltd., Siheung, Korea) for the comparative study. Bacterial growth kinetics of the engineered Salmonella Gallinarum strains Bacterial growth of the engineered attenuated SG strain was evaluated alongside wild type and commercial strain, SG9R. Bacterial cultures grown overnight were inoculated (1%, v/v) to 50 mL LB broth, incubated at 37 o C in a shaking incubator at 200 rpm. Optical density at 600 nm (OD600) was measured using an Infinite M200 spectrophotometer (Tecan, Seestrasse, Switzerland) every 4 hours in a 96-well plate (200 μL). Growth kinetics were further validated by enumerating colony-forming units (CFUs) from serially diluted broth cultures. Samples were taken every 4 h, serially diluted, spread (100 μL) on LB agar plates, and incubated at 37°C. Plates containing 30-300 colonies were counted to determine CFUs. Auto-aggregation assay The clustering ability of bacteria under culture conditions was assessed using an auto-aggregation assay. Overnight bacterial cultures were prepared and inoculated at a 1:100 dilution in LB broth. The cultures were then incubated at 37°C for 24 h. Subsequently, the optical density (OD) of the upper layer of the culture (collected without disturbing the culture, OD 600 pre-resuspension) and the re-suspended culture (OD 600 post-resuspension) after vortexing were measured at 600 nm. The level of auto-aggregation was determined as a percentage using the formula: [(OD 600 post-resuspension – OD600 pre-resuspension) / OD 600 post-resuspension] × 100. Hemolysis assay Overnight cultures of the wild-type and mutant strains were grown, followed by centrifugation at 8000 rpm for 10 minutes to collect the culture supernatants. To eliminate bacterial contaminants, the supernatants were filtered using 0.2 μm membrane filters (BioFACT, Parit Jamil, Malaysia). The resulting sterile solutions were then mixed into a 10% chicken red blood cell (RBC) suspension at a 4:1 ratio and incubated in a shaking incubator at 37°C for 12 hours. A control was prepared by adding LB broth to the RBC suspension at the same ratio. After incubation, the suspensions were centrifuged at 2000 rpm for 5 minutes [16]. Hemolysis rates were determined by absorbance measurements at 570 nm using a multi-well plate reader (Tecan, Männedorf, Switzerland). Acriflavine agglutination test Lack of O-antigen components and confirmation of rough phenotype was conducted by acriflavine agglutination test [17]. Bacteria cultures were grown on LB agar plates for 24 h, and selected bacterial colonies were collected and mixed into 30 μL of 0.2% acriflavine solution on glass slides. Cells were gently mixed, interacted for 2 min., and observed under a microscope at 40 × magnification or by the naked eye. Western blot of lipopolysaccharides Bacterial lipopolysaccharides were extracted using a phenolic-based extraction method using an LPS extraction kit (iNtRON Biotechnology, Seoul, South Korea) following the manufacturer’s recommendations. The LPS samples were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Western blotting was performed using a mouse monoclonal antibody against Salmonella O antigen at 1:1000 (cat. no. 10R-S103b, Fitzgerald, MA, USA) and goat anti-mouse IgG-HRP conjugate at 1:5000 dilution (cat. no. 1030-05, SouthernBiotech, Birmingham, AL 35209 USA). All steps were conducted according to a previously described procedure [18]. Adhesion and Invasion The adhesion and invasion capability of SG strains were evaluated in Hela and chicken peripheral blood mononuclear cells (PBMCs) in vitro . Overnight cultures of bacterial cells were re-inoculated to LB medium as 1% inoculum and incubated for 3 h to reach 0.4 – 0.6 absorbance at OD 600. Cells were collected by centrifugation at 12000 × g for 5 min and washed with phosphate-buffered saline. Blood was collected from the wing vein of the bird, following the standard procedure, and PBMCs were isolated using Ficoll-Paque PLUS density gradient media (Cytiva, Uppsala, Sweden) [19]. Collected macrophages and Hela cells were seeded in 12 well plates at 2 × 10 6 and 2 × 10 5 cells/ well. The PBMCs were incubated for 5 h for attachment and then the media was changed. When the Hela cells reached 60 – 70% confluence, bacterial adhesion and invasion were conducted. Cells were infected with SG WT, SG9R, and the attenuated strains at 40 multiplicity of infection (MOI), 30 min for adhesion and 2.5 h for invasion. In the invasion assay, bacteria were incubated with cells for 2.5 h to invade the cells. The noninfected bacteria were eliminated by 2 h gentamycin treatment (100 µg/mL). Adhered or invaded cells were retrieved by lysis of monolayers using 0.25% Triton X-100 and the bacterial enumeration was done by counting on Brilliant Green Agar (BGA) plates (BD Difco). Cell survival and cytotoxicity assay Salmonella -induced cell cytotoxicity was assessed using an IncuCyte live imaging system (Essen Bioscience, MI, USA). HeLa cells were seeded at a density of 5×10⁵ cells/mL in 12-well plates. Cells were infected with Salmonella at a multiplicity of infection (MOI) of 40 for 2 h. Post-infection, cells were washed twice with phosphate-buffered saline (PBS) to remove dead cells, non-adherent bacteria, and debris. Subsequently, non-infected cells were eliminated by treatment with Gentamycin (100 μg/mL) for 2 h. Following this, cells were treated with propidium iodide (5 µL/mL, cat. no. 556463, BD Biosciences, California, USA) and monitored via imaging at 6 h intervals over 24 h. Safety evaluation of detoxified SG strains in chicken The safety of detoxified Salmonella Gallinarum (SG) strains was assessed following intramuscular (IM) inoculation at varying concentrations in female brown-layer chickens. Four-week-old chickens (n = 12) were inoculated either with the SG wild-type (WT JOL422), attenuated strains JOL3015 and JOL3016, or a commercial vaccine strain, SG9R. Post-inoculation, the birds were monitored for morbidity and mortality associated with fowl typhoid (FT). Clinical parameters such as body temperature, abnormal behavior, anorexia, and feed intake were observed to detect any adverse effects caused by SG infection. To evaluate bacterial persistence in vital organs, the attenuated strains JOL3015 and JOL3016 were administered at concentrations of 1×10⁷ CFU/bird (Low) and 1×10⁸ CFU/bird (High), SG9R and SG WT JOL422 were administered at a concentration of 1×10⁷. Three chickens from each group were sacrificed at 3, 7, and 14 days post-inoculation (dpi) for sample collection. Chickens were euthanized, and the spleen and liver were aseptically collected. The collected organs were homogenized in PBS using a mechanical homogenizer (IKA T 10 basic ULTRA-TURRAX, Germany) and plated on BGA at 10-fold serial dilutions to quantify bacterial load. Additionally, cloacal swabs were collected using sterilized cotton swabs in 1 mL PBS to evaluate bacterial shedding for environmental safety. The swab samples were thoroughly mixed, serially diluted in PBS, and plated on BGA. Body weight changes were monitored at three-day intervals up to 15 days post-inoculation to assess the impact on body weight gain. Histopathological evaluation of organ damage The evaluation of harm inflicted by the attenuated SG strains on specific organs namely, the liver, spleen, and cecum was conducted through a detailed histopathological examination using hematoxylin and eosin (H&E) staining. Three birds per group were sacrificed on the seventh-day post-inoculation, and the organs were collected and fixed in 10% formalin. The tissues were then sectioned into 3 µm slices, fixed, and processed according to a standard protocol for H&E staining. This process involved dehydration, clearing, embedding, and staining to allow for clear visualization of tissue architecture. A comprehensive investigation of potential tissue damage was performed using a Zeiss Axio Imager.M2 microscope (Carl Zeiss AB, Stockholm, Sweden). Microscopic examination allowed for the assessment of cellular and structural integrity and images were documented for further analysis. Quantification of cytokines Chickens inoculated with engineered SG strains underwent endotoxicity assessment through the quantification of inflammatory cytokines. Serum samples were collected on Day 3 post-inoculation. To evaluate in vitro endotoxicity induced by the structural modification of bacterial LPS, LPS was extracted from SG mutants JOL3015, JOL3016, SG9R, and the SG WT strain using an LPS extraction kit (iNtRON, Korea). The PBMCs were isolated from 8-week-old chickens and cultured in RPMI medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) in 12-well plates at a density of 5×10⁵ cells per well. PBMCs were treated with isolated LPS at 100 ng/mL concentrations. The levels of inflammatory cytokines, including TNF-α, IL-1β, and IFN-γ, were measured using commercial sandwich-ELISA kits following the manufacturer's instructions. Briefly, for the TNF-α assay, micro-ELISA plates pre-coated with an antibody specific to chicken TNF-α (Cat. No. MBS2509660, MyBioSource, San Diego, USA) were incubated with serum samples and standards for 90 minutes at 37°C. A biotinylated detection antibody specific to chicken TNF-α and an Avidin-Horseradish Peroxidase (HRP) conjugate were successively added to the microplate wells and incubated. After washing away free components, a substrate solution was added, and the enzyme-substrate reaction was stopped with a stop solution. Optical density at 450 nm was measured using an Infinite M200 spectrophotometer (Tecan). The concentration of TNF-α in the samples was estimated using a reference standard. Similarly, IL-1β (Cat. No. MBS2702032, MyBioSource) and IFN-γ (Cat. No. MBS2700893, MyBioSource) levels were quantified using comparable procedures, adapted from the manufacturer's instructions. Immunization and challenge against fowl typhoid using attenuated SG strain. The immune response elicited by inoculation with attenuated SG strains was evaluated in 4-week-old female brown chickens. Birds (n = 8) were intramuscularly immunized with JOL3015 and JOL3016 strains at a concentration of 1×10⁷ CFU/200 μL per bird. A commercial vaccine strain, SG9R, was used as a comparative control and administered intramuscularly at the same concentration. Additional groups served as PBS and naïve controls. After two weeks, birds received a booster inoculation with the attenuated SG strains. Serum and cloacal swab samples were collected at intervals up to five weeks from the initial inoculation. These samples were used to measure levels of IgY and IgA antibodies. Two weeks after the booster inoculation, blood samples were collected, and PBMCs were isolated. Flow cytometry was performed to quantify the cell-mediated immune response by assessing T-cell counts. Three weeks after booster application, chickens were challenged with wild-type SG strain (SG WT JOL422) via the oral route using 1×10 6 CFU/200 µL per bird. Post-challenge survival rate was evaluated by monitoring for up to 15 days. Animals were sacrificed at the end of the experiment to examine gross morphological distortion in the vital organs. Bacterial persistence in the spleen and liver of immunized chickens was investigated to elucidate the bacterial load. In addition, the spleen and liver tissues were collected for H&E staining as described elsewhere [20]. ELISA Humoral and mucosal immune responses Salmonella -specific systemic IgY and mucosal IgA responses in immunized birds were quantified using an indirect ELISA. For this assay, 96-well plates were coated with 400 ng/well of crude soluble protein extracted from the SG wild-type strain JOL422, dissolved in a carbonate-bicarbonate buffer. The plates were incubated overnight at 4°C to allow for proper antigen coating. The following day, plates were blocked with 5% skim milk for 1 h at room temperature (RT) to prevent non-specific binding. Serum samples were diluted 1:50 for IgY detection, while undiluted cloacal swab samples were used for IgA detection. Samples were added to the wells and incubated for 2 h at RT. After the incubation period, the plates were washed three times with PBS-T (PBS containing 0.05% Tween 20) to remove any unbound antibodies. Subsequently, the plates were incubated with secondary antibodies: goat anti-chicken IgY-HRP (Bethyl Laboratories, Texas, USA) for IgY detection and goat anti-chicken IgA-HR-P (Bethyl Laboratories, Texas, USA) for IgA detection following the manufacturer's instructions at 1:3000 dilution. The plates were incubated for 1 h at RT and washed with PBS-T to remove excess secondary antibodies. The colorimetric detection was carried out by adding an O-phenylenediamine dihydrochloride substrate (Sigma, Missouri, USA). The reaction was allowed to proceed for 15-30 minutes in the dark at RT until sufficient color development was achieved. The enzyme-substrate reaction was stopped by adding 50 μL of 2N sulfuric acid. The optical density (OD) was measured at 492 nm using an Infinite M200 microplate reader (Tecan). The absorbance values obtained were used to quantify the levels of IgY and IgA antibodies in the serum and cloacal swab samples, respectively. Flow cytometry The cell-mediated immune responses were investigated by evaluating T-lymphocyte subsets via flow cytometry analysis. Two weeks after the booster immunization, blood was collected from all groups (n = 5) to isolate PBMCs. Mononuclear cells were separated from whole blood using density gradient centrifugation according to the manufacturer’s instructions. Briefly, blood was diluted 1:1 with phosphate-buffered saline (PBS; pH 7.4) to a final volume of 2 mL and carefully layered over 2 mL of Ficoll-Paque PLUS density gradient media (Cytiva, Uppsala, Sweden) in a centrifuge tube. The samples were centrifuged at 400×g for 30 minutes at 18°C to separate the buffy coat layer. The PBMCs were collected from the interface and then washed twice with PBS to remove residual Ficoll and plasma. The harvested cells were resuspended in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics. The cells were then seeded in 96-well plates at a density of 1×10⁵ cells/well and stimulated with 400 ng/well of crude soluble antigen extracted from the SG wild-type strain for 72 hours in a 5% CO₂ incubator at 37°C. Following antigen stimulation, cells were collected and incubated with fluorescently labeled antibodies: anti-CD3-FITC (Cat: 8200-02, SouthernBiotech, Birmingham, AL, USA), anti-CD8-PE (Cat: 8220-09, SouthernBiotech), and anti-CD4-AF700 (Cat: 8210-31, SouthernBiotech) (each at a concentration of 8 μg/mL) at 4°C for 30 minutes in the dark. After incubation, cells were washed with FACS buffer (PBS containing 2% FBS and 0.1% sodium azide) to remove unbound antibodies. The stained cells were then analyzed using a Macsquant flow cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany). Data acquisition was performed, and T-cell subsets (CD3⁺, CD4⁺, and CD8⁺) were quantified. The results were analyzed using Macsquant analysis software (version 2.6), allowing for a detailed assessment of the cell-mediated immune response elicited by the immunization. Statistical analysis Statistical analysis was performed using Student's t-test and ANOVA to evaluate statistical differences. A p-value <0.05 was considered significant. All analyses were done in GraphPad Prism 9.00 software (San Diego, CA, USA). Results Development of attenuated SG strain The SG strains were engineered to possess defective LPS structures using the well-established lambda red recombination method [21]. This recombineering approach involved replacing the selected genes with a flippase recognition target (FRT) flanked chloramphenicol resistance (cat R ) gene in the chromosome. The targeted deletions included four genes namely, lon , rfaL , pagL , and arnT . Confirmation of these deletions was achieved through flanking PCR [15], as depicted in the supplementary figure (PCR results), using specific flanking primers listed in Table 2. The deletion of rfaL impacted the biosynthesis of the core oligosaccharide, resulting in modified LPS lacking O-antigen attachment. Additionally, the arnT deletion supposedly alter the transfer of L-Ara4N to the phosphate group, affecting the overall charge of the cell surface. The deletion of pagL may block the deacylation of lipid A, conferring the prevention of further modifications in the LPS structure. The conceptual framework of these deletions is depicted in Fig. 1. Phenotypic and biological characterization In our study, we observed that bacteria demonstrate self-aggregation properties during culture, which might be influenced by the hydrophobicity of the cell surfaces. Notably, mutant strains JOL3015 and JOL3016 exhibited significantly higher auto-aggregation abilities, with 61% and 59% respectively, compared to WT and SG9R strains, which displayed only 25% and 37% auto-aggregation respectively (Fig. 2A). Moreover, hemolytic assay revealed a remarkable reduction in hemolysis exceeding 50% in both mutant strains compared to the control (Fig. 2B), indicating a significant alteration in their hemolytic properties. Additionally, the acriflavine agglutination test demonstrated agglutination in the presence of acriflavine for both mutant strains, suggesting a rough surface phenotype (Fig. 2C). This ensures that the lipid A core is exposed and acriflavine could interact with it, leading to agglutination. When visualized under ultraviolet light, clear agglutination patterns were evident to the naked eye. Further analysis through Western blotting confirmed the absence of interaction between the mutant strains and antibodies against Salmonella O-antigen, highlighting a phenotypic change induced by the LPS mutation in these strains (Fig. 2D). These findings collectively underscore the influence of hydrophobicity and LPS modifications on the cell surface properties of these bacterial strains, providing valuable insights into their phenotypic characteristics. Bacterial growth kinetics of attenuated SG strains The growth kinetics of attenuated SG strains were evaluated and compared with the wild-type strain JOL422 and a commercial strain, SG9R (Fig. 3A and 3B). Throughout the experiment, discernible differences in growth dynamics were observed between the engineered SG strains and the wild-type counterpart. While both the wild-type JOL422 and SG9R strains exhibited analogous growth patterns, significant disparities were noted with the engineered strains, particularly JOL3016 and JOL3015. During the initial growth phase, both JOL3015 and JOL3016 maintained a conspicuous gap when compared to the wild-type strain, with JOL3016 displaying a slightly narrower gap in comparison to JOL3015. This disparity persisted up to 16 hours of incubation, after which the gap gradually diminished and plateaued. Notably, the optical density at 600 nm (OD 600 ) peaked between 16 to 20 hours for the wild-type and SG9R strains, followed by a decline. In contrast, both JOL3015 and JOL3016 exhibited an increment in bacterial growth up to 28 hours. At 8 hours, the wild-type strain demonstrated a 3.14 and 2.39-fold increase in OD 600 compared to JOL3015 and JOL3016 respectively, which subsequently narrowed to 1.35 and 1.25-fold at 16 hours. The logarithmic phase could be observed between 4 -12 h for all four strains and both absorbance and CFU increments were increased and narrowed the gap against the WT SG 422 at 28 h post-incubation. At the end of the incubation period, there was a minimal disparity in CFU growth between JOL3016 and SG9R, suggesting comparable growth kinetics. In vitro characterization of bacterial virulence and environmental stress The assessment of adhesion and invasion using Hela and chicken PBMC revealed JOL3016 with comparable results against the SG WT 422 strain. Both adhesion (Fig. 3C) and invasion (Fig. 3D) capability of SG9R and JOL3015 was significantly lower than both GS WT 422 strain and JOL3016. The exposure of bacterial cells to acidic environments at 6.5 pH and 4.0 pH revealed that all strains could tolerate mild acid conditions at 6.5 pH. However, the increase in acidity at 4.0 pH revealed that the mutants are susceptible to acidity. The lowest tolerance was observed by JOL3015, while JOL3016 was comparable to the SG9R vaccine strain (Fig. 3E). Furthermore, oxidative stress conditions induced by variable concentrations of H 2 O 2 (mM) demonstrated a significant growth suppression even at 1.0 mM concentration. At 5.0 mM concentration, the growth of bacterial cells was still present, however, 10.0 mM concentration was lethal to all bacterial strains (Fig. 3F). In vitro assessment of cytotoxic responses Intracellular cytotoxicity induced by each strain SG WT422, SG9R, JOL3015, and JOL3016 was investigated using the propidium iodide staining method. Cells were observed in real-time using the IncuCyte (Essen BioSicece, Gottingen, Germany) live imaging system (Fig. 4A). Visual observation over 24 hours revealed the highest number of red fluorescing objects in cells treated with SG WT 422 strain. The matric quantification of mean red-fluorescent objects revealed, that both SG9R and JOL3016 were comparable to each other while JOL3015 remained lowest in cytotoxic responses (Fig. 4B). Safety assessment of the detoxified strains The bacterial load in vital organs, including the spleen and liver, as well as in cloacal swabs, was evaluated to estimate the burden caused by the detoxified SG strains. Chickens were inoculated with mutant strains at two doses, 1×10 7 and 1×10 8 CFU/bird, via the intramuscular (IM) route and monitored over 15 days. Birds inoculated with the wild-type (WT) strain JOL422, serving as a control, displayed lethargic behavior characterized by depression, anorexia, ruffled feathers, diarrhea, dehydration, and weight loss. In contrast, chickens from the other groups exhibited normal behavior with usual feed and water intake and did not show adverse signs of inoculation or clinical symptoms, such as increased body temperature. The gain in body weight was comparable to that of naïve chickens. The bacterial load in the spleen, liver, and cloacal swabs revealed the dispersal of bacteria in all tested organs and sites. Over time, the bacteria were gradually eliminated from their respective sites, with bacterial persistence lasting for 14 days, which assured the induction of an immune response (Fig. 5A, 5B, and 5C). Bacterial retention of the attenuated strains inoculated at 1×10 7 and 1×10 8 CFU/bird in the selected lymphoid organs was comparable to that of SG9R injected at 1×10 7 CFU/bird. Administration of a tenfold higher bacterial concentration, comparable to SG9R, demonstrated a safe response. As a positive control, WG WT 422 infection displayed more than 90% mortality within 5 to 15 days post-infection (Fig. 5D). Overall, the results indicate reduced infectivity in both attenuated strains, while they retained desirable infectivity to induce immunogenicity. The introduction of SG as a live vaccine resulted in a mild decrease in body weight until 3rd day post-inoculation. Birds vaccinated with the commercial SG9R vaccine exhibited more than 7% body weight loss (Fig. 6A). In comparison, less than 5% body weight loss was recorded for birds inoculated with JOL3016, compared to the naïve group, within 15 days. Endotoxicity, a major issue for implementing live bacterial vaccines due to LPS, was addressed by modifying the LPS structure in both designed SG strains. Endotoxicity induced by these strains was corroborated by measuring inflammatory cytokines using sandwich-ELISA. The concentration of TNF-α, a major inflammatory cytokine marker, showed a significant reduction; JOL3015 and JOL3016 exhibited 3.82- and 4.13-fold decreases, respectively, while SG9R showed a 1.76-fold reduction compared to the WT (Fig. 6B). Notably, both JOL3015 and JOL3016 induced 2.17- and 2.34-fold lower TNF-α production than the commercial SG9R strain, underscoring the significance of the developed strains. Additionally, the production of IL-1β was downregulated by 4.52- and 3.90-fold in the JOL3015 and JOL3016 groups (Fig. 6B), respectively, compared to WT, which was 1.47- and 1.27-fold lower than SG9R. Furthermore, the endotoxicity-related pro-inflammatory cytokine IFN-γ showed elevated levels in the WT group compared to the other groups. Both developed strains demonstrated a downregulation of IFN-γ by more than 2-fold (Fig. 6B). Histopathological examinations of H&E stained spleen and liver tissues also revealed the degree of damage SG WT 422 strain induced in spleen and liver tissues with expanded white pulp areas of lymphatic tissues in spleen and signs of severe inflammation and potentially necrotic regions in liver tissues. Compared to WT inoculation all vaccinated groups showed relatively lower signs of tissue damage, especially for SG9R and JOL3016 strain (Fig. 6C and 6D). This investigation indicates that our strains comprehensively induce lower endotoxicity compared to the WT group, highlighting the potential of these developed strains in minimizing inflammatory responses. These findings support the notion that the engineered strains JOL3015 and JOL3016 are not only safe but also effective in eliciting an immune response without the adverse effects typically associated with live bacterial vaccines. Humoral and mucosal immune response Assessment of humoral immune responses upon immunization demonstrated an increase in IgY (Fig. 7A and 7B) levels in blood and sIgA (Fig. 7C) in mucosal swabs. IgY responses were nearly doubled upon booster immunization. It was notable that the immune responses derived by SG9R and JOL3016 were comparable at 3, 4, and 5 th week of post-primary inoculation, whereas JOL3015 derived slightly lower IgY responses compared to SG9R and JOL3016. Peak IgY responses resulted at 3 weeks of post-priming and maintained till the 5 th week post-priming. The sIgA responses also peaked at 3 weeks post-priming and maintained till the 4th week post-priming. A significant increase in sIgA responses was noted on booster immunization, and JOL3016 was comparable to the SG9R vaccine strain. Cell-mediated immune responses The cell-mediated immune response elicited by immunization was evaluated by quantifying T-cell populations using flow cytometry analysis. The primary focus was on the differentiation of T-lymphocyte subsets, specifically CD4 + and CD8 + T cells, within PBMCs. Flow cytometric analysis revealed a significant increase in CD3 + CD4 + and CD3 + CD8 + T cell populations in the immunized chickens, indicating an enhanced cell-mediated immune response (Fig. 7D and 7E). Chickens immunized with the SG JOL3016 strain exhibited a notable rise in both CD4 + and CD8 + T cells (Fig. 7D and 7E), which was comparable to the immune response observed with the commercial vaccine strain SG9R. The CD3 + CD4 + and CD3 + CD8 + T cell populations for SG9R were 11.40% and 5.32%, respectively, whereas for JOL3016, these populations were 11.25% and 5.61%. These results indicated that immunization with SG JOL3016 and JOL3015 strains leads to a significant upregulation of CD4 + and CD8 + T cells, comparable to the response induced by the commercial SG9R vaccine strain. These findings highlight the potential of the engineered strains to elicit a strong cell-mediated immune response, crucial for effective immunoprotection. Protection against wild-type challenge Chickens were immunized and challenged according to the designated immunization schedule via the intramuscular (IM) route, using the SG WT 422 strain. Body weight measurements and observations for potential mortality were conducted regularly throughout the experiment. Notably, immunization with detoxified SG strains did not induce any adverse reactions during the study period. The impact of detoxified SG strains on chicken weight gain was particularly remarkable between weeks 6 and 9, showing greater weight gain compared to the SG9R vaccine strain. Specifically, chickens immunized with the JOL3016 strain demonstrated body weight gains comparable to the naïve group (Fig. 8A). Upon challenge, chickens in the PBS group experienced severe weight reduction and mortality due to SG infection, whereas all immunized birds were protected against the lethal challenge (Fig. 8B). Additionally, the PBS group exhibited increased body temperature (Supplementary Table 1), while the other groups demonstrated only marginal changes. Further evaluations revealed that liver morphology (Fig. 8C) and splenomegaly (Fig. 8D) in immunized groups corroborated the levels of protection provided by both SG9R and JOL3016 detoxified strains. Post-challenge assessments showed significant, yet comparable outcomes in spleen weight and bacterial loads in spleen and liver tissues between SG9R and JOL3016 immunized groups (Fig. 8E, 8F, and 8G). The bacterial load in the PBS group was around log4 CFU/g, whereas the loads in SG9R and JOL3016 immunized groups were reduced to less than log1 CFU/g. Immunization with detoxified SG strains, particularly JOL3016, not only prevented adverse reactions but also promoted significant weight gain and provided robust protection against lethal challenges. These findings highlight the potential of detoxified SG strains in effectively safeguarding against SG infection while supporting healthy growth in chickens. Histopathological examination A histopathological evaluation of the spleen, liver, and cecum tissues (Fig. 9A, 9B, and 9C) was conducted one week after an oral challenge with the SG WT 422 strain. In the spleen tissues of naïve birds, the white pulp (lymphatic tissues) and red pulp (venous sinuses) were nicely differentiated. Immunized birds with JOL3016, JOL3015, and SG9R strains showed significant preservation of this tissue architecture. In contrast, the PBS control group exhibited a markedly expanded white pulp, indicative of severe infection and inflammation (Fig. 9A). In the liver tissues of the PBS group, severe necrotic discolorations were evident, reflecting extensive tissue damage. Liver tissues from immunized birds were comparable to those of the naïve group, although infiltration of Kupffer cells was observed across all groups, suggesting an active but controlled immune response (Fig. 9B). Histopathological analysis of cecum tissues revealed significant erosion, crypt abscesses, and signs of edema in the PBS group, indicating a severe bacterial infection. In contrast, immunized chickens, whether vaccinated with detoxified SG strains or the SG9R vaccine strain, showed considerable protection. Their cecum tissues were largely free from these severe pathological signs, demonstrating the effectiveness of the immunization in mitigating infection-induced tissue damage. These histopathological findings underscore the protective efficacy of the JOL3016, JOL3015, and SG9R vaccine strains (Fig. 9C). Immunized birds maintained a closer resemblance to naïve tissue architecture across vital organs, significantly reducing infection-related damage and inflammatory responses compared to the non-immunized PBS group. Discussion Fowl typhoid (FT) remains a significant concern in the poultry industry, particularly in developing regions where it inflicts substantial economic losses [ 22 ]. The causative agent, Salmonella Gallinarium (SG), not only impacts productivity but also poses risks to animal welfare and public health. Currently, the SG9R vaccine is widely used to mitigate FT; however, concerns regarding its safety and efficacy persist. Our study addresses these concerns by engineering attenuated SG strains with targeted genetic modifications aimed at enhancing vaccine safety and effectiveness. The SG9R vaccine, while effective in many cases, presents several limitations that hinder its widespread use and effectiveness. Concerns about potential reversion to virulence and endotoxicity raise questions about its long-term efficacy and safety [ 23 , 24 ]. The risk of SG9R reversion during field outbreaks poses a significant challenge, highlighting the need for alternative vaccine candidates. Moreover, the residual pathogenicity of SG9R, particularly in immunocompromised hosts, underscores the urgency to develop safer vaccine options [ 25 ]. Given the pivotal role of LPS in SG pathogenesis and host immune responses [ 26 ], our study focused on modifying LPS structure to enhance vaccine safety and immunogenicity. LPS serves as a key virulence factor and immunogen, making it an attractive target for vaccine development. By targeting the virulence genes and genes involved in LPS biosynthesis and modification, such as lon , rfaL , pagL , and arnT , we aimed to attenuate SG strains while preserving their immunogenicity. The Lon protease acts as a global regulator of bacterial virulence, whose deletion could cause overexpression of several invasion-related genes, by promoting antigen presentation. The rfaL gene encodes O-antigen ligase, which is essential in the proper attachment of the O-antigen component into the lipid A core component. The lack of rfaL gene confers a truncated version of the LPS structure, which has been proven to be important in conferring DIVA capability [ 9 ]. The other two gene targets arnT and pagL play crucial roles in modifying lipid A, a component of LPS, thereby influencing bacterial virulence and host immune response [ 27 – 29 ]. The addition of L-Ara4N by ArnT alters lipid A structure, reducing its negative charge and enhancing bacterial resistance to host defenses [ 30 , 31 ]. On the other hand, PagL -mediated deacylation reduces LPS hydrophobicity, potentially evading host immune detection [ 27 , 32 ]. These modifications highlight the complex interplay between bacterial adaptation and host immune evasion strategies. Figure 1 represents the concept behind lipid A modification by our selected gene targets in the present study. Our study employed a well-established lambda red recombineering approach to engineer attenuated SG strains with targeted in-frame deletions of lon , rfaL , pagL , and arnT genes (Supplementary Fig. 1) in SG genome. These deletions resulted in significant modifications to LPS structure, including changes in core oligosaccharides, O-antigen attachment, surface charge, and lipid A composition [ 9 , 13 , 15 ]. Importantly, these modifications aimed to reduce endotoxicity while maintaining vaccine efficacy. Phenotypic and biological characterization of the engineered SG strains revealed altered surface properties (Fig. 2 A), and reduced hemolytic activity (Fig. 2 B). Truncation of the O-antigen component has been confirmed by acriflavine agglutination assay (Fig. 2 C) and by LPS western blot (Fig. 2 D) that revealed complete absence of O-antigen component. The modified LPS structure results in a rough surface that increases the hydrophobicity and affects the cells to aggregate and settle. Such modifications not only change the phenotypic features but also affect biological characteristics, as evidenced by decreased hemolysis activity. A significant reduction in hemolysis by both mutant strains reflects a reduced virulence phenotype that must be essentially addressed in the vaccine strain. In furtherance, the hemolysins of Salmonella play an essential role in intra-macrophage survival, killing cells, and prolonged systemic salmonellosis [ 33 ]. Bacterial growth kinetics offers insights into the differentiated physiological state of bacteria [ 34 ]. Assessment of growth revealed distinctive growth kinetics compared to wild-type and commercial SG9R strains. Owing to the complete elimination of three genes from each detoxified SG strain namely, JOL 3015 containing deletions in lon, rfaL , and arnT and JOL3016 lon, rfaL and pagL resulted in comparatively lower growth rate compared to the wild type and SG9R vaccine strain at early time points of growth, however reducing the gap with an increase in incubation time (Fig. 3 A and 3 B). Especially, JOL3016 was almost equal in bacterial number to WT and SG9R within a 28 h incubation period demonstrating that the strain is not overly attenuated. The selected genetic markers did not cause a dramatic effect on bacterial adhesion or virulence, especially for the JOL3016 strain that carries pagL deletion ensures that these strains retain their capability to invade host cells which is essential for better antigen presentation (Fig. 3 C and 3 D) [ 35 ]. Acidic and oxidative stress survival assays also revealed that JOL3016 is comparable to the SG9R vaccine strain, while JOL3015 was slightly lower tolerant to acidity and oxidative conditions compared to the SG9R and JOL3016 (Fig. 3 E and 3 F). This ensures the detoxified SG strains may undergo rapid clearance from the intracellular oxidative stress, without persisting as a chronic infection that might be important as a safety consideration. Further to note, the mutant strains induced lowered cytotoxic responses without inflicting significant damage on epithelial monolayers of Hela cells. Here too, JOL3016 was comparable to SG9R while the lowest cytotoxic response was exhibited by the JOL3015 strain exacerbating its stronger attenuation phenotype (Fig. 4 A and 4 B). Importantly, safety assessments demonstrated minimal adverse reactions and reduced endotoxicity in inoculated chickens with detoxified strains. No birds died when inoculated with detoxified SG strains or SG9R whereas SG WT 422 strain resulted in significant infection and death of birds. A comparison of two inoculation doses at 1 × 10 7 and 1 × 10 8 CFU/bird via IM route was completely safe for young chickens and did not affect chicken growth as much as SG9R did. Examination of bacterial persistence in the spleen, liver, and cloacal swabs revealed no significant difference between the two inoculation doses (high and low), yet by the 14th day post-inoculation, bacterial persistence had reduced less than log 2 in all organ samples, spleen, liver, and cloacal swabs collected from challenged chicken. These findings underscore the safety and potential of the engineered strains as vaccine candidates (Fig. 5 ). To further evaluate reduced levels of endotoxicity responses, levels of pro-inflammatory cytokines were investigated in blood samples, that revealed significantly less amount of pro-inflammatory cytokine markers, Tumor necrosis factor-alpha (TNF-α), Interleukin-1β (IL-1β) and Interleukin-γ (IFN-γ) levels even lower than SG9R vaccine strain (Fig. 6 ). These observations were further exacerbated in histopathological examination of spleen and liver tissues by lowered signs of inflammation marked by red and white pulp distribution in spleen and necrotic lesions and server inflammation in liver tissues. Evaluation of humoral and cell-mediated immune responses demonstrated robust immune activation elicited by the engineered SG strains, comparable to the commercial vaccine strain SG9R. Being live attenuated vaccine strains, immunization of chicken has resulted in a significant engagement of both CD3 + CD4 + and CD3 + CD8 + differentiation (Fig. 7 D and 7 E). CD3 + CD4 + T cells also aid in the activation of macrophages and CD8 + T cells, ensuring a robust and coordinated immune response. Their role is pivotal in generating a strong humoral response, which is crucial for neutralizing pathogens and preventing infection spread. On the other hand, CD3 + CD8 + T cells, known as cytotoxic T cells, are directly involved in the elimination of infected cells. They recognize and kill cells presenting specific antigens on their surface, typically through the major histocompatibility complex class I (MHC I) pathway. This cytotoxic activity is essential for controlling intracellular pathogens such as SG, as it helps to limit bacterial replication and spread within the host. Additionally, CD8 + T cells produce various cytokines that contribute to the overall immune response and help in the recruitment and activation of other immune cells. The collective outcome of protective immune responses induced by novel vaccine candidates is well showcased in post-challenged pathological assessments. Importantly, post-challenge survival rates and histopathological analyses confirmed the protective efficacy of the engineered strains against wild-type SG challenge (Figs. 8 and 9 ). These results highlight the potential of the engineered SG strains to induce protective immunity while minimizing adverse reactions and pathological manifestations. In conclusion, this study sheds light on the promising potential of engineered SG strains featuring modified LPS structures as safe and efficacious vaccine candidates against fowl typhoid. Notably, comparative analyses against the commercial vaccine strain SG9R underscored the superiority of the designed strains in terms of reduced endotoxicity and retained protective efficacy. These findings highlight the importance of further research to investigate the long-term efficacy and real-world application of the engineered strains in poultry populations. Abbreviations FT Fowl typhoid LPS Lipopolysaccharide SG Salmonella enterica serovar Gallinarum (Salmonella Gallinarum,) pagL PhoP/PhoQ-activated gene arnT L-Ara4N transferase gene DIVA Differentiate infected from vaccinated animals ELISA Enzyme-linked immunosorbent assay catR Chloramphenicol resistance gene OD Optical density RBC Red blood cell PBMCs Peripheral blood mononuclear cells PBS Phosphate-buffered saline WT Wild-type dpi Days post-inoculation H&E Hematoxylin and eosin staining RT Room temperature TNF-α Tumor necrosis factor-alpha IL-1β Interleukin-1β IFN-γ Interleukin-γ Declarations Ethics approval and consent to participate All animal experiments in this study were conducted under the Jeonbuk National University Animal Ethics Committee (NON2023-135-001) guidelines, following the Korean Council on Animal Care and the Korean Animal Protection Law, 2007: Article 13 . Consent for publication Not applicable Availability of data and material Raw data reported in the manuscript can be made available upon request from the corresponding author. Competing interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This work was supported by the Technology Development Program (S3383209) funded by the Ministry of SMEs and Startups (MSS, Korea) and it was also supported by the National University Development Project at Jeonbuk National University in 2023. The histopathological analysis was performed in the Center for University-wide Research Facilities (CURF) at Jeonbuk National University. Authors’ contributions RPA: Conceptualization, Investigation, Methodology, Validation, Formal analysis, Writing–original draft, Writing–review & editing. JK: Formal analysis, Methodology, Writing–review & editing. AS: Writing–review & editing. JHL: Conceptualization, Resources, Supervision, Funding acquisition, Writing–review & editing. Acknowledgments The authors would like to acknowledge the support of the National University Development Project, Jeonbuk National University, and the Center for University-wide Research Facilities (CURF) at Jeonbuk National University. References Zhou X, Kang X, Zhou K, Yue M (2022) A global dataset for prevalence of Salmonella Gallinarum between 1945 and 2021. Sci Data 9:495. Alves Batista DF, de Freitas Neto OC, Maria de Almeida A, Maboni G, de Carvalho TF, de Carvalho TP, Barrow PA, Berchieri AJ (2018) Evaluation of pathogenicity of Salmonella Gallinarum strains harbouring deletions in genes whose orthologues are conserved pseudogenes in S. Pullorum. PLoS One 13:e0200585. Arora D, Kumar S, Jindal N, Narang G, Kapoor PK, Mahajan NK (2015) Prevalence and epidemiology of Salmonella enterica serovar Gallinarum from poultry in some parts of Haryana, India. Vet World 8:1300-1304. Wigley P, Hulme S, Powers C, Beal R, Smith A, Barrow P (2005) Oral infection with the Salmonella enterica serovar Gallinarum 9R attenuated live vaccine as a model to characterise immunity to fowl typhoid in the chicken. BMC Vet Res 1:2. Lee YJ, Mo IP, Kang MS (2007) Protective efficacy of live Salmonella gallinarum 9R vaccine in commercial layer flocks. Avian Pathol 36:495-498. Kwon YK, Kim A, Kang MS, Her M, Jung BY, Lee KM, Jeong W, An BK, Kwon JH (2010) Prevalence and characterization of Salmonella Gallinarum in the chicken in Korea during 2000 to 2008. Poult Sci 89:236-242. Huang XY, Ansari AR, Huang HB, Zhao X, Li NY, Sun ZJ, Peng KM, Zhong J, Liu HZ (2017) Lipopolysaccharide mediates immuno-pathological alterations in young chicken liver through TLR4 signaling. BMC Immunol 18:12. Brandenburg K, Wiese A (2004) Endotoxins: relationships between structure, function, and activity. Curr Top Med Chem 4:1127-1146. Senevirathne A, Hewawaduge C, Sivasankar C, Lee JH (2022) Prospective lipid-A altered live attenuated Salmonella Gallinarum confers protectivity, DIVA capability, safety and low endotoxicity against fowl typhoid. Vet Microbiol 274:109572. Breazeale SD, Ribeiro AA, McClerren AL, Raetz CR (2005) A formyltransferase required for polymyxin resistance in Escherichia coli and the modification of lipid A with 4-Amino-4-deoxy-L-arabinose. Identification and function oF UDP-4-deoxy-4-formamido-L-arabinose. J Biol Chem 280:14154-14167. Senevirathne A, Hewawaduge C, Lee JH (2022) Assessing an O-antigen deficient, live attenuated Salmonella Gallinarium strain that is DIVA compatible, environmentally safe, and protects chickens against fowl typhoid. Dev Comp Immunol 133:104433. Kirthika P, Jawalagatti V, Senevirathne A, Lee JH (2022) Coordinated interaction between Lon protease and catalase-peroxidase regulates virulence and oxidative stress management during Salmonellosis. Gut Microbes 14:2064705. Kirthika P, Senevirathne A, Jawalagatti V, Park S, Lee JH (2020) Deletion of the lon gene augments expression of Salmonella Pathogenicity Island (SPI)-1 and metal ion uptake genes leading to the accumulation of bactericidal hydroxyl radicals and host pro-inflammatory cytokine-mediated rapid intracellular clearance. Gut Microbes 11:1695-1712. Matsuda K, Chaudhari AA, Kim SW, Lee KM, Lee JH (2010) Physiology, pathogenicity and immunogenicity of lon and/or cpxR deleted mutants of Salmonella Gallinarum as vaccine candidates for fowl typhoid. Vet Res 41:59. Aganja RP, Sivasankar C, Hewawaduge C, Lee JH (2022) Safety assessment of compliant, highly invasive, lipid A-altered, O-antigen-defected Salmonella strains as prospective vaccine delivery systems. Vet Res 53:76. Ishiguro A, Nishioka M, Morishige A, Kawano R, Kobayashi T, Fujinaga A, Takagi F, Kogo T, Morikawa Y, Okayama N et al (2020) What is the best wavelength for the measurement of hemolysis index? Clin Chim Acta 510:15-20. Guo R, Jiao Y, Li Z, Zhu S, Fei X, Geng S, Pan Z, Chen X, Li Q, Jiao X (2017) Safety, Protective Immunity, and DIVA Capability of a Rough Mutant Salmonella Pullorum Vaccine Candidate in Broilers. Front Microbiol 8:547. Hewawaduge C, Senevirathne A, Sivasankar C, Lee JH (2023) The impact of lipid A modification on biofilm and related pathophysiological phenotypes, endotoxicity, immunogenicity, and protection of Salmonella Typhimurium. Vet Microbiol 282:109759. Bertram EM, Jilbert AR, Kotlarski I (1997) Optimization of an in vitro assay which measures the proliferation of duck T lymphocytes from peripheral blood in response to stimulation with PHA and ConA. Dev Comp Immunol 21:299-310. Aganja RP, Sivasankar C, Lee JH (2023) AI-2 quorum sensing controlled delivery of cytolysin-A by tryptophan auxotrophic low-endotoxic Salmonella and its anticancer effects in CT26 mice with colon cancer. J Adv Res. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640-6645. Ojima S, Okamura M, Osawa N, Tamura A, Yoshioka K, Kashimoto T, Haneda T, Ono HK, Hu DL (2021) Characteristics of systemic infection and host responses in chickens experimentally infected with Salmonella enterica serovar Gallinarum biovar Gallinarum. J Vet Med Sci 83:1147-1154. Beylefeld A, Abolnik C (2023) Salmonella gallinarum strains from outbreaks of fowl typhoid fever in Southern Africa closely related to SG9R vaccines. Front Vet Sci 10:1191497. Van Immerseel F, Studholme DJ, Eeckhaut V, Heyndrickx M, Dewulf J, Dewaele I, Van Hoorebeke S, Haesebrouck F, Van Meirhaeghe H, Ducatelle R et al (2013) Salmonella Gallinarum field isolates from laying hens are related to the vaccine strain SG9R. Vaccine 31:4940-4945. Kwon HJ, Cho SH (2011) Pathogenicity of SG 9R, a rough vaccine strain against fowl typhoid. Vaccine 29:1311-1318. Yang KH, Lee MG (2008) Effects of endotoxin derived from Escherichia coli lipopolysaccharide on the pharmacokinetics of drugs. Arch Pharm Res 31:1073-1086. Kawasaki K (2012) Complexity of lipopolysaccharide modifications in: Its effects on endotoxin activity, membrane permeability, and resistance to antimicrobial peptides. Food Res Int 45:493-501. Kawasaki K, Ernst RK, Miller SI (2005) Inhibition of Salmonella enterica serovar Typhimurium lipopolysaccharide deacylation by aminoarabinose membrane modification. J Bacteriol 187:2448-2457. Kawasaki K, Ernst RK, Miller SI (2004) 3-O-deacylation of lipid A by PagL, a PhoP/PhoQ-regulated deacylase of Salmonella typhimurium, modulates signaling through Toll-like receptor 4. J Biol Chem 279:20044-20048. Ernst RK, Guina T, Miller SI (2001) Salmonella typhimurium outer membrane remodeling: role in resistance to host innate immunity. Microbes Infect 3:1327-1334. Raetz CR, Whitfield C (2002) Lipopolysaccharide endotoxins. Annu Rev Biochem 71:635-700. Park BS, Song DH, Kim HM, Choi BS, Lee H, Lee JO (2009) The structural basis of lipopolysaccharide recognition by the TLR4-MD-2 complex. Nature 458:1191-1195. Agrawal RK, Singh BR, Babu N, Chandra M (2005) Novel haemolysins of Salmonella enterica spp. enterica serovar Gallinarum. Indian J Exp Biol 43:626-630. Ferenci T (1999) 'Growth of bacterial cultures' 50 years on: towards an uncertainty principle instead of constants in bacterial growth kinetics. Res Microbiol 150:431-438. Mukherjee S, Bassler BL (2019) Bacterial quorum sensing in complex and dynamically changing environments. Nat Rev Microbiol 17:371-382. Doublet B, Douard G, Targant H, Meunier D, Madec JY, Cloeckaert A (2008) Antibiotic marker modifications of lambda Red and FLP helper plasmids, pKD46 and pCP20, for inactivation of chromosomal genes using PCR products in multidrug-resistant strains. J Microbiol Methods 75:359-361. Tables Table 1. List of bacterial strains and plasmids Bacteria/Plasmid Genotypic characteristics References S . Gallinarum JOL422 Wild type Lab stock JOL914 Δlon Lab strain JOL3015 Δlon ΔrfaL ΔarnT This study JOL3016 Δlon ΔrfaL ΔpagL This study pKD46 oriR101-repA101ts; encodes λ red genes ( exo, bet, gam ); native terminator (tL3); arabinose-inducible promoter for expression (ParaB); bla [21] pKD3 oriR6Kgamma, bla (ampR), rgnB (Ter), cat R , FRT [21] pCP20 Helper plasmid contains a temperature-inducible flp gene for removing the FRT flanked chloramphenicol gene [36] Table 2. List of primers. Gene Primer 5'– 3' Sequences References Gel deletion lon-pKD3 Sense GGTATGGAGCACAGCTATACTATCTGATTACCTGGCGGACACTAAACTAAGTGTAGGCTGGAGCT This study Antisense CGAAATAGCCTGCCAGCCCTGTTTTTATTAGCGCTATTTGCGCGAGGTCAATGGGAATTAGCCATG rfaL -pKD3 Sense TTTGGAAAGATTCATTAAAGAGACTCTGTCTCATCCCAAACCTATTGTGGGTGTAGGCTGGAGCTGCTTC This study Antisense CCTGATGATGGAAAACGCGCTGATACCGTAATAAGTATCAGCGCGTTTTTATGGGAATTAGCCATGGTCC pagL -pKD3 Sense AATTTTAAATATGTTAGCCGGTTAAAAATAACTATTGACATTGAAATGGTGTGTAGGCTGGAGCTGCTTC This study Antisense CGGTGATTAATTACTCCTTCAGCCAGCAACTCGCTAATTGTTATTCAACTATGGGAATTAGCCATGGTCC arnT -pKD3 Sense GAGCTGACCGCCAACGCTGAGCAGACTGGCAAGCACCAGAATGACGCCGAGTGTAGGCTGGAGCTGCTTC This study Antisense ATCCCTGGCCGTGAAGGTTGGCTGGGGTGCCAACAGGCAGCGAGCGCCTCATGGGAATTAGCCATGGTCC lon-inner Sense AATCTGCACGACTACCTCGG This study Antisense GATTACCGGTCAGGCAGGAA lon-outer Sense CAGGAGTTCTTACAGGTAGA This study Antisense CCACACTCCGCTGTAGGTGA rfaL -inner Sense ACAAGTTTAGGACTTCGCTGCC [15] Antisense CAGAATGGTATTATGCGGACCG rfaL -outer Sense GCA GCG TTT CGA GGA ACA AA [15] Antisense TCG TAT CGG TTG ATA CCG GC palL -inner Sense CAGATCTCTTTTGCTGCGGG [15] Antisense AAAAGCCCCAAAGTTCCAGC pagL -outer Sense TGGATGTGCCTGAACAACACT [15] Antisense TTAGCCTCCCTGTCGCCATA arnT -inner Sense GCAACGCGGTACGTTTATCC This study Antisense GAAACGCGCTATGCCGAAAT arnT -outer Sense GAGCTGACCGCCAACGCTGA This study Antisense GAAACGCGCTATGCCGAAAT TNF-a Sense CTTCTGAGGCATTTGGAAGC This study Antisense ACTGGGCGGTCATAGAACAG IL-1b Sense CTACACCCGCTCACAGTCCT This study Antisense TCACTTTCTGGCTGGAGGAG IFN -γ Sense CAAAGCCGCACATCAAACA This study Antisense TTTCACCTTCTTCACGCCAT IL-2 Sense ATCTTTGGCTGTATTTCGGTAG This study Antisense TGGGTCTCAGTTGGTGTGTAG IL-4 Sense GGAGAGCATCCGGATAGTGA This study Antisense TGACGCATGTTGAGGAAGAG GADPH Sense AGAACATCATCCCAGCGTCC This study Antisense CGGCAGGTCAGGTCAACA Supplementary Files SupplementaryFigureandTable.docx Cite Share Download PDF Status: Published Journal Publication published 04 Jan, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4589217","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":321334782,"identity":"45729b9c-f419-4fd4-82ef-847824d0637e","order_by":0,"name":"Ram Prasad Aganja","email":"","orcid":"","institution":"Jeonbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Ram","middleName":"Prasad","lastName":"Aganja","suffix":""},{"id":321334783,"identity":"b3b47dd0-b8fb-4acb-8a9d-4f84d1b7e3b6","order_by":1,"name":"Jun Kwon","email":"","orcid":"","institution":"Jeonbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Kwon","suffix":""},{"id":321334784,"identity":"5176ae6d-628d-421f-9fd7-66eaa452f122","order_by":2,"name":"Amal Senevirathne","email":"","orcid":"","institution":"Jeonbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Amal","middleName":"","lastName":"Senevirathne","suffix":""},{"id":321334785,"identity":"258d7e8f-b9da-4108-8146-ddce17e504a1","order_by":3,"name":"John Hwa Lee","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIie2QMQrCQBBFvwSsJmwbEcwVJgRSiWeJCLGxsBQs3Mo0sU/hLQTrFSE2xjMItt5B16Dp3KQU3Fcsn+E/mFnAYvlBOpLgYA4InN8jaqUw0JNtlVejUlhRPTDjpJviNufhIDyUxY0w8kHl1bxYdpmGOSdhpHQgTALppmxW8lnUJz6O9+qsA5wYomte7K08VjtZKavWiooZlXKM4a4blOzV5EmQq0vS2/IpWFNhVoI008pi5Iu8LLz7YukLShoU+Ume0o/+q4ZLAL9OQn5vWSwWy3/zBLB3OhuBOX4qAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-2028-2207","institution":"Chonbuk National University","correspondingAuthor":true,"prefix":"","firstName":"John","middleName":"Hwa","lastName":"Lee","suffix":""}],"badges":[],"createdAt":"2024-06-16 09:48:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4589217/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4589217/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13567-024-01413-8","type":"published","date":"2025-01-04T15:57:16+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60990715,"identity":"ab7ce879-9dc1-4912-8cb2-7e1b4da1a6e1","added_by":"auto","created_at":"2024-07-24 11:08:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1497195,"visible":true,"origin":"","legend":"\u003cp\u003eStructural Modifications of Lipopolysaccharide (LPS) resulting from Gene Deletions. The schematic representation illustrates the structural components of LPS in wild-type and genetically modified strains. The non-modified LPS comprises three main components: Lipid A, Core oligosaccharide, and O-antigen. In the genetically modified strain, the \u003cem\u003erfaL\u003c/em\u003e gene deletion results in the absence of the O-antigen. Additionally, \u003cem\u003epagL\u003c/em\u003e gene deletion leads to the lack of deacylated Lipid A. Furthermore, the \u003cem\u003earnT\u003c/em\u003e gene deletion prevents the addition of 4-amino-4-deoxy-L-arabinose (L-Ara4N) to the phosphate groups of Lipid A. These gene deletions result in significant structural modifications of the LPS, which are critical for understanding the functional and immunogenic implications of bacterial pathogenesis.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/006ef7cfa363a1ad3071fd61.png"},{"id":60991200,"identity":"4afabd57-e960-43ae-909f-6f8f22516cb7","added_by":"auto","created_at":"2024-07-24 11:16:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1948072,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypic and Biological Characterization of \u003cem\u003eSalmonella\u003c/em\u003e Gallinarum Strains. A. Auto-aggregation. Visual observation of auto-aggregation in bacterial cultures grown statically at 37°C for 24 hours. The percentage of auto-aggregation was calculated by comparing the OD\u003csub\u003e600\u003c/sub\u003e values from the upper layer of the culture with those from the resuspended culture after vortexing. B. Hemolytic Activity. Hemolytic activity was assessed using the supernatant from mutant bacterial cultures incubated with a 10% chicken red blood cell (RBC) suspension at a 4:1 dilution for 12 hours at 37°C. Hemolytic activity was quantified by measuring the OD\u003csub\u003e570\u003c/sub\u003e and comparing the mutant strains to the wild-type. Statistical analysis was performed using one-way ANOVA, with data presented as ***p \u0026lt; 0.001 and ****p \u0026lt; 0.0001. C. Acriflavine Agglutination Test. The rough surface phenotype of mutant strains was confirmed by agglutination formation with acriflavine. Agglutination was observed under a microscope at 40× magnification. The scale bar represents 500 µm. D. Western Blot Analysis of LPS. Lipopolysaccharide (LPS) was extracted from individual strains and analyzed by Western blot. The LPS was probed with a mouse antibody against \u003cem\u003eSalmonella\u003c/em\u003e O antigen (primary antibody) followed by a goat anti-mouse IgG-HRP (secondary antibody). M denotes the protein molecular weight marker.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/6fc419d41c849bf05ca67b0c.png"},{"id":60990714,"identity":"879d30c5-268e-4cf9-b8b0-f0f8091695bd","added_by":"auto","created_at":"2024-07-24 11:08:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2162088,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of attenuated \u003cem\u003eSalmonella\u003c/em\u003e Gallinarum strains. A. Growth Curve Based on Absorbance. Growth kinetics were evaluated by measuring the optical density (OD) at 600 nm over time. B. Growth Curve Based on CFU. Bacterial growth kinetics were assessed by plating cultures at respective time points at different dilutions on BGA media. The colony-forming units (CFU) per mL were then evaluated. C. In Vitro Adhesion. The adhesion strengths of JOL3015, JOL3016, and SG9R strains were compared to the \u003cem\u003eSalmonella\u003c/em\u003eJOL422 wild-type (WT) strain using HeLa cells and peripheral blood mononuclear cells (PBMCs). Monolayer cells were infected with each strain at a multiplicity of infection (MOI) of 40. Adhesion was assessed after 30 minutes of incubation. D. In Vitro Invasion. The invasion capacities of JOL3015, JOL3016, and SG9R strains were compared to the \u003cem\u003eSalmonella\u003c/em\u003e JOL422 WT strain using HeLa cells and PBMCs. Monolayer cells were infected with each strain at an MOI of 40. Invasion was assessed after 2.5 hours of incubation. Data for adhesion and invasion assays were analyzed by multiple unpaired t-tests and are presented as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/346ed24a508e9915b4958a2c.png"},{"id":60990718,"identity":"8159f832-ae7e-4c76-b76e-a6acdb1a0df5","added_by":"auto","created_at":"2024-07-24 11:08:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":9761305,"visible":true,"origin":"","legend":"\u003cp\u003eA. Cell Survival Assay. The attenuation level and persistence of mutant SG strains were evaluated using a cell survival assay. A confluent monolayer of HeLa cells was infected with wild-type (WT) JOL422, SG9R, JOL3015, and JOL3016 strains at a multiplicity of infection (MOI) of 40. Cell survival was monitored using propidium iodide staining, and cytotoxicity was assessed by real-time observation with the IncuCyte live imaging system over 24 hours. Micrographs show images captured 24 hours post-infection, with the scale bar representing 200 μm. B. Cytotoxicity Observation. Higher retention of red-colored objects was observed in WT-infected cells over the 24 hours, indicating increased cytotoxicity. The experiment was repeated three times, with R1 and R2 representing the first and second replicates.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/da7d44cbee6684f389b04f60.png"},{"id":60990717,"identity":"35ebe204-f2ae-48c0-864e-67ab713b380e","added_by":"auto","created_at":"2024-07-24 11:08:37","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2685616,"visible":true,"origin":"","legend":"\u003cp\u003eA-C. Bacterial Localization. Birds were inoculated intramuscularly with 1×10\u003csup\u003e7\u003c/sup\u003e CFU/bird of the designated strains to evaluate the safety profile. The developed strains JOL3015 and JOL3016 were inoculated at 1×10\u003csup\u003e7\u003c/sup\u003e CFU/bird (low dose, L) and 1×10\u003csup\u003e8\u003c/sup\u003e CFU/bird (high dose, H). Bacterial load was enumerated in the spleen (A), liver (B), and cloacal swabs (C). Data were analyzed by multiple unpaired t-tests and are presented as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001. D. Kaplan-Meier Survival Curve. The survival of birds was monitored for 15 days post-inoculation to assess the safety of the strains. The Kaplan-Meier survival curve represents the percentage of surviving birds over the observation period.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/669864e5a79443c54e1d8c0e.png"},{"id":60990719,"identity":"312c09b1-45cd-4b93-b6f7-c6cf5da22af1","added_by":"auto","created_at":"2024-07-24 11:08:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":10611666,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of Safety and Pro-inflammatory Cytokines. A. Change in Body Weight. The change in body weight of chickens was monitored following the introduction of \u003cem\u003eSalmonella\u003c/em\u003e Gallinarum (SG) strains. B. Serum Cytokine Concentration. The concentration of pro-inflammatory cytokines in the serum was measured. Data were analyzed by multiple unpaired t-tests and are presented as *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, and ****p \u0026lt; 0.0001. C. Histopathological Evaluation of Spleen. Inflammatory response in the spleen of immunized birds was assessed. Significant tissue alteration, including degeneration and necrosis in the white pulp, was noted in chickens inoculated with the wild-type (WT) SG JOL422 strain (indicated by arrows). The scale bar represents 50 μm. D. Histopathological Evaluation of Liver. Inflammatory response in the liver of immunized birds was evaluated. The black arrow indicates the infiltration of immune cells in the liver of birds infected with the WT strain. The scale bar represents 50 μm.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/56820725ff3b29cf0042e516.png"},{"id":60990720,"identity":"cc0d9d66-49ec-4888-9151-c9d5bf8b7a30","added_by":"auto","created_at":"2024-07-24 11:08:38","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2051407,"visible":true,"origin":"","legend":"\u003cp\u003eHumoral and Cellular Immune Response Post-immunization. A. IgY Antibody Production. Antibody production in response to immunization was assessed using indirect ELISA over four weeks post-immunization. Booster immunization was administered in the second week following the initial immunization. IgY concentrations (ng/mL) in serum are shown. B. IgA Antibody Production. IgA concentrations (ng/mL) in cloacal secretions were measured using indirect ELISA over the same period. C. Flow Cytometry Analysis. Representative flow cytometry scatter plots show the gating of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e cells post-immunization. D. T Cell Percentages. The histogram represents the percentages of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells in immunized birds. Data were analyzed by multiple unpaired t-tests, with significant differences presented as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001 compared to the PBS control.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/32b778328f8930ceb2b7a73b.png"},{"id":60990716,"identity":"3abb9028-694b-49da-a613-9e86d017dd8e","added_by":"auto","created_at":"2024-07-24 11:08:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4169958,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of Immunized Chicken Upon Challenge. A. Body Weight Alteration. Changes in chicken body weight were recorded pre- and post-challenge to assess the effect of immunization on overall health and the degree of protection against the wild-type challenge. B. Survival Rate. The survival of immunized birds challenged with the wild-type strain was compared with that of the non-immunized group. A Kaplan-Meier survival curve was developed using mortality records over 14 days post-challenge. C. Liver Morphology. Morphological changes in the liver were examined for hepatic lesions post-challenge. D. Spleen Morphology. The spleen was examined for splenomegaly and other morphological changes post-challenge. E. Bacterial Load in Liver. The bacterial load of the wild-type challenge strain in the liver was assessed. F. Bacterial Load in Spleen. The bacterial load of the wild-type challenge strain in the spleen was assessed. G. Spleen Weight. Post-challenge spleen weights were measured and compared with those of naïve birds. Data were analyzed by multiple unpaired t-tests, with significant differences compared to the PBS control presented as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/cc3a8e714ea546c7b4c75532.png"},{"id":60990721,"identity":"a725b03c-d52b-4754-a79e-2a7a0ba8c69a","added_by":"auto","created_at":"2024-07-24 11:08:38","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":14767925,"visible":true,"origin":"","legend":"\u003cp\u003eHistopathological Changes and Microscopic Lesions in Chickens Orally Infected with the Wild-Type Strain. Chickens were orally infected with \u003cem\u003eSalmonella\u003c/em\u003e Gallinarum wild-type strain JOL422 at a concentration of 10^6 CFU/bird. A. Spleen Histopathology. Histopathological analysis of the spleen was performed using hematoxylin and eosin (H\u0026amp;E) staining. Altered cellular alignment and tissue architecture were visualized in the spleen tissues at 200× magnification. In the PBS control group, degeneration and necrosis in the white pulp were observed, indicated by arrows. B. Liver Histopathology. Histopathological analysis of the liver was also performed using H\u0026amp;E staining. Altered tissue architecture and inflammatory lesions characterized by marked infiltration of heterophils and lymphocytes, along with degeneration and necrosis, were observed in the liver tissues at 200× magnification. Arrows highlight inflammatory lesions in the liver. The organs of uninfected chickens (naïve) were used as the control. In the PBS control group, spleen and liver tissues showed signs of heavy lesions and infiltrated immune cells. Data were visualized and analyzed using light microscopy.\u003c/p\u003e","description":"","filename":"Fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/0e2faeccf4bba76e75eaffee.png"},{"id":73093462,"identity":"58a1a1af-9ebc-458b-82e2-d8adfd92bcf4","added_by":"auto","created_at":"2025-01-06 16:19:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":61069925,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/5ea9590e-bf69-407a-b33e-15764af7f43e.pdf"},{"id":60990712,"identity":"17afdcf1-8ec3-4b75-9933-6525fac429f1","added_by":"auto","created_at":"2024-07-24 11:08:37","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":130985,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigureandTable.docx","url":"https://assets-eu.researchsquare.com/files/rs-4589217/v1/5a585a545073d4577a51bf5b.docx"}],"financialInterests":"","formattedTitle":"Deletion of pagL and arnT genes that involved in LPS structure and charge modulation in Salmonella genome confer reduced endotoxicity and retained efficient protection against wild-type S. Gallinarium challenge in chicken","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFowl typhoid (FT) is a severe systemic disease affecting chickens of all age groups, caused by \u003cem\u003eSalmonella enterica\u003c/em\u003e serovar Gallinarum (\u003cem\u003eSalmonella\u003c/em\u003e Gallinarum, SG), with a global prevalence of 8.54%, Asia residing at the top [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The severity of the disease is influenced by various factors, including host age, host susceptibility, nutrition, flock management, and bacterial virulence. The disease imposes a significant threat to the poultry industry, causing up to 100% mortality and substantial economic losses [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Current control measures include strict biosecurity regulations, antibiotic use, and vaccination. However, maintaining biosecurity is costly and challenging for poultry operations while long-term antibiotic use can lead to the development of multi-drug resistant strains. Hence, vaccination is one of the most effective control strategy, with options including live, inactivated, and subunit vaccines. Although FT has been eradicated from commercial poultry in developed countries, it is still prevalent in most developing countries. This ongoing issue underscores the need for effective and accessible vaccination strategies to mitigate the impact of FT on global poultry production [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe live attenuated SG9R strain, a semi-rough strain with limited information on its attenuation, serves as a commercial vaccine for FT. However, it has been reported to cause systemic disease, liver and spleen pathology, and bacterial persistence for several weeks in young chickens, which could affect the productivity of young birds [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Additionally, SG9R vaccination has been associated with residual virulence in newly hatched chickens, limited protection, and vertical transmission [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Despite the control and eradication policy for FT launched in Korea as early as 1970s, the disease remains prevalent among poultry flocks [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo address this gap, a safer SG vaccine can be developed through bacterial strain manipulation using genetic engineering. It is a known fact that bacterial lipopolysaccharides (LPS) initiate proinflammatory immune responses and endotoxicity, which can be lethal to the host, especially at a young age [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Lipid A and its acyl chains in LPS play a central role in triggering inflammatory cytokines. Hexa-acylated lipid A stimulates a maximum proinflammatory response via the TLR4-MD2-CD14 pathway, while tetra- or penta-acylated species significantly reduce immunostimulatory responses [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Thus, lipid A-derived endotoxicity can be mitigated by its structural remodeling. In the present context, the PhoP/PhoQ-activated gene (pagL) encodes deacylase, which modifies lipid A by removing R-3-hydroxy myristate attached at position 3, maintaining bacterial virulence. Therefore, \u003cem\u003epagL\u003c/em\u003e deletion can confer detoxification of lipid A, reducing endotoxicity [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Similarly, \u003cem\u003earnT\u003c/em\u003e (L-Ara4N transferase) modifies LPS by adding 4-amino-4-deoxy-L-arabinose (L-Ara4N) to lipid A\u0026rsquo;s phosphate groups, altering the charge and structure of the LPS, contributing to bacterial survival and immune evasion [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Hence, \u003cem\u003earnT\u003c/em\u003e represents a potential target for regulating the virulence of SG strains. Furthermore, the precise and permanent deletion of such genes eliminates the risk of reverting SG wild-type (WT) strains to a virulent form, making this strategy a safe and effective for developing vaccine candidates. Therefore, remodeling the LPS structure holds promising potential for generating avirulent SG strains for vaccine development.\u003c/p\u003e \u003cp\u003eFurthermore, serological diagnosis of \u003cem\u003eSalmonella\u003c/em\u003e infection relies on detecting LPS-specific antibodies against the O-antigen, a method often interfered with by field infections, making it challenging to differentiate infected from vaccinated animals (DIVA). The DIVA concept is crucial for effective vaccination strategies. Monitoring salmonellosis and ensuring ideal vaccination necessitates the capability to differentiate infected from vaccinated animals, a feat that can be achieved through LPS truncation via O-antigen modification. Thus, targeting the deletion of \u003cem\u003erfaL\u003c/em\u003e, which encodes O-antigen ligase, aims to lower LPS-specific antibodies compared to wild-type infection [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Ultimately, this strategy aids in differentiating infected from vaccinated animals by quantifying antibody levels using enzyme-linked immunosorbent assay (ELISA). The Lon protease serves as a global regulator that controls the expression of virulence genes located in \u003cem\u003eSalmonella\u003c/em\u003e pathogenicity island I (SPI-1) during the early stages of systemic infection. Dysregulation of the Lon protease, a negative regulator of SPI-1 genes, results in increased expression and coordination of early virulence genes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Attenuating SG through \u003cem\u003elon\u003c/em\u003e gene deletion renders the strain hyper-immunogenic with reduced virulence [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. This targeted genetic modification not only enhances the immunogenicity of the strain but also contributes to its safety profile, making it a promising candidate for vaccine development against \u003cem\u003eSalmonella\u003c/em\u003e infection.\u003c/p\u003e \u003cp\u003eThis study aimed to comprehensively evaluate the safety and protective efficacy of attenuated SG strains engineered through the targeted deletion of the \u003cem\u003elon\u003c/em\u003e gene to reduce virulence. Additionally, \u003cem\u003erfaL\u003c/em\u003e gene deletion was pursued to enhance the capability for monitoring salmonellosis using DIVA principles. Furthermore, the strains underwent detoxification processes to yield SG strains with Δ\u003cem\u003elon\u003c/em\u003eΔ\u003cem\u003erfaL\u003c/em\u003eΔ\u003cem\u003epagL\u003c/em\u003e and Δ\u003cem\u003elon\u003c/em\u003eΔ\u003cem\u003erfaL\u003c/em\u003eΔ\u003cem\u003earnT\u003c/em\u003e modifications. Through comparative assessments, the study scrutinized the protective potential of these engineered strains against wild-type challenge, revealing a notable safety and efficacy profile when compared to a commercial vaccine strain, SG9R. These findings underscore the promise of genetically engineered SG strains as viable candidates for advanced vaccine development, offering enhanced safety, efficacy, and monitoring capabilities in combating \u003cem\u003eSalmonella\u003c/em\u003e infection in poultry populations.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eBacterial strains, plasmids, and growth conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll bacterial strains were routinely grown in Luria Bertani (BD, Sparks, MD, USA) medium with agitation at 37\u0026deg;C using appropriate antibiotics as selection markers wherever applicable. All the bacterial strains and plasmids used in the present study are listed in Table 1. In this study, an attenuated SG strain was developed with the deletion of \u003cem\u003elon\u003c/em\u003e, \u003cem\u003erfaL,\u003c/em\u003e and \u003cem\u003earnT\u003c/em\u003e or \u003cem\u003epagL\u003c/em\u003e genes as a therapeutic strain for Salmonellosis. For this, the SG 914 strain (\u003cem\u003e\u0026Delta;lon\u003c/em\u003e)\u0026nbsp;[14]\u0026nbsp;was engineered to develop the SG JOL3015 strain (\u003cem\u003e\u0026Delta;lon \u0026Delta;rfaL \u0026Delta;arnT\u003c/em\u003e) and SG JOL3016 strain (\u003cem\u003e\u0026Delta;lon \u0026Delta;rfaL\u0026nbsp;\u003c/em\u003e\u0026Delta;\u003cem\u003epagL\u003c/em\u003e) applying the \u0026lambda; red recombination technique described elsewhere with modifications\u0026nbsp;[15]. This recombineering approach inserts a chloramphenicol resistance (cat\u003csup\u003eR\u003c/sup\u003e) gene into the chromosome by replacing the target gene. Briefly, the parent SG strain was transformed with a helper plasmid, pKD46, and induced to express recombinase with L-arabinose for homologous recombination. The linear DNA cassette of the cat\u003csup\u003eR\u003c/sup\u003e gene flanked by a \u003cem\u003erfaL\u003c/em\u003e gene homologous sequence was amplified from pKD3 and electroporated (Harvard Apparatus, USA) in pKD46-transformed \u003cem\u003eSalmonella\u003c/em\u003e. The \u003cem\u003erfaL\u003c/em\u003e-deleted mutant colonies were screened by plating on LB media containing chloramphenicol. Colonies were confirmed by inner primers and transformed with pCP20 plasmid to eliminate the FRT-flanked catR through flippase production. The cat\u003csup\u003eR\u003c/sup\u003e deletion was confirmed by flanking primers, as listed in Table 2. The procedure was reprised to include \u003cem\u003earnT\u003c/em\u003e and \u003cem\u003epagL\u003c/em\u003e deletion in the respective strains. A commercially available vaccine SG9R was procured (9R VAC\u0026reg;, Komipharm International Co. Ltd., Siheung, Korea) for the comparative study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial growth kinetics of the engineered \u003cem\u003eSalmonella\u003c/em\u003e Gallinarum strains\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBacterial growth of the engineered attenuated SG strain was evaluated alongside wild type and commercial strain, SG9R. Bacterial cultures grown overnight were inoculated (1%, v/v) to 50 mL LB broth, incubated at 37\u003csup\u003eo\u003c/sup\u003eC in a shaking incubator at 200 rpm. Optical density at 600 nm (OD600) was measured using an Infinite M200 spectrophotometer (Tecan, Seestrasse, Switzerland) every 4 hours in a 96-well plate (200\u0026nbsp;\u0026mu;L). Growth kinetics were further validated by enumerating colony-forming units (CFUs) from serially diluted broth cultures. Samples were taken every 4 h, serially diluted, spread (100 \u0026mu;L) on LB agar plates, and incubated at 37\u0026deg;C. Plates containing 30-300 colonies were counted to determine CFUs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuto-aggregation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe clustering ability of bacteria under culture conditions was assessed using an auto-aggregation assay. Overnight bacterial cultures were prepared and inoculated at a 1:100 dilution in LB broth. The cultures were then incubated at 37\u0026deg;C for 24 h. Subsequently, the optical density (OD) of the upper layer of the culture (collected without disturbing the culture, OD\u003csub\u003e600\u003c/sub\u003e pre-resuspension) and the re-suspended culture (OD\u003csub\u003e600\u003c/sub\u003e post-resuspension) after vortexing were measured at 600 nm. The level of auto-aggregation was determined as a percentage using the formula: [(OD\u003csub\u003e600\u003c/sub\u003e post-resuspension \u0026ndash; OD600 pre-resuspension) / OD\u003csub\u003e600\u003c/sub\u003e post-resuspension] \u0026times; 100.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHemolysis assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOvernight cultures of the wild-type and mutant strains were grown, followed by centrifugation at 8000 rpm for 10 minutes to collect the culture supernatants. To eliminate bacterial contaminants, the supernatants were filtered using 0.2 \u0026mu;m membrane filters (BioFACT, Parit Jamil, Malaysia). The resulting sterile solutions were then mixed into a 10% chicken red blood cell (RBC) suspension at a 4:1 ratio and incubated in a shaking incubator at 37\u0026deg;C for 12 hours. \u0026nbsp;A control was prepared by adding LB broth to the RBC suspension at the same ratio. After incubation, the suspensions were centrifuged at 2000 rpm for 5 minutes [16]. Hemolysis rates were determined by absorbance measurements at 570 nm using a multi-well plate reader (Tecan, M\u0026auml;nnedorf, Switzerland).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcriflavine agglutination test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLack of O-antigen components and confirmation of rough phenotype was conducted by acriflavine agglutination test\u0026nbsp;[17]. Bacteria cultures were grown on LB agar plates for 24 h, and selected bacterial colonies were collected and mixed into 30 \u0026mu;L of 0.2% acriflavine solution on glass slides. Cells were gently mixed, interacted for 2 min., and observed under a microscope at 40\u0026nbsp;\u0026times;\u0026nbsp;magnification or by the naked eye.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot of lipopolysaccharides\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBacterial lipopolysaccharides were extracted using a phenolic-based extraction method using an LPS extraction kit (iNtRON Biotechnology, Seoul, South Korea) following the manufacturer\u0026rsquo;s recommendations. The LPS samples were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Western blotting was performed using a mouse monoclonal antibody against \u003cem\u003eSalmonella\u003c/em\u003e O antigen at 1:1000 (cat. no. 10R-S103b, Fitzgerald, MA, USA) and goat anti-mouse IgG-HRP conjugate at 1:5000 dilution (cat. no. 1030-05, SouthernBiotech, Birmingham, AL 35209 USA). All steps were conducted according to a previously described procedure [18].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdhesion and Invasion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe adhesion and invasion capability of SG strains were evaluated in Hela and chicken peripheral blood mononuclear cells (PBMCs) \u003cem\u003ein vitro\u003c/em\u003e. Overnight cultures of bacterial cells were re-inoculated to LB medium as 1% inoculum and incubated for 3 h to reach 0.4 \u0026ndash; 0.6 absorbance at OD\u003csub\u003e600.\u0026nbsp;\u003c/sub\u003eCells were collected by centrifugation at 12000 \u0026times; g for 5 min and washed with phosphate-buffered saline. Blood was collected from the wing vein of the bird, following the standard procedure, and PBMCs were isolated using\u0026nbsp;Ficoll-Paque PLUS density gradient media (Cytiva, Uppsala, Sweden)\u0026nbsp;[19].\u0026nbsp;Collected macrophages and Hela cells were seeded in 12 well plates at 2 \u0026times;\u0026nbsp;10\u003csup\u003e6\u003c/sup\u003e and 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/ well. The PBMCs were incubated for 5 h for attachment and then the media was changed. When the Hela cells reached 60 \u0026ndash; 70% confluence, bacterial adhesion and invasion were conducted. Cells were infected with SG WT, SG9R, and the attenuated strains at 40 multiplicity of infection (MOI), 30 min for adhesion and 2.5 h for invasion. In the invasion assay, bacteria were incubated with cells for 2.5 h to invade the cells. The noninfected bacteria were eliminated by 2 h gentamycin treatment (100 \u0026micro;g/mL). Adhered or invaded cells were retrieved by lysis of monolayers using 0.25% Triton X-100 and the bacterial enumeration was done by counting on Brilliant Green Agar (BGA) plates (BD Difco).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell survival and cytotoxicity assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSalmonella\u003c/em\u003e-induced cell cytotoxicity was assessed using an IncuCyte live imaging system (Essen Bioscience, MI, USA). HeLa cells were seeded at a density of 5\u0026times;10⁵ cells/mL in 12-well plates. Cells were infected with \u003cem\u003eSalmonella\u003c/em\u003e at a multiplicity of infection (MOI) of 40 for 2 h. Post-infection, cells were washed twice with phosphate-buffered saline (PBS) to remove dead cells, non-adherent bacteria, and debris. Subsequently, non-infected cells were eliminated by treatment with Gentamycin (100 \u0026mu;g/mL) for 2 h. Following this, cells were treated with propidium iodide (5 \u0026micro;L/mL, cat. no. 556463, BD Biosciences, California, USA) and monitored via imaging at 6 h intervals over 24 h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSafety evaluation of detoxified SG strains in chicken\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe safety of detoxified \u003cem\u003eSalmonella\u003c/em\u003e Gallinarum (SG) strains was assessed following intramuscular (IM) inoculation at varying concentrations in female brown-layer chickens. Four-week-old chickens (n = 12) were inoculated either with the SG wild-type (WT JOL422), attenuated strains JOL3015 and JOL3016, or a commercial vaccine strain, SG9R. Post-inoculation, the birds were monitored for morbidity and mortality associated with fowl typhoid (FT). Clinical parameters such as body temperature, abnormal behavior, anorexia, and feed intake were observed to detect any adverse effects caused by SG infection.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; To evaluate bacterial persistence in vital organs, the attenuated strains JOL3015 and JOL3016 were administered at concentrations of 1\u0026times;10⁷ CFU/bird (Low) and 1\u0026times;10⁸ CFU/bird (High), SG9R and SG WT JOL422 were administered at a concentration of 1\u0026times;10⁷. Three chickens from each group were sacrificed at 3, 7, and 14 days post-inoculation (dpi) for sample collection. Chickens were euthanized, and the spleen and liver were aseptically collected. The collected organs were homogenized in PBS using a mechanical homogenizer (IKA T 10 basic ULTRA-TURRAX, Germany) and plated on BGA at 10-fold serial dilutions to quantify bacterial load. Additionally, cloacal swabs were collected using sterilized cotton swabs in 1 mL PBS to evaluate bacterial shedding for environmental safety. The swab samples were thoroughly mixed, serially diluted in PBS, and plated on BGA. Body weight changes were monitored at three-day intervals up to 15 days post-inoculation to assess the impact on body weight gain.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathological evaluation of organ damage\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe evaluation of harm inflicted by the attenuated SG strains on specific organs namely, the liver, spleen, and cecum was conducted through a detailed histopathological examination using hematoxylin and eosin (H\u0026amp;E) staining. Three birds per group were sacrificed on the seventh-day post-inoculation, and the organs were collected and fixed in 10% formalin. The tissues were then sectioned into 3 \u0026micro;m slices, fixed, and processed according to a standard protocol for H\u0026amp;E staining. This process involved dehydration, clearing, embedding, and staining to allow for clear visualization of tissue architecture. A comprehensive investigation of potential tissue damage was performed using a Zeiss Axio Imager.M2 microscope (Carl Zeiss AB, Stockholm, Sweden). Microscopic examination allowed for the assessment of cellular and structural integrity and images were documented for further analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantification of cytokines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChickens inoculated with engineered SG strains underwent endotoxicity assessment through the quantification of inflammatory cytokines. Serum samples were collected on Day 3 post-inoculation. To evaluate in vitro endotoxicity induced by the structural modification of bacterial LPS, LPS was extracted from SG mutants JOL3015, JOL3016, SG9R, and the SG WT strain using an LPS extraction kit (iNtRON, Korea). The PBMCs were isolated from 8-week-old chickens and cultured in RPMI medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) in 12-well plates at a density of 5\u0026times;10⁵ cells per well. PBMCs were treated with isolated LPS at 100 ng/mL concentrations. The levels of inflammatory cytokines, including TNF-\u0026alpha;, IL-1\u0026beta;, and IFN-\u0026gamma;, were measured using commercial sandwich-ELISA kits following the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Briefly, for the TNF-\u0026alpha; assay, micro-ELISA plates pre-coated with an antibody specific to chicken TNF-\u0026alpha; (Cat. No. MBS2509660, MyBioSource, San Diego, USA) were incubated with serum samples and standards for 90 minutes at 37\u0026deg;C. A biotinylated detection antibody specific to chicken TNF-\u0026alpha; and an Avidin-Horseradish Peroxidase (HRP) conjugate were successively added to the microplate wells and incubated. After washing away free components, a substrate solution was added, and the enzyme-substrate reaction was stopped with a stop solution. Optical density at 450 nm was measured using an Infinite M200 spectrophotometer (Tecan). The concentration of TNF-\u0026alpha; in the samples was estimated using a reference standard. Similarly, IL-1\u0026beta; (Cat. No. MBS2702032, MyBioSource) and IFN-\u0026gamma; (Cat. No. MBS2700893, MyBioSource) levels were quantified using comparable procedures, adapted from the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunization and challenge against fowl typhoid using attenuated SG strain.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe immune response elicited by inoculation with attenuated SG strains was evaluated in 4-week-old female brown chickens. Birds (n = 8) were intramuscularly immunized with JOL3015 and JOL3016 strains at a concentration of 1\u0026times;10⁷ CFU/200 \u0026mu;L per bird. A commercial vaccine strain, SG9R, was used as a comparative control and administered intramuscularly at the same concentration. Additional groups served as PBS and na\u0026iuml;ve controls. After two weeks, birds received a booster inoculation with the attenuated SG strains. Serum and cloacal swab samples were collected at intervals up to five weeks from the initial inoculation. These samples were used to measure levels of IgY and IgA antibodies.\u003c/p\u003e\n\u003cp\u003eTwo weeks after the booster inoculation, blood samples were collected, and PBMCs were isolated. Flow cytometry was performed to quantify the cell-mediated immune response by assessing T-cell counts. \u0026nbsp;Three weeks after booster application, chickens were challenged with wild-type SG strain (SG WT JOL422) via the oral route using 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/200 \u0026micro;L per bird. Post-challenge survival rate was evaluated by monitoring for up to 15 days. Animals were sacrificed at the end of the experiment to examine gross morphological distortion in the vital organs. Bacterial persistence in the spleen and liver of immunized chickens was investigated to elucidate the bacterial load. In addition, the spleen and liver tissues were collected for H\u0026amp;E staining as described elsewhere [20].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISA Humoral and mucosal immune responses\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSalmonella\u003c/em\u003e-specific systemic IgY and mucosal IgA responses in immunized birds were quantified using an indirect ELISA. For this assay, 96-well plates were coated with 400 ng/well of crude soluble protein extracted from the SG wild-type strain JOL422, dissolved in a carbonate-bicarbonate buffer. The plates were incubated overnight at 4\u0026deg;C to allow for proper antigen coating. The following day, plates were blocked with 5% skim milk for 1 h at room temperature (RT) to prevent non-specific binding. Serum samples were diluted 1:50 for IgY detection, while undiluted cloacal swab samples were used for IgA detection. Samples were added to the wells and incubated for 2 h at RT. After the incubation period, the plates were washed three times with PBS-T (PBS containing 0.05% Tween 20) to remove any unbound antibodies. Subsequently, the plates were incubated with secondary antibodies: goat anti-chicken IgY-HRP (Bethyl Laboratories, Texas, USA) for IgY detection and goat anti-chicken IgA-HR-P (Bethyl Laboratories, Texas, USA) for IgA detection following the manufacturer\u0026apos;s instructions at 1:3000 dilution. The plates were incubated for 1 h at RT and washed with PBS-T to remove excess secondary antibodies. The colorimetric detection was carried out by adding an O-phenylenediamine dihydrochloride substrate (Sigma, Missouri, USA). The reaction was allowed to proceed for 15-30 minutes in the dark at RT until sufficient color development was achieved. The enzyme-substrate reaction was stopped by adding 50 \u0026mu;L of 2N sulfuric acid. The optical density (OD) was measured at 492 nm using an Infinite M200 microplate reader (Tecan). The absorbance values obtained were used to quantify the levels of IgY and IgA antibodies in the serum and cloacal swab samples, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell-mediated immune responses were investigated by evaluating T-lymphocyte subsets via flow cytometry analysis. Two weeks after the booster immunization, blood was collected from all groups (n = 5) to isolate PBMCs. Mononuclear cells were separated from whole blood using density gradient centrifugation according to the manufacturer\u0026rsquo;s instructions. Briefly, blood was diluted 1:1 with phosphate-buffered saline (PBS; pH 7.4) to a final volume of 2 mL and carefully layered over 2 mL of Ficoll-Paque PLUS density gradient media (Cytiva, Uppsala, Sweden) in a centrifuge tube. The samples were centrifuged at 400\u0026times;g for 30 minutes at 18\u0026deg;C to separate the buffy coat layer. The PBMCs were collected from the interface and then washed twice with PBS to remove residual Ficoll and plasma. The harvested cells were resuspended in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics. The cells were then seeded in 96-well plates at a density of 1\u0026times;10⁵ cells/well and stimulated with 400 ng/well of crude soluble antigen extracted from the SG wild-type strain for 72 hours in a 5% CO₂ incubator at 37\u0026deg;C. Following antigen stimulation, cells were collected and incubated with fluorescently labeled antibodies: anti-CD3-FITC (Cat: 8200-02, SouthernBiotech, Birmingham, AL, USA), anti-CD8-PE (Cat: 8220-09, SouthernBiotech), and anti-CD4-AF700 (Cat: 8210-31, SouthernBiotech) (each at a concentration of 8 \u0026mu;g/mL) at 4\u0026deg;C for 30 minutes in the dark. After incubation, cells were washed with FACS buffer (PBS containing 2% FBS and 0.1% sodium azide) to remove unbound antibodies. \u0026nbsp; \u0026nbsp; \u0026nbsp; The stained cells were then analyzed using a Macsquant flow cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany). Data acquisition was performed, and T-cell subsets (CD3⁺, CD4⁺, and CD8⁺) were quantified. The results were analyzed using Macsquant analysis software (version 2.6), allowing for a detailed assessment of the cell-mediated immune response elicited by the immunization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis was performed using Student\u0026apos;s t-test and ANOVA to evaluate statistical differences. A p-value \u0026lt;0.05 was considered significant. All analyses were done in GraphPad Prism 9.00 software (San Diego, CA, USA).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eDevelopment of attenuated SG strain \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe SG strains were engineered to possess defective LPS structures using the well-established lambda red recombination method [21]. This recombineering approach involved replacing the selected genes with a flippase recognition target (FRT) flanked chloramphenicol resistance (cat\u003csup\u003eR\u003c/sup\u003e) gene in the chromosome. The targeted deletions included four genes namely, \u003cem\u003elon\u003c/em\u003e, \u003cem\u003erfaL\u003c/em\u003e, \u003cem\u003epagL\u003c/em\u003e, and \u003cem\u003earnT\u003c/em\u003e. Confirmation of these deletions was achieved through flanking PCR [15], as depicted in the supplementary figure (PCR results), using specific flanking primers listed in Table 2. The deletion of \u003cem\u003erfaL\u003c/em\u003e impacted the biosynthesis of the core oligosaccharide, resulting in modified LPS lacking O-antigen attachment. Additionally, the \u003cem\u003earnT\u003c/em\u003e deletion supposedly alter the transfer of L-Ara4N to the phosphate group, affecting the overall charge of the cell surface. The deletion of\u003cem\u003e pagL\u003c/em\u003e may block the deacylation of lipid A, conferring the prevention of further modifications in the LPS structure. The conceptual framework of these deletions is depicted in Fig. 1. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhenotypic and biological characterization \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn our study, we observed that bacteria demonstrate self-aggregation properties during culture, which might be influenced by the hydrophobicity of the cell surfaces. Notably, mutant strains JOL3015 and JOL3016 exhibited significantly higher auto-aggregation abilities, with 61% and 59% respectively, compared to WT and SG9R strains, which displayed only 25% and 37% auto-aggregation respectively (Fig. 2A). Moreover, hemolytic assay revealed a remarkable reduction in hemolysis exceeding 50% in both mutant strains compared to the control (Fig. 2B), indicating a significant alteration in their hemolytic properties. Additionally, the acriflavine agglutination test demonstrated agglutination in the presence of acriflavine for both mutant strains, suggesting a rough surface phenotype (Fig. 2C). This ensures that the lipid A core is exposed and acriflavine could interact with it, leading to agglutination. When visualized under ultraviolet light, clear agglutination patterns were evident to the naked eye. Further analysis through Western blotting confirmed the absence of interaction between the mutant strains and antibodies against \u003cem\u003eSalmonella\u003c/em\u003e O-antigen, highlighting a phenotypic change induced by the LPS mutation in these strains (Fig. 2D). These findings collectively underscore the influence of hydrophobicity and LPS modifications on the cell surface properties of these bacterial strains, providing valuable insights into their phenotypic characteristics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial growth kinetics of attenuated SG strains\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe growth kinetics of attenuated SG strains were evaluated and compared with the wild-type strain JOL422 and a commercial strain, SG9R (Fig. 3A and 3B). Throughout the experiment, discernible differences in growth dynamics were observed between the engineered SG strains and the wild-type counterpart. While both the wild-type JOL422 and SG9R strains exhibited analogous growth patterns, significant disparities were noted with the engineered strains, particularly JOL3016 and JOL3015. During the initial growth phase, both JOL3015 and JOL3016 maintained a conspicuous gap when compared to the wild-type strain, with JOL3016 displaying a slightly narrower gap in comparison to JOL3015. This disparity persisted up to 16 hours of incubation, after which the gap gradually diminished and plateaued. Notably, the optical density at 600 nm (OD\u003csub\u003e600\u003c/sub\u003e) peaked between 16 to 20 hours for the wild-type and SG9R strains, followed by a decline. In contrast, both JOL3015 and JOL3016 exhibited an increment in bacterial growth up to 28 hours. At 8 hours, the wild-type strain demonstrated a 3.14 and 2.39-fold increase in OD\u003csub\u003e600\u003c/sub\u003e compared to JOL3015 and JOL3016 respectively, which subsequently narrowed to 1.35 and 1.25-fold at 16 hours. The logarithmic phase could be observed between 4 -12 h for all four strains and both absorbance and CFU increments were increased and narrowed the gap against the WT SG 422 at 28 h post-incubation. At the end of the incubation period, there was a minimal disparity in CFU growth between JOL3016 and SG9R, suggesting comparable growth kinetics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vitro characterization of bacterial virulence and environmental stress\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe assessment of adhesion and invasion using Hela and chicken PBMC revealed JOL3016 with comparable results against the SG WT 422 strain. Both adhesion (Fig. 3C) and invasion (Fig. 3D) capability of SG9R and JOL3015 was significantly lower than both GS WT 422 strain and JOL3016. The exposure of bacterial cells to acidic environments at 6.5 pH and 4.0 pH revealed that all strains could tolerate mild acid conditions at 6.5 pH. However, the increase in acidity at 4.0 pH revealed that the mutants are susceptible to acidity. The lowest tolerance was observed by JOL3015, while JOL3016 was comparable to the SG9R vaccine strain (Fig. 3E). Furthermore, oxidative stress conditions induced by variable concentrations of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (mM) demonstrated a significant growth suppression even at 1.0 mM concentration. At 5.0 mM concentration, the growth of bacterial cells was still present, however, 10.0 mM concentration was lethal to all bacterial strains (Fig. 3F). \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vitro assessment of cytotoxic responses \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIntracellular cytotoxicity induced by each strain SG WT422, SG9R, JOL3015, and JOL3016 was investigated using the propidium iodide staining method. Cells were observed in real-time using the IncuCyte (Essen BioSicece, Gottingen, Germany) live imaging system (Fig. 4A). Visual observation over 24 hours revealed the highest number of red fluorescing objects in cells treated with SG WT 422 strain. The matric quantification of mean red-fluorescent objects revealed, that both SG9R and JOL3016 were comparable to each other while JOL3015 remained lowest in cytotoxic responses (Fig. 4B). \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSafety assessment of the detoxified strains\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe bacterial load in vital organs, including the spleen and liver, as well as in cloacal swabs, was evaluated to estimate the burden caused by the detoxified SG strains. Chickens were inoculated with mutant strains at two doses, 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e and 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/bird, via the intramuscular (IM) route and monitored over 15 days. Birds inoculated with the wild-type (WT) strain JOL422, serving as a control, displayed lethargic behavior characterized by depression, anorexia, ruffled feathers, diarrhea, dehydration, and weight loss. In contrast, chickens from the other groups exhibited normal behavior with usual feed and water intake and did not show adverse signs of inoculation or clinical symptoms, such as increased body temperature. The gain in body weight was comparable to that of na\u0026iuml;ve chickens.\u003c/p\u003e\n\u003cp\u003eThe bacterial load in the spleen, liver, and cloacal swabs revealed the dispersal of bacteria in all tested organs and sites. Over time, the bacteria were gradually eliminated from their respective sites, with bacterial persistence lasting for 14 days, which assured the induction of an immune response (Fig. 5A, 5B, and 5C). Bacterial retention of the attenuated strains inoculated at 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e and 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/bird in the selected lymphoid organs was comparable to that of SG9R injected at 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU/bird. Administration of a tenfold higher bacterial concentration, comparable to SG9R, demonstrated a safe response. As a positive control, WG WT 422 infection displayed more than 90% mortality within 5 to 15 days post-infection (Fig. 5D). Overall, the results indicate reduced infectivity in both attenuated strains, while they retained desirable infectivity to induce immunogenicity.\u003c/p\u003e\n\u003cp\u003eThe introduction of SG as a live vaccine resulted in a mild decrease in body weight until 3rd day post-inoculation. Birds vaccinated with the commercial SG9R vaccine exhibited more than 7% body weight loss (Fig. 6A). In comparison, less than 5% body weight loss was recorded for birds inoculated with JOL3016, compared to the na\u0026iuml;ve group, within 15 days. Endotoxicity, a major issue for implementing live bacterial vaccines due to LPS, was addressed by modifying the LPS structure in both designed SG strains. Endotoxicity induced by these strains was corroborated by measuring inflammatory cytokines using sandwich-ELISA. The concentration of TNF-\u0026alpha;, a major inflammatory cytokine marker, showed a significant reduction; JOL3015 and JOL3016 exhibited 3.82- and 4.13-fold decreases, respectively, while SG9R showed a 1.76-fold reduction compared to the WT (Fig. 6B). Notably, both JOL3015 and JOL3016 induced 2.17- and 2.34-fold lower TNF-\u0026alpha; production than the commercial SG9R strain, underscoring the significance of the developed strains. Additionally, the production of IL-1\u0026beta; was downregulated by 4.52- and 3.90-fold in the JOL3015 and JOL3016 groups (Fig. 6B), respectively, compared to WT, which was 1.47- and 1.27-fold lower than SG9R. Furthermore, the endotoxicity-related pro-inflammatory cytokine IFN-\u0026gamma; showed elevated levels in the WT group compared to the other groups. Both developed strains demonstrated a downregulation of IFN-\u0026gamma; by more than 2-fold (Fig. 6B).\u003c/p\u003e\n\u003cp\u003eHistopathological examinations of H\u0026amp;E stained spleen and liver tissues also revealed the degree of damage SG WT 422 strain induced in spleen and liver tissues with expanded white pulp areas of lymphatic tissues in spleen and signs of severe inflammation and potentially necrotic regions in liver tissues. Compared to WT inoculation all vaccinated groups showed relatively lower signs of tissue damage, especially for SG9R and JOL3016 strain (Fig. 6C and 6D). This investigation indicates that our strains comprehensively induce lower endotoxicity compared to the WT group, highlighting the potential of these developed strains in minimizing inflammatory responses. These findings support the notion that the engineered strains JOL3015 and JOL3016 are not only safe but also effective in eliciting an immune response without the adverse effects typically associated with live bacterial vaccines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHumoral and mucosal immune response \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAssessment of humoral immune responses upon immunization demonstrated an increase in IgY (Fig. 7A and 7B) levels in blood and sIgA (Fig. 7C) in mucosal swabs. IgY responses were nearly doubled upon booster immunization. It was notable that the immune responses derived by SG9R and JOL3016 were comparable at 3, 4, and 5\u003csup\u003eth\u003c/sup\u003e week of post-primary inoculation, whereas JOL3015 derived slightly lower IgY responses compared to SG9R and JOL3016. Peak IgY responses resulted at 3 weeks of post-priming and maintained till the 5\u003csup\u003eth\u003c/sup\u003e week post-priming. The sIgA responses also peaked at 3 weeks post-priming and maintained till the 4th week post-priming. A significant increase in sIgA responses was noted on booster immunization, and JOL3016 was comparable to the SG9R vaccine strain. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell-mediated immune responses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell-mediated immune response elicited by immunization was evaluated by quantifying T-cell populations using flow cytometry analysis. The primary focus was on the differentiation of T-lymphocyte subsets, specifically CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells, within PBMCs. Flow cytometric analysis revealed a significant increase in CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e and CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e T cell populations in the immunized chickens, indicating an enhanced cell-mediated immune response (Fig. 7D and 7E). Chickens immunized with the SG JOL3016 strain exhibited a notable rise in both CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells (Fig. 7D and 7E), which was comparable to the immune response observed with the commercial vaccine strain SG9R. The CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e and CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e T cell populations for SG9R were 11.40% and 5.32%, respectively, whereas for JOL3016, these populations were 11.25% and 5.61%. \u003c/p\u003e\n\u003cp\u003eThese results indicated that immunization with SG JOL3016 and JOL3015 strains leads to a significant upregulation of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells, comparable to the response induced by the commercial SG9R vaccine strain. These findings highlight the potential of the engineered strains to elicit a strong cell-mediated immune response, crucial for effective immunoprotection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtection against wild-type challenge\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChickens were immunized and challenged according to the designated immunization schedule via the intramuscular (IM) route, using the SG WT 422 strain. Body weight measurements and observations for potential mortality were conducted regularly throughout the experiment. Notably, immunization with detoxified SG strains did not induce any adverse reactions during the study period. The impact of detoxified SG strains on chicken weight gain was particularly remarkable between weeks 6 and 9, showing greater weight gain compared to the SG9R vaccine strain. Specifically, chickens immunized with the JOL3016 strain demonstrated body weight gains comparable to the na\u0026iuml;ve group (Fig. 8A). Upon challenge, chickens in the PBS group experienced severe weight reduction and mortality due to SG infection, whereas all immunized birds were protected against the lethal challenge (Fig. 8B). Additionally, the PBS group exhibited increased body temperature (Supplementary Table 1), while the other groups demonstrated only marginal changes.\u003c/p\u003e\n\u003cp\u003eFurther evaluations revealed that liver morphology (Fig. 8C) and splenomegaly (Fig. 8D) in immunized groups corroborated the levels of protection provided by both SG9R and JOL3016 detoxified strains. Post-challenge assessments showed significant, yet comparable outcomes in spleen weight and bacterial loads in spleen and liver tissues between SG9R and JOL3016 immunized groups (Fig. 8E, 8F, and 8G). The bacterial load in the PBS group was around log4 CFU/g, whereas the loads in SG9R and JOL3016 immunized groups were reduced to less than log1 CFU/g. Immunization with detoxified SG strains, particularly JOL3016, not only prevented adverse reactions but also promoted significant weight gain and provided robust protection against lethal challenges. These findings highlight the potential of detoxified SG strains in effectively safeguarding against SG infection while supporting healthy growth in chickens.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathological examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA histopathological evaluation of the spleen, liver, and cecum tissues (Fig. 9A, 9B, and 9C) was conducted one week after an oral challenge with the SG WT 422 strain. In the spleen tissues of na\u0026iuml;ve birds, the white pulp (lymphatic tissues) and red pulp (venous sinuses) were nicely differentiated. Immunized birds with JOL3016, JOL3015, and SG9R strains showed significant preservation of this tissue architecture. In contrast, the PBS control group exhibited a markedly expanded white pulp, indicative of severe infection and inflammation (Fig. 9A). In the liver tissues of the PBS group, severe necrotic discolorations were evident, reflecting extensive tissue damage. Liver tissues from immunized birds were comparable to those of the na\u0026iuml;ve group, although infiltration of Kupffer cells was observed across all groups, suggesting an active but controlled immune response (Fig. 9B).\u003c/p\u003e\n\u003cp\u003eHistopathological analysis of cecum tissues revealed significant erosion, crypt abscesses, and signs of edema in the PBS group, indicating a severe bacterial infection. In contrast, immunized chickens, whether vaccinated with detoxified SG strains or the SG9R vaccine strain, showed considerable protection. Their cecum tissues were largely free from these severe pathological signs, demonstrating the effectiveness of the immunization in mitigating infection-induced tissue damage. These histopathological findings underscore the protective efficacy of the JOL3016, JOL3015, and SG9R vaccine strains (Fig. 9C). Immunized birds maintained a closer resemblance to na\u0026iuml;ve tissue architecture across vital organs, significantly reducing infection-related damage and inflammatory responses compared to the non-immunized PBS group.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFowl typhoid (FT) remains a significant concern in the poultry industry, particularly in developing regions where it inflicts substantial economic losses [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The causative agent, \u003cem\u003eSalmonella\u003c/em\u003e Gallinarium (SG), not only impacts productivity but also poses risks to animal welfare and public health. Currently, the SG9R vaccine is widely used to mitigate FT; however, concerns regarding its safety and efficacy persist. Our study addresses these concerns by engineering attenuated SG strains with targeted genetic modifications aimed at enhancing vaccine safety and effectiveness.\u003c/p\u003e \u003cp\u003eThe SG9R vaccine, while effective in many cases, presents several limitations that hinder its widespread use and effectiveness. Concerns about potential reversion to virulence and endotoxicity raise questions about its long-term efficacy and safety [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The risk of SG9R reversion during field outbreaks poses a significant challenge, highlighting the need for alternative vaccine candidates. Moreover, the residual pathogenicity of SG9R, particularly in immunocompromised hosts, underscores the urgency to develop safer vaccine options [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Given the pivotal role of LPS in SG pathogenesis and host immune responses [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], our study focused on modifying LPS structure to enhance vaccine safety and immunogenicity. LPS serves as a key virulence factor and immunogen, making it an attractive target for vaccine development. By targeting the virulence genes and genes involved in LPS biosynthesis and modification, such as \u003cem\u003elon\u003c/em\u003e, \u003cem\u003erfaL\u003c/em\u003e, \u003cem\u003epagL\u003c/em\u003e, and \u003cem\u003earnT\u003c/em\u003e, we aimed to attenuate SG strains while preserving their immunogenicity. The Lon protease acts as a global regulator of bacterial virulence, whose deletion could cause overexpression of several invasion-related genes, by promoting antigen presentation. The \u003cem\u003erfaL\u003c/em\u003e gene encodes O-antigen ligase, which is essential in the proper attachment of the O-antigen component into the lipid A core component. The lack of \u003cem\u003erfaL\u003c/em\u003e gene confers a truncated version of the LPS structure, which has been proven to be important in conferring DIVA capability [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The other two gene targets \u003cem\u003earnT\u003c/em\u003e and \u003cem\u003epagL\u003c/em\u003e play crucial roles in modifying lipid A, a component of LPS, thereby influencing bacterial virulence and host immune response [\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The addition of L-Ara4N by ArnT alters lipid A structure, reducing its negative charge and enhancing bacterial resistance to host defenses [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. On the other hand, \u003cem\u003ePagL\u003c/em\u003e-mediated deacylation reduces LPS hydrophobicity, potentially evading host immune detection [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. These modifications highlight the complex interplay between bacterial adaptation and host immune evasion strategies. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e represents the concept behind lipid A modification by our selected gene targets in the present study.\u003c/p\u003e \u003cp\u003eOur study employed a well-established lambda red recombineering approach to engineer attenuated SG strains with targeted in-frame deletions of \u003cem\u003elon\u003c/em\u003e, \u003cem\u003erfaL\u003c/em\u003e, \u003cem\u003epagL\u003c/em\u003e, and \u003cem\u003earnT\u003c/em\u003e genes (Supplementary Fig.\u0026nbsp;1) in SG genome. These deletions resulted in significant modifications to LPS structure, including changes in core oligosaccharides, O-antigen attachment, surface charge, and lipid A composition [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Importantly, these modifications aimed to reduce endotoxicity while maintaining vaccine efficacy. Phenotypic and biological characterization of the engineered SG strains revealed altered surface properties (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), and reduced hemolytic activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Truncation of the O-antigen component has been confirmed by acriflavine agglutination assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) and by LPS western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD) that revealed complete absence of O-antigen component. The modified LPS structure results in a rough surface that increases the hydrophobicity and affects the cells to aggregate and settle. Such modifications not only change the phenotypic features but also affect biological characteristics, as evidenced by decreased hemolysis activity. A significant reduction in hemolysis by both mutant strains reflects a reduced virulence phenotype that must be essentially addressed in the vaccine strain. In furtherance, the hemolysins of \u003cem\u003eSalmonella\u003c/em\u003e play an essential role in intra-macrophage survival, killing cells, and prolonged systemic salmonellosis [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBacterial growth kinetics offers insights into the differentiated physiological state of bacteria [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Assessment of growth revealed distinctive growth kinetics compared to wild-type and commercial SG9R strains. Owing to the complete elimination of three genes from each detoxified SG strain namely, JOL 3015 containing deletions in \u003cem\u003elon, rfaL\u003c/em\u003e, and \u003cem\u003earnT\u003c/em\u003e and JOL3016 \u003cem\u003elon, rfaL\u003c/em\u003e and \u003cem\u003epagL\u003c/em\u003e resulted in comparatively lower growth rate compared to the wild type and SG9R vaccine strain at early time points of growth, however reducing the gap with an increase in incubation time (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Especially, JOL3016 was almost equal in bacterial number to WT and SG9R within a 28 h incubation period demonstrating that the strain is not overly attenuated. The selected genetic markers did not cause a dramatic effect on bacterial adhesion or virulence, especially for the JOL3016 strain that carries \u003cem\u003epagL\u003c/em\u003e deletion ensures that these strains retain their capability to invade host cells which is essential for better antigen presentation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Acidic and oxidative stress survival assays also revealed that JOL3016 is comparable to the SG9R vaccine strain, while JOL3015 was slightly lower tolerant to acidity and oxidative conditions compared to the SG9R and JOL3016 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). This ensures the detoxified SG strains may undergo rapid clearance from the intracellular oxidative stress, without persisting as a chronic infection that might be important as a safety consideration. Further to note, the mutant strains induced lowered cytotoxic responses without inflicting significant damage on epithelial monolayers of Hela cells. Here too, JOL3016 was comparable to SG9R while the lowest cytotoxic response was exhibited by the JOL3015 strain exacerbating its stronger attenuation phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Importantly, safety assessments demonstrated minimal adverse reactions and reduced endotoxicity in inoculated chickens with detoxified strains. No birds died when inoculated with detoxified SG strains or SG9R whereas SG WT 422 strain resulted in significant infection and death of birds. A comparison of two inoculation doses at 1 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e and 1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU/bird via IM route was completely safe for young chickens and did not affect chicken growth as much as SG9R did. Examination of bacterial persistence in the spleen, liver, and cloacal swabs revealed no significant difference between the two inoculation doses (high and low), yet by the 14th day post-inoculation, bacterial persistence had reduced less than log 2 in all organ samples, spleen, liver, and cloacal swabs collected from challenged chicken. These findings underscore the safety and potential of the engineered strains as vaccine candidates (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). To further evaluate reduced levels of endotoxicity responses, levels of pro-inflammatory cytokines were investigated in blood samples, that revealed significantly less amount of pro-inflammatory cytokine markers, Tumor necrosis factor-alpha (TNF-α), Interleukin-1β (IL-1β) and Interleukin-γ (IFN-γ) levels even lower than SG9R vaccine strain (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These observations were further exacerbated in histopathological examination of spleen and liver tissues by lowered signs of inflammation marked by red and white pulp distribution in spleen and necrotic lesions and server inflammation in liver tissues.\u003c/p\u003e \u003cp\u003eEvaluation of humoral and cell-mediated immune responses demonstrated robust immune activation elicited by the engineered SG strains, comparable to the commercial vaccine strain SG9R. Being live attenuated vaccine strains, immunization of chicken has resulted in a significant engagement of both CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e and CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e T cells also aid in the activation of macrophages and CD8\u003csup\u003e+\u003c/sup\u003e T cells, ensuring a robust and coordinated immune response. Their role is pivotal in generating a strong humoral response, which is crucial for neutralizing pathogens and preventing infection spread. On the other hand, CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e T cells, known as cytotoxic T cells, are directly involved in the elimination of infected cells. They recognize and kill cells presenting specific antigens on their surface, typically through the major histocompatibility complex class I (MHC I) pathway. This cytotoxic activity is essential for controlling intracellular pathogens such as SG, as it helps to limit bacterial replication and spread within the host. Additionally, CD8\u003csup\u003e+\u003c/sup\u003e T cells produce various cytokines that contribute to the overall immune response and help in the recruitment and activation of other immune cells. The collective outcome of protective immune responses induced by novel vaccine candidates is well showcased in post-challenged pathological assessments. Importantly, post-challenge survival rates and histopathological analyses confirmed the protective efficacy of the engineered strains against wild-type SG challenge (Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). These results highlight the potential of the engineered SG strains to induce protective immunity while minimizing adverse reactions and pathological manifestations.\u003c/p\u003e \u003cp\u003eIn conclusion, this study sheds light on the promising potential of engineered SG strains featuring modified LPS structures as safe and efficacious vaccine candidates against fowl typhoid. Notably, comparative analyses against the commercial vaccine strain SG9R underscored the superiority of the designed strains in terms of reduced endotoxicity and retained protective efficacy. These findings highlight the importance of further research to investigate the long-term efficacy and real-world application of the engineered strains in poultry populations.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eFT Fowl typhoid\u003c/p\u003e\n\u003cp\u003eLPS Lipopolysaccharide \u003c/p\u003e\n\u003cp\u003eSG Salmonella enterica serovar Gallinarum (Salmonella Gallinarum,)\u003c/p\u003e\n\u003cp\u003epagL PhoP/PhoQ-activated gene \u003c/p\u003e\n\u003cp\u003earnT L-Ara4N transferase gene\u003c/p\u003e\n\u003cp\u003eDIVA Differentiate infected from vaccinated animals \u003c/p\u003e\n\u003cp\u003eELISA Enzyme-linked immunosorbent assay \u003c/p\u003e\n\u003cp\u003ecatR Chloramphenicol resistance gene\u003c/p\u003e\n\u003cp\u003eOD Optical density \u003c/p\u003e\n\u003cp\u003eRBC Red blood cell \u003c/p\u003e\n\u003cp\u003ePBMCs Peripheral blood mononuclear cells \u003c/p\u003e\n\u003cp\u003ePBS Phosphate-buffered saline \u003c/p\u003e\n\u003cp\u003eWT Wild-type \u003c/p\u003e\n\u003cp\u003edpi Days post-inoculation \u003c/p\u003e\n\u003cp\u003eH\u0026amp;E Hematoxylin and eosin staining\u003c/p\u003e\n\u003cp\u003eRT Room temperature \u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha; Tumor necrosis factor-alpha \u003c/p\u003e\n\u003cp\u003eIL-1\u0026beta; Interleukin-1\u0026beta; \u003c/p\u003e\n\u003cp\u003eIFN-\u0026gamma; Interleukin-\u0026gamma;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments in this study were conducted under the Jeonbuk National University Animal Ethics Committee (NON2023-135-001) guidelines, following the Korean Council on Animal Care and the Korean Animal Protection Law, 2007: Article 13\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaw data reported in the manuscript can be made available upon request from the corresponding author.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Technology Development Program (S3383209) funded by the Ministry of SMEs and Startups (MSS, Korea) and it was also supported by the National University Development Project at Jeonbuk National University in 2023. The histopathological analysis was performed in the Center for University-wide Research Facilities (CURF) at Jeonbuk National University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRPA: Conceptualization, Investigation, Methodology, Validation, Formal analysis, Writing\u0026ndash;original draft, Writing\u0026ndash;review \u0026amp; editing. JK: Formal analysis, Methodology, Writing\u0026ndash;review \u0026amp; editing. AS: Writing\u0026ndash;review \u0026amp; editing. JHL: Conceptualization, Resources, Supervision, Funding acquisition, Writing\u0026ndash;review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to acknowledge the support of the National University Development Project, Jeonbuk National University, and the Center for University-wide Research Facilities (CURF) at Jeonbuk National University.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZhou X, Kang X, Zhou K, Yue M (2022) A global dataset for prevalence of Salmonella Gallinarum between 1945 and 2021. Sci Data 9:495.\u003c/li\u003e\n\u003cli\u003eAlves Batista DF, de Freitas Neto OC, Maria de Almeida A, Maboni G, de Carvalho TF, de Carvalho TP, Barrow PA, Berchieri AJ (2018) Evaluation of pathogenicity of Salmonella Gallinarum strains harbouring deletions in genes whose orthologues are conserved pseudogenes in S. Pullorum. PLoS One 13:e0200585.\u003c/li\u003e\n\u003cli\u003eArora D, Kumar S, Jindal N, Narang G, Kapoor PK, Mahajan NK (2015) Prevalence and epidemiology of Salmonella enterica serovar Gallinarum from poultry in some parts of Haryana, India. Vet World 8:1300-1304.\u003c/li\u003e\n\u003cli\u003eWigley P, Hulme S, Powers C, Beal R, Smith A, Barrow P (2005) Oral infection with the Salmonella enterica serovar Gallinarum 9R attenuated live vaccine as a model to characterise immunity to fowl typhoid in the chicken. BMC Vet Res 1:2.\u003c/li\u003e\n\u003cli\u003eLee YJ, Mo IP, Kang MS (2007) Protective efficacy of live Salmonella gallinarum 9R vaccine in commercial layer flocks. Avian Pathol 36:495-498.\u003c/li\u003e\n\u003cli\u003eKwon YK, Kim A, Kang MS, Her M, Jung BY, Lee KM, Jeong W, An BK, Kwon JH (2010) Prevalence and characterization of Salmonella Gallinarum in the chicken in Korea during 2000 to 2008. Poult Sci 89:236-242.\u003c/li\u003e\n\u003cli\u003eHuang XY, Ansari AR, Huang HB, Zhao X, Li NY, Sun ZJ, Peng KM, Zhong J, Liu HZ (2017) Lipopolysaccharide mediates immuno-pathological alterations in young chicken liver through TLR4 signaling. BMC Immunol 18:12.\u003c/li\u003e\n\u003cli\u003eBrandenburg K, Wiese A (2004) Endotoxins: relationships between structure, function, and activity. Curr Top Med Chem 4:1127-1146.\u003c/li\u003e\n\u003cli\u003eSenevirathne A, Hewawaduge C, Sivasankar C, Lee JH (2022) Prospective lipid-A altered live attenuated Salmonella Gallinarum confers protectivity, DIVA capability, safety and low endotoxicity against fowl typhoid. Vet Microbiol 274:109572.\u003c/li\u003e\n\u003cli\u003eBreazeale SD, Ribeiro AA, McClerren AL, Raetz CR (2005) A formyltransferase required for polymyxin resistance in Escherichia coli and the modification of lipid A with 4-Amino-4-deoxy-L-arabinose. Identification and function oF UDP-4-deoxy-4-formamido-L-arabinose. J Biol Chem 280:14154-14167.\u003c/li\u003e\n\u003cli\u003eSenevirathne A, Hewawaduge C, Lee JH (2022) Assessing an O-antigen deficient, live attenuated Salmonella Gallinarium strain that is DIVA compatible, environmentally safe, and protects chickens against fowl typhoid. Dev Comp Immunol 133:104433.\u003c/li\u003e\n\u003cli\u003eKirthika P, Jawalagatti V, Senevirathne A, Lee JH (2022) Coordinated interaction between Lon protease and catalase-peroxidase regulates virulence and oxidative stress management during Salmonellosis. Gut Microbes 14:2064705.\u003c/li\u003e\n\u003cli\u003eKirthika P, Senevirathne A, Jawalagatti V, Park S, Lee JH (2020) Deletion of the lon gene augments expression of Salmonella Pathogenicity Island (SPI)-1 and metal ion uptake genes leading to the accumulation of bactericidal hydroxyl radicals and host pro-inflammatory cytokine-mediated rapid intracellular clearance. Gut Microbes 11:1695-1712.\u003c/li\u003e\n\u003cli\u003eMatsuda K, Chaudhari AA, Kim SW, Lee KM, Lee JH (2010) Physiology, pathogenicity and immunogenicity of lon and/or cpxR deleted mutants of Salmonella Gallinarum as vaccine candidates for fowl typhoid. Vet Res 41:59.\u003c/li\u003e\n\u003cli\u003eAganja RP, Sivasankar C, Hewawaduge C, Lee JH (2022) Safety assessment of compliant, highly invasive, lipid A-altered, O-antigen-defected Salmonella strains as prospective vaccine delivery systems. Vet Res 53:76.\u003c/li\u003e\n\u003cli\u003eIshiguro A, Nishioka M, Morishige A, Kawano R, Kobayashi T, Fujinaga A, Takagi F, Kogo T, Morikawa Y, Okayama N\u003cem\u003e et al\u003c/em\u003e (2020) What is the best wavelength for the measurement of hemolysis index? Clin Chim Acta 510:15-20.\u003c/li\u003e\n\u003cli\u003eGuo R, Jiao Y, Li Z, Zhu S, Fei X, Geng S, Pan Z, Chen X, Li Q, Jiao X (2017) Safety, Protective Immunity, and DIVA Capability of a Rough Mutant Salmonella Pullorum Vaccine Candidate in Broilers. Front Microbiol 8:547.\u003c/li\u003e\n\u003cli\u003eHewawaduge C, Senevirathne A, Sivasankar C, Lee JH (2023) The impact of lipid A modification on biofilm and related pathophysiological phenotypes, endotoxicity, immunogenicity, and protection of Salmonella Typhimurium. Vet Microbiol 282:109759.\u003c/li\u003e\n\u003cli\u003eBertram EM, Jilbert AR, Kotlarski I (1997) Optimization of an in vitro assay which measures the proliferation of duck T lymphocytes from peripheral blood in response to stimulation with PHA and ConA. Dev Comp Immunol 21:299-310.\u003c/li\u003e\n\u003cli\u003eAganja RP, Sivasankar C, Lee JH (2023) AI-2 quorum sensing controlled delivery of cytolysin-A by tryptophan auxotrophic low-endotoxic Salmonella and its anticancer effects in CT26 mice with colon cancer. J Adv Res.\u003c/li\u003e\n\u003cli\u003eDatsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640-6645.\u003c/li\u003e\n\u003cli\u003eOjima S, Okamura M, Osawa N, Tamura A, Yoshioka K, Kashimoto T, Haneda T, Ono HK, Hu DL (2021) Characteristics of systemic infection and host responses in chickens experimentally infected with Salmonella enterica serovar Gallinarum biovar Gallinarum. J Vet Med Sci 83:1147-1154.\u003c/li\u003e\n\u003cli\u003eBeylefeld A, Abolnik C (2023) Salmonella gallinarum strains from outbreaks of fowl typhoid fever in Southern Africa closely related to SG9R vaccines. Front Vet Sci 10:1191497.\u003c/li\u003e\n\u003cli\u003eVan Immerseel F, Studholme DJ, Eeckhaut V, Heyndrickx M, Dewulf J, Dewaele I, Van Hoorebeke S, Haesebrouck F, Van Meirhaeghe H, Ducatelle R\u003cem\u003e et al\u003c/em\u003e (2013) Salmonella Gallinarum field isolates from laying hens are related to the vaccine strain SG9R. Vaccine 31:4940-4945.\u003c/li\u003e\n\u003cli\u003eKwon HJ, Cho SH (2011) Pathogenicity of SG 9R, a rough vaccine strain against fowl typhoid. Vaccine 29:1311-1318.\u003c/li\u003e\n\u003cli\u003eYang KH, Lee MG (2008) Effects of endotoxin derived from Escherichia coli lipopolysaccharide on the pharmacokinetics of drugs. Arch Pharm Res 31:1073-1086.\u003c/li\u003e\n\u003cli\u003eKawasaki K (2012) Complexity of lipopolysaccharide modifications in: Its effects on endotoxin activity, membrane permeability, and resistance to antimicrobial peptides. Food Res Int 45:493-501.\u003c/li\u003e\n\u003cli\u003eKawasaki K, Ernst RK, Miller SI (2005) Inhibition of Salmonella enterica serovar Typhimurium lipopolysaccharide deacylation by aminoarabinose membrane modification. J Bacteriol 187:2448-2457.\u003c/li\u003e\n\u003cli\u003eKawasaki K, Ernst RK, Miller SI (2004) 3-O-deacylation of lipid A by PagL, a PhoP/PhoQ-regulated deacylase of Salmonella typhimurium, modulates signaling through Toll-like receptor 4. J Biol Chem 279:20044-20048.\u003c/li\u003e\n\u003cli\u003eErnst RK, Guina T, Miller SI (2001) Salmonella typhimurium outer membrane remodeling: role in resistance to host innate immunity. Microbes Infect 3:1327-1334.\u003c/li\u003e\n\u003cli\u003eRaetz CR, Whitfield C (2002) Lipopolysaccharide endotoxins. Annu Rev Biochem 71:635-700.\u003c/li\u003e\n\u003cli\u003ePark BS, Song DH, Kim HM, Choi BS, Lee H, Lee JO (2009) The structural basis of lipopolysaccharide recognition by the TLR4-MD-2 complex. Nature 458:1191-1195.\u003c/li\u003e\n\u003cli\u003eAgrawal RK, Singh BR, Babu N, Chandra M (2005) Novel haemolysins of Salmonella enterica spp. enterica serovar Gallinarum. Indian J Exp Biol 43:626-630.\u003c/li\u003e\n\u003cli\u003eFerenci T (1999) \u0026apos;Growth of bacterial cultures\u0026apos; 50 years on: towards an uncertainty principle instead of constants in bacterial growth kinetics. Res Microbiol 150:431-438.\u003c/li\u003e\n\u003cli\u003eMukherjee S, Bassler BL (2019) Bacterial quorum sensing in complex and dynamically changing environments. Nat Rev Microbiol 17:371-382.\u003c/li\u003e\n\u003cli\u003eDoublet B, Douard G, Targant H, Meunier D, Madec JY, Cloeckaert A (2008) Antibiotic marker modifications of lambda Red and FLP helper plasmids, pKD46 and pCP20, for inactivation of chromosomal genes using PCR products in multidrug-resistant strains. J Microbiol Methods 75:359-361.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1. List of bacterial strains and plasmids\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"684\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eBacteria/Plasmid\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenotypic characteristics\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.157894736842104%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.8771929824561403%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"99.12280701754386%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eS\u003c/em\u003e. Gallinarum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.8771929824561403%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003eJOL422\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003eWild type\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eLab stock\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003eJOL914\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026Delta;lon\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eLab strain\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003eJOL3015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026Delta;lon \u0026Delta;rfaL \u0026Delta;arnT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003eJOL3016\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026Delta;lon \u0026Delta;rfaL \u0026Delta;pagL\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;pKD46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003eoriR101-repA101ts; encodes \u0026lambda; red genes (\u003cem\u003eexo, bet, gam\u003c/em\u003e); native terminator (tL3); arabinose-inducible promoter for expression (ParaB); \u003cem\u003ebla\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e[21]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;pKD3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003eoriR6Kgamma, \u003cem\u003ebla\u003c/em\u003e (ampR), \u003cem\u003ergnB\u003c/em\u003e (Ter), \u003cem\u003ecat\u003csup\u003eR\u003c/sup\u003e\u003c/em\u003e, FRT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e[21]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.68421052631579%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;pCP20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.280701754385966%\" valign=\"top\"\u003e\n \u003cp\u003eHelper plasmid contains a temperature-inducible \u003cem\u003eflp\u003c/em\u003e gene for removing the FRT flanked chloramphenicol gene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.035087719298245%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e[36]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eTable 2. List of primers.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"654\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u0026apos;\u0026ndash; 3\u0026apos; Sequences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.522935779816514%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eGel deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003elon-pKD3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGGTATGGAGCACAGCTATACTATCTGATTACCTGGCGGACACTAAACTAAGTGTAGGCTGGAGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCGAAATAGCCTGCCAGCCCTGTTTTTATTAGCGCTATTTGCGCGAGGTCAATGGGAATTAGCCATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003erfaL\u003c/em\u003e-pKD3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTTTGGAAAGATTCATTAAAGAGACTCTGTCTCATCCCAAACCTATTGTGGGTGTAGGCTGGAGCTGCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCCTGATGATGGAAAACGCGCTGATACCGTAATAAGTATCAGCGCGTTTTTATGGGAATTAGCCATGGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003epagL\u003c/em\u003e-pKD3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eAATTTTAAATATGTTAGCCGGTTAAAAATAACTATTGACATTGAAATGGTGTGTAGGCTGGAGCTGCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCGGTGATTAATTACTCCTTCAGCCAGCAACTCGCTAATTGTTATTCAACTATGGGAATTAGCCATGGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003earnT\u003c/em\u003e-pKD3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGAGCTGACCGCCAACGCTGAGCAGACTGGCAAGCACCAGAATGACGCCGAGTGTAGGCTGGAGCTGCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eATCCCTGGCCGTGAAGGTTGGCTGGGGTGCCAACAGGCAGCGAGCGCCTCATGGGAATTAGCCATGGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003elon-inner\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eAATCTGCACGACTACCTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGATTACCGGTCAGGCAGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003elon-outer\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCAGGAGTTCTTACAGGTAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCCACACTCCGCTGTAGGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003erfaL\u003c/em\u003e-inner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eACAAGTTTAGGACTTCGCTGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e[15]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCAGAATGGTATTATGCGGACCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003erfaL\u003c/em\u003e-outer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGCA GCG TTT CGA GGA ACA AA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e[15]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTCG TAT CGG TTG ATA CCG GC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003epalL\u003c/em\u003e-inner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCAGATCTCTTTTGCTGCGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e[15]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eAAAAGCCCCAAAGTTCCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003epagL\u003c/em\u003e-outer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTGGATGTGCCTGAACAACACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e[15]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTTAGCCTCCCTGTCGCCATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003earnT\u003c/em\u003e-inner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGCAACGCGGTACGTTTATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGAAACGCGCTATGCCGAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003earnT\u003c/em\u003e-outer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGAGCTGACCGCCAACGCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGAAACGCGCTATGCCGAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTNF-a\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCTTCTGAGGCATTTGGAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eACTGGGCGGTCATAGAACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eIL-1b\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCTACACCCGCTCACAGTCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTCACTTTCTGGCTGGAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eIFN\u003c/em\u003e-\u0026gamma;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCAAAGCCGCACATCAAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTTTCACCTTCTTCACGCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eIL-2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eATCTTTGGCTGTATTTCGGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTGGGTCTCAGTTGGTGTGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eIL-4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eGGAGAGCATCCGGATAGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eTGACGCATGTTGAGGAAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGADPH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eSense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eAGAACATCATCCCAGCGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.596330275229358%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.926605504587156%\" valign=\"top\"\u003e\n \u003cp\u003eAntisense\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.88073394495413%\" valign=\"top\"\u003e\n \u003cp\u003eCGGCAGGTCAGGTCAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.7522935779816513%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.844036697247706%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Fowl typhoid, Salmonella Gallinarium, genetic modification, lipopolysaccharide biosynthesis, vaccine","lastPublishedDoi":"10.21203/rs.3.rs-4589217/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4589217/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFowl typhoid (FT) poses a significant threat to the poultry industry, especially in developing regions, causing substantial economic losses. Caused by \u003cem\u003eSalmonella\u003c/em\u003e Gallinarium, FT can be prevented by vaccination, but existing vaccines like the SG9R strain have limitations, including residual virulence and potential reversion of pathogenicity. This study aims to develop safer and more effective SG vaccine strains through targeted genetic modifications, focusing on genes involved in lipopolysaccharide (LPS) biosynthesis and modification. We evaluated two novel mutant SG strains, JOL3015 and JOL3016, carrying in-frame deletions in Δ\u003cem\u003elon\u003c/em\u003eΔ\u003cem\u003erfaL\u003c/em\u003eΔ\u003cem\u003earnT\u003c/em\u003e and Δ\u003cem\u003elon\u003c/em\u003eΔ\u003cem\u003erfaL\u003c/em\u003eΔ\u003cem\u003epagL\u003c/em\u003e respectively. Intramuscular immunization with JOL3015 and JOL3016 strains showed minimal impact on the growth of 4-week-old young birds, significantly increased antigen-specific IgY, sIgA secretion, and CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cell responses, while inducing lower proinflammatory cytokine levels than SG9R. Histopathological evaluations revealed substantial protection in immunized birds, with minimal tissue damage and inflammatory responses, reducing the in vivo bacterial burden. None of the immunized birds died, highlighting the significant safety and protection conferred by the selected genetic modifications. Our results indicate that JOL3016 provided comparable protective outcomes on par with SG9R, yet with significantly lower endotoxicity responses during the lethal challenge with SG WT JOL422. The novel detoxified SG strains, particularly JOL3016, offer a promising alternative to existing vaccines for FT. They provide effective protection with minimal impact on poultry growth, minimizing the risks associated with reversion and endotoxicity. This study highlights the potential of genetically engineered vaccine strains in improving poultry health and productivity, emphasizing the importance of continued research.\u003c/p\u003e","manuscriptTitle":"Deletion of pagL and arnT genes that involved in LPS structure and charge modulation in Salmonella genome confer reduced endotoxicity and retained efficient protection against wild-type S. Gallinarium challenge in chicken","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-24 11:08:32","doi":"10.21203/rs.3.rs-4589217/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c62c9982-91e2-4159-a614-76d65071d43d","owner":[],"postedDate":"July 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-06T16:04:51+00:00","versionOfRecord":{"articleIdentity":"rs-4589217","link":"https://doi.org/10.1186/s13567-024-01413-8","journal":{"identity":"veterinary-research","isVorOnly":false,"title":"Veterinary Research"},"publishedOn":"2025-01-04 15:57:16","publishedOnDateReadable":"January 4th, 2025"},"versionCreatedAt":"2024-07-24 11:08:32","video":"","vorDoi":"10.1186/s13567-024-01413-8","vorDoiUrl":"https://doi.org/10.1186/s13567-024-01413-8","workflowStages":[]},"version":"v1","identity":"rs-4589217","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4589217","identity":"rs-4589217","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}